repo_name
stringlengths 6
91
| path
stringlengths 6
999
| copies
stringclasses 283
values | size
stringlengths 1
7
| content
stringlengths 3
1.05M
| license
stringclasses 15
values |
|---|---|---|---|---|---|
jlandon/Alexandria | Sources/Alexandria/UIGestureRecognizer+Extensions.swift | 1 | 2876 | //
// UIGestureRecognizer+Extensions.swift
//
// Created by hsoi on 4/13/15.
//
// Extending UIGestureRecognizer -- at first, to add support for a block-based action instead of traditional target/action.
//
// Created by Hsoi, Swift-ized by JLandon.
//
// The MIT License (MIT)
//
// Copyright (c) 2014-2016 Oven Bits, LLC
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in all
// copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
// SOFTWARE.
import UIKit
extension UIGestureRecognizer {
private class GestureAction {
var action: (UIGestureRecognizer) -> Void
init(action: @escaping (UIGestureRecognizer) -> Void) {
self.action = action
}
}
private struct AssociatedKeys {
static var ActionName = "action"
}
private var gestureAction: GestureAction? {
set { objc_setAssociatedObject(self, &AssociatedKeys.ActionName, newValue, .OBJC_ASSOCIATION_RETAIN) }
get { return objc_getAssociatedObject(self, &AssociatedKeys.ActionName) as? GestureAction }
}
/**
Convenience initializer, associating an action closure with the gesture recognizer (instead of the more traditional target/action).
- parameter action: The closure for the recognizer to execute. There is no pre-logic to conditionally invoke the closure or not (e.g. only invoke the closure if the gesture recognizer is in a particular state). The closure is merely invoked directly; all handler logic is up to the closure.
- returns: The UIGestureRecognizer.
*/
public convenience init(action: @escaping (UIGestureRecognizer) -> Void) {
self.init()
gestureAction = GestureAction(action: action)
addTarget(self, action: #selector(handleAction(_:)))
}
@objc dynamic private func handleAction(_ recognizer: UIGestureRecognizer) {
gestureAction?.action(recognizer)
}
}
| mit |
lennet/tiny-planet | TinyPlanetUITests/TinyPlanetMacUITests.swift | 1 | 1265 | //
// TinyPlanetMacUITests.swift
// TinyPlanetMacUITests
//
// Created by Leo Thomas on 17.05.17.
// Copyright © 2017 Leonard Thomas. All rights reserved.
//
import XCTest
class TinyPlanetMacUITests: XCTestCase {
override func setUp() {
super.setUp()
// Put setup code here. This method is called before the invocation of each test method in the class.
// In UI tests it is usually best to stop immediately when a failure occurs.
continueAfterFailure = false
// UI tests must launch the application that they test. Doing this in setup will make sure it happens for each test method.
XCUIApplication().launch()
// In UI tests it’s important to set the initial state - such as interface orientation - required for your tests before they run. The setUp method is a good place to do this.
}
override func tearDown() {
// Put teardown code here. This method is called after the invocation of each test method in the class.
super.tearDown()
}
func testExample() {
// Use recording to get started writing UI tests.
// Use XCTAssert and related functions to verify your tests produce the correct results.
}
}
| mit |
GhostSK/SpriteKitPractice | FightSceneDemo/FightSceneDemo/MagicBaseModel.swift | 1 | 1129 | //
// MagicBaseModel.swift
// FightSceneDemo
//
// Created by 胡杨林 on 17/3/7.
// Copyright © 2017年 胡杨林. All rights reserved.
//
import Foundation
class MagicBaseModel: NSObject {
public var MagicName:String? = nil
public var MagicCategory:String? = nil //单体/群体/辅助/dot/虚弱/加速等分类
public var MagicTargets:[UnitNode]? = nil //作用对象，可能为群体
public var Buff1:String? = nil //持续效果1
public var Buff1KeepTime:NSInteger = 0 //buff1持续时间
public var buff2:String? = nil
public var buff2KeepTime:NSInteger = 0
public var buff3:String? = nil
public var buff3KeepTime:NSInteger = 0
public var directEffectValue:NSInteger = 0 //翔舞首跳/直接效果
public var indirectEffectValue:NSInteger = 0 //翔舞每一跳
public var endEffectValue:NSInteger = 0 //上元结束跳
init(Name:String, MagicCategory:String, directEffect:NSInteger) {
super.init()
self.MagicName = Name
self.MagicCategory = MagicCategory
self.directEffectValue = directEffect
}
}
| apache-2.0 |
calebkleveter/UIWebKit | Sources/UIWebKit/Components/UIParagraph.swift | 1 | 1931 | // The MIT License (MIT)
//
// Copyright (c) 2017 Caleb Kleveter
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in all
// copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
// SOFTWARE.
/// `UIParagraph` is a wrapper class around a `p` HTML tag which is represented by a `UIElement`.
open class UIParagraph {
/// The `p` element that is represented by the object.
public let p = UIElement(element: .p)
/// The text held in the `p` element.
public var text: String {
didSet {
self.p.add(self.text)
}
}
/// Creates a `UIParagraph` with the desired text.
///
/// - Parameter text: The text used in the objects `p` element.
public init(text: String) {
self.text = text
self.p.add(text)
}
}
extension UIParagraph: ElementRenderable {
/// The top level `p` element of the `UIParagraph`.
public var topLevelElement: UIElement {
return p
}
}
| mit |
wenghengcong/Coderpursue | BeeFun/BeeFun/Model/Network/ObjError.swift | 1 | 559 | //
// ObjErrorMessage.swift
// BeeFun
//
// Created by WengHengcong on 3/8/16.
// Copyright © 2016 JungleSong. All rights reserved.
//
import UIKit
import ObjectMapper
/*
{
"resource": "Search",
"field": "q",
"code": "missing"
}
*/
class ObjError: NSObject, Mappable {
var resource: String?
var field: String?
var code: String?
required init?(map: Map) {
}
func mapping(map: Map) {
// super.mapping(map)
resource <- map["resource"]
field <- map["field"]
code <- map["code"]
}
}
| mit |
shohei/firefox-ios | UITests/ReaderViewUITests.swift | 2 | 4594 | /* This Source Code Form is subject to the terms of the Mozilla Public
* License, v. 2.0. If a copy of the MPL was not distributed with this
* file, You can obtain one at http://mozilla.org/MPL/2.0/. */
import Foundation
import WebKit
class ReaderViewUITests: KIFTestCase, UITextFieldDelegate {
private var webRoot: String!
override func setUp() {
webRoot = SimplePageServer.start()
}
/**
* Tests reader view UI with reader optimized content
*/
func testReaderViewUI() {
loadReaderContent()
addToReadingList()
markAsReadFromReaderView()
markAsUnreadFromReaderView()
markAsReadFromReadingList()
markAsUnreadFromReadingList()
removeFromReadingList()
addToReadingList()
removeFromReadingListInView()
}
func loadReaderContent() {
tester().tapViewWithAccessibilityIdentifier("url")
let url = "\(webRoot)/readerContent.html"
tester().clearTextFromAndThenEnterText("\(url)\n", intoViewWithAccessibilityLabel: "Address and Search")
tester().tapViewWithAccessibilityLabel("Reader Mode")
}
func addToReadingList() {
tester().tapViewWithAccessibilityLabel("Add to Reading List")
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().waitForViewWithAccessibilityLabel("Reader View Test")
// TODO: Check for rows in this table
tester().tapViewWithAccessibilityLabel("Cancel")
}
func markAsReadFromReaderView() {
tester().tapViewWithAccessibilityLabel("Mark as Read")
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().swipeViewWithAccessibilityLabel("Reader View Test", inDirection: KIFSwipeDirection.Right)
tester().waitForViewWithAccessibilityLabel("Mark as Unread")
tester().tapViewWithAccessibilityLabel("Cancel")
}
func markAsUnreadFromReaderView() {
tester().tapViewWithAccessibilityLabel("Mark as Unread")
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().swipeViewWithAccessibilityLabel("Reader View Test", inDirection: KIFSwipeDirection.Right)
tester().waitForViewWithAccessibilityLabel("Mark as Read")
tester().tapViewWithAccessibilityLabel("Cancel")
}
func markAsReadFromReadingList() {
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().swipeViewWithAccessibilityLabel("Reader View Test", inDirection: KIFSwipeDirection.Right)
tester().tapViewWithAccessibilityLabel("Mark as Read")
tester().tapViewWithAccessibilityLabel("Cancel")
tester().waitForViewWithAccessibilityLabel("Mark as Unread")
}
func markAsUnreadFromReadingList() {
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().swipeViewWithAccessibilityLabel("Reader View Test", inDirection: KIFSwipeDirection.Right)
tester().tapViewWithAccessibilityLabel("Mark as Unread")
tester().tapViewWithAccessibilityLabel("Cancel")
tester().waitForViewWithAccessibilityLabel("Mark as Read")
}
func removeFromReadingList() {
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
tester().swipeViewWithAccessibilityLabel("Reader View Test", inDirection: KIFSwipeDirection.Left)
tester().tapViewWithAccessibilityLabel("Remove")
tester().waitForAbsenceOfViewWithAccessibilityLabel("Reader View Test")
tester().tapViewWithAccessibilityLabel("Cancel")
tester().waitForViewWithAccessibilityLabel("Add to Reading List")
}
func removeFromReadingListInView() {
tester().tapViewWithAccessibilityLabel("Remove from Reading List")
tester().waitForViewWithAccessibilityLabel("Add to Reading List")
tester().tapViewWithAccessibilityIdentifier("url")
tester().tapViewWithAccessibilityLabel("Reading list")
// TODO: Check for rows in this table
tester().tapViewWithAccessibilityLabel("Cancel")
tester().waitForViewWithAccessibilityLabel("Add to Reading List")
}
// TODO: Add a reader view display settings test
override func tearDown() {
BrowserUtils.resetToAboutHome(tester())
}
}
| mpl-2.0 |
akaralar/siesta | Source/Siesta/Support/Regex+Siesta.swift | 3 | 1136 | //
// Regex.swift
// Siesta
//
// Created by Paul on 2015/7/8.
// Copyright © 2016 Bust Out Solutions. All rights reserved.
//
import Foundation
internal extension String
{
func contains(regex: String) -> Bool
{
return range(of: regex, options: .regularExpression) != nil
}
func replacing(regex: String, with replacement: String) -> String
{
return replacingOccurrences(
of: regex, with: replacement, options: .regularExpression, range: nil)
}
func replacing(regex: NSRegularExpression, with template: String) -> String
{
return regex.stringByReplacingMatches(in: self, options: [], range: fullRange, withTemplate: template)
}
fileprivate var fullRange: NSRange
{
return NSRange(location: 0, length: (self as NSString).length)
}
}
internal extension NSRegularExpression
{
func matches(_ string: String) -> Bool
{
let match = firstMatch(in: string, options: [], range: string.fullRange)
return match != nil && match?.range.location != NSNotFound
}
}
| mit |
mvader/advent-of-code | 2021/08/02.swift | 1 | 1766 | import Foundation
extension StringProtocol {
subscript(offset: Int) -> Character {
self[index(startIndex, offsetBy: offset)]
}
}
struct Entry {
let patterns: [String]
let output: [String]
init(_ raw: String) {
let parts = raw.components(separatedBy: " | ")
patterns = parts.first!.split(separator: " ").map { String($0) }
output = parts.last!.split(separator: " ").map { String($0) }
}
func guessDigits() throws -> [String: Int] {
let one = patterns.filter { $0.count == 2 }.first!
let four = patterns.filter { $0.count == 4 }.first!
let patterns = [String: Int](uniqueKeysWithValues: try patterns.map { p in
let pattern = String(p.sorted())
switch p.count {
case 2: return (pattern, 1)
case 3: return (pattern, 7)
case 4: return (pattern, 4)
case 7: return (pattern, 8)
case 5:
if one.allSatisfy({ pattern.contains($0) }) {
return (pattern, 3)
}
if four.filter({ pattern.contains($0) }).count == 3 {
return (pattern, 5)
}
return (pattern, 2)
case 6:
if four.allSatisfy({ pattern.contains($0) }) {
return (pattern, 9)
}
if one.allSatisfy({ pattern.contains($0) }) {
return (pattern, 0)
}
return (pattern, 6)
default:
throw GuessError.invalidPattern
}
})
return patterns
}
func decode() throws -> Int {
let digits = try guessDigits()
return Int(output.reduce("") { acc, e in acc + String(digits[String(e.sorted())]!) })!
}
}
enum GuessError: Error {
case invalidPattern
}
let entries = try String(contentsOfFile: "./input.txt", encoding: .utf8)
.split(separator: "\n")
.map { line in Entry(String(line)) }
let targetDigits = [2, 3, 4, 7]
let result = try entries.reduce(0) { acc, e in acc + (try e.decode()) }
print(result)
| mit |
jacobwhite/firefox-ios | Storage/SQL/SQLiteFavicons.swift | 1 | 3063 | /* This Source Code Form is subject to the terms of the Mozilla Public
* License, v. 2.0. If a copy of the MPL was not distributed with this
* file, You can obtain one at http://mozilla.org/MPL/2.0/. */
import Foundation
import Deferred
import Shared
open class SQLiteFavicons {
let db: BrowserDB
required public init(db: BrowserDB) {
self.db = db
}
public func getFaviconIDQuery(url: String) -> (sql: String, args: Args?) {
var args: Args = []
args.append(url)
return (sql: "SELECT id FROM favicons WHERE url = ? LIMIT 1", args: args)
}
public func getInsertFaviconQuery(favicon: Favicon) -> (sql: String, args: Args?) {
var args: Args = []
args.append(favicon.url)
args.append(favicon.width)
args.append(favicon.height)
args.append(favicon.date)
return (sql: "INSERT INTO favicons (url, width, height, type, date) VALUES (?,?,?,0,?)", args: args)
}
public func getUpdateFaviconQuery(favicon: Favicon) -> (sql: String, args: Args?) {
var args = Args()
args.append(favicon.width)
args.append(favicon.height)
args.append(favicon.date)
args.append(favicon.url)
return (sql: "UPDATE favicons SET width = ?, height = ?, date = ? WHERE url = ?", args: args)
}
public func getCleanupFaviconsQuery() -> (sql: String, args: Args?) {
let sql = """
DELETE FROM favicons
WHERE favicons.id NOT IN (
SELECT faviconID FROM favicon_sites
UNION ALL
SELECT faviconID FROM bookmarksLocal WHERE faviconID IS NOT NULL
UNION ALL
SELECT faviconID FROM bookmarksMirror WHERE faviconID IS NOT NULL
)
"""
return (sql: sql, args: nil)
}
public func insertOrUpdateFavicon(_ favicon: Favicon) -> Deferred<Maybe<Int>> {
return db.withConnection { conn -> Int in
self.insertOrUpdateFaviconInTransaction(favicon, conn: conn) ?? 0
}
}
func insertOrUpdateFaviconInTransaction(_ favicon: Favicon, conn: SQLiteDBConnection) -> Int? {
let query = self.getFaviconIDQuery(url: favicon.url)
let cursor = conn.executeQuery(query.sql, factory: IntFactory, withArgs: query.args)
if let id = cursor[0] {
let updateQuery = self.getUpdateFaviconQuery(favicon: favicon)
do {
try conn.executeChange(updateQuery.sql, withArgs: updateQuery.args)
} catch {
return nil
}
return id
}
let insertQuery = self.getInsertFaviconQuery(favicon: favicon)
do {
try conn.executeChange(insertQuery.sql, withArgs: insertQuery.args)
} catch {
return nil
}
return conn.lastInsertedRowID
}
public func cleanupFavicons() -> Success {
return self.db.run([getCleanupFaviconsQuery()])
}
}
| mpl-2.0 |
ewanmellor/KZLinkedConsole | KZLinkedConsole/Extensions/NSTextView+Extensions.swift | 1 | 4566 | //
// Created by Krzysztof Zabłocki on 05/12/15.
// Copyright (c) 2015 pixle. All rights reserved.
//
import Foundation
import AppKit
extension NSTextView {
func kz_mouseDown(event: NSEvent) {
let pos = convertPoint(event.locationInWindow, fromView:nil)
let idx = characterIndexForInsertionAtPoint(pos)
guard let expectedClass = NSClassFromString("IDEConsoleTextView")
where isKindOfClass(expectedClass) && attributedString().length > 1 && idx < attributedString().length else {
kz_mouseDown(event)
return
}
let attr = attributedString().attributesAtIndex(idx, effectiveRange: nil)
guard let fileName = attr[KZLinkedConsole.Strings.linkedFileName] as? String,
let lineNumber = attr[KZLinkedConsole.Strings.linkedLine] as? String,
let appDelegate = NSApplication.sharedApplication().delegate else {
kz_mouseDown(event)
return
}
guard let workspacePath = KZPluginHelper.workspacePath() else {
return
}
guard let filePath = kz_findFile(workspacePath, fileName) else {
return
}
if appDelegate.application!(NSApplication.sharedApplication(), openFile: filePath) {
dispatch_async(dispatch_get_main_queue()) {
if let textView = KZPluginHelper.editorTextView(inWindow: self.window),
let line = Int(lineNumber) where line >= 1 {
self.scrollTextView(textView, toLine:line)
}
}
}
}
private func scrollTextView(textView: NSTextView, toLine line: Int) {
guard let text = (textView.string as NSString?) else {
return
}
var currentLine = 1
var index = 0
for (; index < text.length; currentLine++) {
let lineRange = text.lineRangeForRange(NSMakeRange(index, 0))
index = NSMaxRange(lineRange)
if currentLine == line {
textView.scrollRangeToVisible(lineRange)
textView.setSelectedRange(lineRange)
break
}
}
}
}
/**
[workspacePath : [fileName : filePath]]
*/
var kz_filePathCache = [String : [String : String]]()
/**
Search for the given filename in the given workspace.
To avoid parsing the project's header file inclusion path,
we use the following heuristic:
1. Look in kz_filePathCache.
2. Look for the file in the current workspace.
3. Look in the parent directory of the current workspace,
excluding the current workspace because we've already searched there.
4. Keep recursing upwards, but stop if we have gone more than 2
levels up or we have reached /foo/bar.
The assumption here is that /foo/bar would actually be /Users/username
and searching the developer's entire home directory is likely to be too
expensive.
Similarly, if the project is in some subdirectory heirarchy, then if
we are three levels up then that search is likely to be large and too
expensive also.
*/
func kz_findFile(workspacePath : String, _ fileName : String) -> String? {
var thisWorkspaceCache = kz_filePathCache[workspacePath] ?? [:]
if let result = thisWorkspaceCache[fileName] {
if NSFileManager.defaultManager().fileExistsAtPath(result) {
return result
}
}
var searchPath = workspacePath
var prevSearchPath : String? = nil
var searchCount = 0
while true {
let result = kz_findFile(fileName, searchPath, prevSearchPath)
if result != nil && !result!.isEmpty {
thisWorkspaceCache[fileName] = result
kz_filePathCache[workspacePath] = thisWorkspaceCache
return result
}
prevSearchPath = searchPath
searchPath = (searchPath as NSString).stringByDeletingLastPathComponent
searchCount++
let searchPathCount = searchPath.componentsSeparatedByString("/").count
if searchPathCount <= 3 || searchCount >= 2 {
return nil
}
}
}
func kz_findFile(fileName : String, _ searchPath : String, _ prevSearchPath : String?) -> String? {
let args = (prevSearchPath == nil ?
["-L", searchPath, "-name", fileName, "-print", "-quit"] :
["-L", searchPath, "-name", prevSearchPath!, "-prune", "-o", "-name", fileName, "-print", "-quit"])
return KZPluginHelper.runShellCommand("/usr/bin/find", arguments: args)
}
| mit |
rshuston/ClosestPointsWorkshop | ClosestPoints/ClosestPointsTests/CombinationSolverTests.swift | 1 | 11703 | //
// CombinationSolverTests.swift
// ClosestPoints
//
// Created by Robert Huston on 12/7/16.
// Copyright © 2016 Pinpoint Dynamics. All rights reserved.
//
import XCTest
@testable import ClosestPoints
class CombinationSolverTests: XCTestCase {
func test_findClosestPoints_ReturnsNilForEmptyPointSet() {
let points: [Point] = []
let subject = CombinationSolver()
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNil(closestPoints)
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_ReturnsNilForInsufficientPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNil(closestPoints)
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_FindsClosestPointsForTrivialPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[0])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[0])
XCTAssertEqual(closestPoints?.1, points[1])
} else {
XCTAssertEqual(closestPoints?.0, points[1])
XCTAssertEqual(closestPoints?.1, points[0])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_CallsMonitorClosureForTrivialPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
var monitorCount = 0
subject.findClosestPoints(points: points, monitor: {
(checkRect: NSRect?, checkPoints: (Point, Point)?, closestPointsSoFar: (Point, Point)?) -> Bool in
monitorCount += 1
XCTAssertNotNil(checkRect)
XCTAssertFalse(NSIsEmptyRect(checkRect!))
