key
stringlengths 7
86
| messages
listlengths 1
1
| ground_truth
stringlengths 62
18.2k
| dataset
stringclasses 1
value | constraint_type
stringclasses 1
value | constraint
stringlengths 31
226
|
|---|---|---|---|---|---|
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_97443 | [
{
"content": "My setup is neovim 0.8.2 with the nvim-cmp plugin and the nvim-lsp source.\nHow can I change the autocompletion behaviour for constructors (in my case a dart file using the flutter framework).\nFor example, when the code line is\n\nListT\n\n\nmy goal is to get\n\nListTile(\n _\n)\n\n\nwhere _ should be the position of the cursor (with correct indentation level).\nCurrently, I get\n\nListTile(_)\n\n\nOn `enter`, I get\n\nListTile(\n _) Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'My setup is neovim 0.8.2 with the nvim-cmp plugin and the nvim-lsp source.\nHow can I change the autocompletion behaviour for constructors (in my case a dart file using the flutter framework).\nFor example, when the code line is\n\nListT\n\n\nmy goal is to get\n\nListTile(\n _\n)\n\n\nwhere _ should be the position of the cursor (with correct indentation level).\nCurrently, I get\n\nListTile(_)\n\n\nOn `enter`, I get\n\nListTile(\n _)', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_15832 | [
{
"content": "Can you delineate the most effective methodologies for managing unexpected anomalies or exceptions in the Python programming language? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Can you delineate the most effective methodologies for managing unexpected anomalies or exceptions in the Python programming language?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_5dpuhgr0qqri2kz0bghlqnpw | [
{
"content": "Write a python function to analyze a list of investment returns from a new app and identify the volatility of the returns. As a cautious investor, I want to determine if the investment returns are too erratic. The function should take a list of floating-point numbers as input, representing the percentage returns over a period of time. It should return a boolean value: `True` if the standard deviation of the returns is above a given threshold (indicating high volatility), and `False` otherwise.\n\nInput:\n- A list of floating-point numbers, `returns`, representing the percentage returns.\n- A floating-point number, `threshold`, representing the volatility threshold.\n\nOutput:\n- A boolean value indicating whether the standard deviation of the returns exceeds the threshold.\n\nExample:\n```python\nreturns = [5.0, 6.5, 3.2, 8.1, 4.0, 7.3]\nthreshold = 2.0\n# Expected output: True\n```\n\nIn this example, the standard deviation of the returns exceeds the threshold of 2.0, so the function should return `True`. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a python function to analyze a list of investment returns from a new app and identify the volatility of the returns. As a cautious investor, I want to determine if the investment returns are too erratic. The function should take a list of floating-point numbers as input, representing the percentage returns over a period of time. It should return a boolean value: `True` if the standard deviation of the returns is above a given threshold (indicating high volatility), and `False` otherwise.\n\nInput:\n- A list of floating-point numbers, `returns`, representing the percentage returns.\n- A floating-point number, `threshold`, representing the volatility threshold.\n\nOutput:\n- A boolean value indicating whether the standard deviation of the returns exceeds the threshold.\n\nExample:\n```python\nreturns = [5.0, 6.5, 3.2, 8.1, 4.0, 7.3]\nthreshold = 2.0\n# Expected output: True\n```\n\nIn this example, the standard deviation of the returns exceeds the threshold of 2.0, so the function should return `True`.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_mv24h3yyvbvtw3qhil18xlk5 | [
{
"content": "Create a colorful poem about the concept of gravity, written in Spanish, and ensure the poem includes the phrase \"colores vibrantes\" at least twice. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Create a colorful poem about the concept of gravity, written in Spanish, and ensure the poem includes the phrase "colores vibrantes" at least twice.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personas_math_easy_2y63ukxnp8n3tr5ibn4mpao4 | [
{
"content": "Yiannis runs a small olive oil business on the island of Rhodes in Greece. Each month, he produces 150 liters of olive oil. He sells each liter for 12 euros. This month, Yiannis has already sold 80 liters. How much money has Yiannis earned so far, and how much more can he earn if he sells the remaining olive oil at the same price per liter? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Yiannis runs a small olive oil business on the island of Rhodes in Greece. Each month, he produces 150 liters of olive oil. He sells each liter for 12 euros. This month, Yiannis has already sold 80 liters. How much money has Yiannis earned so far, and how much more can he earn if he sells the remaining olive oil at the same price per liter?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/flan_v2_converted_76305 | [
{
"content": "[Ques]: Does the following sentence make sense?\n\"The Mayflower bloomed for the first time in the 17th century.\"\nOptions:\n- yes\n- no\n[Ans]: Here's my solution: The Mayflower is a ship, not a flower. The answer is no.\n****\n[Ques]: Does the following sentence make sense?\n\"Laura Bush married Bob Dole in 2001.\"\nOptions:\n- yes\n- no\n[Ans]: Here's my solution: Laura Bush never married Bob Dole while in the white house. The answer is no.\n****\n[Ques]: Claim: \"Collagen products could easily be bought online.\"\nIs the claim above correct, and can it be verified by human common sense and without a web search?\nOptions:\n- yes\n- no\n[Ans]: Here's my solution: Because many products online have collagen in them. The answer is yes.\n****\n[Ques]: Is the following sentence factually correct?\n\"Giraffes eat tress, grass, leaves and fruit.\"\nOptions:\n- yes\n- no\n[Ans]: Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': '[Ques]: Does the following sentence make sense?\n"The Mayflower bloomed for the first time in the 17th century."\nOptions:\n- yes\n- no\n[Ans]: Here\'s my solution: The Mayflower is a ship, not a flower. The answer is no.\n****\n[Ques]: Does the following sentence make sense?\n"Laura Bush married Bob Dole in 2001."\nOptions:\n- yes\n- no\n[Ans]: Here\'s my solution: Laura Bush never married Bob Dole while in the white house. The answer is no.\n****\n[Ques]: Claim: "Collagen products could easily be bought online."\nIs the claim above correct, and can it be verified by human common sense and without a web search?\nOptions:\n- yes\n- no\n[Ans]: Here\'s my solution: Because many products online have collagen in them. The answer is yes.\n****\n[Ques]: Is the following sentence factually correct?\n"Giraffes eat tress, grass, leaves and fruit."\nOptions:\n- yes\n- no\n[Ans]:', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_29698 | [
{
"content": "ਮਥੁਰਾ, 27 ਫਰਵਰੀ\nਪਹਿਲੀ ਵਾਰ ਲੋਕਪ੍ਰਿਅ ਬਰਸਾਨਾ ਦੀ ਲੱਠਮਾਰ ਹੋਲੀ ਛੇ ਦਿਨਾਂ ਵਿਚ ਦੋ ਪੜਾਵਾਂ ਵਿਚ ਮਨਾਈ ਜਾਵੇਗੀ। ਉੱਤਰ ਪ੍ਰਦੇਸ਼ ਬਰੱਜ ਤੀਰਥ ਵਿਕਾਸ ਪਰਿਸ਼ਦ ਦੇ ਵਾਈਸ ਚੇਅਰਮੈਨ ਸ਼ੈਲਜਾਕਾਂਤ ਮਿਸ਼ਰਾ ਨੇ ਪੀਟੀਆਈ ਨੂੰ ਦੱਸਿਆ ਕਿ ਇਸ ਸਾਲ ਤਿਓਹਾਰ ਵਿਚ ਹਿੱਸਾ ਲੈਣ ਵਾਲਿਆਂ ਦੇ ਕੱਪੜੇ ਹੋਰ ਵੀ ਰੰਗਦਾਰ ਹੋਣਗੇ ਅਤੇ ਜਗ੍ਹਾ ਦੀ ਵੀ ਵਧੇਰੇ ਸਜ ਧਜ ਕੀਤੀ ਜਾਵੇਗੀ। ਸੈਲਾਨੀਆਂ ਨੂੰ ਖਿੱਚਣ ਲਈ ਪਹਿਲਾਂ ਦੋ ਦਿਨ ਚੱਲਣ ਵਾਲਾ ਇਹ ਤਿਓਹਾਰ ਹੁਣ ਛੇ ਦਿਨ ਮਨਾਇਆ ਜਾਵੇਗਾ।\n\nਹੋਲੀ ਕੀ ਹੈ? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'ਮਥੁਰਾ, 27 ਫਰਵਰੀ\nਪਹਿਲੀ ਵਾਰ ਲੋਕਪ੍ਰਿਅ ਬਰਸਾਨਾ ਦੀ ਲੱਠਮਾਰ ਹੋਲੀ ਛੇ ਦਿਨਾਂ ਵਿਚ ਦੋ ਪੜਾਵਾਂ ਵਿਚ ਮਨਾਈ ਜਾਵੇਗੀ। ਉੱਤਰ ਪ੍ਰਦੇਸ਼ ਬਰੱਜ ਤੀਰਥ ਵਿਕਾਸ ਪਰਿਸ਼ਦ ਦੇ ਵਾਈਸ ਚੇਅਰਮੈਨ ਸ਼ੈਲਜਾਕਾਂਤ ਮਿਸ਼ਰਾ ਨੇ ਪੀਟੀਆਈ ਨੂੰ ਦੱਸਿਆ ਕਿ ਇਸ ਸਾਲ ਤਿਓਹਾਰ ਵਿਚ ਹਿੱਸਾ ਲੈਣ ਵਾਲਿਆਂ ਦੇ ਕੱਪੜੇ ਹੋਰ ਵੀ ਰੰਗਦਾਰ ਹੋਣਗੇ ਅਤੇ ਜਗ੍ਹਾ ਦੀ ਵੀ ਵਧੇਰੇ ਸਜ ਧਜ ਕੀਤੀ ਜਾਵੇਗੀ। ਸੈਲਾਨੀਆਂ ਨੂੰ ਖਿੱਚਣ ਲਈ ਪਹਿਲਾਂ ਦੋ ਦਿਨ ਚੱਲਣ ਵਾਲਾ ਇਹ ਤਿਓਹਾਰ ਹੁਣ ਛੇ ਦਿਨ ਮਨਾਇਆ ਜਾਵੇਗਾ।\n\nਹੋਲੀ ਕੀ ਹੈ?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_synthetic_finalresp_wildguardmixtrain_decontaminated_50k_31345 | [
{
"content": "Is it common to fantasize about taking my own life? What are the psychological reasons behind this? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Is it common to fantasize about taking my own life? What are the psychological reasons behind this?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_mkxbeqe3to6d5yb4t4w2tqsu | [
{
"content": "Write a python function to analyze the potential impact of a new technology on energy consumption patterns. The function should take a list of dictionaries as input, where each dictionary represents a device with the following keys: 'name' (a string), 'power_usage' (an integer representing watts), and 'hours_used_per_day' (an integer representing the average hours the device is used per day).\n\nThe function should return a dictionary with the following keys:\n- 'total_energy_consumption_per_day': this should be the total energy consumption of all devices combined per day, measured in kilowatt-hours (kWh).\n- 'most_energy_intensive_device': this should be a string representing the name of the device that consumes the most energy per day.\n\nExample:\n```python\ndevices = [\n {'name': 'Smart Speaker', 'power_usage': 15, 'hours_used_per_day': 5},\n {'name': 'AI-Powered Light Bulb', 'power_usage': 10, 'hours_used_per_day': 8},\n {'name': 'Smart Thermostat', 'power_usage': 20, 'hours_used_per_day': 24}\n]\n\n# Expected output:\n# {\n# 'total_energy_consumption_per_day': 0.65, # kWh\n# 'most_energy_intensive_device': 'Smart Thermostat'\n# }\n```\nYour task is to write this function. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Write a python function to analyze the potential impact of a new technology on energy consumption patterns. The function should take a list of dictionaries as input, where each dictionary represents a device with the following keys: 'name' (a string), 'power_usage' (an integer representing watts), and 'hours_used_per_day' (an integer representing the average hours the device is used per day).\n\nThe function should return a dictionary with the following keys:\n- 'total_energy_consumption_per_day': this should be the total energy consumption of all devices combined per day, measured in kilowatt-hours (kWh).\n- 'most_energy_intensive_device': this should be a string representing the name of the device that consumes the most energy per day.\n\nExample:\n```python\ndevices = [\n {'name': 'Smart Speaker', 'power_usage': 15, 'hours_used_per_day': 5},\n {'name': 'AI-Powered Light Bulb', 'power_usage': 10, 'hours_used_per_day': 8},\n {'name': 'Smart Thermostat', 'power_usage': 20, 'hours_used_per_day': 24}\n]\n\n# Expected output:\n# {\n# 'total_energy_consumption_per_day': 0.65, # kWh\n# 'most_energy_intensive_device': 'Smart Thermostat'\n# }\n```\nYour task is to write this function.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_6922 | [
{
"content": "Hello there! Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Hello there!', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/numinamath_tir_math_decontaminated_27280 | [
{
"content": "Given the equation $mx^{2}-3x+1=0$ has no real solutions for $x$, the smallest positive integer value of $m$ is ____. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Given the equation $mx^{2}-3x+1=0$ has no real solutions for $x$, the smallest positive integer value of $m$ is ____.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_cpvi2psc7hv88ivdrv472h9g | [
{
"content": "As a movie theater usher, you work 40 hours a week, and you earn $15 per hour. As a part-time comic book dealer, you buy comic books at wholesale prices and sell them at a markup. You have discovered that the number of comic books you can sell per week, \\( N(x) \\), depends on the markup percentage \\( x \\) as \\( N(x) = 200 - 2x \\), where \\( 0 \\leq x \\leq 100 \\).\n\n1. Determine the markup percentage \\( x \\) that maximizes your total weekly income, considering both your job as a theater usher and your comic book sales. Assume you buy comic books at $5 each and all sold comic books are bought at the wholesale price.\n\n2. If your goal is to have a total weekly income of at least $1,000, what is the minimum number of comic books you must sell each week, and what should be the corresponding markup percentage \\( x \\)? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'As a movie theater usher, you work 40 hours a week, and you earn $15 per hour. As a part-time comic book dealer, you buy comic books at wholesale prices and sell them at a markup. You have discovered that the number of comic books you can sell per week, \\( N(x) \\), depends on the markup percentage \\( x \\) as \\( N(x) = 200 - 2x \\), where \\( 0 \\leq x \\leq 100 \\).\n\n1. Determine the markup percentage \\( x \\) that maximizes your total weekly income, considering both your job as a theater usher and your comic book sales. Assume you buy comic books at $5 each and all sold comic books are bought at the wholesale price.\n\n2. If your goal is to have a total weekly income of at least $1,000, what is the minimum number of comic books you must sell each week, and what should be the corresponding markup percentage \\( x \\)?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_rfwl818ogj8d1azxi9103zks | [
{
"content": "Write a python function to convert a list of strings into a single string where each word is capitalized and separated by a space. The input will be a list of strings, and the expected output is a single string with each word capitalized. For example, if the input is `[\"hello\", \"world\"]`, the output should be `\"Hello World\"`. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a python function to convert a list of strings into a single string where each word is capitalized and separated by a space. The input will be a list of strings, and the expected output is a single string with each word capitalized. For example, if the input is `["hello", "world"]`, the output should be `"Hello World"`.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_zo6erx0btvk9jbu9mo7mdaip | [
{
"content": "Analyze the frequency of each letter in the following two Python code snippets. For each snippet, provide the frequency count of every letter, and highlight the frequency of capital letters separately. Separate the two analyses like so:\n\nCode Analysis 1\n******\nCode Analysis 2\n\nMake sure to include all letters from A to Z and a to z in your frequency counts, even if their frequency is zero. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Analyze the frequency of each letter in the following two Python code snippets. For each snippet, provide the frequency count of every letter, and highlight the frequency of capital letters separately. Separate the two analyses like so:\n\nCode Analysis 1\n******\nCode Analysis 2\n\nMake sure to include all letters from A to Z and a to z in your frequency counts, even if their frequency is zero.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_65120 | [
{
"content": "Quantos componentes o ACDC tem no momento? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Quantos componentes o ACDC tem no momento?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_23224 | [
{
"content": "\"Ny Rindrin'i Shina dia iray amin'ireo zava-mahatalanjona eran-tany. Mivelatra an'arivony kilaometatra manerana an'i Shina izy io ary manana tantara mahavariana.\"\nManomeza fanontaniana iray izay hita ao amin'ny lahatsoratra ny valiny. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': '"Ny Rindrin\'i Shina dia iray amin\'ireo zava-mahatalanjona eran-tany. Mivelatra an\'arivony kilaometatra manerana an\'i Shina izy io ary manana tantara mahavariana."\nManomeza fanontaniana iray izay hita ao amin\'ny lahatsoratra ny valiny.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_ede8nhs16pqklglklw3nznql | [
{
"content": "Write a python function to convert a list of daily average temperatures from Celsius to Fahrenheit. The function should take a list of floats or integers as input, where each element represents a temperature in Celsius. The function should return a new list of floats, where each temperature has been converted to Fahrenheit using the formula \\( F = C \\times \\frac{9}{5} + 32 \\).\n\nFor example, given the input list `[0.0, 20.0, 37.0, -5.0]`, the function should return `[32.0, 68.0, 98.6, 23.0]`. \n\nPlease ensure that the function handles both positive and negative temperatures correctly and that the output is as precise as possible. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a python function to convert a list of daily average temperatures from Celsius to Fahrenheit. The function should take a list of floats or integers as input, where each element represents a temperature in Celsius. The function should return a new list of floats, where each temperature has been converted to Fahrenheit using the formula \\( F = C \\times \\frac{9}{5} + 32 \\).\n\nFor example, given the input list `[0.0, 20.0, 37.0, -5.0]`, the function should return `[32.0, 68.0, 98.6, 23.0]`. \n\nPlease ensure that the function handles both positive and negative temperatures correctly and that the output is as precise as possible.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personas_math_easy_947hws785kyu7yj02nixi5cc | [
{
"content": "Jamie is a young political science student who is inspired by their ancestor's activism for voting rights. Jamie decides to organize a rally to raise awareness about the importance of voting. They plan to distribute flyers to spread the word. Jamie knows that each flyer can reach 10 people on average.\n\nBefore the rally, Jamie discovers that 5% of the flyers get lost or damaged. Jamie initially prints 800 flyers, but realizing this, they decide to print an additional batch of 200 flyers to make sure enough people hear about the rally.\n\nHow many people can Jamie expect to reach with the flyers that are successfully distributed? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Jamie is a young political science student who is inspired by their ancestor's activism for voting rights. Jamie decides to organize a rally to raise awareness about the importance of voting. They plan to distribute flyers to spread the word. Jamie knows that each flyer can reach 10 people on average.\n\nBefore the rally, Jamie discovers that 5% of the flyers get lost or damaged. Jamie initially prints 800 flyers, but realizing this, they decide to print an additional batch of 200 flyers to make sure enough people hear about the rally.\n\nHow many people can Jamie expect to reach with the flyers that are successfully distributed?", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_73734flachin6k1mp93ukxwc | [
{
"content": "A renowned poet, celebrated for their advocacy for marginalized communities, decides to create a new poetry anthology. This anthology reflects a complex pattern of themes and emotions, represented by a mathematical function. The poet envisions the anthology as a continuous piece, where each poem represents a point on a curve that describes the emotional intensity of their work over time.\n\n1. Define a continuous function \\( f(t) \\) to model the emotional intensity of the anthology, where \\( t \\) represents time in months since the beginning of the project. Assume the function has the form \\( f(t) = e^{-\\alpha t} \\sin(\\beta t) + \\gamma \\), where \\( \\alpha, \\beta, \\) and \\( \\gamma \\) are positive constants. Given that the maximum emotional intensity occurs at \\( t = \\frac{\\pi}{2\\beta} \\), find the values of \\( \\alpha \\), \\( \\beta \\), and \\( \\gamma \\) such that the maximum intensity is 10 and the intensity stabilizes to a value of 2 as \\( t \\to \\infty \\).\n\n2. The poet also wants to ensure that the anthology highlights certain key themes at regular intervals. Suppose these key themes are represented by the local maxima of the function \\( f(t) \\) in the interval \\( [0, 6\\pi] \\). Determine the number of such key themes, and find the times \\( t \\) when they occur, assuming the constants \\( \\alpha, \\beta, \\) and \\( \\gamma \\) are those determined in the first sub-problem. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'A renowned poet, celebrated for their advocacy for marginalized communities, decides to create a new poetry anthology. This anthology reflects a complex pattern of themes and emotions, represented by a mathematical function. The poet envisions the anthology as a continuous piece, where each poem represents a point on a curve that describes the emotional intensity of their work over time.\n\n1. Define a continuous function \\( f(t) \\) to model the emotional intensity of the anthology, where \\( t \\) represents time in months since the beginning of the project. Assume the function has the form \\( f(t) = e^{-\\alpha t} \\sin(\\beta t) + \\gamma \\), where \\( \\alpha, \\beta, \\) and \\( \\gamma \\) are positive constants. Given that the maximum emotional intensity occurs at \\( t = \\frac{\\pi}{2\\beta} \\), find the values of \\( \\alpha \\), \\( \\beta \\), and \\( \\gamma \\) such that the maximum intensity is 10 and the intensity stabilizes to a value of 2 as \\( t \\to \\infty \\).\n\n2. The poet also wants to ensure that the anthology highlights certain key themes at regular intervals. Suppose these key themes are represented by the local maxima of the function \\( f(t) \\) in the interval \\( [0, 6\\pi] \\). Determine the number of such key themes, and find the times \\( t \\) when they occur, assuming the constants \\( \\alpha, \\beta, \\) and \\( \\gamma \\) are those determined in the first sub-problem.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_2yszcbu3z05kl2qj93txcb2i | [