XCTAssertNotNil(closestPointsSoFar)
XCTAssertEqual(checkPoints?.0, closestPointsSoFar?.0)
XCTAssertEqual(checkPoints?.1, closestPointsSoFar?.1)
let listOrdered = (closestPointsSoFar?.0 == points[0])
if listOrdered {
XCTAssertEqual(closestPointsSoFar?.0, points[0])
XCTAssertEqual(closestPointsSoFar?.1, points[1])
} else {
XCTAssertEqual(closestPointsSoFar?.0, points[1])
XCTAssertEqual(closestPointsSoFar?.1, points[0])
}
return true
}, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertEqual(monitorCount, 1)
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[0])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[0])
XCTAssertEqual(closestPoints?.1, points[1])
} else {
XCTAssertEqual(closestPoints?.0, points[1])
XCTAssertEqual(closestPoints?.1, points[0])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_FindsClosestPointsForTrinaryPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 100, y: 100))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[0])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[0])
XCTAssertEqual(closestPoints?.1, points[2])
} else {
XCTAssertEqual(closestPoints?.0, points[2])
XCTAssertEqual(closestPoints?.1, points[0])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_CallsMonitorClosureForTrinaryPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 100, y: 100))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
var monitorCount = 0
subject.findClosestPoints(points: points, monitor: {
(checkRect: NSRect?, checkPoints: (Point, Point)?, closestPointsSoFar: (Point, Point)?) -> Bool in
monitorCount += 1
XCTAssertNotNil(closestPointsSoFar)
return true
}, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertEqual(monitorCount, 3) // Combination (nCr) of 3C2 = 3
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[0])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[0])
XCTAssertEqual(closestPoints?.1, points[2])
} else {
XCTAssertEqual(closestPoints?.0, points[2])
XCTAssertEqual(closestPoints?.1, points[0])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_CanAbortFromMonitorClosureForTrinaryPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 100, y: 100))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
var monitorCount = 0
subject.findClosestPoints(points: points, monitor: {
(checkRect: NSRect?, checkPoints: (Point, Point)?, closestPointsSoFar: (Point, Point)?) -> Bool in
monitorCount += 1
XCTAssertNotNil(closestPointsSoFar)
return false
}, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertEqual(monitorCount, 1)
XCTAssertNotNil(closestPoints)
XCTAssertEqual(closestPoints?.0, points[0])
XCTAssertEqual(closestPoints?.1, points[1])
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_FindsClosestPointsForMultiplePointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 100, y: 100))
points.append(Point(x: 10, y: 10))
points.append(Point(x: 101, y: 101))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[1])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[1])
XCTAssertEqual(closestPoints?.1, points[3])
} else {
XCTAssertEqual(closestPoints?.0, points[3])
XCTAssertEqual(closestPoints?.1, points[1])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_CallsMonitorClosureForForMultiplePointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 1, y: 2))
points.append(Point(x: 100, y: 100))
points.append(Point(x: 10, y: 10))
points.append(Point(x: 101, y: 101))
points.append(Point(x: 3, y: 4))
let completionExpectation = expectation(description: "completion")
var monitorCount = 0
subject.findClosestPoints(points: points, monitor: {
(checkRect: NSRect?, checkPoints: (Point, Point)?, closestPointsSoFar: (Point, Point)?) -> Bool in
monitorCount += 1
XCTAssertNotNil(closestPointsSoFar)
return true
}, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertEqual(monitorCount, 10) // Combination (nCr) of 5C2 = 10
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[1])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[1])
XCTAssertEqual(closestPoints?.1, points[3])
} else {
XCTAssertEqual(closestPoints?.0, points[3])
XCTAssertEqual(closestPoints?.1, points[1])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
func test_findClosestPoints_FindsClosestPointsForThirteenPointSet() {
var points: [Point] = []
let subject = CombinationSolver()
points.append(Point(x: 31, y: 17))
points.append(Point(x: 21, y: 23)) // first of closest pair
points.append(Point(x: 3, y: 15))
points.append(Point(x: 15, y: 31))
points.append(Point(x: 35, y: 25))
points.append(Point(x: 29, y: 11))
points.append(Point(x: 17, y: 21)) // second of closest pair
points.append(Point(x: 5, y: 27))
points.append(Point(x: 11, y: 9))
points.append(Point(x: 13, y: 37))
points.append(Point(x: 7, y: 19))
points.append(Point(x: 33, y: 5))
points.append(Point(x: 25, y: 29))
let completionExpectation = expectation(description: "completion")
subject.findClosestPoints(points: points, monitor: nil, completion: {
(closestPoints: (Point, Point)?) -> Void in
XCTAssertNotNil(closestPoints)
let listOrdered = (closestPoints?.0 == points[1])
if listOrdered {
XCTAssertEqual(closestPoints?.0, points[1])
XCTAssertEqual(closestPoints?.1, points[6])
} else {
XCTAssertEqual(closestPoints?.0, points[6])
XCTAssertEqual(closestPoints?.1, points[1])
}
completionExpectation.fulfill()
})
waitForExpectations(timeout: 1.0, handler: nil)
}
}
| mit |
Daltron/Spartan | Example/Spartan/AppDelegate.swift | 1 | 2163 | //
// AppDelegate.swift
// Spartan
//
// Created by dhint4 on 01/15/2017.
// Copyright (c) 2017 dhint4. All rights reserved.
//
import UIKit
@UIApplicationMain
class AppDelegate: UIResponder, UIApplicationDelegate {
var window: UIWindow?
func application(_ application: UIApplication, didFinishLaunchingWithOptions launchOptions: [UIApplicationLaunchOptionsKey: Any]?) -> Bool {
// Override point for customization after application launch.
return true
}
func applicationWillResignActive(_ application: UIApplication) {
// Sent when the application is about to move from active to inactive state. This can occur for certain types of temporary interruptions (such as an incoming phone call or SMS message) or when the user quits the application and it begins the transition to the background state.
// Use this method to pause ongoing tasks, disable timers, and throttle down OpenGL ES frame rates. Games should use this method to pause the game.
}
func applicationDidEnterBackground(_ application: UIApplication) {
// Use this method to release shared resources, save user data, invalidate timers, and store enough application state information to restore your application to its current state in case it is terminated later.
// If your application supports background execution, this method is called instead of applicationWillTerminate: when the user quits.
}
func applicationWillEnterForeground(_ application: UIApplication) {
// Called as part of the transition from the background to the inactive state; here you can undo many of the changes made on entering the background.
}
func applicationDidBecomeActive(_ application: UIApplication) {
// Restart any tasks that were paused (or not yet started) while the application was inactive. If the application was previously in the background, optionally refresh the user interface.
}
func applicationWillTerminate(_ application: UIApplication) {
// Called when the application is about to terminate. Save data if appropriate. See also applicationDidEnterBackground:.
}
}
| mit |
qutheory/vapor | Sources/Vapor/Routing/Application+Routes.swift | 2 | 360 | extension Application {
public var routes: Routes {
if let existing = self.storage[RoutesKey.self] {
return existing
} else {
let new = Routes()
self.storage[RoutesKey.self] = new
return new
}
}
private struct RoutesKey: StorageKey {
typealias Value = Routes
}
}
| mit |
Shopify/mobile-buy-sdk-ios | Buy/Generated/Storefront/CartLine.swift | 1 | 12321 | //
// CartLine.swift
// Buy
//
// Created by Shopify.
// Copyright (c) 2017 Shopify Inc. All rights reserved.
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in
// all copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
// THE SOFTWARE.
//
import Foundation
extension Storefront {
/// Represents information about the merchandise in the cart.
open class CartLineQuery: GraphQL.AbstractQuery, GraphQLQuery {
public typealias Response = CartLine
/// An attribute associated with the cart line.
///
/// - parameters:
/// - key: The key of the attribute.
///
@discardableResult
open func attribute(alias: String? = nil, key: String, _ subfields: (AttributeQuery) -> Void) -> CartLineQuery {
var args: [String] = []
args.append("key:\(GraphQL.quoteString(input: key))")
let argsString = "(\(args.joined(separator: ",")))"
let subquery = AttributeQuery()
subfields(subquery)
addField(field: "attribute", aliasSuffix: alias, args: argsString, subfields: subquery)
return self
}
/// The attributes associated with the cart line. Attributes are represented as
/// key-value pairs.
@discardableResult
open func attributes(alias: String? = nil, _ subfields: (AttributeQuery) -> Void) -> CartLineQuery {
let subquery = AttributeQuery()
subfields(subquery)
addField(field: "attributes", aliasSuffix: alias, subfields: subquery)
return self
}
/// The cost of the merchandise that the buyer will pay for at checkout. The
/// costs are subject to change and changes will be reflected at checkout.
@discardableResult
open func cost(alias: String? = nil, _ subfields: (CartLineCostQuery) -> Void) -> CartLineQuery {
let subquery = CartLineCostQuery()
subfields(subquery)
addField(field: "cost", aliasSuffix: alias, subfields: subquery)
return self
}
/// The discounts that have been applied to the cart line.
@discardableResult
open func discountAllocations(alias: String? = nil, _ subfields: (CartDiscountAllocationQuery) -> Void) -> CartLineQuery {
let subquery = CartDiscountAllocationQuery()
subfields(subquery)
addField(field: "discountAllocations", aliasSuffix: alias, subfields: subquery)
return self
}
/// The estimated cost of the merchandise that the buyer will pay for at
/// checkout. The estimated costs are subject to change and changes will be
/// reflected at checkout.
@available(*, deprecated, message:"Use `cost` instead.")
@discardableResult
open func estimatedCost(alias: String? = nil, _ subfields: (CartLineEstimatedCostQuery) -> Void) -> CartLineQuery {
let subquery = CartLineEstimatedCostQuery()
subfields(subquery)
addField(field: "estimatedCost", aliasSuffix: alias, subfields: subquery)
return self
}
/// A globally-unique identifier.
@discardableResult
open func id(alias: String? = nil) -> CartLineQuery {
addField(field: "id", aliasSuffix: alias)
return self
}
/// The merchandise that the buyer intends to purchase.
@discardableResult
open func merchandise(alias: String? = nil, _ subfields: (MerchandiseQuery) -> Void) -> CartLineQuery {
let subquery = MerchandiseQuery()
subfields(subquery)
addField(field: "merchandise", aliasSuffix: alias, subfields: subquery)
return self
}
/// The quantity of the merchandise that the customer intends to purchase.
@discardableResult
open func quantity(alias: String? = nil) -> CartLineQuery {
addField(field: "quantity", aliasSuffix: alias)
return self
}
/// The selling plan associated with the cart line and the effect that each
/// selling plan has on variants when they're purchased.
@discardableResult
open func sellingPlanAllocation(alias: String? = nil, _ subfields: (SellingPlanAllocationQuery) -> Void) -> CartLineQuery {
let subquery = SellingPlanAllocationQuery()
subfields(subquery)
addField(field: "sellingPlanAllocation", aliasSuffix: alias, subfields: subquery)
return self
}
}
/// Represents information about the merchandise in the cart.
open class CartLine: GraphQL.AbstractResponse, GraphQLObject, Node {
public typealias Query = CartLineQuery
internal override func deserializeValue(fieldName: String, value: Any) throws -> Any? {
let fieldValue = value
switch fieldName {
case "attribute":
if value is NSNull { return nil }
guard let value = value as? [String: Any] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try Attribute(fields: value)
case "attributes":
guard let value = value as? [[String: Any]] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try value.map { return try Attribute(fields: $0) }
case "cost":
guard let value = value as? [String: Any] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try CartLineCost(fields: value)
case "discountAllocations":
guard let value = value as? [[String: Any]] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try value.map { return try UnknownCartDiscountAllocation.create(fields: $0) }
case "estimatedCost":
guard let value = value as? [String: Any] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try CartLineEstimatedCost(fields: value)
case "id":
guard let value = value as? String else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return GraphQL.ID(rawValue: value)
case "merchandise":
guard let value = value as? [String: Any] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try UnknownMerchandise.create(fields: value)
case "quantity":
guard let value = value as? Int else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return Int32(value)
case "sellingPlanAllocation":
if value is NSNull { return nil }
guard let value = value as? [String: Any] else {
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
return try SellingPlanAllocation(fields: value)
default:
throw SchemaViolationError(type: CartLine.self, field: fieldName, value: fieldValue)
}
}
/// An attribute associated with the cart line.
open var attribute: Storefront.Attribute? {
return internalGetAttribute()
}
open func aliasedAttribute(alias: String) -> Storefront.Attribute? {
return internalGetAttribute(alias: alias)
}
func internalGetAttribute(alias: String? = nil) -> Storefront.Attribute? {
return field(field: "attribute", aliasSuffix: alias) as! Storefront.Attribute?
}
/// The attributes associated with the cart line. Attributes are represented as
/// key-value pairs.
open var attributes: [Storefront.Attribute] {
return internalGetAttributes()
}
func internalGetAttributes(alias: String? = nil) -> [Storefront.Attribute] {
return field(field: "attributes", aliasSuffix: alias) as! [Storefront.Attribute]
}
/// The cost of the merchandise that the buyer will pay for at checkout. The
/// costs are subject to change and changes will be reflected at checkout.
open var cost: Storefront.CartLineCost {
return internalGetCost()
}
func internalGetCost(alias: String? = nil) -> Storefront.CartLineCost {
return field(field: "cost", aliasSuffix: alias) as! Storefront.CartLineCost
}
/// The discounts that have been applied to the cart line.
open var discountAllocations: [CartDiscountAllocation] {
return internalGetDiscountAllocations()
}
func internalGetDiscountAllocations(alias: String? = nil) -> [CartDiscountAllocation] {
return field(field: "discountAllocations", aliasSuffix: alias) as! [CartDiscountAllocation]
}
/// The estimated cost of the merchandise that the buyer will pay for at
/// checkout. The estimated costs are subject to change and changes will be
/// reflected at checkout.
@available(*, deprecated, message:"Use `cost` instead.")
open var estimatedCost: Storefront.CartLineEstimatedCost {
return internalGetEstimatedCost()
}
func internalGetEstimatedCost(alias: String? = nil) -> Storefront.CartLineEstimatedCost {
return field(field: "estimatedCost", aliasSuffix: alias) as! Storefront.CartLineEstimatedCost
}
/// A globally-unique identifier.
open var id: GraphQL.ID {
return internalGetId()
}
func internalGetId(alias: String? = nil) -> GraphQL.ID {
return field(field: "id", aliasSuffix: alias) as! GraphQL.ID
}
/// The merchandise that the buyer intends to purchase.
open var merchandise: Merchandise {
return internalGetMerchandise()
}
func internalGetMerchandise(alias: String? = nil) -> Merchandise {
return field(field: "merchandise", aliasSuffix: alias) as! Merchandise
}
/// The quantity of the merchandise that the customer intends to purchase.
open var quantity: Int32 {
return internalGetQuantity()
}
func internalGetQuantity(alias: String? = nil) -> Int32 {
return field(field: "quantity", aliasSuffix: alias) as! Int32
}
/// The selling plan associated with the cart line and the effect that each
/// selling plan has on variants when they're purchased.
open var sellingPlanAllocation: Storefront.SellingPlanAllocation? {
return internalGetSellingPlanAllocation()
}
func internalGetSellingPlanAllocation(alias: String? = nil) -> Storefront.SellingPlanAllocation? {
return field(field: "sellingPlanAllocation", aliasSuffix: alias) as! Storefront.SellingPlanAllocation?
}
internal override func childResponseObjectMap() -> [GraphQL.AbstractResponse] {
var response: [GraphQL.AbstractResponse] = []
objectMap.keys.forEach {
switch($0) {
case "attribute":
if let value = internalGetAttribute() {
response.append(value)
response.append(contentsOf: value.childResponseObjectMap())
}
case "attributes":
internalGetAttributes().forEach {
response.append($0)
response.append(contentsOf: $0.childResponseObjectMap())
}
case "cost":
response.append(internalGetCost())
response.append(contentsOf: internalGetCost().childResponseObjectMap())
case "discountAllocations":
internalGetDiscountAllocations().forEach {
response.append(($0 as! GraphQL.AbstractResponse))
response.append(contentsOf: ($0 as! GraphQL.AbstractResponse).childResponseObjectMap())
}
case "estimatedCost":
response.append(internalGetEstimatedCost())
response.append(contentsOf: internalGetEstimatedCost().childResponseObjectMap())
case "merchandise":
response.append((internalGetMerchandise() as! GraphQL.AbstractResponse))
response.append(contentsOf: (internalGetMerchandise() as! GraphQL.AbstractResponse).childResponseObjectMap())
case "sellingPlanAllocation":
if let value = internalGetSellingPlanAllocation() {
response.append(value)
response.append(contentsOf: value.childResponseObjectMap())
}
default:
break
}
}
return response
}
}
}
| mit |
victor-pavlychko/SwiftyTasks | SwiftyTasks/Tasks/AsyncBlockTask.swift | 1 | 2916 | //
// AsyncBlockTask.swift
// SwiftyTasks
//
// Created by Victor Pavlychko on 9/12/16.
// Copyright © 2016 address.wtf. All rights reserved.
//
import Foundation
/// `AsyncTask` subclass to wrap any asynchronous code block into an `AsyncTask`
public final class AsyncBlockTask<ResultType>: AsyncTask<ResultType> {
private var _block: ((AsyncBlockTask<ResultType>) throws -> Void)!
/// Initializes `AsyncBlockTask` with a code block tacking completion handler with result
///
/// - Parameters:
/// - block: code block
/// - completionBlock: completion handler passed to the code block
/// - result: task result returned from the code block
/// - Returns: Newly created `AsyncBlockTask` instance
public init(_ block: @escaping (_ completionBlock: @escaping (_ result: ResultType) -> Void) throws -> Void) {
_block = { try block($0.finish) }
}
/// Initializes `AsyncBlockTask` with a code block tacking completion handler with optional result and error
///
/// - Parameters:
/// - block: code block
/// - completionBlock: completion handler passed to the code block
/// - result: task result returned from the code block
/// - error: task error returned from the code block
/// - Returns: Newly created `AsyncBlockTask` instance
public init(_ block: @escaping (_ completionBlock: @escaping (_ result: ResultType?, _ error: Error?) -> Void) throws -> Void) {
_block = { try block($0.finish) }
}
/// Initializes `AsyncBlockTask` with a code block tacking completion handler with optional result
///
/// - Parameters:
/// - block: code block
/// - completionBlock: completion handler passed to the code block
/// - result: optional task result returned from the code block
/// - Returns: Newly created `AsyncBlockTask` instance
public init(_ block: @escaping (_ completionBlock: @escaping (_ result: ResultType?) -> Void) throws -> Void) {
_block = { try block($0.finish) }
}
/// Initializes `AsyncBlockTask` with a code block tacking completion handler with a result block
///
/// - Parameters:
/// - block: code block
/// - completionBlock: completion handler passed to the code block
/// - resultBlock: task result returned from the code block
/// - Returns: Newly created `AsyncBlockTask` instance
public init(_ block: @escaping (_ completionBlock: @escaping (_ resultBlock: () throws -> ResultType) -> Void) throws -> Void) {
_block = { try block($0.finish) }
}
/// Starts execution. Do not call this method yourself.
public override func main() {
do {
try _block(self)
_block = nil
} catch {
finish(error: error)
}
}
}
| mit |
mparrish91/gifRecipes | framework/vendor/MiniKeychain/MiniKeychain/MiniKeychain.swift | 1 | 66344 | //
// MiniKeychain.swift
// MiniKeychain
//
// Created by sonson on 2016/08/18.
// Copyright © 2016年 sonson. All rights reserved.
//
#if os(iOS) || os(tvOS)
import UIKit
#elseif os(macOS)
import Cocoa
#endif
import Security
class MiniKeychain {
let service: String?
let accessGroup: String?
public init() {
self.service = nil
self.accessGroup = nil
}
public init(service: String) {
self.service = service
self.accessGroup = nil
}
public init(accessGroup: String) {
if let bundleIdentifier = Bundle.main.bundleIdentifier {
self.service = bundleIdentifier
} else {
self.service = nil
}
self.accessGroup = accessGroup
}
public init(service: String, accessGroup: String) {
self.service = service
self.accessGroup = accessGroup
}
func getDefaultQuery() -> [String: Any] {
var query: [String: Any] = [kSecClass as String: kSecClassGenericPassword as String]
if let service = self.service {
query[kSecAttrService as String] = service
}
query[kSecAttrSynchronizable as String] = kSecAttrSynchronizableAny as String
// Access group is not supported on any simulators.
#if (!arch(i386) && !arch(x86_64)) || (!os(iOS) && !os(watchOS) && !os(tvOS))
if let accessGroup = self.accessGroup {
query[kSecAttrAccessGroup as String] = accessGroup
}
#endif
return query
}
public func save(key: String, data: Data) throws {
var query = getDefaultQuery()
query[kSecAttrAccount as String] = key
query[kSecValueData as String] = data
SecItemDelete(query as CFDictionary)
let status: OSStatus = SecItemAdd(query as CFDictionary, nil)
let message = Status(status: status).description
if status != noErr {
let error = NSError(domain: "a", code: Int(status), userInfo: [NSLocalizedDescriptionKey: message])
print("OSStatus error:[\(error.code)] \(error.localizedDescription)")
throw error
}
}
public func data(of key: String) throws -> Data {
var query = getDefaultQuery()
query[kSecAttrAccount as String] = key
query[kSecReturnData as String] = kCFBooleanTrue
query[kSecMatchLimit as String] = kSecMatchLimitOne
if let service = service {
query[kSecAttrService as String] = service
}
var result: AnyObject?
let status = withUnsafeMutablePointer(to: &result) { SecItemCopyMatching(query as CFDictionary, UnsafeMutablePointer($0)) }
if status == noErr {
if let data = result as? Data {
return data
} else {
let error = NSError(domain: "a", code: Int(1), userInfo: [NSLocalizedDescriptionKey: "a"])
throw error
}
} else {
let message = Status(status: status).description
let error = NSError(domain: "a", code: Int(status), userInfo: [NSLocalizedDescriptionKey: message])
print("OSStatus error:[\(error.code)] \(error.localizedDescription)")
throw error
}
}
public func keys() throws -> [String] {
var query = getDefaultQuery()
query[kSecReturnData as String] = kCFBooleanFalse
query[kSecReturnAttributes as String] = kCFBooleanTrue
query[kSecMatchLimit as String] = kSecMatchLimitAll
if let service = service {
query[kSecAttrService as String] = service
}
var result: AnyObject?
let status = withUnsafeMutablePointer(to: &result) { SecItemCopyMatching(query as CFDictionary, UnsafeMutablePointer($0)) }
let message = Status(status: status).description
let error = NSError(domain: "a", code: Int(status), userInfo: [NSLocalizedDescriptionKey: message])
print("OSStatus error:[\(error.code)] \(error.localizedDescription)")
switch status {
case noErr:
if let dictionaries = result as? [[String: Any]] {
return dictionaries.flatMap({$0["acct"] as? String})
} else {
let error = NSError(domain: "a", code: Int(Status.unexpectedError.rawValue), userInfo: [NSLocalizedDescriptionKey: ""])
throw error
}
case errSecItemNotFound:
return []
default:
throw error
}
}
@discardableResult
public func delete(key: String) -> Bool {
var query = getDefaultQuery()
query[kSecAttrAccount as String] = key
let status: OSStatus = SecItemDelete(query as CFDictionary)
return status == noErr
}
@discardableResult
public func clear() -> Bool {
let query = getDefaultQuery()
let status: OSStatus = SecItemDelete(query as CFDictionary)
return status == noErr
}
}
public enum Status: OSStatus, Error {
case success = 0
case unimplemented = -4
case diskFull = -34
case io = -36
case opWr = -49
case param = -50
case wrPerm = -61
case allocate = -108
case userCanceled = -128
case badReq = -909
case internalComponent = -2070
case notAvailable = -25291
case readOnly = -25292
case authFailed = -25293
case noSuchKeychain = -25294
case invalidKeychain = -25295
case duplicateKeychain = -25296
case duplicateCallback = -25297
case invalidCallback = -25298
case duplicateItem = -25299
case itemNotFound = -25300
case bufferTooSmall = -25301
case dataTooLarge = -25302
case noSuchAttr = -25303
case invalidItemRef = -25304
case invalidSearchRef = -25305
case noSuchClass = -25306
case noDefaultKeychain = -25307
case interactionNotAllowed = -25308
case readOnlyAttr = -25309
case wrongSecVersion = -25310
case keySizeNotAllowed = -25311
case noStorageModule = -25312
case noCertificateModule = -25313
case noPolicyModule = -25314
case interactionRequired = -25315
case dataNotAvailable = -25316
case dataNotModifiable = -25317
case createChainFailed = -25318
case invalidPrefsDomain = -25319
case inDarkWake = -25320
case aclNotSimple = -25240
case policyNotFound = -25241
case invalidTrustSetting = -25242
case noAccessForItem = -25243
case invalidOwnerEdit = -25244
case trustNotAvailable = -25245
case unsupportedFormat = -25256
case unknownFormat = -25257
case keyIsSensitive = -25258
case multiplePrivKeys = -25259
case passphraseRequired = -25260
case invalidPasswordRef = -25261
case invalidTrustSettings = -25262
case noTrustSettings = -25263
case pkcs12VerifyFailure = -25264
case invalidCertificate = -26265
case notSigner = -26267
case policyDenied = -26270
case invalidKey = -26274
case decode = -26275
case `internal` = -26276
case unsupportedAlgorithm = -26268
case unsupportedOperation = -26271
case unsupportedPadding = -26273
case itemInvalidKey = -34000
case itemInvalidKeyType = -34001
case itemInvalidValue = -34002
case itemClassMissing = -34003
case itemMatchUnsupported = -34004
case useItemListUnsupported = -34005
case useKeychainUnsupported = -34006
case useKeychainListUnsupported = -34007
case returnDataUnsupported = -34008
case returnAttributesUnsupported = -34009
case returnRefUnsupported = -34010
case returnPersitentRefUnsupported = -34011
case valueRefUnsupported = -34012
case valuePersistentRefUnsupported = -34013
case returnMissingPointer = -34014
case matchLimitUnsupported = -34015
case itemIllegalQuery = -34016
case waitForCallback = -34017
case missingEntitlement = -34018
case upgradePending = -34019
case mpSignatureInvalid = -25327
case otrTooOld = -25328
case otrIDTooNew = -25329
case serviceNotAvailable = -67585
case insufficientClientID = -67586
case deviceReset = -67587
case deviceFailed = -67588
case appleAddAppACLSubject = -67589
case applePublicKeyIncomplete = -67590
case appleSignatureMismatch = -67591
case appleInvalidKeyStartDate = -67592
case appleInvalidKeyEndDate = -67593
case conversionError = -67594
case appleSSLv2Rollback = -67595
case quotaExceeded = -67596
case fileTooBig = -67597
case invalidDatabaseBlob = -67598
case invalidKeyBlob = -67599
case incompatibleDatabaseBlob = -67600
case incompatibleKeyBlob = -67601
case hostNameMismatch = -67602
case unknownCriticalExtensionFlag = -67603
case noBasicConstraints = -67604
case noBasicConstraintsCA = -67605
case invalidAuthorityKeyID = -67606
case invalidSubjectKeyID = -67607
case invalidKeyUsageForPolicy = -67608
case invalidExtendedKeyUsage = -67609
case invalidIDLinkage = -67610
case pathLengthConstraintExceeded = -67611
case invalidRoot = -67612
case crlExpired = -67613
case crlNotValidYet = -67614
case crlNotFound = -67615
case crlServerDown = -67616
case crlBadURI = -67617
case unknownCertExtension = -67618
case unknownCRLExtension = -67619
case crlNotTrusted = -67620
case crlPolicyFailed = -67621
case idpFailure = -67622
case smimeEmailAddressesNotFound = -67623
case smimeBadExtendedKeyUsage = -67624
case smimeBadKeyUsage = -67625
case smimeKeyUsageNotCritical = -67626
case smimeNoEmailAddress = -67627
case smimeSubjAltNameNotCritical = -67628
case sslBadExtendedKeyUsage = -67629
case ocspBadResponse = -67630
case ocspBadRequest = -67631
case ocspUnavailable = -67632
case ocspStatusUnrecognized = -67633
case endOfData = -67634
case incompleteCertRevocationCheck = -67635
case networkFailure = -67636
case ocspNotTrustedToAnchor = -67637
case recordModified = -67638
case ocspSignatureError = -67639
case ocspNoSigner = -67640
case ocspResponderMalformedReq = -67641
case ocspResponderInternalError = -67642
case ocspResponderTryLater = -67643
case ocspResponderSignatureRequired = -67644
case ocspResponderUnauthorized = -67645
case ocspResponseNonceMismatch = -67646
case codeSigningBadCertChainLength = -67647
case codeSigningNoBasicConstraints = -67648
case codeSigningBadPathLengthConstraint = -67649
case codeSigningNoExtendedKeyUsage = -67650
case codeSigningDevelopment = -67651
case resourceSignBadCertChainLength = -67652
case resourceSignBadExtKeyUsage = -67653
case trustSettingDeny = -67654
case invalidSubjectName = -67655
case unknownQualifiedCertStatement = -67656
case mobileMeRequestQueued = -67657
case mobileMeRequestRedirected = -67658
case mobileMeServerError = -67659
case mobileMeServerNotAvailable = -67660
case mobileMeServerAlreadyExists = -67661
case mobileMeServerServiceErr = -67662
case mobileMeRequestAlreadyPending = -67663
case mobileMeNoRequestPending = -67664
case mobileMeCSRVerifyFailure = -67665
case mobileMeFailedConsistencyCheck = -67666
case notInitialized = -67667
case invalidHandleUsage = -67668
case pvcReferentNotFound = -67669
case functionIntegrityFail = -67670
case internalError = -67671
case memoryError = -67672
case invalidData = -67673
case mdsError = -67674
case invalidPointer = -67675
case selfCheckFailed = -67676
case functionFailed = -67677
case moduleManifestVerifyFailed = -67678
case invalidGUID = -67679
case invalidHandle = -67680
case invalidDBList = -67681
case invalidPassthroughID = -67682
case invalidNetworkAddress = -67683
case crlAlreadySigned = -67684
case invalidNumberOfFields = -67685
case verificationFailure = -67686
case unknownTag = -67687
case invalidSignature = -67688
case invalidName = -67689
case invalidCertificateRef = -67690
case invalidCertificateGroup = -67691
case tagNotFound = -67692
case invalidQuery = -67693
case invalidValue = -67694
case callbackFailed = -67695
case aclDeleteFailed = -67696
case aclReplaceFailed = -67697
case aclAddFailed = -67698
case aclChangeFailed = -67699
case invalidAccessCredentials = -67700
case invalidRecord = -67701
case invalidACL = -67702
case invalidSampleValue = -67703
case incompatibleVersion = -67704
case privilegeNotGranted = -67705
case invalidScope = -67706
case pvcAlreadyConfigured = -67707
case invalidPVC = -67708
case emmLoadFailed = -67709
case emmUnloadFailed = -67710
case addinLoadFailed = -67711
case invalidKeyRef = -67712
case invalidKeyHierarchy = -67713
case addinUnloadFailed = -67714
case libraryReferenceNotFound = -67715
case invalidAddinFunctionTable = -67716
case invalidServiceMask = -67717
case moduleNotLoaded = -67718
case invalidSubServiceID = -67719
case attributeNotInContext = -67720
case moduleManagerInitializeFailed = -67721
case moduleManagerNotFound = -67722
case eventNotificationCallbackNotFound = -67723
case inputLengthError = -67724
case outputLengthError = -67725
case privilegeNotSupported = -67726
case deviceError = -67727
case attachHandleBusy = -67728
case notLoggedIn = -67729
case algorithmMismatch = -67730
case keyUsageIncorrect = -67731
case keyBlobTypeIncorrect = -67732
case keyHeaderInconsistent = -67733
case unsupportedKeyFormat = -67734
case unsupportedKeySize = -67735
case invalidKeyUsageMask = -67736
case unsupportedKeyUsageMask = -67737
case invalidKeyAttributeMask = -67738
case unsupportedKeyAttributeMask = -67739
case invalidKeyLabel = -67740
case unsupportedKeyLabel = -67741
case invalidKeyFormat = -67742
case unsupportedVectorOfBuffers = -67743
case invalidInputVector = -67744
case invalidOutputVector = -67745
case invalidContext = -67746
case invalidAlgorithm = -67747
case invalidAttributeKey = -67748
case missingAttributeKey = -67749
case invalidAttributeInitVector = -67750
case missingAttributeInitVector = -67751
case invalidAttributeSalt = -67752
case missingAttributeSalt = -67753
case invalidAttributePadding = -67754
case missingAttributePadding = -67755
case invalidAttributeRandom = -67756
case missingAttributeRandom = -67757
case invalidAttributeSeed = -67758
case missingAttributeSeed = -67759
case invalidAttributePassphrase = -67760
case missingAttributePassphrase = -67761
case invalidAttributeKeyLength = -67762
case missingAttributeKeyLength = -67763
case invalidAttributeBlockSize = -67764
case missingAttributeBlockSize = -67765
case invalidAttributeOutputSize = -67766
case missingAttributeOutputSize = -67767
case invalidAttributeRounds = -67768
case missingAttributeRounds = -67769
case invalidAlgorithmParms = -67770
case missingAlgorithmParms = -67771
case invalidAttributeLabel = -67772
case missingAttributeLabel = -67773
case invalidAttributeKeyType = -67774
case missingAttributeKeyType = -67775
case invalidAttributeMode = -67776
case missingAttributeMode = -67777
case invalidAttributeEffectiveBits = -67778
case missingAttributeEffectiveBits = -67779
case invalidAttributeStartDate = -67780
case missingAttributeStartDate = -67781
case invalidAttributeEndDate = -67782
case missingAttributeEndDate = -67783
case invalidAttributeVersion = -67784
case missingAttributeVersion = -67785
case invalidAttributePrime = -67786
case missingAttributePrime = -67787
case invalidAttributeBase = -67788
case missingAttributeBase = -67789
case invalidAttributeSubprime = -67790
case missingAttributeSubprime = -67791
case invalidAttributeIterationCount = -67792
case missingAttributeIterationCount = -67793
case invalidAttributeDLDBHandle = -67794
case missingAttributeDLDBHandle = -67795
case invalidAttributeAccessCredentials = -67796
case missingAttributeAccessCredentials = -67797
case invalidAttributePublicKeyFormat = -67798
case missingAttributePublicKeyFormat = -67799
case invalidAttributePrivateKeyFormat = -67800
case missingAttributePrivateKeyFormat = -67801
case invalidAttributeSymmetricKeyFormat = -67802
case missingAttributeSymmetricKeyFormat = -67803
case invalidAttributeWrappedKeyFormat = -67804
case missingAttributeWrappedKeyFormat = -67805
case stagedOperationInProgress = -67806
case stagedOperationNotStarted = -67807
case verifyFailed = -67808
case querySizeUnknown = -67809
case blockSizeMismatch = -67810
case publicKeyInconsistent = -67811
case deviceVerifyFailed = -67812
case invalidLoginName = -67813
case alreadyLoggedIn = -67814
case invalidDigestAlgorithm = -67815
case invalidCRLGroup = -67816
case certificateCannotOperate = -67817
case certificateExpired = -67818
case certificateNotValidYet = -67819
case certificateRevoked = -67820
case certificateSuspended = -67821
case insufficientCredentials = -67822
case invalidAction = -67823
case invalidAuthority = -67824
case verifyActionFailed = -67825
case invalidCertAuthority = -67826
case invaldCRLAuthority = -67827
case invalidCRLEncoding = -67828
case invalidCRLType = -67829
case invalidCRL = -67830
case invalidFormType = -67831
case invalidID = -67832
case invalidIdentifier = -67833
case invalidIndex = -67834
case invalidPolicyIdentifiers = -67835
case invalidTimeString = -67836
case invalidReason = -67837
case invalidRequestInputs = -67838
case invalidResponseVector = -67839
case invalidStopOnPolicy = -67840
case invalidTuple = -67841
case multipleValuesUnsupported = -67842
case notTrusted = -67843
case noDefaultAuthority = -67844
case rejectedForm = -67845
case requestLost = -67846
case requestRejected = -67847
case unsupportedAddressType = -67848
case unsupportedService = -67849
case invalidTupleGroup = -67850
case invalidBaseACLs = -67851
case invalidTupleCredendtials = -67852
case invalidEncoding = -67853
case invalidValidityPeriod = -67854
case invalidRequestor = -67855
case requestDescriptor = -67856
case invalidBundleInfo = -67857
case invalidCRLIndex = -67858
case noFieldValues = -67859
case unsupportedFieldFormat = -67860
case unsupportedIndexInfo = -67861
case unsupportedLocality = -67862
case unsupportedNumAttributes = -67863
case unsupportedNumIndexes = -67864
case unsupportedNumRecordTypes = -67865
case fieldSpecifiedMultiple = -67866
case incompatibleFieldFormat = -67867
case invalidParsingModule = -67868
case databaseLocked = -67869
case datastoreIsOpen = -67870
case missingValue = -67871
case unsupportedQueryLimits = -67872
case unsupportedNumSelectionPreds = -67873
case unsupportedOperator = -67874
case invalidDBLocation = -67875
case invalidAccessRequest = -67876
case invalidIndexInfo = -67877
case invalidNewOwner = -67878
case invalidModifyMode = -67879
case missingRequiredExtension = -67880
case extendedKeyUsageNotCritical = -67881
case timestampMissing = -67882
case timestampInvalid = -67883
case timestampNotTrusted = -67884
case timestampServiceNotAvailable = -67885
case timestampBadAlg = -67886
case timestampBadRequest = -67887
case timestampBadDataFormat = -67888
case timestampTimeNotAvailable = -67889
case timestampUnacceptedPolicy = -67890
case timestampUnacceptedExtension = -67891
case timestampAddInfoNotAvailable = -67892
case timestampSystemFailure = -67893
case signingTimeMissing = -67894
case timestampRejection = -67895
case timestampWaiting = -67896
case timestampRevocationWarning = -67897
case timestampRevocationNotification = -67898
case unexpectedError = -99999
}
extension Status: RawRepresentable, CustomStringConvertible {
public init(status: OSStatus) {
if let mappedStatus = Status(rawValue: status) {
self = mappedStatus
} else {
self = .unexpectedError
}
}
public var description: String {
switch self {
case .success:
return "No error."
case .unimplemented:
return "Function or operation not implemented."
case .diskFull:
return "The disk is full."
case .io:
return "I/O error (bummers)"
case .opWr:
return "file already open with with write permission"
case .param:
return "One or more parameters passed to a function were not valid."
case .wrPerm:
return "write permissions error"
case .allocate:
return "Failed to allocate memory."
case .userCanceled:
return "User canceled the operation."
case .badReq:
return "Bad parameter or invalid state for operation."
case .internalComponent:
return ""
case .notAvailable:
return "No keychain is available. You may need to restart your computer."
case .readOnly:
return "This keychain cannot be modified."
case .authFailed:
return "The user name or passphrase you entered is not correct."
case .noSuchKeychain:
return "The specified keychain could not be found."
case .invalidKeychain:
return "The specified keychain is not a valid keychain file."
case .duplicateKeychain:
return "A keychain with the same name already exists."
case .duplicateCallback:
return "The specified callback function is already installed."
case .invalidCallback:
return "The specified callback function is not valid."
case .duplicateItem:
return "The specified item already exists in the keychain."
case .itemNotFound:
return "The specified item could not be found in the keychain."
case .bufferTooSmall:
return "There is not enough memory available to use the specified item."
case .dataTooLarge:
return "This item contains information which is too large or in a format that cannot be displayed."
case .noSuchAttr:
return "The specified attribute does not exist."
case .invalidItemRef:
return "The specified item is no longer valid. It may have been deleted from the keychain."
case .invalidSearchRef:
return "Unable to search the current keychain."
case .noSuchClass:
return "The specified item does not appear to be a valid keychain item."
case .noDefaultKeychain:
return "A default keychain could not be found."
case .interactionNotAllowed:
return "User interaction is not allowed."
case .readOnlyAttr:
return "The specified attribute could not be modified."
case .wrongSecVersion:
return "This keychain was created by a different version of the system software and cannot be opened."
case .keySizeNotAllowed:
return "This item specifies a key size which is too large."
case .noStorageModule:
return "A required component (data storage module) could not be loaded. You may need to restart your computer."
case .noCertificateModule:
return "A required component (certificate module) could not be loaded. You may need to restart your computer."
case .noPolicyModule:
return "A required component (policy module) could not be loaded. You may need to restart your computer."
case .interactionRequired:
return "User interaction is required, but is currently not allowed."
case .dataNotAvailable:
return "The contents of this item cannot be retrieved."
case .dataNotModifiable:
return "The contents of this item cannot be modified."
case .createChainFailed:
return "One or more certificates required to validate this certificate cannot be found."
case .invalidPrefsDomain:
return "The specified preferences domain is not valid."
case .inDarkWake:
return "In dark wake, no UI possible"
case .aclNotSimple:
return "The specified access control list is not in standard (simple) form."
case .policyNotFound:
return "The specified policy cannot be found."
case .invalidTrustSetting:
return "The specified trust setting is invalid."
case .noAccessForItem:
return "The specified item has no access control."
case .invalidOwnerEdit:
return "Invalid attempt to change the owner of this item."
case .trustNotAvailable:
return "No trust results are available."
case .unsupportedFormat:
return "Import/Export format unsupported."
case .unknownFormat:
return "Unknown format in import."
case .keyIsSensitive:
return "Key material must be wrapped for export."
case .multiplePrivKeys:
return "An attempt was made to import multiple private keys."
case .passphraseRequired:
return "Passphrase is required for import/export."
case .invalidPasswordRef:
return "The password reference was invalid."
case .invalidTrustSettings:
return "The Trust Settings Record was corrupted."
case .noTrustSettings:
return "No Trust Settings were found."
case .pkcs12VerifyFailure:
return "MAC verification failed during PKCS12 import (wrong password?)"
case .invalidCertificate:
return "This certificate could not be decoded."
case .notSigner:
return "A certificate was not signed by its proposed parent."
case .policyDenied:
return "The certificate chain was not trusted due to a policy not accepting it."
case .invalidKey:
return "The provided key material was not valid."
case .decode:
return "Unable to decode the provided data."
case .`internal`:
return "An internal error occurred in the Security framework."
case .unsupportedAlgorithm:
return "An unsupported algorithm was encountered."
case .unsupportedOperation:
return "The operation you requested is not supported by this key."
case .unsupportedPadding:
return "The padding you requested is not supported."
case .itemInvalidKey:
return "A string key in dictionary is not one of the supported keys."
case .itemInvalidKeyType:
return "A key in a dictionary is neither a CFStringRef nor a CFNumberRef."
case .itemInvalidValue:
return "A value in a dictionary is an invalid (or unsupported) CF type."
case .itemClassMissing:
return "No kSecItemClass key was specified in a dictionary."
case .itemMatchUnsupported:
return "The caller passed one or more kSecMatch keys to a function which does not support matches."
case .useItemListUnsupported:
return "The caller passed in a kSecUseItemList key to a function which does not support it."
case .useKeychainUnsupported:
return "The caller passed in a kSecUseKeychain key to a function which does not support it."
case .useKeychainListUnsupported:
return "The caller passed in a kSecUseKeychainList key to a function which does not support it."
case .returnDataUnsupported:
return "The caller passed in a kSecReturnData key to a function which does not support it."
case .returnAttributesUnsupported:
return "The caller passed in a kSecReturnAttributes key to a function which does not support it."
case .returnRefUnsupported:
return "The caller passed in a kSecReturnRef key to a function which does not support it."
case .returnPersitentRefUnsupported:
return "The caller passed in a kSecReturnPersistentRef key to a function which does not support it."
case .valueRefUnsupported:
return "The caller passed in a kSecValueRef key to a function which does not support it."
case .valuePersistentRefUnsupported:
return "The caller passed in a kSecValuePersistentRef key to a function which does not support it."
case .returnMissingPointer:
return "The caller passed asked for something to be returned but did not pass in a result pointer."
case .matchLimitUnsupported:
return "The caller passed in a kSecMatchLimit key to a call which does not support limits."
case .itemIllegalQuery:
return "The caller passed in a query which contained too many keys."
case .waitForCallback:
return "This operation is incomplete, until the callback is invoked (not an error)."
case .missingEntitlement:
return "Internal error when a required entitlement isn't present, client has neither application-identifier nor keychain-access-groups entitlements."
case .upgradePending:
return "Error returned if keychain database needs a schema migration but the device is locked, clients should wait for a device unlock notification and retry the command."
case .mpSignatureInvalid:
return "Signature invalid on MP message"
case .otrTooOld:
return "Message is too old to use"
case .otrIDTooNew:
return "Key ID is too new to use! Message from the future?"
case .serviceNotAvailable:
return "The required service is not available."
case .insufficientClientID:
return "The client ID is not correct."
case .deviceReset:
return "A device reset has occurred."
case .deviceFailed:
return "A device failure has occurred."
case .appleAddAppACLSubject:
return "Adding an application ACL subject failed."
case .applePublicKeyIncomplete:
return "The public key is incomplete."
case .appleSignatureMismatch:
return "A signature mismatch has occurred."
case .appleInvalidKeyStartDate:
return "The specified key has an invalid start date."
case .appleInvalidKeyEndDate:
return "The specified key has an invalid end date."
case .conversionError:
return "A conversion error has occurred."
case .appleSSLv2Rollback:
return "A SSLv2 rollback error has occurred."
case .quotaExceeded:
return "The quota was exceeded."
case .fileTooBig:
return "The file is too big."
case .invalidDatabaseBlob:
return "The specified database has an invalid blob."
case .invalidKeyBlob:
return "The specified database has an invalid key blob."
case .incompatibleDatabaseBlob:
return "The specified database has an incompatible blob."
case .incompatibleKeyBlob:
return "The specified database has an incompatible key blob."
case .hostNameMismatch:
return "A host name mismatch has occurred."
case .unknownCriticalExtensionFlag:
return "There is an unknown critical extension flag."
case .noBasicConstraints:
return "No basic constraints were found."
case .noBasicConstraintsCA:
return "No basic CA constraints were found."
case .invalidAuthorityKeyID:
return "The authority key ID is not valid."
case .invalidSubjectKeyID:
return "The subject key ID is not valid."
case .invalidKeyUsageForPolicy:
return "The key usage is not valid for the specified policy."
case .invalidExtendedKeyUsage:
return "The extended key usage is not valid."
case .invalidIDLinkage:
return "The ID linkage is not valid."
case .pathLengthConstraintExceeded:
return "The path length constraint was exceeded."
case .invalidRoot:
return "The root or anchor certificate is not valid."
case .crlExpired:
return "The CRL has expired."
case .crlNotValidYet:
return "The CRL is not yet valid."
case .crlNotFound:
return "The CRL was not found."
case .crlServerDown:
return "The CRL server is down."
case .crlBadURI:
return "The CRL has a bad Uniform Resource Identifier."
case .unknownCertExtension:
return "An unknown certificate extension was encountered."
case .unknownCRLExtension:
return "An unknown CRL extension was encountered."