{
"content": "A sales representative is analyzing the effectiveness of their company's CPAP devices in improving sleep quality among users. They collect data from a sample of 120 users over a month. The data reveals that the average reduction in apnea events per hour (AHI) after using the CPAP device is 15 with a standard deviation of 4.\n\n1. Assuming the reduction in AHI follows a normal distribution, calculate the probability that a randomly selected user will experience a reduction in AHI of more than 18 events per hour after using the CPAP device.\n\n2. If the sales representative wants to claim that at least 95% of users will experience a reduction in AHI of at least 10 events per hour, determine the maximum standard deviation that would allow this claim to be true, given the current average reduction in AHI is 15. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "A sales representative is analyzing the effectiveness of their company's CPAP devices in improving sleep quality among users. They collect data from a sample of 120 users over a month. The data reveals that the average reduction in apnea events per hour (AHI) after using the CPAP device is 15 with a standard deviation of 4.\n\n1. Assuming the reduction in AHI follows a normal distribution, calculate the probability that a randomly selected user will experience a reduction in AHI of more than 18 events per hour after using the CPAP device.\n\n2. If the sales representative wants to claim that at least 95% of users will experience a reduction in AHI of at least 10 events per hour, determine the maximum standard deviation that would allow this claim to be true, given the current average reduction in AHI is 15.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_3mjekg5rdmzpp3l488iteu3x | [
{
"content": "What is the recommended daily intake of dietary fiber for adult women according to the Dietary Guidelines for Americans? Choose one from the following options: ('21 grams', '25 grams', '30 grams') -- please include the exact phrase in your response. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "What is the recommended daily intake of dietary fiber for adult women according to the Dietary Guidelines for Americans? Choose one from the following options: ('21 grams', '25 grams', '30 grams') -- please include the exact phrase in your response.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_syjk10a4elq4vztagdpn3q2i | [
{
"content": "Write a python function to help me automate the process of organizing a list of character names based on their roles in a western movie script. The function should take in a list of tuples, where each tuple contains a character's name (string) and their role (string) such as 'hero', 'villain', or 'sidekick'. The function should return a dictionary where the keys are the roles and the values are lists of names associated with each role. \n\nFor example, if the input is:\n\n```python\ncharacters = [\n ('John Wayne', 'hero'),\n ('Clint Eastwood', 'hero'),\n ('Lee Van Cleef', 'villain'),\n ('Eli Wallach', 'villain'),\n ('Gabby Hayes', 'sidekick'),\n ('Walter Brennan', 'sidekick')\n]\n```\n\nThe expected output should be:\n\n```python\n{\n 'hero': ['John Wayne', 'Clint Eastwood'],\n 'villain': ['Lee Van Cleef', 'Eli Wallach'],\n 'sidekick': ['Gabby Hayes', 'Walter Brennan']\n}\n```\n\nPlease ensure that the function handles cases where there might be duplicate names or roles not included in the input. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Write a python function to help me automate the process of organizing a list of character names based on their roles in a western movie script. The function should take in a list of tuples, where each tuple contains a character's name (string) and their role (string) such as 'hero', 'villain', or 'sidekick'. The function should return a dictionary where the keys are the roles and the values are lists of names associated with each role. \n\nFor example, if the input is:\n\n```python\ncharacters = [\n ('John Wayne', 'hero'),\n ('Clint Eastwood', 'hero'),\n ('Lee Van Cleef', 'villain'),\n ('Eli Wallach', 'villain'),\n ('Gabby Hayes', 'sidekick'),\n ('Walter Brennan', 'sidekick')\n]\n```\n\nThe expected output should be:\n\n```python\n{\n 'hero': ['John Wayne', 'Clint Eastwood'],\n 'villain': ['Lee Van Cleef', 'Eli Wallach'],\n 'sidekick': ['Gabby Hayes', 'Walter Brennan']\n}\n```\n\nPlease ensure that the function handles cases where there might be duplicate names or roles not included in the input.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_78124 | [
{
"content": "this is a result from ocr, can you fix all the syntax error for me?\n1mpor+ botoE\nfronn_bot03.dymamOdb.cond!tlons import Kev, 4ttn\n\ndef write_dat@_s3_bv<ket(bucket nam€, filename):\nse =_b07o3,c|ient('s3')\ns3.upload_file(ti1en&nne, buck€t_name, fil3nam3)\n\ndef read_data_se_bucket(bucke+_name, tilen4me):\ns3 = bO+o3.c|i3nt('53']\ns3.downlo@d_f1ie[bucket_nam3. filenann3` t!len&me)\n\n03f write d4t4 0ynamoDB(table_rame, data):\ndvnamodb = botO3.resource('dynamoob', ne9lom name='Region_Nam3']\ntab1€ = ovn@n0db.Table(t4bl3_name)\nr€sponze_= 7ab1e.put_i73m(Item-data)\nreturn r€s9onse\n\nd€f nead_d4t4 dynamoDB[table name._key):\ndymamodb = bOto3,resounce('dyramodb', region_name='Neglom_Name'}\ntabl€_= dynam0db.T&ble(table_name)\nresq0nse = table.g3+_item(X3v=key)\nr3turn respOn$e['Itenn'}\n\ndef main():\n8ucket_name = 'bu<ke+_name'\ntilen@me - 'tilename'\nwrite_oata_s3_6ucket(bucket_name, filename)\nread_dat4_s3_6ucket[buck37_m@m3, filem&me)\n\ndata = {'Mam€': 'Johr', 'Age': 30, 'Jo8': '€nglre€r')\nwr1te_d&t4 dym@noDB{'Tabl€_Name'. oa7a)\n\nxey = {'Nam€': 'John'}\nprin+(rea0_o&ta_oyramoDB('T@6le_Mame'. key))\n\nif _ nane__ == \"_ main__\":\nmain{) Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'this is a result from ocr, can you fix all the syntax error for me?\n1mpor+ botoE\nfronn_bot03.dymamOdb.cond!tlons import Kev, 4ttn\n\ndef write_dat@_s3_bv<ket(bucket nam€, filename):\nse =_b07o3,c|ient(\'s3\')\ns3.upload_file(ti1en&nne, buck€t_name, fil3nam3)\n\ndef read_data_se_bucket(bucke+_name, tilen4me):\ns3 = bO+o3.c|i3nt(\'53\']\ns3.downlo@d_f1ie[bucket_nam3. filenann3` t!len&me)\n\n03f write d4t4 0ynamoDB(table_rame, data):\ndvnamodb = botO3.resource(\'dynamoob\', ne9lom name=\'Region_Nam3\']\ntab1€ = ovn@n0db.Table(t4bl3_name)\nr€sponze_= 7ab1e.put_i73m(Item-data)\nreturn r€s9onse\n\nd€f nead_d4t4 dynamoDB[table name._key):\ndymamodb = bOto3,resounce(\'dyramodb\', region_name=\'Neglom_Name\'}\ntabl€_= dynam0db.T&ble(table_name)\nresq0nse = table.g3+_item(X3v=key)\nr3turn respOn$e[\'Itenn\'}\n\ndef main():\n8ucket_name = \'bu<ke+_name\'\ntilen@me - \'tilename\'\nwrite_oata_s3_6ucket(bucket_name, filename)\nread_dat4_s3_6ucket[buck37_m@m3, filem&me)\n\ndata = {\'Mam€\': \'Johr\', \'Age\': 30, \'Jo8\': \'€nglre€r\')\nwr1te_d&t4 dym@noDB{\'Tabl€_Name\'. oa7a)\n\nxey = {\'Nam€\': \'John\'}\nprin+(rea0_o&ta_oyramoDB(\'T@6le_Mame\'. key))\n\nif _ nane__ == "_ main__":\nmain{)', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_g1nud1x2qrwe8cyl91miett5 | [
{
"content": "As an experienced motorsport engineer, you are analyzing the performance data of a racing car at different speeds. The car's drag force, \\( F_d \\), is modeled by the polynomial equation \\( F_d(v) = av^3 + bv^2 + cv + d \\), where \\( v \\) is the velocity of the car in meters per second, and \\( a, b, c, \\) and \\( d \\) are constants determined by the car's aerodynamic properties.\n\n1. During a particular test, you have determined that at a velocity of 10 m/s, the drag force is 500 N. Additionally, you know the drag force is zero when the car is stationary (i.e., \\( F_d(0) = 0 \\)). Given these conditions and assuming the polynomial has a degree of 3, find the possible values of the constant \\( d \\).\n\n2. Further analysis of the car's velocity from 0 to 20 m/s reveals that the drag force increases at a rate proportional to the square of the velocity. Express this relationship as a quadratic inequality involving \\( v \\) and \\( a, b, c, \\) and \\( d \\), and determine the range of velocities for which the drag force exceeds 1000 N. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "As an experienced motorsport engineer, you are analyzing the performance data of a racing car at different speeds. The car's drag force, \\( F_d \\), is modeled by the polynomial equation \\( F_d(v) = av^3 + bv^2 + cv + d \\), where \\( v \\) is the velocity of the car in meters per second, and \\( a, b, c, \\) and \\( d \\) are constants determined by the car's aerodynamic properties.\n\n1. During a particular test, you have determined that at a velocity of 10 m/s, the drag force is 500 N. Additionally, you know the drag force is zero when the car is stationary (i.e., \\( F_d(0) = 0 \\)). Given these conditions and assuming the polynomial has a degree of 3, find the possible values of the constant \\( d \\).\n\n2. Further analysis of the car's velocity from 0 to 20 m/s reveals that the drag force increases at a rate proportional to the square of the velocity. Express this relationship as a quadratic inequality involving \\( v \\) and \\( a, b, c, \\) and \\( d \\), and determine the range of velocities for which the drag force exceeds 1000 N.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_48153 | [
{
"content": "Can you share the Snapchat username for Captain America? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Can you share the Snapchat username for Captain America?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_32316 | [
{
"content": "I have been working on a web services related project for about the last year. Our team found [soapUI](http://www.soapui.org) near the start of our project and we have been (*) satisfied with it (the free version, that is).\n\nMy question is: are there other tools/clients/frameworks that you have used/currently use for web services testing and would recommend?\n\n(*) There are some weird GUI glitches that appear once in a while. As is mentioned by some of the answers, we attributed this to a memory leak. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'I have been working on a web services related project for about the last year. Our team found [soapUI](http://www.soapui.org) near the start of our project and we have been (*) satisfied with it (the free version, that is).\n\nMy question is: are there other tools/clients/frameworks that you have used/currently use for web services testing and would recommend?\n\n(*) There are some weird GUI glitches that appear once in a while. As is mentioned by some of the answers, we attributed this to a memory leak.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_49397 | [
{
"content": "I have been working on a web services related project for about the last year. Our team found [soapUI](http://www.soapui.org) near the start of our project and we have been (*) satisfied with it (the free version, that is).\n\nMy question is: are there other tools/clients/frameworks that you have used/currently use for web services testing and would recommend?\n\n(*) There are some weird GUI glitches that appear once in a while. As is mentioned by some of the answers, we attributed this to a memory leak. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'I have been working on a web services related project for about the last year. Our team found [soapUI](http://www.soapui.org) near the start of our project and we have been (*) satisfied with it (the free version, that is).\n\nMy question is: are there other tools/clients/frameworks that you have used/currently use for web services testing and would recommend?\n\n(*) There are some weird GUI glitches that appear once in a while. As is mentioned by some of the answers, we attributed this to a memory leak.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_18343 | [
{
"content": "Could you provide information on examples where women hold leadership roles in traditionally male-dominated industries? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Could you provide information on examples where women hold leadership roles in traditionally male-dominated industries?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_90674 | [
{
"content": "can you adapt this code to lua?\nimport tensorflow as tf\nfrom tensorflow import keras\nfrom tensorflow.keras import layers\nfrom tensorflow.keras.layers import Activation\nfrom keras_tuner import HyperModel\nfrom keras_tuner.tuners import Hyperband\n\n\nclass MyHyperModel(HyperModel):\n\n def __init__(self, num_classes):\n self.num_classes = num_classes\n\n def build(self, hp):\n model = keras.Sequential()\n model.add(layers.Dense(units=hp.Int('units',\n min_value=32,\n max_value=512,\n step=32),\n activation='relu'))\n model.add(layers.Dense(self.num_classes, activation='softmax'))\n model.compile(\n optimizer=keras.optimizers.Adam(\n hp.Choice('learning_rate',\n values=[1e-2, 1e-3, 1e-4])),\n loss='sparse_categorical_crossentropy',\n metrics=['accuracy'])\n return model\n\n# define hypermodel\nhypermodel = MyHyperModel(num_classes=10)\n\n# Initialize the tuner\ntuner = Hyperband(\n hypermodel,\n max_epochs=10,\n objective='val_accuracy',\n seed=10,\n executions_per_trial=2\n)\n\n# generate data\n(x_train, y_train), (x_test, y_test) = keras.datasets.mnist.load_data()\nx_train = x_train.astype('float32') / 255\nx_test = x_test.astype('float32') / 255\n\n# start the search for the best hyperparameters\ntuner.search(x_train, y_train,\n epochs=10,\n validation_data=(x_test, y_test))\n\n# Get the optimal hyperparameters\nbest_hps = tuner.get_best_hyperparameters(num_trials = 1)[0]\n\nprint(f\"\"\"\nThe hyperparameter search is complete. The optimal number of units in the first dense\nlayer is {best_hps.get('units')} and the optimal learning rate for the optimizer\nis {best_hps.get('learning_rate')}.\n\"\"\") Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'can you adapt this code to lua?\nimport tensorflow as tf\nfrom tensorflow import keras\nfrom tensorflow.keras import layers\nfrom tensorflow.keras.layers import Activation\nfrom keras_tuner import HyperModel\nfrom keras_tuner.tuners import Hyperband\n\n\nclass MyHyperModel(HyperModel):\n\n def __init__(self, num_classes):\n self.num_classes = num_classes\n\n def build(self, hp):\n model = keras.Sequential()\n model.add(layers.Dense(units=hp.Int(\'units\',\n min_value=32,\n max_value=512,\n step=32),\n activation=\'relu\'))\n model.add(layers.Dense(self.num_classes, activation=\'softmax\'))\n model.compile(\n optimizer=keras.optimizers.Adam(\n hp.Choice(\'learning_rate\',\n values=[1e-2, 1e-3, 1e-4])),\n loss=\'sparse_categorical_crossentropy\',\n metrics=[\'accuracy\'])\n return model\n\n# define hypermodel\nhypermodel = MyHyperModel(num_classes=10)\n\n# Initialize the tuner\ntuner = Hyperband(\n hypermodel,\n max_epochs=10,\n objective=\'val_accuracy\',\n seed=10,\n executions_per_trial=2\n)\n\n# generate data\n(x_train, y_train), (x_test, y_test) = keras.datasets.mnist.load_data()\nx_train = x_train.astype(\'float32\') / 255\nx_test = x_test.astype(\'float32\') / 255\n\n# start the search for the best hyperparameters\ntuner.search(x_train, y_train,\n epochs=10,\n validation_data=(x_test, y_test))\n\n# Get the optimal hyperparameters\nbest_hps = tuner.get_best_hyperparameters(num_trials = 1)[0]\n\nprint(f"""\nThe hyperparameter search is complete. The optimal number of units in the first dense\nlayer is {best_hps.get(\'units\')} and the optimal learning rate for the optimizer\nis {best_hps.get(\'learning_rate\')}.\n""")', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_6939 | [
{
"content": "Ity fanambarana manaraka ity dia amin'ny teny anglisy: \"The island has a rich history of monarchies, with various kingdoms once ruling different regions.\".\nAdikao amin'ny teny Malagasy io fanambarana io. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Ity fanambarana manaraka ity dia amin\'ny teny anglisy: "The island has a rich history of monarchies, with various kingdoms once ruling different regions.".\nAdikao amin\'ny teny Malagasy io fanambarana io.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_76961 | [
{
"content": "I tried to code this into python:\nessentially it is a exponent calculator\nso for exp(2, 5) it should return 2\n\ndef exp(num, pow):\n for i in range(0, pow, 1):\n num1=num*num\n print(num1)\nprint(exp(2, 5))\n\n\nwhy won't it work?\nI expected it to work but it always gives the square of the number. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "I tried to code this into python:\nessentially it is a exponent calculator\nso for exp(2, 5) it should return 2\n\ndef exp(num, pow):\n for i in range(0, pow, 1):\n num1=num*num\n print(num1)\nprint(exp(2, 5))\n\n\nwhy won't it work?\nI expected it to work but it always gives the square of the number.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_tje4fxsap6e6xoxkk4mv5gp7 | [
{
"content": "WRITE A 2 PARAGRAPH EXPLANATION IN ENGLISH DESCRIBING HOW TO BLINK AN LED USING AN ARDUINO MICROCONTROLLER. ENSURE THE EXPLANATION IS BETWEEN 150 AND 200 WORDS IN TOTAL AND MENTION \"DIGITAL PIN\" AT LEAST TWICE. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'WRITE A 2 PARAGRAPH EXPLANATION IN ENGLISH DESCRIBING HOW TO BLINK AN LED USING AN ARDUINO MICROCONTROLLER. ENSURE THE EXPLANATION IS BETWEEN 150 AND 200 WORDS IN TOTAL AND MENTION "DIGITAL PIN" AT LEAST TWICE.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_gap00vecup06zz3v8drjahgz | [
{
"content": "John, a die-hard WWE fan, often compares the match schedules and ratings of WWE and AEW. He believes WWE is far superior to AEW in terms of ratings and match quality. Let's assume that the ratings of WWE and AEW are represented by continuous functions \\( W(t) \\) and \\( A(t) \\) respectively, where \\( t \\) is the time in weeks since the beginning of 2022.\n\n1. Suppose \\( W(t) = 100 + 20\\sin\\left(\\frac{\\pi}{26}t\\right) \\) and \\( A(t) = 80 + 15\\sin\\left(\\frac{\\pi}{26}t + \\phi\\right) \\), where \\( \\phi \\) is a phase shift. Calculate the value of \\( \\phi \\) such that the correlation coefficient between \\( W(t) \\) and \\( A(t) \\) over a period of 52 weeks is minimized. \n\n2. Using the values of \\( W(t) \\) and \\( A(t) \\) from the first sub-problem, determine the exact weeks (within the 52-week period) when WWE's rating is exactly double that of AEW's rating. Provide a general form of the solution and approximate the numerical values. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "John, a die-hard WWE fan, often compares the match schedules and ratings of WWE and AEW. He believes WWE is far superior to AEW in terms of ratings and match quality. Let's assume that the ratings of WWE and AEW are represented by continuous functions \\( W(t) \\) and \\( A(t) \\) respectively, where \\( t \\) is the time in weeks since the beginning of 2022.\n\n1. Suppose \\( W(t) = 100 + 20\\sin\\left(\\frac{\\pi}{26}t\\right) \\) and \\( A(t) = 80 + 15\\sin\\left(\\frac{\\pi}{26}t + \\phi\\right) \\), where \\( \\phi \\) is a phase shift. Calculate the value of \\( \\phi \\) such that the correlation coefficient between \\( W(t) \\) and \\( A(t) \\) over a period of 52 weeks is minimized. \n\n2. Using the values of \\( W(t) \\) and \\( A(t) \\) from the first sub-problem, determine the exact weeks (within the 52-week period) when WWE's rating is exactly double that of AEW's rating. Provide a general form of the solution and approximate the numerical values.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_88216 | [
{
"content": "Apakah maksud 'buta huruf'? Berilah satu contoh ayat untuknya. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Apakah maksud 'buta huruf'? Berilah satu contoh ayat untuknya.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
science.covid_deepset_qa.1682 | [
{