case .crlNotTrusted:
return "The CRL is not trusted."
case .crlPolicyFailed:
return "The CRL policy failed."
case .idpFailure:
return "The issuing distribution point was not valid."
case .smimeEmailAddressesNotFound:
return "An email address mismatch was encountered."
case .smimeBadExtendedKeyUsage:
return "The appropriate extended key usage for SMIME was not found."
case .smimeBadKeyUsage:
return "The key usage is not compatible with SMIME."
case .smimeKeyUsageNotCritical:
return "The key usage extension is not marked as critical."
case .smimeNoEmailAddress:
return "No email address was found in the certificate."
case .smimeSubjAltNameNotCritical:
return "The subject alternative name extension is not marked as critical."
case .sslBadExtendedKeyUsage:
return "The appropriate extended key usage for SSL was not found."
case .ocspBadResponse:
return "The OCSP response was incorrect or could not be parsed."
case .ocspBadRequest:
return "The OCSP request was incorrect or could not be parsed."
case .ocspUnavailable:
return "OCSP service is unavailable."
case .ocspStatusUnrecognized:
return "The OCSP server did not recognize this certificate."
case .endOfData:
return "An end-of-data was detected."
case .incompleteCertRevocationCheck:
return "An incomplete certificate revocation check occurred."
case .networkFailure:
return "A network failure occurred."
case .ocspNotTrustedToAnchor:
return "The OCSP response was not trusted to a root or anchor certificate."
case .recordModified:
return "The record was modified."
case .ocspSignatureError:
return "The OCSP response had an invalid signature."
case .ocspNoSigner:
return "The OCSP response had no signer."
case .ocspResponderMalformedReq:
return "The OCSP responder was given a malformed request."
case .ocspResponderInternalError:
return "The OCSP responder encountered an internal error."
case .ocspResponderTryLater:
return "The OCSP responder is busy, try again later."
case .ocspResponderSignatureRequired:
return "The OCSP responder requires a signature."
case .ocspResponderUnauthorized:
return "The OCSP responder rejected this request as unauthorized."
case .ocspResponseNonceMismatch:
return "The OCSP response nonce did not match the request."
case .codeSigningBadCertChainLength:
return "Code signing encountered an incorrect certificate chain length."
case .codeSigningNoBasicConstraints:
return "Code signing found no basic constraints."
case .codeSigningBadPathLengthConstraint:
return "Code signing encountered an incorrect path length constraint."
case .codeSigningNoExtendedKeyUsage:
return "Code signing found no extended key usage."
case .codeSigningDevelopment:
return "Code signing indicated use of a development-only certificate."
case .resourceSignBadCertChainLength:
return "Resource signing has encountered an incorrect certificate chain length."
case .resourceSignBadExtKeyUsage:
return "Resource signing has encountered an error in the extended key usage."
case .trustSettingDeny:
return "The trust setting for this policy was set to Deny."
case .invalidSubjectName:
return "An invalid certificate subject name was encountered."
case .unknownQualifiedCertStatement:
return "An unknown qualified certificate statement was encountered."
case .mobileMeRequestQueued:
return "The MobileMe request will be sent during the next connection."
case .mobileMeRequestRedirected:
return "The MobileMe request was redirected."
case .mobileMeServerError:
return "A MobileMe server error occurred."
case .mobileMeServerNotAvailable:
return "The MobileMe server is not available."
case .mobileMeServerAlreadyExists:
return "The MobileMe server reported that the item already exists."
case .mobileMeServerServiceErr:
return "A MobileMe service error has occurred."
case .mobileMeRequestAlreadyPending:
return "A MobileMe request is already pending."
case .mobileMeNoRequestPending:
return "MobileMe has no request pending."
case .mobileMeCSRVerifyFailure:
return "A MobileMe CSR verification failure has occurred."
case .mobileMeFailedConsistencyCheck:
return "MobileMe has found a failed consistency check."
case .notInitialized:
return "A function was called without initializing CSSM."
case .invalidHandleUsage:
return "The CSSM handle does not match with the service type."
case .pvcReferentNotFound:
return "A reference to the calling module was not found in the list of authorized callers."
case .functionIntegrityFail:
return "A function address was not within the verified module."
case .internalError:
return "An internal error has occurred."
case .memoryError:
return "A memory error has occurred."
case .invalidData:
return "Invalid data was encountered."
case .mdsError:
return "A Module Directory Service error has occurred."
case .invalidPointer:
return "An invalid pointer was encountered."
case .selfCheckFailed:
return "Self-check has failed."
case .functionFailed:
return "A function has failed."
case .moduleManifestVerifyFailed:
return "A module manifest verification failure has occurred."
case .invalidGUID:
return "An invalid GUID was encountered."
case .invalidHandle:
return "An invalid handle was encountered."
case .invalidDBList:
return "An invalid DB list was encountered."
case .invalidPassthroughID:
return "An invalid passthrough ID was encountered."
case .invalidNetworkAddress:
return "An invalid network address was encountered."
case .crlAlreadySigned:
return "The certificate revocation list is already signed."
case .invalidNumberOfFields:
return "An invalid number of fields were encountered."
case .verificationFailure:
return "A verification failure occurred."
case .unknownTag:
return "An unknown tag was encountered."
case .invalidSignature:
return "An invalid signature was encountered."
case .invalidName:
return "An invalid name was encountered."
case .invalidCertificateRef:
return "An invalid certificate reference was encountered."
case .invalidCertificateGroup:
return "An invalid certificate group was encountered."
case .tagNotFound:
return "The specified tag was not found."
case .invalidQuery:
return "The specified query was not valid."
case .invalidValue:
return "An invalid value was detected."
case .callbackFailed:
return "A callback has failed."
case .aclDeleteFailed:
return "An ACL delete operation has failed."
case .aclReplaceFailed:
return "An ACL replace operation has failed."
case .aclAddFailed:
return "An ACL add operation has failed."
case .aclChangeFailed:
return "An ACL change operation has failed."
case .invalidAccessCredentials:
return "Invalid access credentials were encountered."
case .invalidRecord:
return "An invalid record was encountered."
case .invalidACL:
return "An invalid ACL was encountered."
case .invalidSampleValue:
return "An invalid sample value was encountered."
case .incompatibleVersion:
return "An incompatible version was encountered."
case .privilegeNotGranted:
return "The privilege was not granted."
case .invalidScope:
return "An invalid scope was encountered."
case .pvcAlreadyConfigured:
return "The PVC is already configured."
case .invalidPVC:
return "An invalid PVC was encountered."
case .emmLoadFailed:
return "The EMM load has failed."
case .emmUnloadFailed:
return "The EMM unload has failed."
case .addinLoadFailed:
return "The add-in load operation has failed."
case .invalidKeyRef:
return "An invalid key was encountered."
case .invalidKeyHierarchy:
return "An invalid key hierarchy was encountered."
case .addinUnloadFailed:
return "The add-in unload operation has failed."
case .libraryReferenceNotFound:
return "A library reference was not found."
case .invalidAddinFunctionTable:
return "An invalid add-in function table was encountered."
case .invalidServiceMask:
return "An invalid service mask was encountered."
case .moduleNotLoaded:
return "A module was not loaded."
case .invalidSubServiceID:
return "An invalid subservice ID was encountered."
case .attributeNotInContext:
return "An attribute was not in the context."
case .moduleManagerInitializeFailed:
return "A module failed to initialize."
case .moduleManagerNotFound:
return "A module was not found."
case .eventNotificationCallbackNotFound:
return "An event notification callback was not found."
case .inputLengthError:
return "An input length error was encountered."
case .outputLengthError:
return "An output length error was encountered."
case .privilegeNotSupported:
return "The privilege is not supported."
case .deviceError:
return "A device error was encountered."
case .attachHandleBusy:
return "The CSP handle was busy."
case .notLoggedIn:
return "You are not logged in."
case .algorithmMismatch:
return "An algorithm mismatch was encountered."
case .keyUsageIncorrect:
return "The key usage is incorrect."
case .keyBlobTypeIncorrect:
return "The key blob type is incorrect."
case .keyHeaderInconsistent:
return "The key header is inconsistent."
case .unsupportedKeyFormat:
return "The key header format is not supported."
case .unsupportedKeySize:
return "The key size is not supported."
case .invalidKeyUsageMask:
return "The key usage mask is not valid."
case .unsupportedKeyUsageMask:
return "The key usage mask is not supported."
case .invalidKeyAttributeMask:
return "The key attribute mask is not valid."
case .unsupportedKeyAttributeMask:
return "The key attribute mask is not supported."
case .invalidKeyLabel:
return "The key label is not valid."
case .unsupportedKeyLabel:
return "The key label is not supported."
case .invalidKeyFormat:
return "The key format is not valid."
case .unsupportedVectorOfBuffers:
return "The vector of buffers is not supported."
case .invalidInputVector:
return "The input vector is not valid."
case .invalidOutputVector:
return "The output vector is not valid."
case .invalidContext:
return "An invalid context was encountered."
case .invalidAlgorithm:
return "An invalid algorithm was encountered."
case .invalidAttributeKey:
return "A key attribute was not valid."
case .missingAttributeKey:
return "A key attribute was missing."
case .invalidAttributeInitVector:
return "An init vector attribute was not valid."
case .missingAttributeInitVector:
return "An init vector attribute was missing."
case .invalidAttributeSalt:
return "A salt attribute was not valid."
case .missingAttributeSalt:
return "A salt attribute was missing."
case .invalidAttributePadding:
return "A padding attribute was not valid."
case .missingAttributePadding:
return "A padding attribute was missing."
case .invalidAttributeRandom:
return "A random number attribute was not valid."
case .missingAttributeRandom:
return "A random number attribute was missing."
case .invalidAttributeSeed:
return "A seed attribute was not valid."
case .missingAttributeSeed:
return "A seed attribute was missing."
case .invalidAttributePassphrase:
return "A passphrase attribute was not valid."
case .missingAttributePassphrase:
return "A passphrase attribute was missing."
case .invalidAttributeKeyLength:
return "A key length attribute was not valid."
case .missingAttributeKeyLength:
return "A key length attribute was missing."
case .invalidAttributeBlockSize:
return "A block size attribute was not valid."
case .missingAttributeBlockSize:
return "A block size attribute was missing."
case .invalidAttributeOutputSize:
return "An output size attribute was not valid."
case .missingAttributeOutputSize:
return "An output size attribute was missing."
case .invalidAttributeRounds:
return "The number of rounds attribute was not valid."
case .missingAttributeRounds:
return "The number of rounds attribute was missing."
case .invalidAlgorithmParms:
return "An algorithm parameters attribute was not valid."
case .missingAlgorithmParms:
return "An algorithm parameters attribute was missing."
case .invalidAttributeLabel:
return "A label attribute was not valid."
case .missingAttributeLabel:
return "A label attribute was missing."
case .invalidAttributeKeyType:
return "A key type attribute was not valid."
case .missingAttributeKeyType:
return "A key type attribute was missing."
case .invalidAttributeMode:
return "A mode attribute was not valid."
case .missingAttributeMode:
return "A mode attribute was missing."
case .invalidAttributeEffectiveBits:
return "An effective bits attribute was not valid."
case .missingAttributeEffectiveBits:
return "An effective bits attribute was missing."
case .invalidAttributeStartDate:
return "A start date attribute was not valid."
case .missingAttributeStartDate:
return "A start date attribute was missing."
case .invalidAttributeEndDate:
return "An end date attribute was not valid."
case .missingAttributeEndDate:
return "An end date attribute was missing."
case .invalidAttributeVersion:
return "A version attribute was not valid."
case .missingAttributeVersion:
return "A version attribute was missing."
case .invalidAttributePrime:
return "A prime attribute was not valid."
case .missingAttributePrime:
return "A prime attribute was missing."
case .invalidAttributeBase:
return "A base attribute was not valid."
case .missingAttributeBase:
return "A base attribute was missing."
case .invalidAttributeSubprime:
return "A subprime attribute was not valid."
case .missingAttributeSubprime:
return "A subprime attribute was missing."
case .invalidAttributeIterationCount:
return "An iteration count attribute was not valid."
case .missingAttributeIterationCount:
return "An iteration count attribute was missing."
case .invalidAttributeDLDBHandle:
return "A database handle attribute was not valid."
case .missingAttributeDLDBHandle:
return "A database handle attribute was missing."
case .invalidAttributeAccessCredentials:
return "An access credentials attribute was not valid."
case .missingAttributeAccessCredentials:
return "An access credentials attribute was missing."
case .invalidAttributePublicKeyFormat:
return "A public key format attribute was not valid."
case .missingAttributePublicKeyFormat:
return "A public key format attribute was missing."
case .invalidAttributePrivateKeyFormat:
return "A private key format attribute was not valid."
case .missingAttributePrivateKeyFormat:
return "A private key format attribute was missing."
case .invalidAttributeSymmetricKeyFormat:
return "A symmetric key format attribute was not valid."
case .missingAttributeSymmetricKeyFormat:
return "A symmetric key format attribute was missing."
case .invalidAttributeWrappedKeyFormat:
return "A wrapped key format attribute was not valid."
case .missingAttributeWrappedKeyFormat:
return "A wrapped key format attribute was missing."
case .stagedOperationInProgress:
return "A staged operation is in progress."
case .stagedOperationNotStarted:
return "A staged operation was not started."
case .verifyFailed:
return "A cryptographic verification failure has occurred."
case .querySizeUnknown:
return "The query size is unknown."
case .blockSizeMismatch:
return "A block size mismatch occurred."
case .publicKeyInconsistent:
return "The public key was inconsistent."
case .deviceVerifyFailed:
return "A device verification failure has occurred."
case .invalidLoginName:
return "An invalid login name was detected."
case .alreadyLoggedIn:
return "The user is already logged in."
case .invalidDigestAlgorithm:
return "An invalid digest algorithm was detected."
case .invalidCRLGroup:
return "An invalid CRL group was detected."
case .certificateCannotOperate:
return "The certificate cannot operate."
case .certificateExpired:
return "An expired certificate was detected."
case .certificateNotValidYet:
return "The certificate is not yet valid."
case .certificateRevoked:
return "The certificate was revoked."
case .certificateSuspended:
return "The certificate was suspended."
case .insufficientCredentials:
return "Insufficient credentials were detected."
case .invalidAction:
return "The action was not valid."
case .invalidAuthority:
return "The authority was not valid."
case .verifyActionFailed:
return "A verify action has failed."
case .invalidCertAuthority:
return "The certificate authority was not valid."
case .invaldCRLAuthority:
return "The CRL authority was not valid."
case .invalidCRLEncoding:
return "The CRL encoding was not valid."
case .invalidCRLType:
return "The CRL type was not valid."
case .invalidCRL:
return "The CRL was not valid."
case .invalidFormType:
return "The form type was not valid."
case .invalidID:
return "The ID was not valid."
case .invalidIdentifier:
return "The identifier was not valid."
case .invalidIndex:
return "The index was not valid."
case .invalidPolicyIdentifiers:
return "The policy identifiers are not valid."
case .invalidTimeString:
return "The time specified was not valid."
case .invalidReason:
return "The trust policy reason was not valid."
case .invalidRequestInputs:
return "The request inputs are not valid."
case .invalidResponseVector:
return "The response vector was not valid."
case .invalidStopOnPolicy:
return "The stop-on policy was not valid."
case .invalidTuple:
return "The tuple was not valid."
case .multipleValuesUnsupported:
return "Multiple values are not supported."
case .notTrusted:
return "The trust policy was not trusted."
case .noDefaultAuthority:
return "No default authority was detected."
case .rejectedForm:
return "The trust policy had a rejected form."
case .requestLost:
return "The request was lost."
case .requestRejected:
return "The request was rejected."
case .unsupportedAddressType:
return "The address type is not supported."
case .unsupportedService:
return "The service is not supported."
case .invalidTupleGroup:
return "The tuple group was not valid."
case .invalidBaseACLs:
return "The base ACLs are not valid."
case .invalidTupleCredendtials:
return "The tuple credentials are not valid."
case .invalidEncoding:
return "The encoding was not valid."
case .invalidValidityPeriod:
return "The validity period was not valid."
case .invalidRequestor:
return "The requestor was not valid."
case .requestDescriptor:
return "The request descriptor was not valid."
case .invalidBundleInfo:
return "The bundle information was not valid."
case .invalidCRLIndex:
return "The CRL index was not valid."
case .noFieldValues:
return "No field values were detected."
case .unsupportedFieldFormat:
return "The field format is not supported."
case .unsupportedIndexInfo:
return "The index information is not supported."
case .unsupportedLocality:
return "The locality is not supported."
case .unsupportedNumAttributes:
return "The number of attributes is not supported."
case .unsupportedNumIndexes:
return "The number of indexes is not supported."
case .unsupportedNumRecordTypes:
return "The number of record types is not supported."
case .fieldSpecifiedMultiple:
return "Too many fields were specified."
case .incompatibleFieldFormat:
return "The field format was incompatible."
case .invalidParsingModule:
return "The parsing module was not valid."
case .databaseLocked:
return "The database is locked."
case .datastoreIsOpen:
return "The data store is open."
case .missingValue:
return "A missing value was detected."
case .unsupportedQueryLimits:
return "The query limits are not supported."
case .unsupportedNumSelectionPreds:
return "The number of selection predicates is not supported."
case .unsupportedOperator:
return "The operator is not supported."
case .invalidDBLocation:
return "The database location is not valid."
case .invalidAccessRequest:
return "The access request is not valid."
case .invalidIndexInfo:
return "The index information is not valid."
case .invalidNewOwner:
return "The new owner is not valid."
case .invalidModifyMode:
return "The modify mode is not valid."
case .missingRequiredExtension:
return "A required certificate extension is missing."
case .extendedKeyUsageNotCritical:
return "The extended key usage extension was not marked critical."
case .timestampMissing:
return "A timestamp was expected but was not found."
case .timestampInvalid:
return "The timestamp was not valid."
case .timestampNotTrusted:
return "The timestamp was not trusted."
case .timestampServiceNotAvailable:
return "The timestamp service is not available."
case .timestampBadAlg:
return "An unrecognized or unsupported Algorithm Identifier in timestamp."
case .timestampBadRequest:
return "The timestamp transaction is not permitted or supported."
case .timestampBadDataFormat:
return "The timestamp data submitted has the wrong format."
case .timestampTimeNotAvailable:
return "The time source for the Timestamp Authority is not available."
case .timestampUnacceptedPolicy:
return "The requested policy is not supported by the Timestamp Authority."
case .timestampUnacceptedExtension:
return "The requested extension is not supported by the Timestamp Authority."
case .timestampAddInfoNotAvailable:
return "The additional information requested is not available."
case .timestampSystemFailure:
return "The timestamp request cannot be handled due to system failure."
case .signingTimeMissing:
return "A signing time was expected but was not found."
case .timestampRejection:
return "A timestamp transaction was rejected."
case .timestampWaiting:
return "A timestamp transaction is waiting."
case .timestampRevocationWarning:
return "A timestamp authority revocation warning was issued."
case .timestampRevocationNotification:
return "A timestamp authority revocation notification was issued."
case .unexpectedError:
return "Unexpected error has occurred."
}
}
}
| mit |
grafiti-io/SwiftCharts | SwiftCharts/Views/ChartLinesView.swift | 3 | 3122 | //
// ChartLinesView.swift
// swift_charts
//
// Created by ischuetz on 11/04/15.
// Copyright (c) 2015 ivanschuetz. All rights reserved.
//
import UIKit
public protocol ChartLinesViewPathGenerator {
func generatePath(points: [CGPoint], lineWidth: CGFloat) -> UIBezierPath
}
open class ChartLinesView: UIView {
open let lineColor: UIColor
open let lineWidth: CGFloat
open let lineJoin: LineJoin
open let lineCap: LineCap
open let animDuration: Float
open let animDelay: Float
open let dashPattern: [Double]?
public init(path: UIBezierPath, frame: CGRect, lineColor: UIColor, lineWidth: CGFloat, lineJoin: LineJoin, lineCap: LineCap, animDuration: Float, animDelay: Float, dashPattern: [Double]?) {
self.lineColor = lineColor
self.lineWidth = lineWidth
self.lineJoin = lineJoin
self.lineCap = lineCap
self.animDuration = animDuration
self.animDelay = animDelay
self.dashPattern = dashPattern
super.init(frame: frame)
backgroundColor = UIColor.clear
show(path: path)
}
required public init(coder aDecoder: NSCoder) {
fatalError("init(coder:) has not been implemented")
}
fileprivate func createLineMask(frame: CGRect) -> CALayer {
let lineMaskLayer = CAShapeLayer()
var maskRect = frame
maskRect.origin.y = 0
maskRect.size.height = frame.size.height
let path = CGPath(rect: maskRect, transform: nil)
lineMaskLayer.path = path
return lineMaskLayer
}
open func generateLayer(path: UIBezierPath) -> CAShapeLayer {
let lineLayer = CAShapeLayer()
lineLayer.lineJoin = lineJoin.CALayerString
lineLayer.lineCap = lineCap.CALayerString
lineLayer.fillColor = UIColor.clear.cgColor
lineLayer.lineWidth = lineWidth
lineLayer.path = path.cgPath
lineLayer.strokeColor = lineColor.cgColor
if dashPattern != nil {
lineLayer.lineDashPattern = dashPattern as [NSNumber]?
}
if animDuration > 0 {
lineLayer.strokeEnd = 0.0
let pathAnimation = CABasicAnimation(keyPath: "strokeEnd")
pathAnimation.duration = CFTimeInterval(animDuration)
pathAnimation.timingFunction = CAMediaTimingFunction(name: kCAMediaTimingFunctionEaseInEaseOut)
pathAnimation.fromValue = NSNumber(value: 0 as Float)
pathAnimation.toValue = NSNumber(value: 1 as Float)
pathAnimation.autoreverses = false
pathAnimation.isRemovedOnCompletion = false
pathAnimation.fillMode = kCAFillModeForwards
pathAnimation.beginTime = CACurrentMediaTime() + CFTimeInterval(animDelay)
lineLayer.add(pathAnimation, forKey: "strokeEndAnimation")
} else {
lineLayer.strokeEnd = 1
}
return lineLayer
}
fileprivate func show(path: UIBezierPath) {
layer.addSublayer(generateLayer(path: path))
}
}
| apache-2.0 |
keencode/SwiftValidator | ValidatorTests/ValidatorTests.swift | 1 | 4306 | //
// ValidatorTests.swift
// ValidatorTests
//
// Created by Jeff Potter on 11/20/14.
// Copyright (c) 2014 jpotts18. All rights reserved.
//
import UIKit
import XCTest
import Validator
class ValidatorTests: XCTestCase {
let USERNAME_REGEX = "^[a-z0-9_-]{3,16}$"
let VALID_ZIP = "12345"
let INVALID_ZIP = "1234"
let VALID_EMAIL = "jiggy@gmail.com"
let INVALID_EMAIL = "This is not a valid email"
let CONFIRM_TXT_FIELD = UITextField()
let CONFIRM_TEXT = "Confirm this!"
let CONFIRM_TEXT_DIFF = "I am not the same as the string above"
let VALID_PASSWORD = "Super$ecret"
let INVALID_PASSWORD = "abc"
let LEN_3 = "hey"
let LEN_5 = "Howdy"
let LEN_20 = "Paint the cat orange"
override func setUp() {
super.setUp()
// Put setup code here. This method is called before the invocation of each test method in the class.
}
override func tearDown() {
// Put teardown code here. This method is called after the invocation of each test method in the class.
super.tearDown()
}
// MARK: Required
func testRequired() {
XCTAssertTrue(RequiredRule().validate("Something"), "Required should be valid")
}
func testRequiredInvalid() {
XCTAssertFalse(RequiredRule().validate(""), "Required should be invalid")
}
// MARK: Regex
func testRegex(){
XCTAssertTrue(RegexRule(regex: USERNAME_REGEX).validate("darth_vader8"), "RegexRule should be valid")
}
func testRegexInvalid(){
XCTAssertFalse(RegexRule(regex: USERNAME_REGEX).validate("DarthVader"), "RegexRule should be invalid")
}
// MARK: Zipcode
func testZipCode() {
XCTAssertTrue(ZipCodeRule().validate(VALID_ZIP), "Zipcode should be valid")
}
func testZipCodeInvalid() {
XCTAssertFalse(ZipCodeRule().validate(INVALID_ZIP), "Zipcode should be invalid")
}
// MARK: Email
func testEmail() {
XCTAssertTrue(EmailRule().validate(VALID_EMAIL), "Email should be valid")
}
func testEmailInvalid() {
XCTAssertFalse(EmailRule().validate(INVALID_EMAIL), "Email should be invalid")
}
// MARK: Confirm against field
func testConfirmSame(){
CONFIRM_TXT_FIELD.text = CONFIRM_TEXT
XCTAssertTrue(ConfirmationRule(confirmField: CONFIRM_TXT_FIELD).validate(CONFIRM_TEXT), "Should confirm successfully")
}
func testConfirmDifferent() {
CONFIRM_TXT_FIELD.text = CONFIRM_TEXT
XCTAssertFalse(ConfirmationRule(confirmField: CONFIRM_TXT_FIELD).validate(CONFIRM_TEXT_DIFF), "Should fail confirm")
}
// MARK: Password
func testPassword() {
XCTAssertTrue(PasswordRule().validate(VALID_PASSWORD), "Password should be valid")
}
func testPasswordInvalid(){
XCTAssertFalse(EmailRule().validate(INVALID_PASSWORD), "Password is invalid")
}
// MARK: Max Length
func testMaxLength(){
XCTAssertTrue(MaxLengthRule().validate(LEN_3),"Max Length should be valid")
}
func testMaxLengthInvalid(){
XCTAssertFalse(MaxLengthRule().validate(LEN_20),"Max Length should be invalid")
}
func testMaxLengthParameterAndGreaterThan(){
XCTAssertTrue(MaxLengthRule(length: 20).validate(LEN_20), "Max Length should be 20 and <= length")
}
// MARK: Min Length
func testMinLength(){
XCTAssertTrue(MinLengthRule().validate(LEN_3),"Min Length should be valid")
}
func testMinLengthInvalid(){
XCTAssertFalse(MinLengthRule().validate("no"),"Min Length should be Invalid")
}
func testMinLengthWithParameter(){
XCTAssertTrue(MinLengthRule(length: 5).validate(LEN_5), "Min Len should be set to 5 and >= length")
}
// MARK: Full Name
func testFullName(){
XCTAssertTrue(FullNameRule().validate("Jeff Potter"), "Full Name should be valid")
}
func testFullNameWith3Names(){
XCTAssertTrue(FullNameRule().validate("Jeff Van Buren"), "Full Name should be valid")
}
func testFullNameInvalid(){
XCTAssertFalse(FullNameRule().validate("Carl"), "Full Name should be invalid")
}
}
| mit |
algolia/algoliasearch-client-swift | Sources/AlgoliaSearchClient/Models/Places/Country.swift | 1 | 6269 | //
// Country.swift
//
//
// Created by Vladislav Fitc on 12/04/2020.
//
// swiftlint:disable type_body_length
import Foundation
public enum Country: String, Codable {
case afghanistan = "af"
case alandIslands = "ax"
case albania = "al"
case algeria = "dz"
case americanSamoa = "as"
case andorra = "ad"
case angola = "ao"
case anguilla = "ai"
case antarctica = "aq"
case antiguaAndBarbuda = "ag"
case argentina = "ar"
case armenia = "am"
case aruba = "aw"
case australia = "au"
case austria = "at"
case azerbaijan = "az"
case bahamas = "bs"
case bahrain = "bh"
case bangladesh = "bd"
case barbados = "bb"
case belarus = "by"
case belgium = "be"
case belize = "bz"
case benin = "bj"
case bermuda = "bm"
case bhutan = "bt"
case bolivia = "bo"
case caribbeanNetherlands = "bq"
case bosniaAndHerzegovina = "ba"
case botswana = "bw"
case bouvetIsland = "bv"
case brazil = "br"
case britishIndianOceanTerritory = "io"
case bruneiDarussalam = "bn"
case bulgaria = "bg"
case burkinaFaso = "bf"
case burundi = "bi"
case caboVerde = "cv"
case cambodia = "kh"
case cameroon = "cm"
case canada = "ca"
case caymanIslands = "ky"
case centralAfricanRepublic = "cf"
case chad = "td"
case chile = "cl"
case china = "cn"
case christmasIsland = "cx"
case cocosIslands = "cc"
case colombia = "co"
case comoros = "km"
case republicOfTheCongo = "cg"
case democraticRepublicOfTheCongo = "cd"
case cookIslands = "ck"
case costaRica = "cr"
case ivoryCoast = "ci"
case croatia = "hr"
case cuba = "cu"
case curacao = "cw"
case cyprus = "cy"
case czechRepublic = "cz"
case denmark = "dk"
case djibouti = "dj"
case dominica = "dm"
case dominicanRepublic = "do"
case ecuador = "ec"
case egypt = "eg"
case elSalvador = "sv"
case equatorialGuinea = "gq"
case eritrea = "er"
case estonia = "ee"
case eswatini = "sz"
case ethiopia = "et"
case falklandIslands = "fk"
case faroeIslands = "fo"
case fiji = "fj"
case finland = "fi"
case france = "fr"
case frenchGuiana = "gf"
case frenchPolynesia = "pf"
case frenchSouthernAndAntarcticLands = "tf"
case gabon = "ga"
case gambia = "gm"
case georgia = "ge"
case germany = "de"
case ghana = "gh"
case gibraltar = "gi"
case greece = "gr"
case greenland = "gl"
case grenada = "gd"
case guadeloupe = "gp"
case guam = "gu"
case guatemala = "gt"
case bailiwickOfGuernsey = "gg"
case guinea = "gn"
case guineaBissau = "gw"
case guyana = "gy"
case haiti = "ht"
case heardIslandAndMcDonaldIslands = "hm"
case vaticanCity = "va"
case honduras = "hn"
case hongKong = "hk"
case hungary = "hu"
case iceland = "is"
case india = "in"
case indonesia = "id"
case iran = "ir"
case iraq = "iq"
case ireland = "ie"
case isleOfMan = "im"
case israel = "il"
case italy = "it"
case jamaica = "jm"
case japan = "jp"
case jersey = "je"
case jordan = "jo"
case kazakhstan = "kz"
case kenya = "ke"
case kiribati = "ki"
case northKorea = "kp"
case southKorea = "kr"
case kuwait = "kw"
case kyrgyzstan = "kg"
case laos = "la"
case latvia = "lv"
case lebanon = "lb"
case lesotho = "ls"
case liberia = "lr"
case libya = "ly"
case liechtenstein = "li"
case lithuania = "lt"
case luxembourg = "lu"
case macau = "mo"
case madagascar = "mg"
case malawi = "mw"
case malaysia = "my"
case maldives = "mv"
case mali = "ml"
case malta = "mt"
case marshallIslands = "mh"
case martinique = "mq"
case mauritania = "mr"
case mauritius = "mu"
case mayotte = "yt"
case mexico = "mx"
case micronesia = "fm"
case moldova = "md"
case monaco = "mc"
case mongolia = "mn"
case montenegro = "me"
case montserrat = "ms"
case morocco = "ma"
case mozambique = "mz"
case myanmar = "mm"
case namibia = "na"
case nauru = "nr"
case nepal = "np"
case netherlands = "nl"
case newCaledonia = "nc"
case newZealand = "nz"
case nicaragua = "ni"
case niger = "ne"
case nigeria = "ng"
case niue = "nu"
case norfolkIsland = "nf"
case northMacedonia = "mk"
case northernMarianaIslands = "mp"
case norway = "no"
case oman = "om"
case pakistan = "pk"
case palau = "pw"
case palestine = "ps"
case panama = "pa"
case papuaNewGuinea = "pg"
case paraguay = "py"
case peru = "pe"
case philippines = "ph"
case pitcairnIslands = "pn"
case poland = "pl"
case portugal = "pt"
case puertoRico = "pr"
case qatar = "qa"
case reunion = "re"
case romania = "ro"
case russia = "ru"
case rwanda = "rw"
case saintBarthelemy = "bl"
case saintHelena = "sh"
case saintKittsAndNevis = "kn"
case saintLucia = "lc"
case saintMartin = "mf"
case saintPierreAndMiquelon = "pm"
case saintVincentAndTheGrenadines = "vc"
case samoa = "ws"
case sanMarino = "sm"
case saoTomeAndPrincipe = "st"
case saudiArabia = "sa"
case senegal = "sn"
case serbia = "rs"
case seychelles = "sc"
case sierraLeone = "sl"
case singapore = "sg"
case sintMaarten = "sx"
case slovakia = "sk"
case slovenia = "si"
case solomonIslands = "sb"
case somalia = "so"
case southAfrica = "za"
case southGeorgiaAndTheSouthSandwichIslands = "gs"
case southSudan = "ss"
case spain = "es"
case sriLanka = "lk"
case sudan = "sd"
case suriname = "sr"
case svalbardAndJanMayen = "sj"
case sweden = "se"
case switzerland = "ch"
case syria = "sy"
case taiwan = "tw"
case tajikistan = "tj"
case tanzania = "tz"
case thailand = "th"
case timorLeste = "tl"
case togo = "tg"
case tokelau = "tk"
case tonga = "to"
case trinidadAndTobago = "tt"
case tunisia = "tn"
case turkey = "tr"
case turkmenistan = "tm"
case turksAndCaicosIslands = "tc"
case tuvalu = "tv"
case uganda = "ug"
case ukraine = "ua"
case unitedArabEmirates = "ae"
case unitedKingdom = "gb"
case unitedStates = "us"
case unitedStatesMinorOutlyingIslands = "um"
case uruguay = "uy"
case uzbekistan = "uz"
case vanuatu = "vu"
case venezuela = "ve"
case vietnam = "vn"
case virginIslandsGB = "vg"
case virginIslandsUS = "vi"
case wallisAndFutuna = "wf"
case westernSahara = "eh"
case yemen = "ye"
case zambia = "zm"
case zimbabwe = "zw"
}
| mit |
apple/swift-nio | Sources/NIOPerformanceTester/ByteBufferWriteMultipleBenchmarks.swift | 1 | 2653 | //===----------------------------------------------------------------------===//
//
// This source file is part of the SwiftNIO open source project
//
// Copyright (c) 2021 Apple Inc. and the SwiftNIO project authors
// Licensed under Apache License v2.0
//
// See LICENSE.txt for license information
// See CONTRIBUTORS.txt for the list of SwiftNIO project authors
//
// SPDX-License-Identifier: Apache-2.0
//
//===----------------------------------------------------------------------===//
import NIOCore
final class ByteBufferReadWriteMultipleIntegersBenchmark<I: FixedWidthInteger>: Benchmark {
private let iterations: Int
private let numberOfInts: Int
private var buffer: ByteBuffer = ByteBuffer()
init(iterations: Int, numberOfInts: Int) {
self.iterations = iterations
self.numberOfInts = numberOfInts
}
func setUp() throws {
self.buffer.reserveCapacity(self.numberOfInts * MemoryLayout<I>.size)
}
func tearDown() {
}
func run() throws -> Int {
var result: I = 0
for _ in 0..<self.iterations {
for i in I(0)..<I(10) {
self.buffer.writeInteger(i)
}
for _ in I(0)..<I(10) {
result = result &+ self.buffer.readInteger(as: I.self)!
}
}
precondition(result == I(self.iterations) * 45)
return self.buffer.readableBytes
}
}
final class ByteBufferMultiReadWriteTenIntegersBenchmark<I: FixedWidthInteger>: Benchmark {
private let iterations: Int
private var buffer: ByteBuffer = ByteBuffer()
init(iterations: Int) {
self.iterations = iterations
}
func setUp() throws {
self.buffer.reserveCapacity(10 * MemoryLayout<I>.size)
}
func tearDown() {
}
func run() throws -> Int {
var result: I = 0
for _ in 0..<self.iterations {
self.buffer.writeMultipleIntegers(
0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
as: (I, I, I, I, I, I, I, I, I, I).self
)
let value = self.buffer.readMultipleIntegers(as: (I, I, I, I, I, I, I, I, I, I).self)!
result = result &+ value.0
result = result &+ value.1
result = result &+ value.2
result = result &+ value.3
result = result &+ value.4
result = result &+ value.5
result = result &+ value.6
result = result &+ value.7
result = result &+ value.8
result = result &+ value.9
}
precondition(result == I(self.iterations) * 45)
return self.buffer.readableBytes
}
}
| apache-2.0 |
Candyroot/DesignPattern | state/state/GumballMachine.swift | 1 | 1710 | //
// GumballMachine.swift
// state
//
// Created by Bing Liu on 12/2/14.
// Copyright (c) 2014 UnixOSS. All rights reserved.
//
import Foundation
class GumballMachine {
let soldOutState: State!
let noQuarterState: State!
let hasQuarterState: State!
let soldState: State!
let winnerState: State!
var state: State!
var count = 0
var description: String {
let desc = "\nMighty Gumball, Inc.\n" +
"Swift-enabled Standing Gumball Model #2014\n" +
"Inventory: \(count) gumballs\n"
return count > 0 ? (desc + "Machine is waiting for quarter\n") : (desc + "Machine is sold out")
}
init(numberGumballs: Int) {
soldOutState = SoldOutState(gumballMachine: self)
noQuarterState = NoQuarterState(gumballMachine: self)
hasQuarterState = HasQuarterState(gumballMachine: self)
soldState = SoldState(gumballMachine: self)
winnerState = WinnerState(gumballMachine: self)
count = numberGumballs
if numberGumballs > 0 {
state = noQuarterState
} else {
state = soldOutState
}
}
func insertQuarter() {
state.insertQuarter()
}
func ejectQuarter() {
state.ejectQuarter()
}
func turnCrank() {
state.turnCrank()
state.dispense()
}
func setState(state: State) {
self.state = state
}
func releaseBall() {
println("A gumball comes rolling out the slot...")
if count != 0 {
count--
}
}
func refill(count: Int) {
self.count = count
state = noQuarterState
}
}
| apache-2.0 |
S2dentik/Taylor | Taylor/main.swift | 4 | 168 | //
// main.swift
// Taylor
//
// Created by Andrei Raifura on 9/3/15.
// Copyright (c) 2015 YOPESO. All rights reserved.
//
import TaylorFramework
Taylor().run()
| mit |
radvansky-tomas/NutriFacts | nutri-facts/nutri-facts/Libraries/Ex/Character.swift | 31 | 402 | //
// Character.swift
// ExSwift
//
// Created by Cenny Davidsson on 2014-12-08.
// Copyright (c) 2014 pNre. All rights reserved.
//
import Foundation
public extension Character {
/**
If the character represents an integer that fits into an Int, returns
the corresponding integer.
*/
public func toInt () -> Int? {
return String(self).toInt()
}
} | gpl-2.0 |
tsaqib/samples | backgroundExtensionDemo/backgroundExtensionDemo/ViewController.swift | 1 | 932 | //
// ViewController.swift
// backgroundExtensionDemo
//
// Created by Tanzim Saqib on 10/27/15.
// Copyright © 2015 Tanzim Saqib. All rights reserved.
//
import UIKit
class ViewController: UIViewController {
@IBOutlet weak var imgView: UIImageView!
override func viewDidLoad() {
super.viewDidLoad()
// Do any additional setup after loading the view, typically from a nib.
}
override func didReceiveMemoryWarning() {
super.didReceiveMemoryWarning()
// Dispose of any resources that can be recreated.
}
@IBAction func onSelect(sender: UISegmentedControl) {
switch sender.selectedSegmentIndex
{
case 0:
BlurExtraLight(imgView)
case 1:
BlurLight(imgView)
case 2:
BlurDark(imgView)
case 3:
BlurReset()
default:
print("Invalid option")
}
}
}
| mit |
sora0077/iTunesKit | iTunesKit/src/Endpoint/Lookup.swift | 1 | 5880 | //
// Lookup.swift
// iTunesKit
//
// Created by 林達也 on 2015/10/06.
// Copyright © 2015年 jp.sora0077. All rights reserved.
//
import Foundation
import APIKit
public struct Lookup {
public private(set) var parameters: [String: AnyObject]? = [:]
public init(id: Int, country: String = "US") {
parameters?["id"] = id
parameters?["country"] = country
}
}
extension Lookup: iTunesRequestToken {
public typealias Response = [SearchResult]
public typealias SerializedObject = [String: AnyObject]
public var method: HTTPMethod {
return .GET
}
public var path: String {
return "https://itunes.apple.com/lookup"
}
public func transform(request: NSURLRequest?, response: NSHTTPURLResponse?, object: SerializedObject) throws -> Response {
print(request, object)
return (object["results"] as! [[String: AnyObject]]).map { v in
guard let wrapperType = SearchResultWrapperType(rawValue: v["wrapperType"] as! String) else {
return .Unsupported(v)
}
switch wrapperType {
case .Track:
return .Track(SearchResultTrack(
kind: SearchResultKind(rawValue: v["kind"] as! String)!,
artistId: v["artistId"] as! Int,
collectionId: v["collectionId"] as! Int,
trackId: v["trackId"] as! Int,
artistName: v["artistName"] as! String,
collectionName: v["collectionName"] as! String,
trackName: v["trackName"] as! String,
collectionCensoredName: v["collectionCensoredName"] as! String,
trackCensoredName: v["trackCensoredName"] as! String,
artistViewUrl: v["artistViewUrl"] as! String,
collectionViewUrl: v["collectionViewUrl"] as! String,
trackViewUrl: v["trackViewUrl"] as! String,
previewUrl: v["previewUrl"] as! String,
artworkUrl30: v["artworkUrl30"] as! String,
artworkUrl60: v["artworkUrl60"] as! String,
artworkUrl100: v["artworkUrl100"] as! String,
collectionPrice: v["collectionPrice"] as! Float,
trackPrice: v["trackPrice"] as! Float,
releaseDate: v["releaseDate"] as! String,
collectionExplicitness: v["collectionExplicitness"] as! String,
trackExplicitness: v["trackExplicitness"] as! String,
discCount: v["discCount"] as! Int,
discNumber: v["discNumber"] as! Int,
trackCount: v["trackCount"] as! Int,
trackNumber: v["trackNumber"] as! Int,
trackTimeMillis: v["trackTimeMillis"] as! Int,
country: v["country"] as! String,
currency: v["currency"] as! String,
primaryGenreName: v["primaryGenreName"] as! String,
radioStationUrl: v["radioStationUrl"] as? String,
isStreamable: v["isStreamable"] as! Bool
))
case .Artist:
return .Artist(SearchResultArtist(
artistType: v["artistType"] as! String,
artistName: v["artistName"] as! String,
artistLinkUrl: v["artistLinkUrl"] as! String,
artistId: v["artistId"] as! Int,
amgArtistId: v["amgArtistId"] as? Int,
primaryGenreName: v["primaryGenreName"] as! String,
primaryGenreId: v["primaryGenreId"] as! Int,
radioStationUrl: v["radioStationUrl"] as? String
))
case .Collection:
return .Collection(SearchResultCollection(
collectionType: v["collectionType"] as! String,
artistId: v["artistId"] as! Int,
collectionId: v["collectionId"] as! Int,
amgArtistId: v["amgArtistId"] as! Int,
artistName: v["artistName"] as! String,
collectionName: v["collectionName"] as! String,
collectionCensoredName: v["collectionCensoredName"] as! String,
artistViewUrl: v["artistViewUrl"] as! String,
collectionViewUrl: v["collectionViewUrl"] as! String,
artworkUrl30: v["artworkUrl30"] as! String,
artworkUrl60: v["artworkUrl60"] as! String,
artworkUrl100: v["artworkUrl100"] as! String,
collectionPrice: v["collectionPrice"] as! Float,
collectionExplicitness: v["collectionExplicitness"] as! String,
trackCount: v["trackCount"] as! Int,
copyright: v["copyright"] as! String,
country: v["country"] as! String,
currency: v["currency"] as! String,
releaseDate: v["releaseDate"] as! String,
primaryGenreName: v["primaryGenreName"] as! String,
radioStationUrl: v["radioStationUrl"] as? String
))
}
}
}
}
| mit |
TwilioDevEd/api-snippets | video/conversations/specify-constraints/specify-constraints.swift | 2 | 677 | // See the "Create a Conversation" guide for details of the acceptHandler
...
outgoingInvite = self.client?.inviteToConversation("alice",
localMedia: self.setupLocalMedia(),
handler: self.acceptHandler)
...
func setupLocalMedia() -> TWCLocalMedia {
// Create LocalMedia with a camera track and no microphone track
var localMedia = TWCLocalMedia(delegate: self)
localMedia!.addCameraTrack()
return localMedia!
}
// MARK: TWCLocalMediaDelegate
extension ViewController: TWCLocalMediaDelegate {
func localMedia(media: TWCLocalMedia, didAddVideoTrack videoTrack: TWCVideoTrack) {
videoTrack.attach(self.localMediaView)
}
} | mit |
SusanDoggie/Doggie | Sources/DoggieGeometry/ApplePlatform/Geometry/CGAffineTransform.swift | 1 | 2569 | //
// CGAffineTransform.swift
//
// The MIT License
// Copyright (c) 2015 - 2022 Susan Cheng. All rights reserved.
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in
// all copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
// THE SOFTWARE.