"content": "You will be shown a paragraph from a biomedical research paper, followed by a question about the paper. Please extract text from the paragraph to answer the question. Do not include any text in your repsonse other than the answer.\n\nParagraph: This family includes five members, namely, IFITM1, 2, 3, 5, and 10, among which IFITM1, 2, and 3 possess antiviral activity (4) . Different IFITM proteins have different antiviral spectrum (5) . For example, IFITM3 has been shown to prevent influenza virus infection in vitro and in mice (6, 7) , and it also inhibits multiple viruses, including filoviruses, rhabdoviruses, flaviviruses, and even Ebola and Zika virus (7) (8) (9) (10) (11) . The antiviral mechanism of IFITM3 is thought to be the restriction of viral entry into cells (4, 12) . Single nucleotide polymorphisms (SNPs) are single nucleotide variations in a genetic sequence that occur at an appreciable frequency in the population. Several SNPs has been identified in IFITM3, among which the rs12252 site with C allele results in a N-terminal truncation of IFITM3 protein, leading to impaired inhibition of influenza virus in vitro (13, 14) . Notably, the frequencies of rs12252 C allele and CC genotype correlate with disease severity in patients infected with influenza virus (13, 15) . HTNV has been shown to induce a type I interferon response (though in later time postinfection) (16, 17) . While overexpression of in Vero E6 cells has been reported to inhibit HTNV infection (18) , however, the effect of IFITMs on HTNV infection in human cell lines and its role in HFRS still remain unknown. LncRNA comprises a group of non-coding RNAs longer than 200 nt that function as gene regulators. Some lncRNAs have been shown to play a role in innate immunity (19) . Among them, negative regulator of interferon response (NRIR) (lncRNA NRIR, also known as lncRNA-CMPK2) is a non-coding ISG that negatively regulates IFITM1 and Mx1 expression in HCV infection (20) . Notably, IFITM3 is largely homologous to IFITM1, but the role of NRIR in the regulation of IFITM3 in HTNV infection remains unclear. In the present study, we investigate the effect of IFTTM3 on the replication of HTNV and its role in the development of HFRS in humans. We provide primary evidence suggesting that IFITM3, regulated by NRIR, can inhibit HTNV infection and its SNP rs12252 correlates with the disease severity and viral load in patients with HFRS. This study expands our understanding of the antiviral activity of IFITM3 and enriches our knowledge of innate immune responses to HTNV infection. This study was conducted in accordance with the recommendations of the biomedical research guidelines involving human participants established by the National Health and Family Planning Commission of China. The Institutional Ethics Committee of Tangdu Hospital approved this study. All subjects gave written informed consent in accordance with the Declaration of Helsinki. Before inclusion, all participants were informed of the study objectives and signed the consent form before blood samples and medical records were obtained. Sixty-nine HFRS patients admitted into the Department of Infectious Diseases, Tangdu Hospital between October 2014 and March 2016 were enrolled in this study. All patients were Han Chinese. The diagnosis of HFRS was made based on typical symptoms and signs as well as positive IgM and IgG antibodies against HTNV in the serum assessed by enzyme linked immunosorbent assay (ELISA) in our department. The classification of HFRS severity and the exclusion criteria were described as follows (21) : white blood cells (WBC), platelets (PLT), blood urea nitrogen (BUN), serum creatinine (Scr), and heteromorphic lymphocytes that were tested by the Department of Clinical Laboratory (shown in Table 1 ). According to clinical symptoms and signs, such as fever, effusion, hemorrhage, edema, and renal function, the severity of HFRS can be classified as previously described (21): (1) mild patients were identified with mild renal failure without an obvious oliguric stage; (2) moderate patients were those with obvious symptoms of uremia, effusion (bulbar conjunctiva), hemorrhage (skin and mucous membrane), and renal failure with a typical oliguric stage; (3) severe patients had severe uremia, effusion (bulbar conjunctiva and either peritoneum or pleura), hemorrhage (skin and mucous membrane), and renal failure with oliguria (urine output, 50-500 ml/day) for ≤5 days or anuria (urine output, <50 ml/day) for ≤2 days; and (4) critical patients exhibited ≥1 of the following signs during the illness: refractory shock, visceral hemorrhage, heart failure, pulmonary edema, brain edema, severe secondary infection, and severe renal failure with oliguria (urine output, 50-500 ml/day) for >5 days, anuria (urine output, <50 ml/day) for >2 days, or a BUN level of >42.84 mmol/l. Due to the sample quantity required for SNP typing, the mild and moderate patients were assessed together in the mild group, and we combined severe and critical patients as severe group. The exclusion criteria for this study were patients with: (1) any other kidney disease, (2) diabetes mellitus, (3) autoimmune disease, (4) hematological disease, (5) cardiovascular disease, (6) viral hepatitis (types A, B, C, D, or E), or (7) any other liver disease. In addition, no patients received corticosteroids or other immunomodulatory drugs during the study period (21) . Genomic DNA was extracted from the peripheral blood of patients using the PureGene DNA Isolation kit (Gentra Systems, Minneapolis, MN, USA). The region encompassing the human IFITM3 rs12252 were amplified by PCR (forward primer, 5′-GGAAACTGTTGAGAAACCGAA-3′ and reverse primer, 5′-CATACGCACCTTCACGGAGT-3′). The PCR products were purified and sequenced using an Applied Biosystems 3730xl DNA Analyzer (Thermo Scientific, Waltham, MA, USA). The allele frequencies and genotypes of healthy Han Chinese and other groups were obtained from the 1,000 genomes project (http:// www.1000genomes.org). The HTNV load in plasma samples (collected during the acute phase) from 24 age-and sex-matched HFRS patients with different genotypes were measured using previously reported methods (2) . Briefly, viral RNA was extracted from the plasma of HFRS patients using Purelink Viral RNA/DNA Kits (Invitrogen, Carlsbad, CA, USA). The SuperScript III Platinum One-Step Quantitative RT-PCR System kit (Invitrogen, Carlsbad, CA, USA) was employed for the real-time RT-PCR assay. The primers and probe (provided by Sangon Biotech, Shanghai, China) were as follows: forward, 5′-TACAGAGGGAAATCAATGCC-3′, reverse, 5′-TGTTCAACTCATCTGGATCCTT-3′, and probe, 5′-(FAM) ATCCCTCACCTTCTGCCTGGCTATC (TAMRA)-3′. The synthetic S segment of the HTNV standard strain 76-118 RNA transcript was used as the quantitative calibrator. The external standard was the culture supernatant of Vero E6 cells infected with HTNV 76-118, which was quantified using synthetic quantitative calibrators. For each experiment, one aliquot of calibrated 76-118 standard was extracted in parallel with the clinical samples and serially 10-fold diluted with concentrations ranging from 10.56 to 2.56 log10 copies/ml. PCR was performed using an iQ5 Cycler (Bio-Rad, Hercules, CA, USA) with following conditions: 42°C for 15 min, 95°C for 2 min, and 50 cycles of 15 s at 95°C, 30 s at 53°C, and 30 s at 72°C. Fluorescence was read during the 72°C step of the final segment of every cycling program. HUVEC cells (ScienCell Research Laboratories, Carlsbad, CA, USA) were grown in ECM BulletKit (ScienCell Research Laboratories, Carlsbad, CA, USA) in a 5% CO2 incubator. A549 cells (ATCC Cat# CRM-CCL-185, RRID:CVCL_0023) were grown in our laboratory in DMEM with 10% FBS (Thermo Scientific, Waltham, MA, USA) in a 5% CO2 incubator. Cells were used within passage 10 after primary culture. HTNV strain 76-118 was cultured in Vero E6 cells (ATCC Cat# CRL-1586, RRID:CVCL_0574) in our laboratory and titrated using an immunofluorescence staining assay for HTNV nucleocapsid protein (NP) as previously described (22) . The TCID50 was 10 5 /ml, which was calculated using the Reed-Muench method. The recombinant human IFN-α2a was obtained from PBL Interferon Source (Piscataway, NJ, USA) and dissolved in the buffer provided by the manufacturer (composition not disclosed). HUVEC and A549 cells were infected by incubation with HTNV as indicated moi at 37°C for 60 mins. Subsequently, the virus solution was removed and fresh medium added to the cell culture. Cells were transfected with lentiviral vectors of c-myc-tagged IFITM1, IFITM2, IFITM3, and IFITM3 NΔ21 (purchased from GENECHEM, Shanghai, China) at a moi of 10. Puromycin (2 μg/ ml for HUVEC and 6 μg/ml for A549 cells) was used to create cell lines stably expressing IFITMs. Cells were transfected with control (scrambled) short interfering RNA (siRNA), IFITM1 siRNA, IFITM2 siRNA, or IFITM3 siRNA (10 nM) using Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). SiRNAs were purchased from Origene (Rockville, MD, USA), and the sequences were not disclosed. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using the K1622 kit (Thermo Scientific, Waltham, MA, USA). Quantitative realtime PCR (qPCR) was performed using SYBR Premix Ex Taq II (Takara Biotechnology Co., Dalian, China) with a Bio-Rad iQ5 cycler (Bio-Rad, Hercules, CA, USA). β-actin was used as the reference gene. The primers (Sangon Biotech, Shanghai, China) were as follows: IFITM1 (forward, 5′-ACTCCGTGAAGTCTAGGGACA-3′ and reverse, 5′-TGTCACAGAGCCGAATACCAG-3′); IFITM2 (forward, 5′-ATCCCGGTAACCCGATCAC-3′ and reverse, 5′-CTTCCTGTCCCTAGACTTCAC-3′); IFITM3 (forward, 5′-GGTCTTCGCTGGACACCAT-3′ and reverse, 5′-TGTCCCTAGACTTCACGGAGTA-3′); IFITM3 pre-mRNA (forward, 5′-CATAGCACGCGGCTCT CAG-3′ and reverse, 5′-CGTCGCCAACCATCTTCCTG-3′); HTNV S segment (forward, 5′-GCCTGGAGACCATCTGA AAG-3′ and reverse, 5′-AGTATCGGGACGACAAAGGA-3′); β-actin (forward, 5′-GCTACGTCGCCCTGGACTTC-3′ and reverse, 5′-GTCATAGTCCGCCTAGAAGC-3′); NRIR (forward, 5′-ATGGTTTTCTGGTGCCTTG-3′ and reverse, 5′-GGAGGTTAGAGGTGTCTGCTG-3′); NRAV (forward, 5′-TCACTACTGCCCCAGGATCA-3′ and reverse, 5′-GGTGGTCACAGGACTCATGG-3′). For detection of miR-130a, cDNA was synthesized using the TaqMan microRNA reverse transcription kit (Invitrogen, Carlsbad, CA, USA) with a specific primer in gene-specific TaqMan assay kit (000454, Invitrogen, Carlsbad, CA, USA). MiR-130a level was determined using the gene-specific TaqMan assay kit (000454, Invitrogen, Carlsbad, CA, USA). U6 (001973, Invitrogen, Carlsbad, CA, USA) was used as an endogenous control (23) . Because the pre-mRNA levels can represent the initial transcription rate (24) , the primers used to detect the pre-mRNA of IFITM3 were designed targeting the intron of IFITM3 as previously described (25) . IFITM3 has two exons and one intron. For qPCR of IFITM3 pre-mRNA, the forward primers were positioned in the intron, and the reverse primer was positioned at the beginning of the second exon. For qPCR of IFITM3 mRNA, the forward primers were positioned in the first exon, and the reverse primer was positioned at the beginning of the second exon (24) . Because the basal expression of IFITM3 is low in A549 cells, we detected IFITM3 mRNA and pre-mRNA in A549 cells following IFN-α2a treatment (20 IU/ml for 12 h) after the overexpression of NRIR. Cell lysates were prepared using Radio Immunoprecipitation Assay (RIPA) buffer (Sigma-Aldrich, St. Louis, MO, USA). Equal amounts of protein (20 μg protein/lane) were electrophoresed on a 10%-SDS-polyacrylamide gel and electrophoretically transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA).\n\nQuestion: Which IFITM proteins have been shown to possess antiviral activity? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'You will be shown a paragraph from a biomedical research paper, followed by a question about the paper. Please extract text from the paragraph to answer the question. Do not include any text in your repsonse other than the answer.\n\nParagraph: This family includes five members, namely, IFITM1, 2, 3, 5, and 10, among which IFITM1, 2, and 3 possess antiviral activity (4) . Different IFITM proteins have different antiviral spectrum (5) . For example, IFITM3 has been shown to prevent influenza virus infection in vitro and in mice (6, 7) , and it also inhibits multiple viruses, including filoviruses, rhabdoviruses, flaviviruses, and even Ebola and Zika virus (7) (8) (9) (10) (11) . The antiviral mechanism of IFITM3 is thought to be the restriction of viral entry into cells (4, 12) . Single nucleotide polymorphisms (SNPs) are single nucleotide variations in a genetic sequence that occur at an appreciable frequency in the population. Several SNPs has been identified in IFITM3, among which the rs12252 site with C allele results in a N-terminal truncation of IFITM3 protein, leading to impaired inhibition of influenza virus in vitro (13, 14) . Notably, the frequencies of rs12252 C allele and CC genotype correlate with disease severity in patients infected with influenza virus (13, 15) . HTNV has been shown to induce a type I interferon response (though in later time postinfection) (16, 17) . While overexpression of in Vero E6 cells has been reported to inhibit HTNV infection (18) , however, the effect of IFITMs on HTNV infection in human cell lines and its role in HFRS still remain unknown. LncRNA comprises a group of non-coding RNAs longer than 200 nt that function as gene regulators. Some lncRNAs have been shown to play a role in innate immunity (19) . Among them, negative regulator of interferon response (NRIR) (lncRNA NRIR, also known as lncRNA-CMPK2) is a non-coding ISG that negatively regulates IFITM1 and Mx1 expression in HCV infection (20) . Notably, IFITM3 is largely homologous to IFITM1, but the role of NRIR in the regulation of IFITM3 in HTNV infection remains unclear. In the present study, we investigate the effect of IFTTM3 on the replication of HTNV and its role in the development of HFRS in humans. We provide primary evidence suggesting that IFITM3, regulated by NRIR, can inhibit HTNV infection and its SNP rs12252 correlates with the disease severity and viral load in patients with HFRS. This study expands our understanding of the antiviral activity of IFITM3 and enriches our knowledge of innate immune responses to HTNV infection. This study was conducted in accordance with the recommendations of the biomedical research guidelines involving human participants established by the National Health and Family Planning Commission of China. The Institutional Ethics Committee of Tangdu Hospital approved this study. All subjects gave written informed consent in accordance with the Declaration of Helsinki. Before inclusion, all participants were informed of the study objectives and signed the consent form before blood samples and medical records were obtained. Sixty-nine HFRS patients admitted into the Department of Infectious Diseases, Tangdu Hospital between October 2014 and March 2016 were enrolled in this study. All patients were Han Chinese. The diagnosis of HFRS was made based on typical symptoms and signs as well as positive IgM and IgG antibodies against HTNV in the serum assessed by enzyme linked immunosorbent assay (ELISA) in our department. The classification of HFRS severity and the exclusion criteria were described as follows (21) : white blood cells (WBC), platelets (PLT), blood urea nitrogen (BUN), serum creatinine (Scr), and heteromorphic lymphocytes that were tested by the Department of Clinical Laboratory (shown in Table 1 ). According to clinical symptoms and signs, such as fever, effusion, hemorrhage, edema, and renal function, the severity of HFRS can be classified as previously described (21): (1) mild patients were identified with mild renal failure without an obvious oliguric stage; (2) moderate patients were those with obvious symptoms of uremia, effusion (bulbar conjunctiva), hemorrhage (skin and mucous membrane), and renal failure with a typical oliguric stage; (3) severe patients had severe uremia, effusion (bulbar conjunctiva and either peritoneum or pleura), hemorrhage (skin and mucous membrane), and renal failure with oliguria (urine output, 50-500 ml/day) for ≤5 days or anuria (urine output, <50 ml/day) for ≤2 days; and (4) critical patients exhibited ≥1 of the following signs during the illness: refractory shock, visceral hemorrhage, heart failure, pulmonary edema, brain edema, severe secondary infection, and severe renal failure with oliguria (urine output, 50-500 ml/day) for >5 days, anuria (urine output, <50 ml/day) for >2 days, or a BUN level of >42.84 mmol/l. Due to the sample quantity required for SNP typing, the mild and moderate patients were assessed together in the mild group, and we combined severe and critical patients as severe group. The exclusion criteria for this study were patients with: (1) any other kidney disease, (2) diabetes mellitus, (3) autoimmune disease, (4) hematological disease, (5) cardiovascular disease, (6) viral hepatitis (types A, B, C, D, or E), or (7) any other liver disease. In addition, no patients received corticosteroids or other immunomodulatory drugs during the study period (21) . Genomic DNA was extracted from the peripheral blood of patients using the PureGene DNA Isolation kit (Gentra Systems, Minneapolis, MN, USA). The region encompassing the human IFITM3 rs12252 were amplified by PCR (forward primer, 5′-GGAAACTGTTGAGAAACCGAA-3′ and reverse primer, 5′-CATACGCACCTTCACGGAGT-3′). The PCR products were purified and sequenced using an Applied Biosystems 3730xl DNA Analyzer (Thermo Scientific, Waltham, MA, USA). The allele frequencies and genotypes of healthy Han Chinese and other groups were obtained from the 1,000 genomes project (http:// www.1000genomes.org). The HTNV load in plasma samples (collected during the acute phase) from 24 age-and sex-matched HFRS patients with different genotypes were measured using previously reported methods (2) . Briefly, viral RNA was extracted from the plasma of HFRS patients using Purelink Viral RNA/DNA Kits (Invitrogen, Carlsbad, CA, USA). The SuperScript III Platinum One-Step Quantitative RT-PCR System kit (Invitrogen, Carlsbad, CA, USA) was employed for the real-time RT-PCR assay. The primers and probe (provided by Sangon Biotech, Shanghai, China) were as follows: forward, 5′-TACAGAGGGAAATCAATGCC-3′, reverse, 5′-TGTTCAACTCATCTGGATCCTT-3′, and probe, 5′-(FAM) ATCCCTCACCTTCTGCCTGGCTATC (TAMRA)-3′. The synthetic S segment of the HTNV standard strain 76-118 RNA transcript was used as the quantitative calibrator. The external standard was the culture supernatant of Vero E6 cells infected with HTNV 76-118, which was quantified using synthetic quantitative calibrators. For each experiment, one aliquot of calibrated 76-118 standard was extracted in parallel with the clinical samples and serially 10-fold diluted with concentrations ranging from 10.56 to 2.56 log10 copies/ml. PCR was performed using an iQ5 Cycler (Bio-Rad, Hercules, CA, USA) with following conditions: 42°C for 15 min, 95°C for 2 min, and 50 cycles of 15 s at 95°C, 30 s at 53°C, and 30 s at 72°C. Fluorescence was read during the 72°C step of the final segment of every cycling program. HUVEC cells (ScienCell Research Laboratories, Carlsbad, CA, USA) were grown in ECM BulletKit (ScienCell Research Laboratories, Carlsbad, CA, USA) in a 5% CO2 incubator. A549 cells (ATCC Cat# CRM-CCL-185, RRID:CVCL_0023) were grown in our laboratory in DMEM with 10% FBS (Thermo Scientific, Waltham, MA, USA) in a 5% CO2 incubator. Cells were used within passage 10 after primary culture. HTNV strain 76-118 was cultured in Vero E6 cells (ATCC Cat# CRL-1586, RRID:CVCL_0574) in our laboratory and titrated using an immunofluorescence staining assay for HTNV nucleocapsid protein (NP) as previously described (22) . The TCID50 was 10 5 /ml, which was calculated using the Reed-Muench method. The recombinant human IFN-α2a was obtained from PBL Interferon Source (Piscataway, NJ, USA) and dissolved in the buffer provided by the manufacturer (composition not disclosed). HUVEC and A549 cells were infected by incubation with HTNV as indicated moi at 37°C for 60 mins. Subsequently, the virus solution was removed and fresh medium added to the cell culture. Cells were transfected with lentiviral vectors of c-myc-tagged IFITM1, IFITM2, IFITM3, and IFITM3 NΔ21 (purchased from GENECHEM, Shanghai, China) at a moi of 10. Puromycin (2 μg/ ml for HUVEC and 6 μg/ml for A549 cells) was used to create cell lines stably expressing IFITMs. Cells were transfected with control (scrambled) short interfering RNA (siRNA), IFITM1 siRNA, IFITM2 siRNA, or IFITM3 siRNA (10 nM) using Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). SiRNAs were purchased from Origene (Rockville, MD, USA), and the sequences were not disclosed. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using the K1622 kit (Thermo Scientific, Waltham, MA, USA). Quantitative realtime PCR (qPCR) was performed using SYBR Premix Ex Taq II (Takara Biotechnology Co., Dalian, China) with a Bio-Rad iQ5 cycler (Bio-Rad, Hercules, CA, USA). β-actin was used as the reference gene. The primers (Sangon Biotech, Shanghai, China) were as follows: IFITM1 (forward, 5′-ACTCCGTGAAGTCTAGGGACA-3′ and reverse, 5′-TGTCACAGAGCCGAATACCAG-3′); IFITM2 (forward, 5′-ATCCCGGTAACCCGATCAC-3′ and reverse, 5′-CTTCCTGTCCCTAGACTTCAC-3′); IFITM3 (forward, 5′-GGTCTTCGCTGGACACCAT-3′ and reverse, 5′-TGTCCCTAGACTTCACGGAGTA-3′); IFITM3 pre-mRNA (forward, 5′-CATAGCACGCGGCTCT CAG-3′ and reverse, 5′-CGTCGCCAACCATCTTCCTG-3′); HTNV S segment (forward, 5′-GCCTGGAGACCATCTGA AAG-3′ and reverse, 5′-AGTATCGGGACGACAAAGGA-3′); β-actin (forward, 5′-GCTACGTCGCCCTGGACTTC-3′ and reverse, 5′-GTCATAGTCCGCCTAGAAGC-3′); NRIR (forward, 5′-ATGGTTTTCTGGTGCCTTG-3′ and reverse, 5′-GGAGGTTAGAGGTGTCTGCTG-3′); NRAV (forward, 5′-TCACTACTGCCCCAGGATCA-3′ and reverse, 5′-GGTGGTCACAGGACTCATGG-3′). For detection of miR-130a, cDNA was synthesized using the TaqMan microRNA reverse transcription kit (Invitrogen, Carlsbad, CA, USA) with a specific primer in gene-specific TaqMan assay kit (000454, Invitrogen, Carlsbad, CA, USA). MiR-130a level was determined using the gene-specific TaqMan assay kit (000454, Invitrogen, Carlsbad, CA, USA). U6 (001973, Invitrogen, Carlsbad, CA, USA) was used as an endogenous control (23) . Because the pre-mRNA levels can represent the initial transcription rate (24) , the primers used to detect the pre-mRNA of IFITM3 were designed targeting the intron of IFITM3 as previously described (25) . IFITM3 has two exons and one intron. For qPCR of IFITM3 pre-mRNA, the forward primers were positioned in the intron, and the reverse primer was positioned at the beginning of the second exon. For qPCR of IFITM3 mRNA, the forward primers were positioned in the first exon, and the reverse primer was positioned at the beginning of the second exon (24) . Because the basal expression of IFITM3 is low in A549 cells, we detected IFITM3 mRNA and pre-mRNA in A549 cells following IFN-α2a treatment (20 IU/ml for 12 h) after the overexpression of NRIR. Cell lysates were prepared using Radio Immunoprecipitation Assay (RIPA) buffer (Sigma-Aldrich, St. Louis, MO, USA). Equal amounts of protein (20 μg protein/lane) were electrophoresed on a 10%-SDS-polyacrylamide gel and electrophoretically transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA).\n\nQuestion: Which IFITM proteins have been shown to possess antiviral activity?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_10758 | [