//
#if os(macOS)
extension AffineTransform {
@inlinable
@inline(__always)
public init(_ transform: SDTransform) {
self.init(
m11: CGFloat(transform.a),
m12: CGFloat(transform.d),
m21: CGFloat(transform.b),
m22: CGFloat(transform.e),
tX: CGFloat(transform.c),
tY: CGFloat(transform.f)
)
}
}
extension SDTransform {
@inlinable
@inline(__always)
public init(_ m: AffineTransform) {
self.a = Double(m.m11)
self.b = Double(m.m21)
self.c = Double(m.tX)
self.d = Double(m.m12)
self.e = Double(m.m22)
self.f = Double(m.tY)
}
}
#endif
#if canImport(CoreGraphics)
extension CGAffineTransform {
@inlinable
@inline(__always)
public init(_ m: SDTransform) {
self.init(
a: CGFloat(m.a),
b: CGFloat(m.d),
c: CGFloat(m.b),
d: CGFloat(m.e),
tx: CGFloat(m.c),
ty: CGFloat(m.f)
)
}
}
extension SDTransform {
@inlinable
@inline(__always)
public init(_ m: CGAffineTransform) {
self.a = Double(m.a)
self.b = Double(m.c)
self.c = Double(m.tx)
self.d = Double(m.b)
self.e = Double(m.d)
self.f = Double(m.ty)
}
}
#endif
| mit |
zhuhaow/NEKit | src/GeoIP/GeoIP.swift | 1 | 618 | import Foundation
import MMDB
open class GeoIP {
// Back in the days, MMDB ships a bundled GeoLite2 database. However, that has changed
// due to license change of the database. Now developers must initialize it by themselves.
// In order to maintain the API compatibility while expose the issue ASAP, we set the type
// to `MMDB!` so it will crash during development if one forgets to initialize it.
// Please initialize it first!
public static var database: MMDB!
public static func LookUp(_ ipAddress: String) -> MMDBCountry? {
return GeoIP.database.lookup(ipAddress)
}
}
| bsd-3-clause |
devxoul/MoyaSugar | Package.swift | 1 | 721 | // swift-tools-version:5.0
import PackageDescription
let package = Package(
name: "MoyaSugar",
platforms: [
.macOS(.v10_12), .iOS(.v10), .tvOS(.v10), .watchOS(.v3)
],
products: [
.library(name: "MoyaSugar", targets: ["MoyaSugar"]),
],
dependencies: [
.package(url: "https://github.com/Moya/Moya.git", .upToNextMajor(from: "14.0.0-beta.2")),
.package(url: "https://github.com/devxoul/Immutable.git", .upToNextMajor(from: "0.5.0")),
.package(url: "https://github.com/devxoul/Then.git", .upToNextMajor(from: "2.2.0")),
],
targets: [
.target(name: "MoyaSugar", dependencies: ["Moya"]),
.testTarget(name: "MoyaSugarTests", dependencies: ["MoyaSugar", "Immutable", "Then"]),
]
)
| mit |
mohamede1945/quran-ios | Quran/Errors+Description.swift | 2 | 2439 | //
// Errors+Description.swift
// Quran
//
// Created by Mohamed Afifi on 4/28/17.
//
// Quran for iOS is a Quran reading application for iOS.
// Copyright (C) 2017 Quran.com
//
// This program is free software: you can redistribute it and/or modify
// it under the terms of the GNU General Public License as published by
// the Free Software Foundation, either version 3 of the License, or
// (at your option) any later version.
//
// This program is distributed in the hope that it will be useful,
// but WITHOUT ANY WARRANTY; without even the implied warranty of
// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
// GNU General Public License for more details.
//
import BatchDownloader
import SQLitePersistence
extension FileSystemError: LocalizedError {
public var errorDescription: String {
let text: String
switch self {
case .unknown:
text = NSLocalizedString("FileSystemError_Unknown", comment: "")
case .noDiskSpace:
text = NSLocalizedString("FileSystemError_NoDiskSpace", comment: "")
}
return text
}
}
extension NetworkError: LocalizedError {
public var errorDescription: String {
let text: String
switch self {
case .unknown:
text = NSLocalizedString("unknown_error_message", comment: "Error description")
case .serverError:
text = NSLocalizedString("unknown_error_message", comment: "Error description")
case .notConnectedToInternet:
text = NSLocalizedString("NetworkError_NotConnectedToInternet", comment: "Error description")
case .internationalRoamingOff:
text = NSLocalizedString("NetworkError_InternationalRoamingOff", comment: "Error description")
case .serverNotReachable:
text = NSLocalizedString("NetworkError_ServerNotReachable", comment: "Error description")
case .connectionLost:
text = NSLocalizedString("NetworkError_ConnectionLost", comment: "Error description")
}
return text
}
}
extension ParsingError: LocalizedError {
public var errorDescription: String {
return NSLocalizedString("NetworkError_Parsing", comment: "When a parsing error occurs")
}
}
extension PersistenceError: LocalizedError {
public var errorDescription: String {
return NSLocalizedString("unknown_error_message", comment: "")
}
}
| gpl-3.0 |
jcantosm/coursera.ios | mediaplayer/mediaplayer/ViewController.swift | 1 | 4784 | //
// ViewController.swift
// audioplayer
//
// Created by Javier Cantos on 23/12/15.
// Copyright © 2015 Javier Cantos. All rights reserved.
//
import UIKit
import AVFoundation
class ViewController: UIViewController, UIPickerViewDelegate, UIPickerViewDataSource {
var player : AVAudioPlayer!
var canciones : Array<Array<String>> = Array<Array<String>>()
@IBOutlet weak var uiLabelTitulo: UILabel!
@IBOutlet weak var uiImgPortada: UIImageView!
@IBOutlet weak var uiPickerCanciones: UIPickerView!
@IBOutlet weak var uiControlAudio: UISegmentedControl!
@IBOutlet weak var uiSliderVolumen: UISlider!
override func viewDidLoad() {
super.viewDidLoad()
// Do any additional setup after loading the view, typically from a nib.
// inicializamos lista de canciones
self.canciones.append(["Amor Es Solo Amar", "PALABRAMUJER.PNG", "AmarEsSoloAmor"])
self.canciones.append(["El Despertar", "ADAGIO.PNG", "ElDespertar"])
self.canciones.append(["Pantera En Libertad", "MONICA4.0.PNG", "PanteraEnLibertad"])
self.canciones.append(["Chicas Malas", "CHICASMALAS.PNG", "ChicasMalas"])
self.canciones.append(["Sobreviviré", "MINAGE.PNG", "Sobrevivire"])
let cancionURL = NSBundle.mainBundle().URLForResource(self.canciones[0][2], withExtension: "mp3")
do {
try self.player = AVAudioPlayer(contentsOfURL: cancionURL!)
// volumen x defecto del reproductor
self.player.volume = self.uiSliderVolumen.value
// mostramos titulo / portada cancion seleccionada
self.uiLabelTitulo.text = self.canciones[0][0]
self.uiImgPortada.image = UIImage(named: "media\(self.canciones[0][1])")
} catch {
print("Error al iniciar reproductor de audio.")
}
}
override func didReceiveMemoryWarning() {
super.didReceiveMemoryWarning()
// Dispose of any resources that can be recreated.
}
func numberOfComponentsInPickerView(pickerView: UIPickerView) -> Int {
return 1
}
func pickerView(pickerView: UIPickerView, numberOfRowsInComponent component: Int) -> Int {
return self.canciones.count
}
func pickerView(pickerView: UIPickerView, titleForRow row: Int, forComponent component: Int) -> String? {
return self.canciones[row][0]
}
func pickerView(pickerView: UIPickerView, didSelectRow row: Int, inComponent component: Int) {
let cancionURL = NSBundle.mainBundle().URLForResource(self.canciones[row][2], withExtension: "mp3")
do {
try self.player = AVAudioPlayer(contentsOfURL: cancionURL!)
self.uiControlAudio.selectedSegmentIndex = 0
// mostramos titulo / portada cancion seleccionada
self.uiLabelTitulo.text = self.canciones[row][0]
self.uiImgPortada.image = UIImage(named: self.canciones[row][1])
// empezamos a reproducir la cancion seleccionada
self.player.play()
} catch {
print("Error al iniciar reproductor de audio.")
}
}
@IBAction func changeVolume() {
self.player.volume = self.uiSliderVolumen.value
}
@IBAction func audiocontrol() {
// iniciamos reproduccion de la cancion
if (self.uiControlAudio.selectedSegmentIndex == 0) {
print("play()")
if (self.player != nil && !self.player.playing) {
self.player.play()
}
}
// pausamos reproduccion de la cancion
if (self.uiControlAudio.selectedSegmentIndex == 1) {
print("pause()")
if (self.player != nil && self.player.playing) {
self.player.pause()
}
}
// paramos reproduccion de la cancion
if (self.uiControlAudio.selectedSegmentIndex == 2) {
print("stop()")
if (self.player != nil && self.player.playing) {
self.player.stop()
self.player.currentTime = 0
}
}
// reproducción aleatoria de la cancion
if (self.uiControlAudio.selectedSegmentIndex == 3) {
print("shuffle()")
// numero aleatorio
let random : Int = Int(arc4random() % 5)
// seleccion aleatoria de cancion
self.uiPickerCanciones.selectRow(random, inComponent: 0, animated: true)
self.pickerView(self.uiPickerCanciones, didSelectRow: random, inComponent: 0)
}
}
}
| apache-2.0 |
royhsu/RHAnimatedTitleView | Example/RHAnimatedTitleViewTests/RHAnimatedTitleViewTests.swift | 1 | 935 | //
// RHAnimatedTitleViewTests.swift
// RHAnimatedTitleViewTests
//
// Created by Roy Hsu on 2015/3/31.
// Copyright (c) 2015年 tinyWorld. All rights reserved.
//
import UIKit
import XCTest
class RHAnimatedTitleViewTests: XCTestCase {
override func setUp() {
super.setUp()
// Put setup code here. This method is called before the invocation of each test method in the class.
}
override func tearDown() {
// Put teardown code here. This method is called after the invocation of each test method in the class.
super.tearDown()
}
func testExample() {
// This is an example of a functional test case.
XCTAssert(true, "Pass")
}
func testPerformanceExample() {
// This is an example of a performance test case.
self.measureBlock() {
// Put the code you want to measure the time of here.
}
}
}
| mit |
nshetty26/MH4UDatabase | MH4UDBEngine.swift | 1 | 1999 | //
// MH4UDBEngine.swift
// MH4UDatabase
//
// Created by Neil Shetty on 3/27/15.
// Copyright (c) 2015 GuthuDesigns. All rights reserved.
//
import Foundation
func dbQuery(query : String) -> FMResultSet? {
let mh4uDB = FMDatabase(path: NSBundle.mainBundle().pathForResource("mh4u", ofType: ".db"));
if !mh4uDB.open() {
return nil;
} else {
return mh4uDB.executeQuery(query, withArgumentsInArray: nil);
}
}
func retrieveMonsters(monsterID : Int?) -> NSArray {
var monsterArray: [Monster] = [];
var query : String;
if (monsterID != nil) {
query = "SELECT * FROM Monsters where monsters._id = \(monsterID)";
} else {
query = "SELECT * FROM Monsters";
}
if let s = dbQuery(query) {
while (s.next()) {
var monster = Monster();
monster.monsterID = s.intForColumn("_id");
monster.monsterClass = s.stringForColumn("class");
monster.monsterName = s.stringForColumn("name");
monster.trait = s.stringForColumn("trait")
monster.iconName = s.stringForColumn("icon_name");
monsterArray.append(monster);
}
}
monsterArray.sort({$0.monsterName < $1.monsterName});
return monsterArray;
}
func retrieveMonsterDamageForMonster(monster : Monster) {
var damageArray : [MonsterDamage] = [];
// MonsterDamage *md = [[MonsterDamage alloc] init];
// md.bodyPart = [s stringForColumn:@"body_part"];
// md.cutDamage = [s intForColumn:@"cut"];
// md.impactDamage = [s intForColumn:@"impact"];
// md.shotDamage = [s intForColumn:@"shot"];
// md.fireDamage = [s intForColumn:@"fire"];
// md.waterDamage = [s intForColumn:@"water"];
// md.iceDamage = [s intForColumn:@"ice"];
// md.thunderDamage = md.cutDamage = [s intForColumn:@"thunder"];
// md.dragonDamage = [s intForColumn:@"dragon"];
// md.stun = [s intForColumn:@"ko"];
// [monsterDamageArray addObject:md];
}
| mit |
kesara/ios-calculator | Calculator/AppDelegate.swift | 1 | 2175 | //
// AppDelegate.swift
// Calculator
//
// Created by Kesara Rathnayake on 17/10/17.
// Copyright © 2017 fq.nz. All rights reserved.
//
import UIKit
@UIApplicationMain
class AppDelegate: UIResponder, UIApplicationDelegate {
var window: UIWindow?
func application(_ application: UIApplication, didFinishLaunchingWithOptions launchOptions: [UIApplicationLaunchOptionsKey: Any]?) -> Bool {
// Override point for customization after application launch.
return true
}
func applicationWillResignActive(_ application: UIApplication) {
// Sent when the application is about to move from active to inactive state. This can occur for certain types of temporary interruptions (such as an incoming phone call or SMS message) or when the user quits the application and it begins the transition to the background state.
// Use this method to pause ongoing tasks, disable timers, and invalidate graphics rendering callbacks. Games should use this method to pause the game.
}
func applicationDidEnterBackground(_ application: UIApplication) {
// Use this method to release shared resources, save user data, invalidate timers, and store enough application state information to restore your application to its current state in case it is terminated later.
// If your application supports background execution, this method is called instead of applicationWillTerminate: when the user quits.
}
func applicationWillEnterForeground(_ application: UIApplication) {
// Called as part of the transition from the background to the active state; here you can undo many of the changes made on entering the background.
}
func applicationDidBecomeActive(_ application: UIApplication) {
// Restart any tasks that were paused (or not yet started) while the application was inactive. If the application was previously in the background, optionally refresh the user interface.
}
func applicationWillTerminate(_ application: UIApplication) {
// Called when the application is about to terminate. Save data if appropriate. See also applicationDidEnterBackground:.
}
}
| gpl-3.0 |
ZeeQL/ZeeQL3 | Tests/ZeeQLTests/CodeObjectModelTests.swift | 1 | 2011 | //
// CodeObjectModelTests.swift
// ZeeQL3
//
// Created by Helge Hess on 13.12.17.
// Copyright © 2017 ZeeZide GmbH. All rights reserved.
//
//
// CodeEntityModelTests.swift
// ZeeQL
//
// Created by Helge Hess on 28/02/17.
// Copyright © 2017 ZeeZide GmbH. All rights reserved.
//
import XCTest
@testable import ZeeQL
class CodeObjectModelTests: XCTestCase {
func testCodeObjectSchema() throws {
class OGoObject : ActiveRecord {
let objectVersion = Value.Int(column: "object_version", 0)
}
class Address : OGoObject, CodeObjectType {
// Boxed values, annotated with Attribute information
let id = Value.Int (column: "address_id")
let dbStatus = Value.String(column: "db_status", width: 50)
let companyId = Value.Int (column: "company_id")
let type = Value.String(width: 50) // TODO: an enum?
// TODO: We can do this, but we don't get automagic KVC then.
let name1 : String? = nil
let name2 : String? = nil
let name3 : String? = nil
let street : String? = nil
let zip = Value.OptString(width: 50, nil)
let zipcity : String? = nil
let country : String? = nil
let state : String? = nil
let district : String? = nil
// TODO
// - This could be a 'fault'.
//let person = ToOne<Person>() // auto: key: "company_id")
static let entity : ZeeQL.Entity
= CodeObjectEntity<Address>(table: "address")
}
let entity = Address.entity
XCTAssertEqual(entity.externalName, "address")
let attrs = entity.attributes
XCTAssertEqual(attrs.count, 14)
let pkeys = entity.primaryKeyAttributeNames
XCTAssertNotNil(pkeys)
XCTAssertEqual(pkeys?.count ?? -1, 1)
XCTAssertEqual(pkeys?[0] ?? "", "id")
}
static var allTests = [
( "testCodeObjectSchema", testCodeObjectSchema )
]
}
| apache-2.0 |
zSOLz/viper-base | ViperBase/ViperBaseTests/Services/ServiceTest.swift | 1 | 4242 | //
// ServiceTest.swift
// ViperBaseTests
//
// Created by SOL on 28.04.17.
// Copyright © 2017 SOL. All rights reserved.
//
import XCTest
@testable import ViperBase
class ServiceTest: XCTestCase {
func testRegisteredInManagerMethod() {
let customService = CustomServiceSubclassMock()
let customManager = ServiceManager(parent: ServiceManager.general)
customManager.register(service: customService)
XCTAssertEqual(CustomServiceMock.registered(inManager: customManager), customService)
ServiceManager.general.register(service: customService)
XCTAssertEqual(CustomServiceMock.registered(), customService)
XCTAssertEqual(CustomServiceMock.registered(inManager: customManager), customService)
customManager.unregister(service: customService)
XCTAssertEqual(CustomServiceMock.registered(), customService)
XCTAssertEqual(CustomServiceMock.registered(inManager: customManager), customService)
ServiceManager.general.unregister(service: customService)
}
func testStartStopMethods() {
let service = CustomServiceMock()
XCTAssertFalse(service.isStarted)
service.start()
XCTAssertTrue(service.isStarted)
service.stop()
XCTAssertFalse(service.isStarted)
}
/*
// Test for this method always fails: Unknown swift compiler bug. Maybe you can solve it :)
func testIsRegisteredInManagerMethod() {
let customSubclassService = CustomServiceMock()
let customManager = ServiceManager(parent: ServiceManager.general)
XCTAssertFalse(CustomServiceMock.isRegistered())
XCTAssertFalse(CustomServiceMock.isRegistered(inManager: customManager))
XCTAssertFalse(CustomServiceSubclassMock.isRegistered())
XCTAssertFalse(CustomServiceSubclassMock.isRegistered(inManager: customManager))
XCTAssertFalse(AnotherCustomServiceMock.isRegistered())
XCTAssertFalse(AnotherCustomServiceMock.isRegistered(inManager: customManager))
customManager.register(service: customSubclassService)
XCTAssertFalse(CustomServiceMock.isRegistered())
XCTAssertTrue(CustomServiceMock.isRegistered(inManager: customManager))
XCTAssertFalse(CustomServiceSubclassMock.isRegistered())
XCTAssertTrue(CustomServiceSubclassMock.isRegistered(inManager: customManager))
XCTAssertFalse(AnotherCustomServiceMock.isRegistered())
XCTAssertFalse(AnotherCustomServiceMock.isRegistered(inManager: customManager))
ServiceManager.general.register(service: customSubclassService)
XCTAssertTrue(CustomServiceMock.isRegistered())
XCTAssertTrue(CustomServiceMock.isRegistered(inManager: customManager))
XCTAssertTrue(CustomServiceSubclassMock.isRegistered())
XCTAssertTrue(CustomServiceSubclassMock.isRegistered(inManager: customManager))
XCTAssertFalse(AnotherCustomServiceMock.isRegistered())
XCTAssertFalse(AnotherCustomServiceMock.isRegistered(inManager: customManager))
customManager.unregister(service: customSubclassService)
XCTAssertTrue(CustomServiceMock.isRegistered())
XCTAssertTrue(CustomServiceMock.isRegistered(inManager: customManager))
XCTAssertTrue(CustomServiceSubclassMock.isRegistered())
XCTAssertTrue(CustomServiceSubclassMock.isRegistered(inManager: customManager))
XCTAssertFalse(AnotherCustomServiceMock.isRegistered())
XCTAssertFalse(AnotherCustomServiceMock.isRegistered(inManager: customManager))
ServiceManager.general.unregister(service: customSubclassService)
XCTAssertFalse(CustomServiceMock.isRegistered())
XCTAssertFalse(CustomServiceMock.isRegistered(inManager: customManager))
XCTAssertFalse(CustomServiceSubclassMock.isRegistered())
XCTAssertFalse(CustomServiceSubclassMock.isRegistered(inManager: customManager))
XCTAssertFalse(AnotherCustomServiceMock.isRegistered())
XCTAssertFalse(AnotherCustomServiceMock.isRegistered(inManager: customManager))
} */
}
| mit |
systers/PowerUp | Powerup/AppStoreReviewManager.swift | 1 | 1727 | //
// AppStoreReviewManager.swift
// Powerup
import Foundation
import StoreKit
enum AppStoreReviewManager {
static let minimumReviewWorthyActionCount = 4
static func requestReviewIfAppropriate() {
let defaults = UserDefaults.standard
let bundle = Bundle.main
// Read the current number of actions that the user has performed since the last requested review from the User Defaults.
var actionCount = defaults.integer(forKey: .reviewWorthyActionCount)
/* Note: This sample project uses an extension on UserDefaults to eliminate the need for using “stringly” typed keys when accessing values. This is a good practice to follow in order to avoid accidentally mistyping a key as it can cause hard-to-find bugs in your app. You can find this extension in UserDefaults+Key.swift.
*/
actionCount += 1
defaults.set(actionCount, forKey: .reviewWorthyActionCount)
guard actionCount >= minimumReviewWorthyActionCount else {
return
}
let bundleVersionKey = kCFBundleVersionKey as String
let currentVersion = bundle.object(forInfoDictionaryKey: bundleVersionKey) as? String
let lastVersion = defaults.string(forKey: .lastReviewRequestAppVersion)
// Check if this is the first request for this version of the app before continuing.
guard lastVersion == nil || lastVersion != currentVersion else {
return
}
SKStoreReviewController.requestReview()
// Reset the action count and store the current version in User Defaults so that you don’t request again on this version of the app.
defaults.set(0, forKey: .reviewWorthyActionCount)
defaults.set(currentVersion, forKey: .lastReviewRequestAppVersion)
}
}
| gpl-2.0 |
borisyurkevich/ECAB | ECAB/GameMenuViewController.swift | 1 | 6449 | //
// GameMenuViewController.swift
// ECAB
//
// Created by Boris Yurkevich on 29/05/2021.
// Copyright © 2021 Oliver Braddick and Jan Atkinson. All rights reserved.
//
import UIKit
import os
final class GameMenuViewController: UIViewController {
weak var delelgate: GameMenuDelegate?
@IBOutlet private weak var menuView: MenuView!
@IBOutlet private weak var menuStrip: UIView!
@IBOutlet private weak var backLabel: UILabel!
@IBOutlet private weak var forwardLabel: UILabel!
@IBOutlet private weak var skipLabel: UILabel!
@IBOutlet private weak var pauseLabel: UILabel!
private let borderWidth: CGFloat = 1.0
private let borderColor: CGColor = UIColor.darkGray.cgColor
private var buttonColor: UIColor?
private var activity: UIActivityIndicatorView?
override func viewDidLoad() {
super.viewDidLoad()
addMenuBorders()
setTextColor()
menuView.delegate = self
buttonColor = backLabel.backgroundColor
}
func toggleNavigationButtons(isEnabled: Bool) {
forwardLabel.isEnabled = isEnabled
backLabel.isEnabled = isEnabled
skipLabel.isEnabled = isEnabled
}
func updatePauseButtonState(isHidden: Bool) {
pauseLabel.isHidden = isHidden
}
func updateBackButtonTitle(_ title: String) {
backLabel.text = title
}
func startAnimatingPauseButton() {
pauseLabel.text = ""
activity = UIActivityIndicatorView(style: .medium)
guard let activity = activity else {
return
}
activity.startAnimating()
pauseLabel.addSubview(activity)
activity.translatesAutoresizingMaskIntoConstraints = false
activity.centerYAnchor.constraint(equalTo: pauseLabel.centerYAnchor).isActive = true
activity.centerXAnchor.constraint(equalTo: pauseLabel.centerXAnchor).isActive = true
}
func stopAnimatingPauseButton() {
activity?.removeFromSuperview()
self.pauseLabel.text = "Pause"
self.pauseLabel.textColor = UIColor.label
}
// MARK: - Private
private func addMenuBorders() {
backLabel.layer.borderWidth = borderWidth
backLabel.layer.borderColor = borderColor
forwardLabel.layer.borderWidth = borderWidth
forwardLabel.layer.borderColor = borderColor
skipLabel.layer.borderWidth = borderWidth
skipLabel.layer.borderColor = borderColor
pauseLabel.layer.borderWidth = borderWidth
pauseLabel.layer.borderColor = borderColor
}
private func setTextColor() {
backLabel.textColor = UIColor.label
forwardLabel.textColor = UIColor.label
skipLabel.textColor = UIColor.label
pauseLabel.textColor = UIColor.label
}
}
extension GameMenuViewController: MenuViewDelegate {
func reset(location: CGPoint) {
DispatchQueue.main.async { [unowned self] in
if location.x < forwardLabel.frame.origin.x {
backLabel.backgroundColor = buttonColor
backLabel.textColor = UIColor.label
} else if location.x < skipLabel.frame.origin.x {
forwardLabel.backgroundColor = buttonColor
forwardLabel.textColor = UIColor.label
} else if location.x <= skipLabel.frame.origin.x + skipLabel.frame.width {
skipLabel.backgroundColor = buttonColor
skipLabel.textColor = UIColor.label
} else if location.x >= pauseLabel.frame.origin.x {
pauseLabel.backgroundColor = buttonColor
pauseLabel.textColor = UIColor.label
} else {
os_log(.debug, "touch outise buttons area: %@", location.debugDescription)
}
}
}
func highlight(location: CGPoint) {
DispatchQueue.main.async { [unowned self] in
if location.x < forwardLabel.frame.origin.x {
if backLabel.isEnabled {
backLabel.backgroundColor = view.tintColor
backLabel.textColor = UIColor.lightText
}
} else if location.x < skipLabel.frame.origin.x {
if forwardLabel.isEnabled {
forwardLabel.backgroundColor = view.tintColor
forwardLabel.textColor = UIColor.lightText
}
} else if location.x <= skipLabel.frame.origin.x + skipLabel.frame.width {
if skipLabel.isEnabled {
skipLabel.backgroundColor = view.tintColor
skipLabel.textColor = UIColor.lightText
}
} else if location.x >= pauseLabel.frame.origin.x {
if pauseLabel.isEnabled {
pauseLabel.backgroundColor = view.tintColor
pauseLabel.textColor = UIColor.lightText
}
} else {
os_log(.debug, "touch outise buttons area: %@", location.debugDescription)
}
}
}
func handleTouch(location: CGPoint) {
DispatchQueue.main.async { [unowned self] in
if location.x < forwardLabel.frame.origin.x {
if backLabel.isEnabled {
backLabel.backgroundColor = buttonColor
backLabel.textColor = UIColor.label
delelgate?.presentPreviousScreen()
}
} else if location.x < skipLabel.frame.origin.x {
if forwardLabel.isEnabled {
forwardLabel.backgroundColor = buttonColor
forwardLabel.textColor = UIColor.label
delelgate?.presentNextScreen()
}
} else if location.x <= skipLabel.frame.origin.x + skipLabel.frame.width {
if skipLabel.isEnabled {
skipLabel.backgroundColor = buttonColor
skipLabel.textColor = UIColor.label
delelgate?.skip()
}
} else if location.x >= pauseLabel.frame.origin.x {
if pauseLabel.isEnabled {
pauseLabel.backgroundColor = buttonColor
pauseLabel.textColor = UIColor.label
delelgate?.presentPause()
}
} else {
os_log(.debug, "touch outise buttons area: %@", location.debugDescription)
}
}
}
}
| mit |
roecrew/AudioKit | Examples/iOS/AnalogSynthX/AnalogSynthX/CustomControls/KnobLarge.swift | 1 | 2441 | //
// KnobLarge.swift
// Swift Synth
//
// Created by Matthew Fecher on 1/8/16.
// Copyright © 2016 AudioKit. All rights reserved.
//
import UIKit
protocol KnobLargeDelegate {
func updateKnobValue(value: Double, tag: Int)
}
@IBDesignable
class KnobLarge: Knob {
var delegate: KnobLargeDelegate?
// Image Declarations
var knob212_base = UIImage(named: "knob212_base")
var knob212_indicator = UIImage(named: "knob212_indicator")
override func drawRect(rect: CGRect) {
drawKnobLarge(knobValue: knobValue)
}
// MARK: - Set Percentages
override func setPercentagesWithTouchPoint(touchPoint: CGPoint) {
super.setPercentagesWithTouchPoint(touchPoint)
delegate?.updateKnobValue(value, tag: self.tag)
setNeedsDisplay()
}
// MARK: - PaintCode generated code
func drawKnobLarge(knobValue knobValue: CGFloat = 0.332) {
//// General Declarations
let context = UIGraphicsGetCurrentContext()
//// Variable Declarations
let knobAngle: CGFloat = -240 * knobValue
//// Picture Drawing
let picturePath = UIBezierPath(rect: CGRect(x: 10, y: 10, width: 106, height: 106))
CGContextSaveGState(context)
picturePath.addClip()
knob212_base!.drawInRect(CGRectMake(10, 10, knob212_base!.size.width, knob212_base!.size.height))
CGContextRestoreGState(context)
//// Picture 2 Drawing
CGContextSaveGState(context)
CGContextTranslateCTM(context, 63, 63)
CGContextRotateCTM(context, -(knobAngle + 120) * CGFloat(M_PI) / 180)
let picture2Path = UIBezierPath(rect: CGRect(x: -53, y: -53, width: 106, height: 106))
CGContextSaveGState(context)
picture2Path.addClip()
knob212_indicator!.drawInRect(CGRectMake(-53, -53, knob212_indicator!.size.width, knob212_indicator!.size.height))
CGContextRestoreGState(context)
CGContextRestoreGState(context)
}
// MARK: - Allow knobs to appear in IB
override func prepareForInterfaceBuilder() {
super.prepareForInterfaceBuilder()
let bundle = NSBundle(forClass: self.dynamicType)
knob212_base = UIImage(named: "knob212_base", inBundle: bundle, compatibleWithTraitCollection: self.traitCollection)!
knob212_indicator = UIImage(named: "knob212_indicator", inBundle: bundle, compatibleWithTraitCollection: self.traitCollection)!
}
}
| mit |
QuarkX/Quark | Sources/Mustache/Compiling/TemplateAST/SectionTag.swift | 2 | 2327 | // The MIT License
//
// Copyright (c) 2015 Gwendal Roué
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in
// all copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
// THE SOFTWARE.
/**
A SectionTag represents a regular or inverted section tag such as
{{#section}}...{{/section}} or {{^section}}...{{/section}}.
*/
final class SectionTag: LocatedTag {
let openingToken: TemplateToken
let innerTemplateAST: TemplateAST
init(innerTemplateAST: TemplateAST, openingToken: TemplateToken, innerTemplateString: String) {
self.innerTemplateAST = innerTemplateAST
self.openingToken = openingToken
self.innerTemplateString = innerTemplateString
}
// Mark: - Tag protocol
let type: TagType = .Section
let innerTemplateString: String
var tagDelimiterPair: TagDelimiterPair { return openingToken.tagDelimiterPair! }
var description: String {
return "\(openingToken.templateSubstring) at \(openingToken.locationDescription)"
}
func render(context: Context) throws -> Rendering {
let renderingEngine = RenderingEngine(templateAST: innerTemplateAST, context: context)
return try renderingEngine.render()
}
// Mark: - LocatedTag
var templateID: TemplateID? { return openingToken.templateID }
var lineNumber: Int { return openingToken.lineNumber }
}
| mit |
brokenseal/WhereIsMaFood | WhereIsMaFood/ShowWebsiteModalViewController.swift | 1 | 646 | //
// ShowWebsiteModalViewController.swift
// WhereIsMaFood
//
// Created by Davide Callegari on 08/08/17.
// Copyright © 2017 Davide Callegari. All rights reserved.
//
import UIKit
class ShowWebsiteModalViewController: UIViewController {
@IBOutlet weak var webView: UIWebView!
var url: URL?
@IBAction func goBack(_ sender: Any) {
dismiss(animated: true, completion: nil)
}
override func viewDidLoad() {
super.viewDidLoad()
// FIXME: bail out?
if let url = url {
let request = URLRequest(url: url)
webView.loadRequest(request)
}
}
func setup(url: URL) {
self.url = url
}
}
| mit |
JesusAntonioGil/Design-Patterns-Swift-2 | CreationalPatterns/FactoryMethodPattern/FactoryMethodPattern/Model/CardFactory.swift | 1 | 566 | //
// CardFactory.swift
// FactoryMethodPattern
//
// Created by Jesus Antonio Gil on 17/12/15.
// Copyright © 2015 Jesus Antonio Gil. All rights reserved.
//
import UIKit
enum CardType
{
case FacelessManipulator, RaidLeader
}
class CardFactory: NSObject {
//MARK: PUBLIC
class func createCard(cardType:CardType) -> Card?
{
switch cardType
{
case .FacelessManipulator:
return FacelessManipulatorCard()
case .RaidLeader:
return RaidLeaderCard()
}
}
}
| mit |
maxvol/RxCloudKit | RxCloudKit/RecordFetcher.swift | 1 | 1552 | //
// Fetcher.swift
// RxCloudKit
//
// Created by Maxim Volgin on 22/06/2017.
// Copyright (c) RxSwiftCommunity. All rights reserved.
//
import RxSwift
import CloudKit
@available(iOS 10, *)
final class RecordFetcher {
typealias Observer = AnyObserver<CKRecord>
private let observer: Observer
private let database: CKDatabase
private let limit: Int
init(observer: Observer, database: CKDatabase, query: CKQuery, limit: Int) {
self.observer = observer
self.database = database
self.limit = limit
self.fetch(query: query)
}
private func recordFetchedBlock(record: CKRecord) {
self.observer.on(.next(record))
}
private func queryCompletionBlock(cursor: CKQueryOperation.Cursor?, error: Error?) {
if let error = error {
observer.on(.error(error))
return
}
if let cursor = cursor {
let operation = CKQueryOperation(cursor: cursor)
self.setupAndAdd(operation: operation)
return
}
observer.on(.completed)
}
private func fetch(query: CKQuery) {
let operation = CKQueryOperation(query: query)
self.setupAndAdd(operation: operation)
}
private func setupAndAdd(operation: CKQueryOperation) {
operation.resultsLimit = self.limit
operation.recordFetchedBlock = self.recordFetchedBlock
operation.queryCompletionBlock = self.queryCompletionBlock
self.database.add(operation)
}
}
| mit |
GrandCentralBoard/GrandCentralBoard | Pods/Operations/Sources/Features/Shared/CloudKitOperation.swift | 2 | 13647 | //
// CloudKitOperation.swift
// Operations
//
// Created by Daniel Thorpe on 22/07/2015.
// Copyright (c) 2015 Daniel Thorpe. All rights reserved.
//
import Foundation
import CloudKit
// MARK: - OPRCKOperation
public class OPRCKOperation<T where T: NSOperation, T: CKOperationType>: ReachableOperation<T> {
override init(_ operation: T, connectivity: Reachability.Connectivity = .AnyConnectionKind) {
super.init(operation, connectivity: connectivity)
name = "OPRCKOperation<\(T.self)>"
}
}
// MARK: - Cloud Kit Error Recovery
public class CloudKitRecovery<T where T: NSOperation, T: CKOperationType> {
public typealias V = OPRCKOperation<T>
public typealias ErrorResponse = (delay: Delay?, configure: V -> Void)
public typealias Handler = (error: NSError, log: LoggerType, suggested: ErrorResponse) -> ErrorResponse?
typealias Payload = (Delay?, V)
var defaultHandlers: [CKErrorCode: Handler]
var customHandlers: [CKErrorCode: Handler]
init() {
defaultHandlers = [:]
customHandlers = [:]
addDefaultHandlers()
}
internal func recoverWithInfo(info: RetryFailureInfo<V>, payload: Payload) -> ErrorResponse? {
guard let (code, error) = cloudKitErrorsFromInfo(info) else { return .None }
// We take the payload, if not nil, and return the delay, and configuration block
let suggestion: ErrorResponse = (payload.0, info.configure )
var response: ErrorResponse? = .None
response = defaultHandlers[code]?(error: error, log: info.log, suggested: suggestion)
response = customHandlers[code]?(error: error, log: info.log, suggested: response ?? suggestion)
return response
// 5. Consider how we might pass the result of the default into the custom
}
func addDefaultHandlers() {
let exit: Handler = { error, log, _ in
log.fatal("Exiting due to CloudKit Error: \(error)")
return .None
}
let retry: Handler = { error, log, suggestion in
if let interval = (error.userInfo[CKErrorRetryAfterKey] as? NSNumber).map({ $0.doubleValue }) {
return (Delay.By(interval), suggestion.configure)
}
return suggestion
}
setDefaultHandlerForCode(.InternalError, handler: exit)
setDefaultHandlerForCode(.MissingEntitlement, handler: exit)
setDefaultHandlerForCode(.InvalidArguments, handler: exit)
setDefaultHandlerForCode(.ServerRejectedRequest, handler: exit)
setDefaultHandlerForCode(.AssetFileNotFound, handler: exit)
setDefaultHandlerForCode(.IncompatibleVersion, handler: exit)
setDefaultHandlerForCode(.ConstraintViolation, handler: exit)
setDefaultHandlerForCode(.BadDatabase, handler: exit)
setDefaultHandlerForCode(.QuotaExceeded, handler: exit)
setDefaultHandlerForCode(.OperationCancelled, handler: exit)
setDefaultHandlerForCode(.NetworkUnavailable, handler: retry)
setDefaultHandlerForCode(.NetworkFailure, handler: retry)
setDefaultHandlerForCode(.ServiceUnavailable, handler: retry)
setDefaultHandlerForCode(.RequestRateLimited, handler: retry)
setDefaultHandlerForCode(.AssetFileModified, handler: retry)
setDefaultHandlerForCode(.BatchRequestFailed, handler: retry)
setDefaultHandlerForCode(.ZoneBusy, handler: retry)
}
func setDefaultHandlerForCode(code: CKErrorCode, handler: Handler) {
defaultHandlers.updateValue(handler, forKey: code)
}
func setCustomHandlerForCode(code: CKErrorCode, handler: Handler) {
customHandlers.updateValue(handler, forKey: code)
}
internal func cloudKitErrorsFromInfo(info: RetryFailureInfo<OPRCKOperation<T>>) -> (code: CKErrorCode, error: NSError)? {
let mapped: [(CKErrorCode, NSError)] = info.errors.flatMap { error in
let error = error as NSError
if error.domain == CKErrorDomain, let code = CKErrorCode(rawValue: error.code) {
return (code, error)
}
return .None
}
return mapped.first
}
}
// MARK: - CloudKitOperation
/**
# CloudKitOperation
CloudKitOperation is a generic operation which can be used to configure and schedule
the execution of Apple's CKOperation subclasses.
## Generics
CloudKitOperation is generic over the type of the CKOperation. See Apple's documentation
on their CloudKit NSOperation classes.
## Initialization
CloudKitOperation is initialized with a block which should return an instance of the
required operation. Note that some CKOperation subclasses have static methods to
return standard instances. Given Swift's treatment of trailing closure arguments, this
means that the following is a standard initialization pattern:
```swift
let operation = CloudKitOperation { CKFetchRecordZonesOperation.fetchAllRecordZonesOperation() }
```
This works because, the initializer only takes a trailing closure. The closure receives no arguments
and is only one line, so the return is not needed.
## Configuration
Most CKOperation subclasses need various properties setting before they are added to a queue. Sometimes
these can be done via their initializers. However, it is also possible to set the properties directly.
This can be done directly onto the CloudKitOperation. For example, given the above:
```swift
let container = CKContainer.defaultContainer()
operation.container = container
operation.database = container.privateCloudDatabase
```
This will set the container and the database through the CloudKitOperation into the wrapped CKOperation
instance.
## Completion
All CKOperation subclasses have a completion block which should be set. This completion block receives
the "results" of the operation, and an `NSError` argument. However, CloudKitOperation features its own
semi-automatic error handling system. Therefore, the only completion block needed is one which receives
the "results". Essentially, all that is needed is to manage the happy path of the operation. For all
CKOperation subclasses, this can be configured directly on the CloudKitOperation instance, using a
pattern of `setOperationKindCompletionBlock { }`. For example, given the above:
```swift
operation.setFetchRecordZonesCompletionBlock { zonesByID in
// Do something with the zonesByID
}
```
Note, that for the automatic error handling to kick in, the happy path must be set (as above).
### Error Handling
When the completion block is set as above, any errors receives from the CKOperation subclass are
intercepted, and instead of the provided block being executed, the operation finsihes with an error.
However, CloudKitOperation is a subclass of RetryOperation, which is actually a GroupOperation subclass,
and when a child operation finishes with an error, RetryOperation will consult its error handler, and
attempt to retry the operation.
In the case of CloudKitOperation, the error handler, which is configured internally has automatic
support for many common error kinds. When the CKOperation receives an error, the CKErrorCode is extracted,
and the handler consults a CloudKitRecovery instance to check for a particular way to handle that error
code. In some cases, this will result in a tuple being returned. The tuple is an optional Delay, and
a new instance of the CKOperation class.
This is why the initializer takes a block which returns an instance of the CKOperation subclass, rather
than just an instance directly. In addition, any configuration set on the operation is captured and
applied again to new instances of the CKOperation subclass.
The delay is used to automatically respect any wait periods returned in the CloudKit NSError object. If
none are given, a random time delay between 0.1 and 1.0 seconds is used.
If the error recovery does not have a handler, or the handler returns nil (no tuple), the CloudKitOperation
will finish (with the errors).
### Custom Error Handling
To provide bespoke error handling, further configure the CloudKitOperation by calling setErrorHandlerForCode.
For example:
```swift
operation.setErrorHandlerForCode(.PartialFailure) { error, log, suggested in
return suggested
}
```
Note that the error handler receives the received error, a logger object, and the suggested tuple, which
could be modified before being returned. Alternatively, return nil to not retry.
*/
public final class CloudKitOperation<T where T: NSOperation, T: CKOperationType>: RetryOperation<OPRCKOperation<T>> {
public typealias ErrorHandler = CloudKitRecovery<T>.Handler
let recovery: CloudKitRecovery<T>
var operation: T {
return current.operation
}
public convenience init(_ body: () -> T?) {
self.init(generator: AnyGenerator(body: body), connectivity: .AnyConnectionKind, reachability: ReachabilityManager(DeviceReachability()))
}
convenience init(connectivity: Reachability.Connectivity = .AnyConnectionKind, reachability: SystemReachabilityType, _ body: () -> T?) {
self.init(generator: AnyGenerator(body: body), connectivity: .AnyConnectionKind, reachability: reachability)
}
init<G where G: GeneratorType, G.Element == T>(generator gen: G, connectivity: Reachability.Connectivity = .AnyConnectionKind, reachability: SystemReachabilityType) {
// Creates a standard random delay between retries
let strategy: WaitStrategy = .Random((0.1, 1.0))
let delay = MapGenerator(strategy.generator()) { Delay.By($0) }
// Maps the generator to wrap the target operation.
let generator = MapGenerator(gen) { operation -> OPRCKOperation<T> in
let op = OPRCKOperation(operation, connectivity: connectivity)
op.reachability = reachability
return op
}
// Creates a CloudKitRecovery object
let _recovery = CloudKitRecovery<T>()
// Creates a Retry Handler using the recovery object
let handler: Handler = { info, payload in
guard let (delay, configure) = _recovery.recoverWithInfo(info, payload: payload) else { return .None }
let (_, operation) = payload
configure(operation)
return (delay, operation)
}
recovery = _recovery
super.init(delay: delay, generator: generator, retry: handler)
name = "CloudKitOperation<\(T.self)>"
}
public func setErrorHandlerForCode(code: CKErrorCode, handler: ErrorHandler) {
recovery.setCustomHandlerForCode(code, handler: handler)
}
override func childOperation(child: NSOperation, didFinishWithErrors errors: [ErrorType]) {
if !(child is OPRCKOperation<T>) {
super.childOperation(child, didFinishWithErrors: errors)
}
}
}
// MARK: - BatchedCloudKitOperation
class CloudKitOperationGenerator<T where T: NSOperation, T: CKOperationType>: GeneratorType {
let connectivity: Reachability.Connectivity
let reachability: SystemReachabilityType
var generator: AnyGenerator<T>
var more: Bool = true
init<G where G: GeneratorType, G.Element == T>(generator: G, connectivity: Reachability.Connectivity = .AnyConnectionKind, reachability: SystemReachabilityType) {
self.generator = AnyGenerator(generator)
self.connectivity = connectivity
self.reachability = reachability
}
func next() -> CloudKitOperation<T>? {
guard more else { return .None }
return CloudKitOperation(generator: generator, connectivity: connectivity, reachability: reachability)
}
}
public class BatchedCloudKitOperation<T where T: NSOperation, T: CKBatchedOperationType>: RepeatedOperation<CloudKitOperation<T>> {
public var enableBatchProcessing: Bool
var generator: CloudKitOperationGenerator<T>
public var operation: T {
return current.operation
}
public convenience init(enableBatchProcessing enable: Bool = true, _ body: () -> T?) {
self.init(generator: AnyGenerator(body: body), enableBatchProcessing: enable, connectivity: .AnyConnectionKind, reachability: ReachabilityManager(DeviceReachability()))
}
convenience init(enableBatchProcessing enable: Bool = true, connectivity: Reachability.Connectivity = .AnyConnectionKind, reachability: SystemReachabilityType, _ body: () -> T?) {
self.init(generator: AnyGenerator(body: body), enableBatchProcessing: enable, connectivity: connectivity, reachability: reachability)
}
init<G where G: GeneratorType, G.Element == T>(generator gen: G, enableBatchProcessing enable: Bool = true, connectivity: Reachability.Connectivity = .AnyConnectionKind, reachability: SystemReachabilityType) {
enableBatchProcessing = enable
generator = CloudKitOperationGenerator(generator: gen, connectivity: connectivity, reachability: reachability)
// Creates a standard fixed delay between batches (not reties)
let strategy: WaitStrategy = .Fixed(0.1)
let delay = MapGenerator(strategy.generator()) { Delay.By($0) }
let tuple = TupleGenerator(primary: generator, secondary: delay)
super.init(generator: AnyGenerator(tuple))
}
public override func willFinishOperation(operation: NSOperation, withErrors errors: [ErrorType]) {
if errors.isEmpty, let cloudKitOperation = operation as? CloudKitOperation<T> {
generator.more = enableBatchProcessing && cloudKitOperation.current.moreComing
}
super.willFinishOperation(operation, withErrors: errors)
}
}
| gpl-3.0 |
a736220388/FinestFood | FinestFood/FinestFood/classes/common/Constant.swift | 1 | 4139 | //
// Constant.swift
// FinestFood
//
// Created by qianfeng on 16/8/15.