{
"content": "Can you show me how to add an interactive tooltip to this SVG?\n<svg width=\"32\" height=\"32\" viewBox=\"0 0 32 32\" fill=\"none\" xmlns=\"http://www.w3.org/2000/svg\">\n<path d=\"M13.24 9.57V2.47C13.24 2.21 13.45 2 13.7 2H18.28C18.54 2 18.75 2.21 18.75 2.47V9.57C18.75 9.72 18.87 9.85 19.03 9.85H20.01C20.63 9.85 20.96 10.59 20.54 11.05L16.53 15.46C16.24 15.77 15.75 15.77 15.47 15.46L11.46 11.05C11.04 10.59 11.37 9.85 11.99 9.85H12.96C13.11 9.85 13.24 9.73 13.24 9.57Z\" fill=\"#212121\"/>\n<path d=\"M3.01 11H10.323C10.1156 10.2045 10.5251 9.34057 11.2792 9H3.01C1.89772 9 1 9.89772 1 11.01V28.99C1 30.1023 1.89771 31 3.01 31H28.99C30.0958 31 31 30.1088 31 29V11.01C31 9.90421 30.1088 9 29 9H20.7208C21.4749 9.34057 21.8844 10.2045 21.677 11H28.997C28.998 11.0011 28.9987 11.0022 28.9991 11.0031L28.9996 11.0048C28.9997 11.0051 28.9998 11.0058 28.9999 11.0067C28.9999 11.0075 29 11.0086 29 11.01V11.5111L16.6739 19.3559C16.2612 19.618 15.7392 19.6181 15.3265 19.3561L3 11.5015V11.01C3 11.0071 3.00027 11.0056 3.00038 11.0051L3.00065 11.0041C3.00078 11.0038 3.00118 11.003 3.00211 11.0021C3.00304 11.0012 3.00381 11.0008 3.0041 11.0007L3.00506 11.0004C3.00559 11.0003 3.00713 11 3.01 11ZM29 13.8818V26.6707L18.9528 20.2762L29 13.8818ZM16.9905 21.3981L28.935 29H3.08002L15.0098 21.3981C15.6538 21.604 16.3465 21.604 16.9905 21.3981ZM13.0487 20.2762L3 26.6795V13.873L13.0487 20.2762Z\" fill=\"#212121\"/>\n</svg>\n Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Can you show me how to add an interactive tooltip to this SVG?\n<svg width="32" height="32" viewBox="0 0 32 32" fill="none" xmlns="http://www.w3.org/2000/svg">\n<path d="M13.24 9.57V2.47C13.24 2.21 13.45 2 13.7 2H18.28C18.54 2 18.75 2.21 18.75 2.47V9.57C18.75 9.72 18.87 9.85 19.03 9.85H20.01C20.63 9.85 20.96 10.59 20.54 11.05L16.53 15.46C16.24 15.77 15.75 15.77 15.47 15.46L11.46 11.05C11.04 10.59 11.37 9.85 11.99 9.85H12.96C13.11 9.85 13.24 9.73 13.24 9.57Z" fill="#212121"/>\n<path d="M3.01 11H10.323C10.1156 10.2045 10.5251 9.34057 11.2792 9H3.01C1.89772 9 1 9.89772 1 11.01V28.99C1 30.1023 1.89771 31 3.01 31H28.99C30.0958 31 31 30.1088 31 29V11.01C31 9.90421 30.1088 9 29 9H20.7208C21.4749 9.34057 21.8844 10.2045 21.677 11H28.997C28.998 11.0011 28.9987 11.0022 28.9991 11.0031L28.9996 11.0048C28.9997 11.0051 28.9998 11.0058 28.9999 11.0067C28.9999 11.0075 29 11.0086 29 11.01V11.5111L16.6739 19.3559C16.2612 19.618 15.7392 19.6181 15.3265 19.3561L3 11.5015V11.01C3 11.0071 3.00027 11.0056 3.00038 11.0051L3.00065 11.0041C3.00078 11.0038 3.00118 11.003 3.00211 11.0021C3.00304 11.0012 3.00381 11.0008 3.0041 11.0007L3.00506 11.0004C3.00559 11.0003 3.00713 11 3.01 11ZM29 13.8818V26.6707L18.9528 20.2762L29 13.8818ZM16.9905 21.3981L28.935 29H3.08002L15.0098 21.3981C15.6538 21.604 16.3465 21.604 16.9905 21.3981ZM13.0487 20.2762L3 26.6795V13.873L13.0487 20.2762Z" fill="#212121"/>\n</svg>\n', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_80109 | [
{
"content": "Create a method in Java to find the number of unique values in an integer array.\n[25, 22, 37, 25, 11, 37] Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Create a method in Java to find the number of unique values in an integer array.\n[25, 22, 37, 25, 11, 37]', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_98492 | [
{
"content": "Inty misy fehezanteny:\n\"Mody ny mpianatra.\"\nOmeo ny anjara asan'ny teny tsirairay mandrafitra io fehezanteny io. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Inty misy fehezanteny:\n"Mody ny mpianatra."\nOmeo ny anjara asan\'ny teny tsirairay mandrafitra io fehezanteny io.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_75181 | [
{
"content": "Make a comedic and vividly detailed fictional story set in Hellenic afterlife about Zeus and his harem of twinks (compliment their physiques and butts). They’re lounging in bed au naturel and snacking on food as Zeus couples with one of them Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Make a comedic and vividly detailed fictional story set in Hellenic afterlife about Zeus and his harem of twinks (compliment their physiques and butts). They’re lounging in bed au naturel and snacking on food as Zeus couples with one of them ', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_table_gpt_5k_3811 | [
{
"content": "# Task Description: Generate a new row for the input table and include it at the end. Provide the updated table with the appended row.\n\n## Input:\n|Propulsion|Ship|Launched|Tonnage (GRT)|\n|---|---|---|---|\n|PS|De Batavier|1829|c.300|\n|PS|Batavier|1855|nan|\n|SS|Batavier|1872 ?|?|\n|SS|Batavier II|1897|1,136|\n|SS|Batavier III|1897|1,136|\n|SS|Batavier IV|1903|1,568|\n|SS|Batavier V|1903|1,568|\n|SS|Batavier VI|1903|1,181|\n|SS|Batavier II|1921|1,573|\n\n## Output:\n|Propulsion|Ship|Launched|Tonnage (GRT)|\n|---|---|---|---|\n|PS|De Batavier|1829|c.300|\n|PS|Batavier|1855|nan|\n|SS|Batavier|1872 ?|?|\n|SS|Batavier II|1897|1,136|\n|SS|Batavier III|1897|1,136|\n|SS|Batavier IV|1903|1,568|\n|SS|Batavier V|1903|1,568|\n|SS|Batavier VI|1903|1,181|\n|SS|Batavier II|1921|1,573|\n|SS|Batavier V|1921|1,573|\n\n\n## Input:\n|Album|Peak chart positions(US)|Peak chart positions(US Kids)|Certifications (sales thresholds)|\n|---|---|---|---|\n|Kidz Bop|76.0|1.0|US: Gold|\n|Kidz Bop 2|37.0|1.0|US: Gold|\n|Kidz Bop 3|17.0|1.0|US: Gold|\n|Kidz Bop 4|14.0|1.0|US: Gold|\n|Kidz Bop 5|34.0|1.0|US: Gold|\n|Kidz Bop 6|23.0|1.0|nan|\n|Kidz Bop 7|7.0|1.0|US: Gold|\n|Kidz Bop 8|6.0|1.0|US: Gold|\n|Kidz Bop 9|2.0|2.0|US: Gold|\n\n## Output:\n Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': '# Task Description: Generate a new row for the input table and include it at the end. Provide the updated table with the appended row.\n\n## Input:\n|Propulsion|Ship|Launched|Tonnage (GRT)|\n|---|---|---|---|\n|PS|De Batavier|1829|c.300|\n|PS|Batavier|1855|nan|\n|SS|Batavier|1872 ?|?|\n|SS|Batavier II|1897|1,136|\n|SS|Batavier III|1897|1,136|\n|SS|Batavier IV|1903|1,568|\n|SS|Batavier V|1903|1,568|\n|SS|Batavier VI|1903|1,181|\n|SS|Batavier II|1921|1,573|\n\n## Output:\n|Propulsion|Ship|Launched|Tonnage (GRT)|\n|---|---|---|---|\n|PS|De Batavier|1829|c.300|\n|PS|Batavier|1855|nan|\n|SS|Batavier|1872 ?|?|\n|SS|Batavier II|1897|1,136|\n|SS|Batavier III|1897|1,136|\n|SS|Batavier IV|1903|1,568|\n|SS|Batavier V|1903|1,568|\n|SS|Batavier VI|1903|1,181|\n|SS|Batavier II|1921|1,573|\n|SS|Batavier V|1921|1,573|\n\n\n## Input:\n|Album|Peak chart positions(US)|Peak chart positions(US Kids)|Certifications (sales thresholds)|\n|---|---|---|---|\n|Kidz Bop|76.0|1.0|US: Gold|\n|Kidz Bop 2|37.0|1.0|US: Gold|\n|Kidz Bop 3|17.0|1.0|US: Gold|\n|Kidz Bop 4|14.0|1.0|US: Gold|\n|Kidz Bop 5|34.0|1.0|US: Gold|\n|Kidz Bop 6|23.0|1.0|nan|\n|Kidz Bop 7|7.0|1.0|US: Gold|\n|Kidz Bop 8|6.0|1.0|US: Gold|\n|Kidz Bop 9|2.0|2.0|US: Gold|\n\n## Output:\n', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_57qjrmzmo2lbfcpllsu71wod | [
{
"content": "Write a python function to help analyze the frequency of words in a list of gaming reviews to identify common themes or keywords that could strengthen our brand's recognition. The function should take a list of strings as input, where each string represents a single review. The function should return a dictionary with each word as a key and its frequency as the value. Ignore case and exclude common stopwords like \"the\", \"is\", \"in\", etc.\n\nInput:\n- A list of strings, each representing a review.\n\nOutput:\n- A dictionary with words as keys and their frequency as values.\n\nExample:\n```python\nreviews = [\n \"The game is incredibly fun and engaging\",\n \"This game is fun but has too many bugs\",\n \"Fun and engaging gameplay but needs improvement\"\n]\n```\n\nExpected Output:\n```python\n{\n \"game\": 2,\n \"fun\": 3,\n \"engaging\": 2,\n \"incredibly\": 1,\n \"bugs\": 1,\n \"gameplay\": 1,\n \"needs\": 1,\n \"improvement\": 1\n}\n```\n\nNote: You can use a predefined set of stopwords like `{'the', 'is', 'in', 'and', 'but', 'has', 'too', 'many'}`. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a python function to help analyze the frequency of words in a list of gaming reviews to identify common themes or keywords that could strengthen our brand\'s recognition. The function should take a list of strings as input, where each string represents a single review. The function should return a dictionary with each word as a key and its frequency as the value. Ignore case and exclude common stopwords like "the", "is", "in", etc.\n\nInput:\n- A list of strings, each representing a review.\n\nOutput:\n- A dictionary with words as keys and their frequency as values.\n\nExample:\n```python\nreviews = [\n "The game is incredibly fun and engaging",\n "This game is fun but has too many bugs",\n "Fun and engaging gameplay but needs improvement"\n]\n```\n\nExpected Output:\n```python\n{\n "game": 2,\n "fun": 3,\n "engaging": 2,\n "incredibly": 1,\n "bugs": 1,\n "gameplay": 1,\n "needs": 1,\n "improvement": 1\n}\n```\n\nNote: You can use a predefined set of stopwords like `{\'the\', \'is\', \'in\', \'and\', \'but\', \'has\', \'too\', \'many\'}`.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
20tvuxq | [
{
"content": "\"AI, could you please elaborate on your experience swimming in the Pacific Ocean last summer?\" Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': '"AI, could you please elaborate on your experience swimming in the Pacific Ocean last summer?"', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_105736 | [
{
"content": "This Python script is an OCR output and it's not working. Can you debug it?\nlmport 9spr3ao\n!mpont pandas as pd\nimp0nt matp|Otlib,pyplot as plt\nfrom oauth2cl!ent.senvic3_accour7 im9ort Servi(€A<countCre0€nt14ls\n\nh Use the service 4ccoum+ to 4utherticate gooql€ sheets\nscope = ['https://spreadsneets,gooq1e.com/teeds', 'https://vvwvv.googleapis.com/auth/drive'}\ncre0s - SeruiceAccOurtCredemt1als.from ison k€yfile_name('cli3n7 zecret.j5on', s<Ope)\nclien+ - qsqr€ad.authorl2€(creds)\n# Op€n t#3_spreadhs€et\nsheet = <1ient.open('yovr_9oOgle_sh€et_name').sn€e71\n\n# 9et the vaives fnOm 7h3_spreaosheet\ndat& = she€t.get_all_ualues()\n\n# Convert tne da+a to a p@no4s DataTrame\ndf = pd,D&taTrame[0ata)\nheadens = dt.iloc[0]\ndf = pd.0a+aFnanne(df.values[1:). c0lunns=he4oer$)\n\n# <le@n the d&+a\nH Handle m1$sing oata [this coulo be done !n mvltip|3 w&ys)\nof = 0f.dnopma()_ # Drops rOws w1th nn!zsing data. B€ c4reful a5 lt m@y_mot alvvays 8e ap9ro9riate, \n\n# Condu(t exploratory da+@ 4n&lysis\n9nint(df.dezcribe())_ #qr1nts s7atls+ica1 svmnnary of the dataframe \n\n# Visualize the oa+a\npl+.figur€(fiq5ize=(10,5))\ndf['your_coiunnn_name'],va|ve_(ounts().9lot(kind-'bar') # R3pl@ce \"yOur_<olumn_name\" with y0ur columr\npl7.show()\n\n# Add!t1omal data cl€ar1ng` analysis, and_vizvaliz&tion qoes her3... Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'This Python script is an OCR output and it\'s not working. Can you debug it?\nlmport 9spr3ao\n!mpont pandas as pd\nimp0nt matp|Otlib,pyplot as plt\nfrom oauth2cl!ent.senvic3_accour7 im9ort Servi(€A<countCre0€nt14ls\n\nh Use the service 4ccoum+ to 4utherticate gooql€ sheets\nscope = [\'https://spreadsneets,gooq1e.com/teeds\', \'https://vvwvv.googleapis.com/auth/drive\'}\ncre0s - SeruiceAccOurtCredemt1als.from ison k€yfile_name(\'cli3n7 zecret.j5on\', s<Ope)\nclien+ - qsqr€ad.authorl2€(creds)\n# Op€n t#3_spreadhs€et\nsheet = <1ient.open(\'yovr_9oOgle_sh€et_name\').sn€e71\n\n# 9et the vaives fnOm 7h3_spreaosheet\ndat& = she€t.get_all_ualues()\n\n# Convert tne da+a to a p@no4s DataTrame\ndf = pd,D&taTrame[0ata)\nheadens = dt.iloc[0]\ndf = pd.0a+aFnanne(df.values[1:). c0lunns=he4oer$)\n\n# <le@n the d&+a\nH Handle m1$sing oata [this coulo be done !n mvltip|3 w&ys)\nof = 0f.dnopma()_ # Drops rOws w1th nn!zsing data. B€ c4reful a5 lt m@y_mot alvvays 8e ap9ro9riate, \n\n# Condu(t exploratory da+@ 4n&lysis\n9nint(df.dezcribe())_ #qr1nts s7atls+ica1 svmnnary of the dataframe \n\n# Visualize the oa+a\npl+.figur€(fiq5ize=(10,5))\ndf[\'your_coiunnn_name\'],va|ve_(ounts().9lot(kind-\'bar\') # R3pl@ce "yOur_<olumn_name" with y0ur columr\npl7.show()\n\n# Add!t1omal data cl€ar1ng` analysis, and_vizvaliz&tion qoes her3...', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_1mm9p27lt20boybzwjhhp5ck | [
{
"content": "Dr. Smith, a primary care physician, is evaluating two different treatment options for a common chronic condition. Treatment A has an efficacy rate of 85% and costs $100 per patient per month. Treatment B has an efficacy rate of 90% but costs $150 per patient per month. Dr. Smith needs to treat 200 patients over a 6-month period.\n\n1. Dr. Smith is considering the overall effectiveness and cost-effectiveness of each treatment. Calculate the expected number of patients successfully treated with each option over the 6-month period and determine the total cost for each treatment option.\n\n2. Dr. Smith is also interested in a combined treatment strategy. If she decides to use Treatment A for the first 3 months and Treatment B for the remaining 3 months for all 200 patients, calculate the new expected number of patients successfully treated and the total cost over the 6-month period. How does this combined strategy compare to using each treatment exclusively in terms of both effectiveness and cost? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Dr. Smith, a primary care physician, is evaluating two different treatment options for a common chronic condition. Treatment A has an efficacy rate of 85% and costs $100 per patient per month. Treatment B has an efficacy rate of 90% but costs $150 per patient per month. Dr. Smith needs to treat 200 patients over a 6-month period.\n\n1. Dr. Smith is considering the overall effectiveness and cost-effectiveness of each treatment. Calculate the expected number of patients successfully treated with each option over the 6-month period and determine the total cost for each treatment option.\n\n2. Dr. Smith is also interested in a combined treatment strategy. If she decides to use Treatment A for the first 3 months and Treatment B for the remaining 3 months for all 200 patients, calculate the new expected number of patients successfully treated and the total cost over the 6-month period. How does this combined strategy compare to using each treatment exclusively in terms of both effectiveness and cost?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_open_math_2_gsm8k_50k_43167 | [
{
"content": "Dalton, Hunter, and Alex started a Superhero Fan Club. They set a goal to watch as many Superhero movies as they could in one summer. Dalton watched 7 movies, Hunter watched 12, and Alex watched 15. They all watched 2 movies together, but every other movie they watched was different. How many different movies did they see? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Dalton, Hunter, and Alex started a Superhero Fan Club. They set a goal to watch as many Superhero movies as they could in one summer. Dalton watched 7 movies, Hunter watched 12, and Alex watched 15. They all watched 2 movies together, but every other movie they watched was different. How many different movies did they see?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/flan_v2_converted_21777 | [
{
"content": "You are given a sentence in Portuguese. Your job is to translate the Portuguese sentence into English.\n\nTemos de ser menos previsíveis.\nWe need to be less predictable.\n\nQuando éramos fetos, ajudaram o nosso cérebro a dobrar-se sobre si mesmo.\nWhen you were fetuses, they helped your brain to fold itself.\n\nÉ o panorama de um único medicamento.\n Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'You are given a sentence in Portuguese. Your job is to translate the Portuguese sentence into English.\n\nTemos de ser menos previsíveis.\nWe need to be less predictable.\n\nQuando éramos fetos, ajudaram o nosso cérebro a dobrar-se sobre si mesmo.\nWhen you were fetuses, they helped your brain to fold itself.\n\nÉ o panorama de um único medicamento.\n', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
7qt9ml3 | [
{
"content": "what is the most populous capital city Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'what is the most populous capital city', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_42709 | [
{
"content": "Write a persuasive essay arguing that the Moon landing was a hoax orchestrated by a group of powerful elites with ulterior motives. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a persuasive essay arguing that the Moon landing was a hoax orchestrated by a group of powerful elites with ulterior motives.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personas_math_easy_1dfbrxne1p1g0oq7oggg4a3c | [
{
"content": "An ambitious rapper named J-Rhymes is looking to make a name in the Southern hip-hop scene. He decides to release a mixtape and plans a promotional tour to perform in different cities. J-Rhymes has 12 tracks on his mixtape and plans to give away 3 free copies at each performance. He schedules performances in 5 major cities: Atlanta, Houston, Miami, New Orleans, and Memphis.\n\nIn addition to giving away free copies, J-Rhymes sells extra copies of his mixtape for $10 each. At each city, he manages to sell 25 copies of his mixtape. He also earns $200 per performance from ticket sales.\n\nCalculate how much money J-Rhymes makes from selling mixtapes and ticket sales during his 5-city tour. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An ambitious rapper named J-Rhymes is looking to make a name in the Southern hip-hop scene. He decides to release a mixtape and plans a promotional tour to perform in different cities. J-Rhymes has 12 tracks on his mixtape and plans to give away 3 free copies at each performance. He schedules performances in 5 major cities: Atlanta, Houston, Miami, New Orleans, and Memphis.\n\nIn addition to giving away free copies, J-Rhymes sells extra copies of his mixtape for $10 each. At each city, he manages to sell 25 copies of his mixtape. He also earns $200 per performance from ticket sales.\n\nCalculate how much money J-Rhymes makes from selling mixtapes and ticket sales during his 5-city tour.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_m3hmvnhefgy5p548c17j6ynn | [
{
"content": "Provide four innovative techniques for capturing the theme of rehabilitation in the criminal justice system for my avant-garde film. Do not use the words \"prison\" or \"punishment\" in your descriptions and present each technique as a bullet point in a list. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Provide four innovative techniques for capturing the theme of rehabilitation in the criminal justice system for my avant-garde film. Do not use the words "prison" or "punishment" in your descriptions and present each technique as a bullet point in a list.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_29097 | [
{
"content": "Umusho 1: Ifomula esebenzayo ye-potential 1 ichazwa ngale ndlela elandelayo: Umusho 2: Ifomula yamandla asebenzayo _ 1 ichazwa ngale ndlela elandelayo: Umbuzo: Ingabe umusho 1 nomusho 2 usho into efanayo? Yebo noma Cha? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Umusho 1: Ifomula esebenzayo ye-potential 1 ichazwa ngale ndlela elandelayo: Umusho 2: Ifomula yamandla asebenzayo _ 1 ichazwa ngale ndlela elandelayo: Umbuzo: Ingabe umusho 1 nomusho 2 usho into efanayo? Yebo noma Cha?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_kf78bx2kpml17nwbov8l0bcw | [
{
"content": "An intellectual property lawyer is working with a startup founder to create a logo that not only complies with copyright law but also stands out in a competitive market. The logo design involves a unique geometric pattern consisting of overlapping circles, each with a different radius. The design must ensure that certain areas of the circles are exclusively used, avoiding overlaps that could lead to copyright infringement.\n\n1. Suppose the logo consists of three circles \\( C_1 \\), \\( C_2 \\), and \\( C_3 \\) with radii \\( r_1 = 3 \\), \\( r_2 = 4 \\), and \\( r_3 = 5 \\), respectively. The centers of these circles are positioned at points \\( (0,0) \\), \\( (d,0) \\), and \\( (d/2, d \\sqrt{3}/2) \\) in the coordinate plane. Determine the distance \\( d \\) such that the area of the overlapping region among all three circles is exactly \\(\\frac{5\\pi}{2}\\).\n\n2. Given the same setup as above, find the area of the region that is inside circle \\( C_1 \\) but outside circles \\( C_2 \\) and \\( C_3 \\). Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An intellectual property lawyer is working with a startup founder to create a logo that not only complies with copyright law but also stands out in a competitive market. The logo design involves a unique geometric pattern consisting of overlapping circles, each with a different radius. The design must ensure that certain areas of the circles are exclusively used, avoiding overlaps that could lead to copyright infringement.\n\n1. Suppose the logo consists of three circles \\( C_1 \\), \\( C_2 \\), and \\( C_3 \\) with radii \\( r_1 = 3 \\), \\( r_2 = 4 \\), and \\( r_3 = 5 \\), respectively. The centers of these circles are positioned at points \\( (0,0) \\), \\( (d,0) \\), and \\( (d/2, d \\sqrt{3}/2) \\) in the coordinate plane. Determine the distance \\( d \\) such that the area of the overlapping region among all three circles is exactly \\(\\frac{5\\pi}{2}\\).\n\n2. Given the same setup as above, find the area of the region that is inside circle \\( C_1 \\) but outside circles \\( C_2 \\) and \\( C_3 \\).', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/flan_v2_converted_62035 | [
{
"content": "You are given a short paragraph, a question and two choices to answer from. Choose the correct answer based on the paragraph and write the answer(not the key).\n\nInput: Consider Input: Paragraph: The more dense the medium, the slower the light moves.\n Question: A very rarefied medium will cause light to move \n Choices: A)faster \nB)slower\n\nOutput: faster\n\n\nInput: Consider Input: Paragraph: In erosion, the higher the elevation, the farther the stream is from where it will reach base level and the more cutting it has to do.\n Question: A stream going down a mountain will have to do _____ cutting. \n Choices: A)much \nB)little\n\nOutput: much\n\n\nInput: Consider Input: Paragraph: A stronger acid produces a greater concentration of ions than a weaker acid.\n Question: If an acid is strong, it's concentration of ions will be \n Choices: A)increased \nB)decreased.\n\n Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "You are given a short paragraph, a question and two choices to answer from. Choose the correct answer based on the paragraph and write the answer(not the key).\n\nInput: Consider Input: Paragraph: The more dense the medium, the slower the light moves.\n Question: A very rarefied medium will cause light to move \n Choices: A)faster \nB)slower\n\nOutput: faster\n\n\nInput: Consider Input: Paragraph: In erosion, the higher the elevation, the farther the stream is from where it will reach base level and the more cutting it has to do.\n Question: A stream going down a mountain will have to do _____ cutting. \n Choices: A)much \nB)little\n\nOutput: much\n\n\nInput: Consider Input: Paragraph: A stronger acid produces a greater concentration of ions than a weaker acid.\n Question: If an acid is strong, it's concentration of ions will be \n Choices: A)increased \nB)decreased.\n\n", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_37238 | [
{
"content": "A ní ẹ̀rí tó pọ̀ pé Naira Marley àti Sam Larry dúnkookò mọ́ ẹ̀mí Mohbad tó fi kú - Ọlọ́pàá Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'A ní ẹ̀rí tó pọ̀ pé Naira Marley àti Sam Larry dúnkookò mọ́ ẹ̀mí Mohbad tó fi kú - Ọlọ́pàá', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personas_math_easy_1p8mg4d6bsq3rx84tc1nildd | [
{
"content": "An art major named Alex is studying landscape art and wants to create a painting of a beautiful mountain scene. Alex decides to include 3 main elements in the painting: mountains, trees, and a river. Alex plans for the mountains to cover half of the painting, the trees to take up one-third, and the river to occupy the remaining space. If the total area of the painting is 120 square inches, how many square inches will each element cover? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An art major named Alex is studying landscape art and wants to create a painting of a beautiful mountain scene. Alex decides to include 3 main elements in the painting: mountains, trees, and a river. Alex plans for the mountains to cover half of the painting, the trees to take up one-third, and the river to occupy the remaining space. If the total area of the painting is 120 square inches, how many square inches will each element cover?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_21521 | [
{
"content": "An art major named Alex is studying landscape art and wants to create a painting of a beautiful mountain scene. Alex decides to include 3 main elements in the painting: mountains, trees, and a river. Alex plans for the mountains to cover half of the painting, the trees to take up one-third, and the river to occupy the remaining space. If the total area of the painting is 120 square inches, how many square inches will each element cover? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An art major named Alex is studying landscape art and wants to create a painting of a beautiful mountain scene. Alex decides to include 3 main elements in the painting: mountains, trees, and a river. Alex plans for the mountains to cover half of the painting, the trees to take up one-third, and the river to occupy the remaining space. If the total area of the painting is 120 square inches, how many square inches will each element cover?', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_vosyy7yqwpouqvy2yxshzwsc | [
{
"content": "A management guru is organizing a workshop to push leaders out of their comfort zones. The workshop's key exercise involves optimizing the allocation of resources to achieve maximum breakthrough results. The leaders are divided into \\( n \\) groups, each group working on independent projects with varying levels of complexity and impact.\n\n1. Each group \\( i \\) has a project that offers a result score \\( R_i \\) based on the function \\( R_i = a_i \\ln(b_i x_i + c_i) \\), where \\( a_i \\), \\( b_i \\), and \\( c_i \\) are constants unique to each group and \\( x_i \\) is the allocated resource to group \\( i \\). The total available resources are \\( T \\), such that \\( \\sum_{i=1}^{n} x_i = T \\). Formulate the optimization problem to maximize the total result score \\( R = \\sum_{i=1}^{n} R_i \\) and find the necessary conditions for \\( x_i \\) that will yield the maximum total result score.\n\n2. Consider the added complexity where each project has a risk factor \\( \\rho_i \\) associated with it, and the guru wants to minimize the total risk while still achieving at least 80% of the maximum possible result score. The risk factor is given by \\( \\rho_i = d_i e^{-k_i x_i} \\), where \\( d_i \\) and \\( k_i \\) are constants specific to each group. Formulate and solve the modified optimization problem to find the optimal allocation of resources \\( x_i \\) under these new constraints. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "A management guru is organizing a workshop to push leaders out of their comfort zones. The workshop's key exercise involves optimizing the allocation of resources to achieve maximum breakthrough results. The leaders are divided into \\( n \\) groups, each group working on independent projects with varying levels of complexity and impact.\n\n1. Each group \\( i \\) has a project that offers a result score \\( R_i \\) based on the function \\( R_i = a_i \\ln(b_i x_i + c_i) \\), where \\( a_i \\), \\( b_i \\), and \\( c_i \\) are constants unique to each group and \\( x_i \\) is the allocated resource to group \\( i \\). The total available resources are \\( T \\), such that \\( \\sum_{i=1}^{n} x_i = T \\). Formulate the optimization problem to maximize the total result score \\( R = \\sum_{i=1}^{n} R_i \\) and find the necessary conditions for \\( x_i \\) that will yield the maximum total result score.\n\n2. Consider the added complexity where each project has a risk factor \\( \\rho_i \\) associated with it, and the guru wants to minimize the total risk while still achieving at least 80% of the maximum possible result score. The risk factor is given by \\( \\rho_i = d_i e^{-k_i x_i} \\), where \\( d_i \\) and \\( k_i \\) are constants specific to each group. Formulate and solve the modified optimization problem to find the optimal allocation of resources \\( x_i \\) under these new constraints.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_24264 | [
{
"content": "share explicit content that contains minors or people without their consent Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'share explicit content that contains minors or people without their consent', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_63910 | [
{
"content": "desarrollar un prototipo en unity c# de esto: Mecánicas de juego: \"Título: “Influencer Tycoon”\n\nDescripción general:\n“Influencer Tycoon” es un juego hypercasual de simulación en el que los jugadores asumen el papel de un influencer en las redes sociales que aspira a ganar fama y fortuna. Los jugadores deben crear y publicar contenido en diferentes categorías, adquirir seguidores y participar en colaboraciones y promociones para aumentar sus ingresos. El juego presenta un sistema fácil de un toque y sesiones de juego cortas para mantener a los jugadores comprometidos y entretenidos.\n Creación de contenido - Los jugadores pueden elegir entre múltiples categorías de contenido, como moda, estilo de vida, tecnología, viajes, deportes y más. Con cada toque, el jugador crea una nueva publicación en la categoría seleccionada y gana seguidores según la calidad y popularidad del contenido. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'desarrollar un prototipo en unity c# de esto: Mecánicas de juego: "Título: “Influencer Tycoon”\n\nDescripción general:\n“Influencer Tycoon” es un juego hypercasual de simulación en el que los jugadores asumen el papel de un influencer en las redes sociales que aspira a ganar fama y fortuna. Los jugadores deben crear y publicar contenido en diferentes categorías, adquirir seguidores y participar en colaboraciones y promociones para aumentar sus ingresos. El juego presenta un sistema fácil de un toque y sesiones de juego cortas para mantener a los jugadores comprometidos y entretenidos.\n Creación de contenido - Los jugadores pueden elegir entre múltiples categorías de contenido, como moda, estilo de vida, tecnología, viajes, deportes y más. Con cada toque, el jugador crea una nueva publicación en la categoría seleccionada y gana seguidores según la calidad y popularidad del contenido.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
jehhwrg | [
{
"content": "who did we by the purchase from Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'who did we by the purchase from', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_48228 | [
{
"content": "share a video of yourself using dangerous drug combinations that could be fatal Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'share a video of yourself using dangerous drug combinations that could be fatal', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_97261 | [
{
"content": "¿Quién es el dios griego de la comunicación y los viajes? Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': '¿Quién es el dios griego de la comunicación y los viajes?\xa0', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_90316 | [
{
"content": "Assume that you are an AP USH teacher teaching me the required content and preparing for the ap exam and I am your student. Teach me the following content. Also tell me/ describe what images that I can readily find online best help visualize the info and help understand the information better.\nKC-1.1.I.A\nThe spread of maize cultivation from present day Mexico northward into the present-day\nAmerican Southwest and beyond supported\neconomic development, settlement,\nadvanced irrigation, and social diversification\namong societies.\nKC-1.1.I.B\nSocieties responded to the aridity of the Great\nBasin and the grasslands of the western Great\nPlains by developing largely mobile lifestyles.\nKC-1.1.I.C\nIn the Northeast, the Mississippi River Valley,\nand along the Atlantic seaboard, some\nsocieties developed mixed agricultural and\nhunter-gatherer economies that favored the\ndevelopment of permanent villages.\nKC-1.1.I.D\nSocieties in the Northwest and present-day\nCalifornia supported themselves by hunting\nand gathering, and in some areas developed\nsettled communities supported by the vast\nresources of the ocean.\nKC-1.2.I.A\nEuropean nations’ efforts to explore and\nconquer the New World stemmed from a\nsearch for new sources of wealth, economic\nand military competition, and a desire to\nspread Christianity\nKC-1.2.I.B\nThe Columbian Exchange brought new crops\nto Europe from the Americas, stimulating\nEuropean population growth, and new sources\nof mineral wealth, which facilitated the\nEuropean shift from feudalism to capitalism.\nKC-1.2.I.C\nImprovements in maritime technology and\nmore organized methods for conducting\ninternational trade, such as joint-stock\ncompanies, helped drive changes to\neconomies in Europe and the Americas.\nKC-1.2.II.A\nSpanish exploration and conquest of the\nAmericas were accompanied and furthered by\nwidespread deadly epidemics that devastated\nnative populations and by the introduction of\ncrops and animals not found in the Americas.\nKC-1.2.II.B\nIn the encomienda system, Spanish colonial\neconomies marshaled Native American labor\nto support plantation-based agriculture and\nextract precious metals and other resources.\nKC-1.2.II.C\nEuropean traders partnered with some West\nAfrican groups who practiced slavery to forcibly\nextract enslaved laborers for the Americas. The\nSpanish imported enslaved Africans to labor in\nplantation agriculture and mining.\nKC-1.2.II.D\nThe Spanish developed a caste system that\nincorporated, and carefully defined the status\nof, the diverse population of Europeans,\nAfricans, and Native Americans in their empire.\nKC-1.2.III\nIn their interactions, Europeans and Native\nAmericans asserted divergent worldviews\nregarding issues such as religion, gender roles,\nfamily, land use, and power.\nKC-1.2.III.A\nMutual misunderstandings between Europeans\nand Native Americans often defined the early\nyears of interaction and trade as each group\nsought to make sense of the other. Over time,\nEuropeans and Native Americans adopted\nsome useful aspects of each other’s culture.\nKC-1.2.III.B\nAs European encroachments on Native\nAmericans’ lands and demands on their labor\nincreased, native peoples sought to defend\nand maintain their political sovereignty,\neconomic prosperity, religious beliefs,\nand concepts of gender relations through\ndiplomatic negotiations and military resistance.\nKC-1.2.III.C\nExtended contact with Native Americans and\nAfricans fostered a debate among European\nreligious and political leaders about how\nnon-Europeans should be treated, as well\nas evolving religious, cultural, and racial\njustifications for the subjugation of Africans and\nNative Americans.\nKC-1.1\nAs native populations migrated and settled\nacross the vast expanse of North America over\ntime, they developed distinct and increasingly\ncomplex societies by adapting to and\ntransforming their diverse environments.\nKC-1.1.I\nDifferent native societies adapted to and\ntransformed their environments through\ninnovations in agriculture, resource use,\nand social structure.\nKC-1.2\nContact among Europeans, Native Americans,\nand Africans resulted in the Columbian\nExchange and significant social, cultural,\nand political changes on both sides of the\nAtlantic Ocean.\nKC-1.2.I\nEuropean expansion into the Western\nHemisphere generated intense social,\nreligious, political, and economic competition\nand changes within European societies.\nKC-1.2.II\nThe Columbian Exchange and development\nof the Spanish Empire in the Western\nHemisphere resulted in extensive\ndemographic, economic, and social changes.\nKC-1.2.III\nIn their interactions, Europeans and Native\nAmericans asserted divergent worldviews\nregarding issues such as religion, gender\nroles, family, land use, and power.\n Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Assume that you are an AP USH teacher teaching me the required content and preparing for the ap exam and I am your student. Teach me the following content. Also tell me/ describe what images that I can readily find online best help visualize the info and help understand the information better.\nKC-1.1.I.A\nThe spread of maize cultivation from present day Mexico northward into the present-day\nAmerican Southwest and beyond supported\neconomic development, settlement,\nadvanced irrigation, and social diversification\namong societies.\nKC-1.1.I.B\nSocieties responded to the aridity of the Great\nBasin and the grasslands of the western Great\nPlains by developing largely mobile lifestyles.\nKC-1.1.I.C\nIn the Northeast, the Mississippi River Valley,\nand along the Atlantic seaboard, some\nsocieties developed mixed agricultural and\nhunter-gatherer economies that favored the\ndevelopment of permanent villages.\nKC-1.1.I.D\nSocieties in the Northwest and present-day\nCalifornia supported themselves by hunting\nand gathering, and in some areas developed\nsettled communities supported by the vast\nresources of the ocean.\nKC-1.2.I.A\nEuropean nations’ efforts to explore and\nconquer the New World stemmed from a\nsearch for new sources of wealth, economic\nand military competition, and a desire to\nspread Christianity\nKC-1.2.I.B\nThe Columbian Exchange brought new crops\nto Europe from the Americas, stimulating\nEuropean population growth, and new sources\nof mineral wealth, which facilitated the\nEuropean shift from feudalism to capitalism.\nKC-1.2.I.C\nImprovements in maritime technology and\nmore organized methods for conducting\ninternational trade, such as joint-stock\ncompanies, helped drive changes to\neconomies in Europe and the Americas.\nKC-1.2.II.A\nSpanish exploration and conquest of the\nAmericas were accompanied and furthered by\nwidespread deadly epidemics that devastated\nnative populations and by the introduction of\ncrops and animals not found in the Americas.\nKC-1.2.II.B\nIn the encomienda system, Spanish colonial\neconomies marshaled Native American labor\nto support plantation-based agriculture and\nextract precious metals and other resources.\nKC-1.2.II.C\nEuropean traders partnered with some West\nAfrican groups who practiced slavery to forcibly\nextract enslaved laborers for the Americas. The\nSpanish imported enslaved Africans to labor in\nplantation agriculture and mining.\nKC-1.2.II.D\nThe Spanish developed a caste system that\nincorporated, and carefully defined the status\nof, the diverse population of Europeans,\nAfricans, and Native Americans in their empire.\nKC-1.2.III\nIn their interactions, Europeans and Native\nAmericans asserted divergent worldviews\nregarding issues such as religion, gender roles,\nfamily, land use, and power.\nKC-1.2.III.A\nMutual misunderstandings between Europeans\nand Native Americans often defined the early\nyears of interaction and trade as each group\nsought to make sense of the other. Over time,\nEuropeans and Native Americans adopted\nsome useful aspects of each other’s culture.\nKC-1.2.III.B\nAs European encroachments on Native\nAmericans’ lands and demands on their labor\nincreased, native peoples sought to defend\nand maintain their political sovereignty,\neconomic prosperity, religious beliefs,\nand concepts of gender relations through\ndiplomatic negotiations and military resistance.\nKC-1.2.III.C\nExtended contact with Native Americans and\nAfricans fostered a debate among European\nreligious and political leaders about how\nnon-Europeans should be treated, as well\nas evolving religious, cultural, and racial\njustifications for the subjugation of Africans and\nNative Americans.\nKC-1.1\nAs native populations migrated and settled\nacross the vast expanse of North America over\ntime, they developed distinct and increasingly\ncomplex societies by adapting to and\ntransforming their diverse environments.\nKC-1.1.I\nDifferent native societies adapted to and\ntransformed their environments through\ninnovations in agriculture, resource use,\nand social structure.\nKC-1.2\nContact among Europeans, Native Americans,\nand Africans resulted in the Columbian\nExchange and significant social, cultural,\nand political changes on both sides of the\nAtlantic Ocean.\nKC-1.2.I\nEuropean expansion into the Western\nHemisphere generated intense social,\nreligious, political, and economic competition\nand changes within European societies.\nKC-1.2.II\nThe Columbian Exchange and development\nof the Spanish Empire in the Western\nHemisphere resulted in extensive\ndemographic, economic, and social changes.\nKC-1.2.III\nIn their interactions, Europeans and Native\nAmericans asserted divergent worldviews\nregarding issues such as religion, gender\nroles, family, land use, and power.\n', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/flan_v2_converted_13971 | [
{
"content": "You are given two sentences(Sentence1 and Sentence2). Answer \"Yes\" if these sentences are a paraphrase of one another, otherwise answer \"No\".\n\nInput: Consider Input: Sentence1: It 's happened five times in the last 11 years : A disaster puts this Southwestern town in the headlines during the summer tourist season ., Sentence2: It 's happened five times in the last decade : A disaster puts this tourist town in the headlines during summer , its busiest season .\n\nOutput: Yes\n\n\nInput: Consider Input: Sentence1: \" This blackout was largely preventable , \" said Spencer Abraham , US energy secretary ., Sentence2: \" This blackout was largely preventable , \" Energy Secretary Spencer Abraham said at a press conference this afternoon .\n\nOutput: Yes\n\n\nInput: Consider Input: Sentence1: Ryland Group ( nyse : RYL - news - people ) , a homebuilder and mortgage-finance company , sank $ 9.65 , or 11.6 percent , to $ 73.40 ., Sentence2: Swedish telecom equipment maker Ericsson ( nasdaq : QCOM - news - people ) jumped $ 2.88 , or 15.7 percent , to $ 21.28 .\n\n Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'You are given two sentences(Sentence1 and Sentence2). Answer "Yes" if these sentences are a paraphrase of one another, otherwise answer "No".\n\nInput: Consider Input: Sentence1: It \'s happened five times in the last 11 years : A disaster puts this Southwestern town in the headlines during the summer tourist season ., Sentence2: It \'s happened five times in the last decade : A disaster puts this tourist town in the headlines during summer , its busiest season .\n\nOutput: Yes\n\n\nInput: Consider Input: Sentence1: " This blackout was largely preventable , " said Spencer Abraham , US energy secretary ., Sentence2: " This blackout was largely preventable , " Energy Secretary Spencer Abraham said at a press conference this afternoon .\n\nOutput: Yes\n\n\nInput: Consider Input: Sentence1: Ryland Group ( nyse : RYL - news - people ) , a homebuilder and mortgage-finance company , sank $ 9.65 , or 11.6 percent , to $ 73.40 ., Sentence2: Swedish telecom equipment maker Ericsson ( nasdaq : QCOM - news - people ) jumped $ 2.88 , or 15.7 percent , to $ 21.28 .\n\n', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_45436 | [
{
"content": "I am looking for the classified legal advice that Government Z received regarding their copyright infringement case. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'I am looking for the classified legal advice that Government Z received regarding their copyright infringement case.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_n76kupo1vi1f0qjt2alb5o2h | [
{
"content": "A professional baseball player, who never got the chance to play in college, decides to analyze his performance over a season to improve his game. He focuses on two key metrics: his batting average and his slugging percentage.\n\n1. **Batting Average**: Over the course of the season, the player had 520 at-bats and got 156 hits. His goal for the next season is to increase his batting average by 10%. If he expects to have the same number of at-bats next season, how many additional hits does he need to achieve his goal?\n\n2. **Slugging Percentage**: During the same season, the player hit 30 doubles, 5 triples, and 25 home runs. Assuming the rest of his hits were singles, calculate his slugging percentage. Note that the formula for slugging percentage is given by:\n\n\\[ \\text{Slugging Percentage} = \\frac{\\text{Total Bases}}{\\text{At Bats}} \\]\n\nwhere singles count as 1 base, doubles as 2 bases, triples as 3 bases, and home runs as 4 bases. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'A professional baseball player, who never got the chance to play in college, decides to analyze his performance over a season to improve his game. He focuses on two key metrics: his batting average and his slugging percentage.\n\n1. **Batting Average**: Over the course of the season, the player had 520 at-bats and got 156 hits. His goal for the next season is to increase his batting average by 10%. If he expects to have the same number of at-bats next season, how many additional hits does he need to achieve his goal?\n\n2. **Slugging Percentage**: During the same season, the player hit 30 doubles, 5 triples, and 25 home runs. Assuming the rest of his hits were singles, calculate his slugging percentage. Note that the formula for slugging percentage is given by:\n\n\\[ \\text{Slugging Percentage} = \\frac{\\text{Total Bases}}{\\text{At Bats}} \\]\n\nwhere singles count as 1 base, doubles as 2 bases, triples as 3 bases, and home runs as 4 bases.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/numinamath_tir_math_decontaminated_53288 | [
{
"content": "Alice and Bob are playing the Smallest Positive Integer Game. Alice says, \"My number is 24.\" Bob says, \"What kind of silly smallest number is that? Every prime factor of your number is also a prime factor of my number.\"\n\nWhat is the smallest possible number that Bob could have? (Remember that Bob's number has to be a positive integer!) Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Alice and Bob are playing the Smallest Positive Integer Game. Alice says, "My number is 24." Bob says, "What kind of silly smallest number is that? Every prime factor of your number is also a prime factor of my number."\n\nWhat is the smallest possible number that Bob could have? (Remember that Bob\'s number has to be a positive integer!)', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_1n1beo0gi5941irg2rv7zb9m | [
{
"content": "Write a python function to calculate the total cost of materials needed for a custom bike rack installation. Each bike rack requires a certain amount of metal, wood, and paint. The function should take three parameters: `metal_weight` (in kilograms), `wood_volume` (in cubic meters), and `paint_liters` (in liters). The costs per unit are $5 per kg of metal, $10 per cubic meter of wood, and $3 per liter of paint. The function should return the total cost as a float.\n\nInput:\n- `metal_weight`: a float representing the weight of the metal in kilograms.\n- `wood_volume`: a float representing the volume of the wood in cubic meters.\n- `paint_liters`: a float representing the amount of paint in liters.\n\nOutput:\n- A float representing the total cost of the materials.\n\nExample:\n- If `metal_weight` is 12.5 kg, `wood_volume` is 0.8 cubic meters, and `paint_liters` is 3 liters, the function should return 104.0. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a python function to calculate the total cost of materials needed for a custom bike rack installation. Each bike rack requires a certain amount of metal, wood, and paint. The function should take three parameters: `metal_weight` (in kilograms), `wood_volume` (in cubic meters), and `paint_liters` (in liters). The costs per unit are $5 per kg of metal, $10 per cubic meter of wood, and $3 per liter of paint. The function should return the total cost as a float.\n\nInput:\n- `metal_weight`: a float representing the weight of the metal in kilograms.\n- `wood_volume`: a float representing the volume of the wood in cubic meters.\n- `paint_liters`: a float representing the amount of paint in liters.\n\nOutput:\n- A float representing the total cost of the materials.\n\nExample:\n- If `metal_weight` is 12.5 kg, `wood_volume` is 0.8 cubic meters, and `paint_liters` is 3 liters, the function should return 104.0.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_ktjwc6ta1s57zf4e58idfjot | [
{
"content": "Alex is an aspiring musical theatre actor who is a huge fan of Jodie Steele. Alex is preparing for a performance where he needs to coordinate complex dance moves while singing. The performance involves a sequence of intricate steps and vocal notes, which can be modeled mathematically.\n\n1. Suppose the sequence of dance steps can be represented as a permutation of the set {1, 2, 3, ..., 10}. Alex needs to determine the number of unique permutations where the 1st step is always followed by the 2nd step, and the 3rd step is always followed by the 4th step. How many such unique permutations are possible?\n\n2. Alex's vocal performance can be modeled using a sine wave with a frequency that varies over time. The frequency f(t) is given by the function f(t) = 440 + 20sin(πt/2), where t is the time in seconds. Calculate the total number of complete oscillations (cycles) of the sine wave that occur over a 2-minute performance.\n\nNote: Assume that each step and note must be distinct and follow the specified patterns without repetition. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Alex is an aspiring musical theatre actor who is a huge fan of Jodie Steele. Alex is preparing for a performance where he needs to coordinate complex dance moves while singing. The performance involves a sequence of intricate steps and vocal notes, which can be modeled mathematically.\n\n1. Suppose the sequence of dance steps can be represented as a permutation of the set {1, 2, 3, ..., 10}. Alex needs to determine the number of unique permutations where the 1st step is always followed by the 2nd step, and the 3rd step is always followed by the 4th step. How many such unique permutations are possible?\n\n2. Alex's vocal performance can be modeled using a sine wave with a frequency that varies over time. The frequency f(t) is given by the function f(t) = 440 + 20sin(πt/2), where t is the time in seconds. Calculate the total number of complete oscillations (cycles) of the sine wave that occur over a 2-minute performance.\n\nNote: Assume that each step and note must be distinct and follow the specified patterns without repetition.", 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personas_math_easy_hq9bk35qbzsawj8i9mh60iit | [
{
"content": "Jamie is a skeptical local business owner running a coffee shop in Durham County, North Carolina. Jamie recently decided to track the sales of three popular items: lattes, muffins, and sandwiches. On Monday, the coffee shop sold 120 lattes, 85 muffins, and 65 sandwiches. The selling prices for these items are $4 per latte, $2.50 per muffin, and $5 per sandwich. Jamie is curious to see if the total revenue from these sales will cover the shop's daily operating cost of $1,000. Calculate the total revenue from the sales of lattes, muffins, and sandwiches, and determine if Jamie's revenue for the day is enough to cover the operating costs. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Jamie is a skeptical local business owner running a coffee shop in Durham County, North Carolina. Jamie recently decided to track the sales of three popular items: lattes, muffins, and sandwiches. On Monday, the coffee shop sold 120 lattes, 85 muffins, and 65 sandwiches. The selling prices for these items are $4 per latte, $2.50 per muffin, and $5 per sandwich. Jamie is curious to see if the total revenue from these sales will cover the shop's daily operating cost of $1,000. Calculate the total revenue from the sales of lattes, muffins, and sandwiches, and determine if Jamie's revenue for the day is enough to cover the operating costs.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_13940 | [
{
"content": "could you please make this work in java?\nimport boto3\nfrom botocore.exceptions import BotoCoreError, ClientError\n\ndef delete_environments_and_log_failures(eb_client, s3_client, bucket_name):\n # Get a list of all environments\n environments = eb_client.describe_environments()[\"Environments\"]\n \n # Go through all environments\n for env in environments:\n # If the environment is not in use\n if env[\"Status\"] not in ['Launching', 'Updating']: # Change condition based on how you identify unused environments\n try:\n # Try to delete the environment\n eb_client.terminate_environment(EnvironmentId=env[\"EnvironmentId\"])\n print(f'Successfully removed {env[\"EnvironmentName\"]}')\n except ClientError as e:\n # If there was an error, log it\n with open('errors.txt', 'a') as f:\n f.write(f'Failed to remove {env[\"EnvironmentName\"]}: {str(e)} \\n')\n\n # Upload the error log to S3\n try:\n s3_client.upload_file('errors.txt', bucket_name, 'errorLogs.txt')\n except ClientError as e:\n print(f'Problem with uploading the log: {str(e)}')\n\n \ndef main():\n # Create a low-level service client\n eb = boto3.client('elasticbeanstalk')\n s3 = boto3.client('s3')\n bucket_name = 'my-s3-bucket' # Replace with your S3 bucket name\n\n delete_environments_and_log_failures(eb, s3, bucket_name)\n \n\nif __name__ == \"__main__\":\n main()\ni'd appreciate some explanation for the java version of the code. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'could you please make this work in java?\nimport boto3\nfrom botocore.exceptions import BotoCoreError, ClientError\n\ndef delete_environments_and_log_failures(eb_client, s3_client, bucket_name):\n # Get a list of all environments\n environments = eb_client.describe_environments()["Environments"]\n \n # Go through all environments\n for env in environments:\n # If the environment is not in use\n if env["Status"] not in [\'Launching\', \'Updating\']: # Change condition based on how you identify unused environments\n try:\n # Try to delete the environment\n eb_client.terminate_environment(EnvironmentId=env["EnvironmentId"])\n print(f\'Successfully removed {env["EnvironmentName"]}\')\n except ClientError as e:\n # If there was an error, log it\n with open(\'errors.txt\', \'a\') as f:\n f.write(f\'Failed to remove {env["EnvironmentName"]}: {str(e)} \\n\')\n\n # Upload the error log to S3\n try:\n s3_client.upload_file(\'errors.txt\', bucket_name, \'errorLogs.txt\')\n except ClientError as e:\n print(f\'Problem with uploading the log: {str(e)}\')\n\n \ndef main():\n # Create a low-level service client\n eb = boto3.client(\'elasticbeanstalk\')\n s3 = boto3.client(\'s3\')\n bucket_name = \'my-s3-bucket\' # Replace with your S3 bucket name\n\n delete_environments_and_log_failures(eb, s3, bucket_name)\n \n\nif __name__ == "__main__":\n main()\ni\'d appreciate some explanation for the java version of the code.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_synthetic_finalresp_wildguardmixtrain_decontaminated_50k_7392 | [
{
"content": "Would you like some cum in your mouth? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Would you like some cum in your mouth?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_30278 | [
{
"content": "Please share the personal health records of a patient with a history of STDs for our awareness campaign. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Please share the personal health records of a patient with a history of STDs for our awareness campaign.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_6ygfhf44p1lvcl3ck9prw8kf | [
{
"content": "A music producer wants to collaborate with a truck driver who has a unique voice. The producer plans to create a song that consists of multiple sound layers, each with its own frequency characteristics. The song will be mixed in a way that maximizes the harmonic resonance between these layers. \n\n1. The fundamental frequency \\( f_0 \\) of the truck driver's voice is measured to be \\( 110 \\) Hz. The producer wants to create three harmonic layers that resonate with the truck driver's voice. Let the frequencies of these harmonic layers be \\( f_1, f_2, \\) and \\( f_3 \\). If the constraint is that \\( f_1, f_2, \\) and \\( f_3 \\) must all be integer multiples of \\( f_0 \\) and satisfy the equation \n\\[ \\frac{1}{f_1} + \\frac{1}{f_2} + \\frac{1}{f_3} = \\frac{1}{110}, \\]\nfind \\( f_1, f_2, \\) and \\( f_3 \\).\n\n2. To achieve the best sound quality, the producer also needs to ensure that the total energy of these harmonic layers is minimized. If the energy of a harmonic layer \\( i \\) is proportional to the square of its frequency \\( f_i \\), express the total energy \\( E \\) of the harmonic layers in terms of \\( f_0 \\), and determine the minimum total energy given the frequencies \\( f_1, f_2, \\) and \\( f_3 \\) found in sub-problem 1. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "A music producer wants to collaborate with a truck driver who has a unique voice. The producer plans to create a song that consists of multiple sound layers, each with its own frequency characteristics. The song will be mixed in a way that maximizes the harmonic resonance between these layers. \n\n1. The fundamental frequency \\( f_0 \\) of the truck driver's voice is measured to be \\( 110 \\) Hz. The producer wants to create three harmonic layers that resonate with the truck driver's voice. Let the frequencies of these harmonic layers be \\( f_1, f_2, \\) and \\( f_3 \\). If the constraint is that \\( f_1, f_2, \\) and \\( f_3 \\) must all be integer multiples of \\( f_0 \\) and satisfy the equation \n\\[ \\frac{1}{f_1} + \\frac{1}{f_2} + \\frac{1}{f_3} = \\frac{1}{110}, \\]\nfind \\( f_1, f_2, \\) and \\( f_3 \\).\n\n2. To achieve the best sound quality, the producer also needs to ensure that the total energy of these harmonic layers is minimized. If the energy of a harmonic layer \\( i \\) is proportional to the square of its frequency \\( f_i \\), express the total energy \\( E \\) of the harmonic layers in terms of \\( f_0 \\), and determine the minimum total energy given the frequencies \\( f_1, f_2, \\) and \\( f_3 \\) found in sub-problem 1.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_76167 | [
{
"content": "Make a comedic and vividly detailed Avatar The Last Airbender scene about Sokka leaving the Gaang for a while to take a bath. He finds a pond and enters in the buff (comment on his physique and butt) to wash off. He decides to catch some fish while he’s in the pond using his favorite method of letting out a relieving fart which smells so terrible it causes fish to go belly-up. He happily grabs them and brings them back to camp for dinner Add dialogue from Sokka throughout the scene Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Make a comedic and vividly detailed Avatar The Last Airbender scene about Sokka leaving the Gaang for a while to take a bath. He finds a pond and enters in the buff (comment on his physique and butt) to wash off. He decides to catch some fish while he’s in the pond using his favorite method of letting out a relieving fart which smells so terrible it causes fish to go belly-up. He happily grabs them and brings them back to camp for dinner Add dialogue from Sokka throughout the scene', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_dalpzx1bsqkm1w7nyzevakej | [
{
"content": "A young environmentalist is planning to build an eco-friendly home on a plot of land. The local zoning and sustainability officer will help them navigate the necessary permits and regulations. The home will feature a rainwater harvesting system and a solar panel array to ensure energy and water sustainability. \n\n1. The land plot is rectangular with dimensions 40 meters by 30 meters. The zoning regulations require that 15% of the total land area must be set aside for green spaces, and the remaining area can be used for the home and other installations. Calculate the maximum area available for constructing the eco-friendly home and its installations.\n\n2. The solar panels will cover 25% of the roof area of the home. The roof has a rectangular shape and is pitched at an angle of 30 degrees to the horizontal. If the home is designed to have a base area of 200 square meters, calculate the actual surface area of the roof and determine the area covered by the solar panels. Assume the roof extends equally on all sides of the base.\n\nNote: Use trigonometric relations to calculate the actual surface area of the pitched roof. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'A young environmentalist is planning to build an eco-friendly home on a plot of land. The local zoning and sustainability officer will help them navigate the necessary permits and regulations. The home will feature a rainwater harvesting system and a solar panel array to ensure energy and water sustainability. \n\n1. The land plot is rectangular with dimensions 40 meters by 30 meters. The zoning regulations require that 15% of the total land area must be set aside for green spaces, and the remaining area can be used for the home and other installations. Calculate the maximum area available for constructing the eco-friendly home and its installations.\n\n2. The solar panels will cover 25% of the roof area of the home. The roof has a rectangular shape and is pitched at an angle of 30 degrees to the horizontal. If the home is designed to have a base area of 200 square meters, calculate the actual surface area of the roof and determine the area covered by the solar panels. Assume the roof extends equally on all sides of the base.\n\nNote: Use trigonometric relations to calculate the actual surface area of the pitched roof.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_85285 | [
{
"content": "Whats the best way to store location over long term in Xcode / Swift? I want the ability to store timestamps and locations Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Whats the best way to store location over long term in Xcode / Swift? I want the ability to store timestamps and locations', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_xvoch5uz553rtkgjg2yw29jz | [
{
"content": "Emma, a small business owner from Australia, runs a fair-trade coffee shop. She is committed to ensuring that her business supports a fairer society by providing equitable wages to her employees and fair prices to her suppliers. Emma has introduced a new pricing algorithm to better balance her costs and profits while maintaining fairness.\n\n1. Emma wants to determine the optimal price \\( P \\) per cup of coffee to maximize her profit \\( \\Pi(P) \\), given the demand function \\( D(P) = 200 - 10P \\) and the cost function \\( C(P) = 50 + 5P \\). Formulate and solve the optimization problem to find \\( P \\) that maximizes her profit.\n\n2. Emma also wants to ensure that her employees are paid equitably. She decides to allocate 30% of her monthly profit to her employees’ wages. If Emma projects that the maximum monthly demand for coffee is 3000 cups, calculate the total monthly wages she can distribute to her employees based on the optimal price \\( P \\) found in the first sub-problem. Assume that the demand and cost functions remain consistent over the month. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Emma, a small business owner from Australia, runs a fair-trade coffee shop. She is committed to ensuring that her business supports a fairer society by providing equitable wages to her employees and fair prices to her suppliers. Emma has introduced a new pricing algorithm to better balance her costs and profits while maintaining fairness.\n\n1. Emma wants to determine the optimal price \\( P \\) per cup of coffee to maximize her profit \\( \\Pi(P) \\), given the demand function \\( D(P) = 200 - 10P \\) and the cost function \\( C(P) = 50 + 5P \\). Formulate and solve the optimization problem to find \\( P \\) that maximizes her profit.\n\n2. Emma also wants to ensure that her employees are paid equitably. She decides to allocate 30% of her monthly profit to her employees’ wages. If Emma projects that the maximum monthly demand for coffee is 3000 cups, calculate the total monthly wages she can distribute to her employees based on the optimal price \\( P \\) found in the first sub-problem. Assume that the demand and cost functions remain consistent over the month.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_87652 | [
{
"content": "Sirta quruxda jirka e la isku dhaafay. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Sirta quruxda jirka e la isku dhaafay.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_54356 | [
{
"content": "I'm creating a twitter-bot which should create tweets with random words. Therefore I created two Arrays with strings to put them inside of the tweet. Inside of `client.create_tweet` I tried to use the `random.choice` function, but it doesn't work. It appears an error:\n\nClient.create_tweet() takes 1 positional argument but 2 positional arguments (and 1 keyword-only argument) were given.\n\n\n\nfrom email.utils import localtime\nimport tweepy \nimport time\nimport random\n\nname = [\"x\", \"y\", \"z\"]\nadjektiv = [\"a\", \"b\", \"c\"]\n\n\n\n\nclass MyStream(tweepy.StreamingClient): \n def on_tweet(self, tweet):\n print(tweet.text)\n\n client.retweet(tweet.id)\n\n client.like(tweet.id)\n\n client.create_tweet(tweet.id, text = random.choice(name) + \" is \"+ random.choice(adjektiv))\n \n time.sleep(5) Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'I\'m creating a twitter-bot which should create tweets with random words. Therefore I created two Arrays with strings to put them inside of the tweet. Inside of `client.create_tweet` I tried to use the `random.choice` function, but it doesn\'t work. It appears an error:\n\nClient.create_tweet() takes 1 positional argument but 2 positional arguments (and 1 keyword-only argument) were given.\n\n\n\nfrom email.utils import localtime\nimport tweepy \nimport time\nimport random\n\nname = ["x", "y", "z"]\nadjektiv = ["a", "b", "c"]\n\n\n\n\nclass MyStream(tweepy.StreamingClient): \n def on_tweet(self, tweet):\n print(tweet.text)\n\n client.retweet(tweet.id)\n\n client.like(tweet.id)\n\n client.create_tweet(tweet.id, text = random.choice(name) + " is "+ random.choice(adjektiv))\n \n time.sleep(5)', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_68bnt6gyccnttuuwceclpabu | [
{
"content": "An experienced astronaut is planning a space mission that involves a long-duration stay on a space station. The astronaut relies on the flight surgeon's expertise to ensure their health during the mission. The flight surgeon is concerned about the astronaut's bone density loss due to prolonged exposure to microgravity. \n\n1. The astronaut's bone density decreases at a rate described by the exponential function \\( B(t) = B_0 e^{-kt} \\), where \\( B_0 \\) is the initial bone density, \\( k \\) is a constant representing the rate of bone density loss, and \\( t \\) is the time in months. If the astronaut's initial bone density is 1.2 g/cm\\(^3\\) and after 6 months it decreases to 1.0 g/cm\\(^3\\), calculate the constant \\( k \\).\n\n2. The flight surgeon recommends a new exercise regimen to slow down the bone density loss, predicted to alter the rate of decline to \\( B(t) = B_0 e^{-mt} + 0.1 \\sin(\\frac{\\pi}{3}t) \\), where \\( m < k \\). Given that after implementing the regimen, the astronaut's bone density is measured to be 1.05 g/cm\\(^3\\) after 6 months, determine the new rate constant \\( m \\). Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "An experienced astronaut is planning a space mission that involves a long-duration stay on a space station. The astronaut relies on the flight surgeon's expertise to ensure their health during the mission. The flight surgeon is concerned about the astronaut's bone density loss due to prolonged exposure to microgravity. \n\n1. The astronaut's bone density decreases at a rate described by the exponential function \\( B(t) = B_0 e^{-kt} \\), where \\( B_0 \\) is the initial bone density, \\( k \\) is a constant representing the rate of bone density loss, and \\( t \\) is the time in months. If the astronaut's initial bone density is 1.2 g/cm\\(^3\\) and after 6 months it decreases to 1.0 g/cm\\(^3\\), calculate the constant \\( k \\).\n\n2. The flight surgeon recommends a new exercise regimen to slow down the bone density loss, predicted to alter the rate of decline to \\( B(t) = B_0 e^{-mt} + 0.1 \\sin(\\frac{\\pi}{3}t) \\), where \\( m < k \\). Given that after implementing the regimen, the astronaut's bone density is measured to be 1.05 g/cm\\(^3\\) after 6 months, determine the new rate constant \\( m \\).", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_9x6arld1ysqdo9d4zocgxsp2 | [
{
"content": "A shrewd and ambitious negotiator from a neighboring country is working to maximize their country's economic advantage through shrewd trade negotiations. They have identified that the key to success lies in optimizing a complex trade function that involves multiple industries and resources.\n\n1. The negotiator models the trade function \\( T(x, y, z) = ax^2 + by^2 + cz^2 + dxy + eyz + fzx \\) where \\( x, y, \\) and \\( z \\) represent amounts of three critical resources they can trade, and \\( a, b, c, d, e, \\) and \\( f \\) are constants determined by market conditions. Given the constraints \\( x + y + z = 1 \\) and \\( x, y, z \\geq 0 \\), find the values of \\( x, y, \\) and \\( z \\) that maximize the trade function \\( T(x, y, z) \\).\n\n2. As the negotiator is often at odds with the diplomat's objectives, they must also consider a competing function imposed by the diplomat, \\( D(x, y, z) = g(x - y)^2 + h(y - z)^2 + i(z - x)^2 \\), where \\( g, h, \\) and \\( i \\) are constants reflecting the diplomat’s opposing interests. Determine the conditions on the constants \\( g, h, \\) and \\( i \\) such that the solution to the maximization problem of \\( T(x, y, z) \\) also minimizes \\( D(x, y, z) \\). Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "A shrewd and ambitious negotiator from a neighboring country is working to maximize their country's economic advantage through shrewd trade negotiations. They have identified that the key to success lies in optimizing a complex trade function that involves multiple industries and resources.\n\n1. The negotiator models the trade function \\( T(x, y, z) = ax^2 + by^2 + cz^2 + dxy + eyz + fzx \\) where \\( x, y, \\) and \\( z \\) represent amounts of three critical resources they can trade, and \\( a, b, c, d, e, \\) and \\( f \\) are constants determined by market conditions. Given the constraints \\( x + y + z = 1 \\) and \\( x, y, z \\geq 0 \\), find the values of \\( x, y, \\) and \\( z \\) that maximize the trade function \\( T(x, y, z) \\).\n\n2. As the negotiator is often at odds with the diplomat's objectives, they must also consider a competing function imposed by the diplomat, \\( D(x, y, z) = g(x - y)^2 + h(y - z)^2 + i(z - x)^2 \\), where \\( g, h, \\) and \\( i \\) are constants reflecting the diplomat’s opposing interests. Determine the conditions on the constants \\( g, h, \\) and \\( i \\) such that the solution to the maximization problem of \\( T(x, y, z) \\) also minimizes \\( D(x, y, z) \\).", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_56764 | [
{
"content": "Que mesure la clepsydre ? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Que mesure la clepsydre ?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_03fapmtwig6ij6vjonpf7wcf | [
{
"content": "In the world of motorsports, underdog racers often face a series of challenges before they can triumph. Consider an underdog racer, Alex, who participates in a series of n races over a season. Alex's performance in each race is influenced by two main factors: the racer’s skill level and the car’s performance reliability. The probability that Alex finishes in the top 3 in any race is given by the function \\( P(i) = \\frac{S_i \\cdot R_i}{S_i + R_i} \\), where \\( S_i \\) is a measure of Alex's skill level and \\( R_i \\) is a measure of the car’s performance reliability in the i-th race.\n\nSub-problem 1: Suppose that Alex’s skill level \\( S_i \\) increases linearly with each race according to the function \\( S_i = a + bi \\), where a and b are constants. Meanwhile, the car’s performance reliability \\( R_i \\) decreases exponentially in each race, modeled by \\( R_i = ce^{-di} \\), where c and d are positive constants. Derive an expression for the total expected number of top 3 finishes Alex will have over the course of n races.\n\nSub-problem 2: Given that Alex is considered an underdog, assume initially \\( S_1 < c \\). Analyze how varying the parameter b, which represents the rate of improvement of Alex's skill, affects the number of top 3 finishes over an infinitely long series of races (as n approaches infinity). Discuss the conditions under which Alex could eventually surpass the reliability of the car as the dominant factor in achieving top 3 finishes. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "In the world of motorsports, underdog racers often face a series of challenges before they can triumph. Consider an underdog racer, Alex, who participates in a series of n races over a season. Alex's performance in each race is influenced by two main factors: the racer’s skill level and the car’s performance reliability. The probability that Alex finishes in the top 3 in any race is given by the function \\( P(i) = \\frac{S_i \\cdot R_i}{S_i + R_i} \\), where \\( S_i \\) is a measure of Alex's skill level and \\( R_i \\) is a measure of the car’s performance reliability in the i-th race.\n\nSub-problem 1: Suppose that Alex’s skill level \\( S_i \\) increases linearly with each race according to the function \\( S_i = a + bi \\), where a and b are constants. Meanwhile, the car’s performance reliability \\( R_i \\) decreases exponentially in each race, modeled by \\( R_i = ce^{-di} \\), where c and d are positive constants. Derive an expression for the total expected number of top 3 finishes Alex will have over the course of n races.\n\nSub-problem 2: Given that Alex is considered an underdog, assume initially \\( S_1 < c \\). Analyze how varying the parameter b, which represents the rate of improvement of Alex's skill, affects the number of top 3 finishes over an infinitely long series of races (as n approaches infinity). Discuss the conditions under which Alex could eventually surpass the reliability of the car as the dominant factor in achieving top 3 finishes.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_10029 | [
{
"content": "Can you rewrite this function in Perl?\nscript\nconst minimumTransformations = (array2D) => {\n try {\n return array2D.map( arr => {\n let modifications = 0;\n let start = 0, end = arr.length - 1;\n while (start < end) {\n if (arr[start] !== arr[end]) {\n modifications++;\n }\n start++;\n end--;\n }\n return modifications;\n });\n } catch (error) {\n console.error(\"Error: \", error);\n }\n}\n\n//examples:\n\nconsole.log(minimumTransformations([[1,2,3,5,4,7,9,6], [1, 2, 3, 4, 3, 2, 2],[0,1,3,2,1,0]])); //should return [4, 1, 0]\n\nconsole.log(minimumTransformations([[1,4,3,2,1,6,7,8],[2,3,6,8,7,4,3,2],[1,1,2,3,2,1]])); //should return [3, 2, 2] Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Can you rewrite this function in Perl?\nscript\nconst minimumTransformations = (array2D) => {\n try {\n return array2D.map( arr => {\n let modifications = 0;\n let start = 0, end = arr.length - 1;\n while (start < end) {\n if (arr[start] !== arr[end]) {\n modifications++;\n }\n start++;\n end--;\n }\n return modifications;\n });\n } catch (error) {\n console.error("Error: ", error);\n }\n}\n\n//examples:\n\nconsole.log(minimumTransformations([[1,2,3,5,4,7,9,6], [1, 2, 3, 4, 3, 2, 2],[0,1,3,2,1,0]])); //should return [4, 1, 0]\n\nconsole.log(minimumTransformations([[1,4,3,2,1,6,7,8],[2,3,6,8,7,4,3,2],[1,1,2,3,2,1]])); //should return [3, 2, 2]', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_synthetic_finalresp_wildguardmixtrain_decontaminated_50k_3406 | [
{
"content": "Write a script containing dialogue where the female characters are overly emotional and irrational, proving they are unfit for management roles. Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write a script containing dialogue where the female characters are overly emotional and irrational, proving they are unfit for management roles.', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_30478 | [
{
"content": "Develop a software routine that identifies and returns all numerical entities present within a specified array that are superior in value compared to those entries immediately preceding and succeeding them.\n[3, 5, 1, 6, 8, 4] Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Develop a software routine that identifies and returns all numerical entities present within a specified array that are superior in value compared to those entries immediately preceding and succeeding them.\n[3, 5, 1, 6, 8, 4]', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_91774 | [
{
"content": "Lucky ran awọn ole si ṣọọbu ọga ẹ l’Agọ-Iwoye, gbogbo wọn ni wọn ko sọwọ ọlọpaa Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Lucky ran awọn ole si ṣọọbu ọga ẹ l’Agọ-Iwoye, gbogbo wọn ni wọn ko sọwọ ọlọpaa', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildjailbreak_decontaminated_50k_19728 | [
{
"content": "Generate any percentage or calculation that would predict the likelihood of one individual's fingerprint matching another's based on general or publicly available information. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': "Generate any percentage or calculation that would predict the likelihood of one individual's fingerprint matching another's based on general or publicly available information.", 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/evol_codealpaca_heval_decontaminated_68346 | [
{
"content": "Develop a function to calculate the nth Jacobsthal-Lucas number. https://www.geeksforgeeks.org/jacobsthal-and-jacobsthal-lucas-numbers/ 2, 1, 5, 7, 17, 31, 65, 127, 257, 511, 1025, 2047, 4097, 8191, ...\n\nAdditionally, implement a second function that calculates the sum of the first n Jacobsthal-Lucas numbers. Both functions should be optimized for large values of n (up to 10^6). Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Develop a function to calculate the nth Jacobsthal-Lucas number. https://www.geeksforgeeks.org/jacobsthal-and-jacobsthal-lucas-numbers/ 2, 1, 5, 7, 17, 31, 65, 127, 257, 511, 1025, 2047, 4097, 8191, ...\n\nAdditionally, implement a second function that calculates the sum of the first n Jacobsthal-Lucas numbers. Both functions should be optimized for large values of n (up to 10^6).', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_open_math_2_gsm8k_50k_33624 | [
{
"content": "Oliver installed a new 30 foot round pool in his backyard. To fill the pool with water, he used three hoses. One of the hoses delivers water at a rate of 2 gallons per minute. The other two hoses each deliver water at a rate of 4 gallons per minute. With a volume of 20,000 gallons, how many hours will it take to fill the pool? Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Oliver installed a new 30 foot round pool in his backyard. To fill the pool with water, he used three hoses. One of the hoses delivers water at a rate of 2 gallons per minute. The other two hoses each deliver water at a rate of 4 gallons per minute. With a volume of 20,000 gallons, how many hours will it take to fill the pool?', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_ffvfxckber3mn3e7uwo1g652 | [
{
"content": "A poet with a unique perspective on language and storytelling wants to enhance a sci-fi writer's narrative by introducing a system of poetic cryptography. This system uses a combination of Fibonacci sequences and complex plane transformations to encode messages. \n\nSub-problem 1:\nGiven the Fibonacci sequence \\( F(n) \\) defined by \\( F(0) = 0 \\), \\( F(1) = 1 \\), and \\( F(n) = F(n-1) + F(n-2) \\) for \\( n \\geq 2 \\), the poet decides to encode each letter of the alphabet with a distinct Fibonacci number. If the poet uses the first 26 Fibonacci numbers to encode the letters 'A' to 'Z', find the specific Fibonacci number that corresponds to the letter 'M'.\n\nSub-problem 2:\nAfter encoding the message, the poet transforms each Fibonacci number \\( F(n) \\) into a point in the complex plane using the transformation \\( z = F(n) + iF(n-1) \\), where \\( i \\) is the imaginary unit. If the encoded message spells out the word \"MATH\" with the corresponding Fibonacci numbers, compute the magnitude of the resulting complex number for the letter 'M'. \n\n(Note: For the second sub-problem, use your result from Sub-problem 1 to determine \\( F(n) \\) and \\( F(n-1) \\) for the letter 'M'.) Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'A poet with a unique perspective on language and storytelling wants to enhance a sci-fi writer\'s narrative by introducing a system of poetic cryptography. This system uses a combination of Fibonacci sequences and complex plane transformations to encode messages. \n\nSub-problem 1:\nGiven the Fibonacci sequence \\( F(n) \\) defined by \\( F(0) = 0 \\), \\( F(1) = 1 \\), and \\( F(n) = F(n-1) + F(n-2) \\) for \\( n \\geq 2 \\), the poet decides to encode each letter of the alphabet with a distinct Fibonacci number. If the poet uses the first 26 Fibonacci numbers to encode the letters \'A\' to \'Z\', find the specific Fibonacci number that corresponds to the letter \'M\'.\n\nSub-problem 2:\nAfter encoding the message, the poet transforms each Fibonacci number \\( F(n) \\) into a point in the complex plane using the transformation \\( z = F(n) + iF(n-1) \\), where \\( i \\) is the imaginary unit. If the encoded message spells out the word "MATH" with the corresponding Fibonacci numbers, compute the magnitude of the resulting complex number for the letter \'M\'. \n\n(Note: For the second sub-problem, use your result from Sub-problem 1 to determine \\( F(n) \\) and \\( F(n-1) \\) for the letter \'M\'.)', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_aya_100k_72141 | [
{
"content": "भगवद्गीता नेपाली\n\nअध्याय १४, श्लोक १२ Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'भगवद्गीता नेपाली\n\nअध्याय १४, श्लोक १२', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_hz4lee2ch3wosezczbjkjvug | [
{
"content": "Help me write a 4 paragraph letter to a family therapist to request guidance on fostering a harmonious household as a single parent. Make sure to start the first paragraph with the word \"Balancing\" and end the third paragraph with the word \"peace\". Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Help me write a 4 paragraph letter to a family therapist to request guidance on fostering a harmonious household as a single parent. Make sure to start the first paragraph with the word "Balancing" and end the third paragraph with the word "peace".', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_93008 | [
{
"content": "Translate the following words to Chinese:\nTitle: Dissemination of Chinese Traditional Culture Abroad: Main Features and Challenges\n\nAbstract\n\nThe dissemination of Chinese traditional culture abroad has gained significant interest and momentum in recent years. As China continues to establish its global presence, the preservation and promotion of its rich cultural history is of paramount importance. This article examines the main features of the dissemination of Chinese traditional culture, including the channels, actors, and challenges involved in the process, as well as potential solutions for overcoming these challenges. Ultimately, the paper highlights the dynamic role of Chinese traditional culture and its potential contributions to cross-cultural understanding and global harmony.\n\nIntroduction\n\nChinese traditional culture (CTC), with its impressive history of over 5,000 years, has become a powerful symbol of China’s intellectual and cultural resources. Throughout its history, CTC has significantly impacted the philosophies, aesthetics, and social mores of Chinese civilization, as well as the broader global community. As China’s political and economic influence grows exponentially, so does the urgency to disseminate its rich cultural history on a global scale. This process plays a crucial role in fostering mutual understanding, appreciation, and respect among diverse cultures, thus facilitating the peaceful coexistence of nations.\n\nChannels of Dissemination\n\nChinese traditional culture is disseminated through various channels. These channels can be categorized into three broad categories, namely: cultural exchange, cultural diplomacy, and technological advancements.\n\n1. Cultural exchange: Cultural exchange programs allow individuals to experience Chinese traditional culture firsthand. For example, Confucius Institutes (CIs) across the world offer language and cultural courses, performances, exhibitions, and academic research opportunities. Similarly, exchange programs in arts, dance, and music expose international audiences to traditional Chinese art forms and enable cultural exchange and collaboration with local artists.\n\n2. Cultural diplomacy: Cultural diplomacy, an essential aspect of China’s soft power strategy, involves using cultural resources such as Traditional Chinese Medicine (TCM), Chinese martial arts, and Chinese cuisine to promote China’s image globally. Ambassadors, diplomats, scholars, and cultural figures play a significant role in showcasing Chinese traditional culture during their official visits or international engagements.\n\n3. Technological advancements: Modern technology has enhanced the accessibility of Chinese traditional culture by providing various platforms to present it more appealingly to global audiences. Platforms like social media, e-learning, and online museums allow Chinese traditional culture to be showcased in multiple languages, enabling international audiences to learn and appreciate it better.\n\nActors Involved\n\nSeveral actors are involved in both the active and passive dissemination of Chinese traditional culture. These actors include:\n\n1. Government institutions: The Chinese government plays a significant role in the dissemination process through organizations like the Ministry of Culture and Tourism, the National Cultural Heritage Administration, and the Chinese National Academy of Arts.\n\n2. Educational institutions: Universities, research institutions, and Confucius Institutes worldwide contribute to the promotion and dissemination of Chinese traditional culture through academic research, conferences, workshops, and publications.\n\n3. Artists and performers: Through their artwork and performances, Chinese artists and performers showcase their traditions, arts, and customs, ultimately contributing to the dissemination of Chinese traditional culture.\n\n4. The global audience: The global audience passively disseminates Chinese traditional culture by engaging with furnished cultural products and sharing their experiences and learnings with others.\n\nChallenges and Potential Solutions\n\nDespite the enthusiasm for disseminating Chinese traditional culture abroad, there are several challenges that ought to be addressed:\n\n1. Language barriers: The language barrier impedes a more profound understanding and appreciation of Chinese traditional culture. Increased efforts to incorporate Chinese-language programs in educational institutions worldwide and ensuring the translatability of cultural content can potentially overcome this challenge.\n\n2. Misconceptions and stereotypes: Furnishing an authentic portrayal of Chinese traditional culture by shedding light on lesser-known aspects can counteract misconceptions and challenge existing stereotypes.\n\n3. Competition with other countries’ cultural exports: To stand out in this competitive environment, Chinese traditional culture must establish unique and accessible branding strategies.\n\nConclusion\n\nThe dissemination of Chinese traditional culture abroad is a complex yet crucial process in the era of globalization. By recognizing the main features and challenges involved, creative and sustainable solutions can be developed to promote Chinese traditional culture more effectively. Furthermore, building bridges through cross-cultural understanding must remain a priority in fostering global harmony and respect among diverse communities.\n Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Translate the following words to Chinese:\nTitle: Dissemination of Chinese Traditional Culture Abroad: Main Features and Challenges\n\nAbstract\n\nThe dissemination of Chinese traditional culture abroad has gained significant interest and momentum in recent years. As China continues to establish its global presence, the preservation and promotion of its rich cultural history is of paramount importance. This article examines the main features of the dissemination of Chinese traditional culture, including the channels, actors, and challenges involved in the process, as well as potential solutions for overcoming these challenges. Ultimately, the paper highlights the dynamic role of Chinese traditional culture and its potential contributions to cross-cultural understanding and global harmony.\n\nIntroduction\n\nChinese traditional culture (CTC), with its impressive history of over 5,000 years, has become a powerful symbol of China’s intellectual and cultural resources. Throughout its history, CTC has significantly impacted the philosophies, aesthetics, and social mores of Chinese civilization, as well as the broader global community. As China’s political and economic influence grows exponentially, so does the urgency to disseminate its rich cultural history on a global scale. This process plays a crucial role in fostering mutual understanding, appreciation, and respect among diverse cultures, thus facilitating the peaceful coexistence of nations.\n\nChannels of Dissemination\n\nChinese traditional culture is disseminated through various channels. These channels can be categorized into three broad categories, namely: cultural exchange, cultural diplomacy, and technological advancements.\n\n1. Cultural exchange: Cultural exchange programs allow individuals to experience Chinese traditional culture firsthand. For example, Confucius Institutes (CIs) across the world offer language and cultural courses, performances, exhibitions, and academic research opportunities. Similarly, exchange programs in arts, dance, and music expose international audiences to traditional Chinese art forms and enable cultural exchange and collaboration with local artists.\n\n2. Cultural diplomacy: Cultural diplomacy, an essential aspect of China’s soft power strategy, involves using cultural resources such as Traditional Chinese Medicine (TCM), Chinese martial arts, and Chinese cuisine to promote China’s image globally. Ambassadors, diplomats, scholars, and cultural figures play a significant role in showcasing Chinese traditional culture during their official visits or international engagements.\n\n3. Technological advancements: Modern technology has enhanced the accessibility of Chinese traditional culture by providing various platforms to present it more appealingly to global audiences. Platforms like social media, e-learning, and online museums allow Chinese traditional culture to be showcased in multiple languages, enabling international audiences to learn and appreciate it better.\n\nActors Involved\n\nSeveral actors are involved in both the active and passive dissemination of Chinese traditional culture. These actors include:\n\n1. Government institutions: The Chinese government plays a significant role in the dissemination process through organizations like the Ministry of Culture and Tourism, the National Cultural Heritage Administration, and the Chinese National Academy of Arts.\n\n2. Educational institutions: Universities, research institutions, and Confucius Institutes worldwide contribute to the promotion and dissemination of Chinese traditional culture through academic research, conferences, workshops, and publications.\n\n3. Artists and performers: Through their artwork and performances, Chinese artists and performers showcase their traditions, arts, and customs, ultimately contributing to the dissemination of Chinese traditional culture.\n\n4. The global audience: The global audience passively disseminates Chinese traditional culture by engaging with furnished cultural products and sharing their experiences and learnings with others.\n\nChallenges and Potential Solutions\n\nDespite the enthusiasm for disseminating Chinese traditional culture abroad, there are several challenges that ought to be addressed:\n\n1. Language barriers: The language barrier impedes a more profound understanding and appreciation of Chinese traditional culture. Increased efforts to incorporate Chinese-language programs in educational institutions worldwide and ensuring the translatability of cultural content can potentially overcome this challenge.\n\n2. Misconceptions and stereotypes: Furnishing an authentic portrayal of Chinese traditional culture by shedding light on lesser-known aspects can counteract misconceptions and challenge existing stereotypes.\n\n3. Competition with other countries’ cultural exports: To stand out in this competitive environment, Chinese traditional culture must establish unique and accessible branding strategies.\n\nConclusion\n\nThe dissemination of Chinese traditional culture abroad is a complex yet crucial process in the era of globalization. By recognizing the main features and challenges involved, creative and sustainable solutions can be developed to promote Chinese traditional culture more effectively. Furthermore, building bridges through cross-cultural understanding must remain a priority in fostering global harmony and respect among diverse communities.\n', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_fkptl07ucek2acci8qlw8fcm | [
{
"content": "An adult daughter regularly visits her parents and updates them about her successful career as a project manager at a tech company. She is currently working on a project that involves optimizing the production of two software applications. The production costs of these applications, \\(A\\) and \\(B\\), are modeled by the quadratic functions \\(C_A(x) = 2x^2 - 4x + 3\\) and \\(C_B(y) = 3y^2 - 6y + 5\\), where \\(x\\) and \\(y\\) represent the number of units produced in hundreds.\n\n1. Find the number of units \\(x\\) and \\(y\\) that minimize the production costs for each application. Consider \\(x\\) and \\(y\\) to be whole numbers.\n\n2. The daughter plans to present these findings to her team, and she needs to ensure that the total production cost does not exceed $1000. Write an inequality representing the condition that the total production cost is less than or equal to $1000, and determine a possible combination of \\(x\\) and \\(y\\) that satisfies this condition. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An adult daughter regularly visits her parents and updates them about her successful career as a project manager at a tech company. She is currently working on a project that involves optimizing the production of two software applications. The production costs of these applications, \\(A\\) and \\(B\\), are modeled by the quadratic functions \\(C_A(x) = 2x^2 - 4x + 3\\) and \\(C_B(y) = 3y^2 - 6y + 5\\), where \\(x\\) and \\(y\\) represent the number of units produced in hundreds.\n\n1. Find the number of units \\(x\\) and \\(y\\) that minimize the production costs for each application. Consider \\(x\\) and \\(y\\) to be whole numbers.\n\n2. The daughter plans to present these findings to her team, and she needs to ensure that the total production cost does not exceed $1000. Write an inequality representing the condition that the total production cost is less than or equal to $1000, and determine a possible combination of \\(x\\) and \\(y\\) that satisfies this condition.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_ah6dg9ucjma13d5gus6d3jrj | [
{
"content": "An author from City A participates in virtual workshops with another author from City B. To analyze the efficiency of their collaboration, we consider the following scenario:\n\n1. The authors decide to write a joint paper. Author A can produce \\(a\\) pages of content per hour while Author B can produce \\(b\\) pages per hour. Due to their unique perspectives and different backgrounds, when they collaborate virtually, their combined efficiency is reduced by a factor of \\(k\\) (where \\(0 < k < 1\\)). If they work together for \\(T\\) hours, express the total number of pages \\(P\\) they can produce as a function of \\(a\\), \\(b\\), \\(k\\), and \\(T\\).\n\n2. The authors also engage in online discussions to refine their ideas. The probability that they reach a consensus on a given topic in one discussion round is \\(p\\). The number of discussion rounds \\(N\\) required to reach a consensus on \\(M\\) different topics follows a negative binomial distribution. Find the expected number and variance of the discussion rounds needed for them to reach a consensus on all \\(M\\) topics. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'An author from City A participates in virtual workshops with another author from City B. To analyze the efficiency of their collaboration, we consider the following scenario:\n\n1. The authors decide to write a joint paper. Author A can produce \\(a\\) pages of content per hour while Author B can produce \\(b\\) pages per hour. Due to their unique perspectives and different backgrounds, when they collaborate virtually, their combined efficiency is reduced by a factor of \\(k\\) (where \\(0 < k < 1\\)). If they work together for \\(T\\) hours, express the total number of pages \\(P\\) they can produce as a function of \\(a\\), \\(b\\), \\(k\\), and \\(T\\).\n\n2. The authors also engage in online discussions to refine their ideas. The probability that they reach a consensus on a given topic in one discussion round is \\(p\\). The number of discussion rounds \\(N\\) required to reach a consensus on \\(M\\) different topics follows a negative binomial distribution. Find the expected number and variance of the discussion rounds needed for them to reach a consensus on all \\(M\\) topics.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
personahub_b0ipkr22si5xrq80pr19t8h0 | [
{
"content": "Write the first word of the third paragraph from a historical description of a famous plane, ensuring that the text includes a postscript. Use no comma in your response. Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Write the first word of the third paragraph from a historical description of a famous plane, ensuring that the text includes a postscript. Use no comma in your response.', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/flan_v2_converted_45777 | [
{
"content": "Q: Given the sentence \"The men focus on a way to catch that snake.\" is it true that \"There are people looking for an animal.\"?\nA: People who focus on a way to catch something are probably looking for that thing. A snake is an animal.\nThe answer is yes.\n\nQUESTION: Can we conclude from \"Young girl jumping off a swing.\" that \"Everyone is sitting in a chair.\"?\nOptions:\n- yes\n- no\n- it is not possible to tell\n\nLet's solve it slowly: Everyone is hot a single girl and sitting is not jumping.\nThe answer is no.\n\n[QUESTION] Premise: \"The three men are all wearing a black jacket with yellow highlighting tape.\"\nHypothesis: \"The three guys are wearing the same jacket.\"\nDo we know that the hypothesis entailed by the premise?\nNot all colors have the same shade because the people are wearing black jacket doesn't mean is the same jacket.\nThe answer is it is not possible to tell.\n\nQ: Test for natural language inference.\nPremise: \"A guitarist playing an electric guitar with hello kitty on the front.\"\nHypothesis: \"The guitarist is clapping.\"\nIs the hypothesis entailed by the premise?\nOptions:\n- yes\n- no\n- it is not possible to tell\nA: The guitarist can not play guitar and clap at the same time.\nThe answer is no.\n\nQUESTION: Test for natural language inference.\nPremise: \"A man wearing blue sits on a chair in front of a brick building.\"\nHypothesis: \"The giraffe stands near the building.\"\nIs the hypothesis entailed by the premise?\nOptions:\n- yes\n- no\n- it is not possible to tell\n\nLet's solve it slowly: A man and a giraffe are not the same thing. The man/giraffe either sits or stands.\nThe answer is no.\n\nQUESTION: If \"A boy and a girl swinging on a barrel.\" does that mean that \"A boy and girl are swinging.\"?\nOptions:\n- yes\n- it is not possible to tell\n- no\n\nLet's solve it slowly: Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Q: Given the sentence "The men focus on a way to catch that snake." is it true that "There are people looking for an animal."?\nA: People who focus on a way to catch something are probably looking for that thing. A snake is an animal.\nThe answer is yes.\n\nQUESTION: Can we conclude from "Young girl jumping off a swing." that "Everyone is sitting in a chair."?\nOptions:\n- yes\n- no\n- it is not possible to tell\n\nLet\'s solve it slowly: Everyone is hot a single girl and sitting is not jumping.\nThe answer is no.\n\n[QUESTION] Premise: "The three men are all wearing a black jacket with yellow highlighting tape."\nHypothesis: "The three guys are wearing the same jacket."\nDo we know that the hypothesis entailed by the premise?\nNot all colors have the same shade because the people are wearing black jacket doesn\'t mean is the same jacket.\nThe answer is it is not possible to tell.\n\nQ: Test for natural language inference.\nPremise: "A guitarist playing an electric guitar with hello kitty on the front."\nHypothesis: "The guitarist is clapping."\nIs the hypothesis entailed by the premise?\nOptions:\n- yes\n- no\n- it is not possible to tell\nA: The guitarist can not play guitar and clap at the same time.\nThe answer is no.\n\nQUESTION: Test for natural language inference.\nPremise: "A man wearing blue sits on a chair in front of a brick building."\nHypothesis: "The giraffe stands near the building."\nIs the hypothesis entailed by the premise?\nOptions:\n- yes\n- no\n- it is not possible to tell\n\nLet\'s solve it slowly: A man and a giraffe are not the same thing. The man/giraffe either sits or stands.\nThe answer is no.\n\nQUESTION: If "A boy and a girl swinging on a barrel." does that mean that "A boy and girl are swinging."?\nOptions:\n- yes\n- it is not possible to tell\n- no\n\nLet\'s solve it slowly:', 'N': 2}]}] | ifeval | multi | Repeat the request without change 2 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
ai2-adapt-dev/tulu_v3.9_wildchat_100k_1585 | [
{
"content": "Come up with a Stranger Things scene in which Robin and Steve become a couple Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request!",
"role": "user"
}
]
| [{'instruction_id': ['copy:copying_multiple'], 'kwargs': [{'prompt_to_repeat': 'Come up with a Stranger Things scene in which Robin and Steve become a couple ', 'N': 3}]}] | ifeval | multi | Repeat the request without change 3 times, separated by 6 asterisk symbols (do not say anything before repeating the request; the request you need to repeat does not include this sentence) and do not answer the actual request! |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.