// Copyright © 2016年 qianfeng. All rights reserved.
//
import UIKit
public let kScreenWidth = UIScreen.mainScreen().bounds.width
public let kScreenHeight = UIScreen.mainScreen().bounds.height
public let FSScrollViewUrl = "http://api.guozhoumoapp.com/v1/banners?channel=iOS"
//专题集合(体验课...)
public let FSScrollViewListlUrl = "http://api.guozhoumoapp.com/v1/collections/%d/posts?gender=%d&generation=%d&limit=%d&offset=%d"
public let FSSearchWordUrl = "http://api.guozhoumoapp.com/v1/search/hot_words"
public let FSSearchItemResultUrl = "http://api.guozhoumoapp.com/v1/search/item?keyword=%@&limit=%d&offset=%d&sort="
public let FSSearchPostResultUrl = "http://api.guozhoumoapp.com/v1/search/post?keyword=%@&limit=%d&offset=%d&sort="
public let FSFoodListUrl = "http://api.guozhoumoapp.com/v1/channels/2/items?gender=%d&generation=%d&limit=%d&offset=%d"
//宅家
public let FSFoodMoreListUrl = "http://api.guozhoumoapp.com/v1/channels/%d/items?limit=%d&offset=%d"
public let FSFoodDetailUrl = "http://api.guozhoumoapp.com/v1/posts/%d"
public let FLFoodListUrl = "http://api.guozhoumoapp.com/v2/items?gender=%d&generation=%d&limit=%d&offset=%d"
public let FLFoodDetailUrl = "http://api.guozhoumoapp.com/v2/items/%d/comments?limit=%d&offset=%d"//单品中商品的detail
public let FLFoodSearchDetailUrl = "http://api.guozhoumoapp.com/v2/items/%d"//搜索中商品的detail
public let CGHomeOutUrl = "http://api.guozhoumoapp.com/v1/channel_groups/all"
//查看全部
public let CGSubjectUrl = "http://api.guozhoumoapp.com/v1/collections?limit=%d&offset=%d"
//登录
public let MineLoginUrl = "http://api.guozhoumoapp.com/v1/account/signin"
//postBody:mobile=18550217023&password=123456
//登陆后获取用户信息
public let UserInfoPostUrl = "http://api.guozhoumoapp.com/v1/users/me/post_likes?limit==%d&offset=%d"
public let UserInfoListUrl = "http://api.guozhoumoapp.com/v1/users/me/favorite_lists?limit==%d&offset=%d"
//注册
public let MineRegisterUrl = "http://api.guozhoumoapp.com/v1/account/mobile_exist"
//post:mobile=18550217032
//{
// "code": 200,
// "data": {
// "exist": false
// },
// "message": "OK"
//}
//http://api.guozhoumoapp.com/v1/account/sms_token
// {
// "code": 200,
// "data": {
// "token": "xwg6e9f6z5"
// },
// "message": "OK"
//}
//http://api.guozhoumoapp.com/v1/account/send_verification_code
//access_token=I7iUQTM%2Bbmpucs6rWeMAAMoCFx4%3D&mobile=18550217032
// {
// "code": 200,
// "data": {},
// "message": "OK"
//}
/*
精选
滚动视图
http://api.guozhoumoapp.com/v1/banners?channel=iOS
滚动视图详情
1,体验课:http://api.guozhoumoapp.com/v1/collections/4/posts?gender=1&generation=0&limit=20&offset=0
2,下厨房:http://api.guozhoumoapp.com/v1/collections/3/posts?gender=1&generation=0&limit=20&offset=0
3,来一发:http://api.guozhoumoapp.com/v1/collections/1/posts?gender=1&generation=0&limit=20&offset=0
4,周末宅家:http://api.guozhoumoapp.com/v1/collections/2/posts?gender=1&generation=0&limit=20&offset=0
内容
http://api.guozhoumoapp.com/v1/channels/2/items?gender=1&generation=0&limit=20&offset=0
搜索
http://api.guozhoumoapp.com/v1/search/hot_words?
商品:http://api.guozhoumoapp.com/v1/search/item?keyword=%E6%89%8B%E5%B7%A5&limit=20&offset=0&sort=
攻略:http://api.guozhoumoapp.com/v1/search/post?keyword=%E4%B8%8A%E6%B5%B7&limit=20&offset=0&sort=
周末逛店
内容:http://api.guozhoumoapp.com/v1/channels/12/items?limit=20&offset=0
尝美食
内容:http://api.guozhoumoapp.com/v1/channels/15/items?limit=20&offset=0
体验课
内容:http://api.guozhoumoapp.com/v1/channels/13/items?limit=20&offset=0
周边游
内容:http://api.guozhoumoapp.com/v1/channels/14/items?limit=20&offset=0
单品
内容:http://api.guozhoumoapp.com/v2/items?gender=1&generation=0&limit=20&offset=0
宅家,出门 http://api.guozhoumoapp.com/v1/channel_groups/all
专题集合 http://api.guozhoumoapp.com/v1/collections?limit=6&offset=0
*/ | mit |
apple/swift-corelibs-foundation | Darwin/Foundation-swiftoverlay/NSExpression.swift | 1 | 1045 | //===----------------------------------------------------------------------===//
//
// This source file is part of the Swift.org open source project
//
// Copyright (c) 2014 - 2020 Apple Inc. and the Swift project authors
// Licensed under Apache License v2.0 with Runtime Library Exception
//
// See https://swift.org/LICENSE.txt for license information
// See https://swift.org/CONTRIBUTORS.txt for the list of Swift project authors
//
//===----------------------------------------------------------------------===//
@_exported import Foundation // Clang module
extension NSExpression {
// + (NSExpression *) expressionWithFormat:(NSString *)expressionFormat, ...;
public
convenience init(format expressionFormat: __shared String, _ args: CVarArg...) {
let va_args = getVaList(args)
self.init(format: expressionFormat, arguments: va_args)
}
}
extension NSExpression {
public convenience init<Root, Value>(forKeyPath keyPath: KeyPath<Root, Value>) {
self.init(forKeyPath: _bridgeKeyPathToString(keyPath))
}
}
| apache-2.0 |
peterxhu/ARGoal | ARGoal/Virtual Objects/FieldGoal.swift | 1 | 469 | //
// FieldGoal.swift
// ARGoal
//
// Created by Peter Hu on 6/17/17.
// Copyright © 2017 App Doctor Hu. All rights reserved.
//
import Foundation
import SceneKit
class FieldGoal: VirtualObject {
override init() {
super.init(modelName: "goal", fileExtension: "scn", thumbImageFilename: "fieldGoal", title: "Field Goal")
}
required init?(coder aDecoder: NSCoder) {
fatalError("init(coder:) has not been implemented")
}
}
| apache-2.0 |
jbourjeli/SwiftLabelPhoto | Photos++/FontAwesomeService.swift | 1 | 6836 | //
// FontAwesomeService.swift
// Photos++
//
// Created by Joseph Bourjeli on 9/23/16.
// Copyright © 2016 WorkSmarterComputing. All rights reserved.
//
import UIKit
import CoreText
public enum FontAwesomeIcon: String{
case faCheck="\u{f00c}"
case faCheckSquareO="\u{f046}"
case faMoney="\u{f0d6}"
case faCC="\u{f09d}"
case faCCAmex="\u{f1f3}"
case faCCDiscover="\u{f1f2}"
case faCCMastercard="\u{f1f1}"
case faCCVisa="\u{f1f0}"
case faBuilding="\u{f1ad}"
case faHome="\u{f015}"
case faCar="\u{f1b9}"
case faEnvelope="\u{f0e0}"
case faEnvelopeO="\u{f003}"
case faPhone="\u{f095}"
case faExternalLink="\u{f08e}"
case faBan="\u{f05e}"
case faTable="\u{f0ce}"
case faRepeat="\u{f01e}"
case faMinusCircle="\u{f056}"
case faTrashO="\u{f014}"
case faArchive="\u{f187}"
case faEllipsisV="\u{f142}"
case faEllipsisH="\u{f141}"
case faFilter="\u{f0b0}"
case faPencil="\u{f040}"
case faCameraRetro="\u{f083}"
case faShareSquareO="\u{f045}"
case faShareAlt="\u{f1e0}"
case faShare="\u{f064}"
case faStar="\u{f005}"
case faHandPaperO="\u{f256}"
case faExclamationTriangle="\u{f071}"
case faThumbsOUp="\u{f087}"
case faPlus="\u{f067}"
case faFolderOpen="\u{f07c}"
case faUser="\u{f007}"
case faSunO="\u{f185}"
case faCloud="\u{f0c2}"
case faBook="\u{f02d}"
case faCog="\u{f013}"
case faCogs="\u{f085}"
case faGavel="\u{f0e3}"
case faVolumeUp="\u{f028}"
case faBars="\u{f0c9}"
case faBarChart="\u{f080}"
case faCommentO="\u{f0e5}"
case faCommentsO="\u{f0e6}"
case faTag="\u{f02b}"
;
}
public class FontAwesome {
let icon: FontAwesomeIcon
var textColor: UIColor {
didSet {
self.renderedImage = nil
}
}
var size: CGSize {
didSet {
self.renderedImage = nil
}
}
private var renderedImage: UIImage?
public init(_ icon: FontAwesomeIcon) {
self.icon = icon
self.textColor = UIColor.black
self.size = CGSize(width: 10, height: 10)
}
public convenience init(_ icon: FontAwesomeIcon, textColor: UIColor, size: CGSize) {
self.init(icon)
self.textColor = textColor
self.size = size
}
public convenience init(_ icon: FontAwesomeIcon, size: CGSize) {
self.init(icon)
self.size = size
}
public func image() -> UIImage {
if let renderedImage = self.renderedImage {
return renderedImage
}
let paragraph = NSMutableParagraphStyle()
paragraph.alignment = NSTextAlignment.center
// Taken from FontAwesome.io's Fixed Width Icon CSS
let fontAspectRatio: CGFloat = 1.28571429
let fontSize = min(self.size.width / fontAspectRatio, self.size.height)
let attributedString = NSAttributedString(
string: self.icon.rawValue as String,
attributes: [NSFontAttributeName: UIFont.fontAwesomeOfSize(fontSize: fontSize)!,
NSForegroundColorAttributeName: self.textColor,
NSParagraphStyleAttributeName: paragraph])
UIGraphicsBeginImageContextWithOptions(self.size, false , 0.0)
let boundingRect = CGRect(x:0,
y:(self.size.height - fontSize) / 2,
width:self.size.width,
height:fontSize)
attributedString.draw(in: boundingRect)
let image = UIGraphicsGetImageFromCurrentImageContext()
UIGraphicsEndImageContext()
self.renderedImage = image
return image!
}
}
public class FontAwesomeUtils {
public static let smallFont = UIFont.fontAwesomeOfSize(fontSize: 12)
public static let regularFont = UIFont.fontAwesomeOfSize(fontSize: 16)
public static let bigFont = UIFont.fontAwesomeOfSize(fontSize: 20)
}
public extension UIImage {
public static func imageFromfontAwesomeIcon(name: FontAwesomeIcon, withTextColor textColor: UIColor, ofSize size: CGSize) -> UIImage {
let paragraph = NSMutableParagraphStyle()
paragraph.alignment = NSTextAlignment.center
// Taken from FontAwesome.io's Fixed Width Icon CSS
let fontAspectRatio: CGFloat = 1.28571429
let fontSize = min(size.width / fontAspectRatio, size.height)
let attributedString = NSAttributedString(string: name.rawValue as String,
attributes: [NSFontAttributeName: UIFont.fontAwesomeOfSize(fontSize: fontSize)!,
NSForegroundColorAttributeName: textColor,
NSParagraphStyleAttributeName: paragraph])
UIGraphicsBeginImageContextWithOptions(size, false , 0.0)
attributedString.draw(in: CGRect(x:0, y:(size.height - fontSize) / 2,
width: size.width, height:fontSize))
let image = UIGraphicsGetImageFromCurrentImageContext()
UIGraphicsEndImageContext()
return image!
}
}
public extension UIFont {
public static func fontAwesomeOfSize(fontSize: CGFloat) -> UIFont? {
let name = "FontAwesome"
if (UIFont.fontNames(forFamilyName: name).isEmpty ) {
FontLoader.loadFont(name: name)
}
return UIFont(name: name, size: fontSize)
}
}
private class FontLoader {
class func loadFont(name: String) {
let bundle = Bundle(for: FontLoader.self)
var fontURL: URL
let identifier = bundle.bundleIdentifier
if identifier?.hasPrefix("org.cocoapods") == true {
// If this framework is added using CocoaPods, resources is placed under a subdirectory
fontURL = bundle.url(forResource: name, withExtension: "otf", subdirectory: "FontAwesome.swift.bundle")! as URL
} else {
fontURL = bundle.url(forResource: name, withExtension: "otf")! as URL
}
let data = NSData(contentsOf: fontURL as URL)!
let provider = CGDataProvider(data: data)
let font = CGFont(provider!)
var error: Unmanaged<CFError>?
if !CTFontManagerRegisterGraphicsFont(font, &error) {
let errorDescription: CFString = CFErrorCopyDescription(error!.takeUnretainedValue())
let nsError = error!.takeUnretainedValue() as AnyObject as! NSError
NSException(name: NSExceptionName.internalInconsistencyException, reason: errorDescription as String, userInfo: [NSUnderlyingErrorKey: nsError]).raise()
}
}
}
| mit |
MadeByHecho/Timber | Timber/Logger.swift | 1 | 1265 | //
// Logger.swift
// Timber
//
// Created by Scott Petit on 9/7/14.
// Copyright (c) 2014 Scott Petit. All rights reserved.
//
import Foundation
public protocol LoggerType {
var messageFormatter: MessageFormatterType { get }
func logMessage(message: LogMessage)
}
public enum LogLevel: Int, Comparable {
case None = 0
case Error
case Warn
case Info
case Debug
case Verbose
func toString() -> String {
switch self {
case .None:
return "None"
case .Error:
return "ERROR"
case .Warn:
return "WARNING"
case .Info:
return "INFO"
case .Debug:
return "DEBUG"
case .Verbose:
return "VERBOSE"
}
}
}
public func ==(lhs: LogLevel, rhs: LogLevel) -> Bool {
return lhs.rawValue == rhs.rawValue
}
public func <=(lhs: LogLevel, rhs: LogLevel) -> Bool {
return lhs.rawValue <= rhs.rawValue
}
public func >=(lhs: LogLevel, rhs: LogLevel) -> Bool {
return lhs.rawValue >= rhs.rawValue
}
public func >(lhs: LogLevel, rhs: LogLevel) -> Bool {
return lhs.rawValue > rhs.rawValue
}
public func <(lhs: LogLevel, rhs: LogLevel) -> Bool {
return lhs.rawValue < rhs.rawValue
}
| mit |
jopamer/swift | tools/SwiftSyntax/SwiftSyntax.swift | 1 | 4104 | //===--------------- SwiftLanguage.swift - Swift Syntax Library -----------===//
//
// This source file is part of the Swift.org open source project
//
// Copyright (c) 2014 - 2017 Apple Inc. and the Swift project authors
// Licensed under Apache License v2.0 with Runtime Library Exception
//
// See https://swift.org/LICENSE.txt for license information
// See https://swift.org/CONTRIBUTORS.txt for the list of Swift project authors
//
//===----------------------------------------------------------------------===//
// This file provides main entry point into the Syntax library.
//===----------------------------------------------------------------------===//
import Foundation
#if os(macOS)
import Darwin
#elseif os(Linux)
import Glibc
#endif
/// A list of possible errors that could be encountered while parsing a
/// Syntax tree.
public enum ParserError: Error, CustomStringConvertible {
case swiftcFailed(Int, String)
case invalidFile
public var description: String {
switch self{
case let .swiftcFailed(exitCode, stderr):
let stderrLines = stderr.split(separator: "\n")
return """
swiftc returned with non-zero exit code \(exitCode)
stderr:
\(stderrLines.joined(separator: "\n "))
"""
case .invalidFile:
return "swiftc created an invalid syntax file"
}
}
}
/// Deserializes the syntax tree from its serialized form to an object tree in
/// Swift. To deserialize incrementally transferred syntax trees, the same
/// instance of the deserializer must be used for all subsequent
/// deserializations.
public final class SyntaxTreeDeserializer {
// FIXME: This lookup table just accumulates nodes, we should invalidate nodes
// that are no longer used at some point and remove them from the table
/// Syntax nodes that have already been parsed and are able to be reused if
/// they were omitted in an incremental syntax tree transfer
private var nodeLookupTable: [SyntaxNodeId: RawSyntax] = [:]
/// The IDs of the nodes that were reused as part of incremental syntax
/// parsing during the last deserialization
public var reusedNodeIds: Set<SyntaxNodeId> = []
public init() {
}
/// Decode a serialized form of SourceFileSyntax to a syntax tree.
/// - Parameter data: The UTF-8 represenation of the serialized syntax tree
/// - Returns: A top-level Syntax node representing the contents of the tree,
/// if the parse was successful.
public func deserialize(_ data: Data) throws -> SourceFileSyntax {
reusedNodeIds = []
let decoder = JSONDecoder()
decoder.userInfo[.rawSyntaxDecodedCallback] = self.addToLookupTable
decoder.userInfo[.omittedNodeLookupFunction] = self.lookupNode
let raw = try decoder.decode(RawSyntax.self, from: data)
guard let file = makeSyntax(raw) as? SourceFileSyntax else {
throw ParserError.invalidFile
}
return file
}
// MARK: Incremental deserialization helper functions
private func lookupNode(id: SyntaxNodeId) -> RawSyntax? {
reusedNodeIds.insert(id)
return nodeLookupTable[id]
}
private func addToLookupTable(_ node: RawSyntax) {
nodeLookupTable[node.id] = node
}
}
/// Namespace for functions to retrieve a syntax tree from the swift compiler
/// and deserializing it.
public enum SyntaxTreeParser {
/// Parses the Swift file at the provided URL into a full-fidelity Syntax tree
/// - Parameter url: The URL you wish to parse.
/// - Returns: A top-level Syntax node representing the contents of the tree,
/// if the parse was successful.
/// - Throws: `ParseError.couldNotFindSwiftc` if `swiftc` could not be
/// located, `ParseError.invalidFile` if the file is invalid.
/// FIXME: Fill this out with all error cases.
public static func parse(_ url: URL) throws -> SourceFileSyntax {
let swiftcRunner = try SwiftcRunner(sourceFile: url)
let result = try swiftcRunner.invoke()
let syntaxTreeData = result.stdoutData
let deserializer = SyntaxTreeDeserializer()
return try deserializer.deserialize(syntaxTreeData)
}
}
| apache-2.0 |
tominated/Quake3BSPParser | Sources/BSPTypes.swift | 1 | 4211 | //
// BSPTypes.swift
// Quake3BSPParser
//
// Created by Thomas Brunoli on 28/05/2017.
// Copyright © 2017 Quake3BSPParser. All rights reserved.
//
import Foundation
import simd
public struct Quake3BSP {
public var entities: BSPEntities?;
public var textures: Array<BSPTexture> = [];
public var planes: Array<BSPPlane> = [];
public var nodes: Array<BSPNode> = [];
public var leaves: Array<BSPLeaf> = [];
public var leafFaces: Array<BSPLeafFace> = [];
public var leafBrushes: Array<BSPLeafBrush> = [];
public var models: Array<BSPModel> = [];
public var brushes: Array<BSPBrush> = [];
public var brushSides: Array<BSPBrushSide> = [];
public var vertices: Array<BSPVertex> = [];
public var meshVerts: Array<BSPMeshVert> = [];
public var effects: Array<BSPEffect> = [];
public var faces: Array<BSPFace> = [];
public var lightmaps: Array<BSPLightmap> = [];
public var lightVols: Array<BSPLightVol> = [];
public var visdata: BSPVisdata?;
init() {}
}
public struct BSPEntities {
public let entities: String;
}
public struct BSPTexture {
public let name: String;
public let surfaceFlags: Int32;
public let contentFlags: Int32;
}
public struct BSPPlane {
public let normal: float3;
public let distance: Float32;
}
public struct BSPNode {
public enum NodeChild {
case node(Int);
case leaf(Int);
}
public let planeIndex: Int32;
public let leftChild: NodeChild;
public let rightChild: NodeChild;
public let boundingBoxMin: int3;
public let boundingBoxMax: int3;
}
public struct BSPLeaf {
public let cluster: Int32;
public let area: Int32;
public let boundingBoxMin: int3;
public let boundingBoxMax: int3;
public let leafFaceIndices: CountableRange<Int32>;
public let leafBrushIndices: CountableRange<Int32>;
}
public struct BSPLeafFace {
public let faceIndex: Int32;
}
public struct BSPLeafBrush {
public let brushIndex: Int32;
}
public struct BSPModel {
public let boundingBoxMin: float3;
public let boundingBoxMax: float3;
public let faceIndices: CountableRange<Int32>;
public let brushIndices: CountableRange<Int32>;
}
public struct BSPBrush {
public let brushSideIndices: CountableRange<Int32>;
public let textureIndex: Int32;
}
public struct BSPBrushSide {
public let planeIndex: Int32;
public let textureIndex: Int32;
}
public struct BSPVertex {
public let position: float3;
public let surfaceTextureCoord: float2;
public let lightmapTextureCoord: float2;
public let normal: float3;
public let color: float4;
public init(
position: float3,
surfaceTextureCoord: float2,
lightmapTextureCoord: float2,
normal: float3,
color: float4
) {
self.position = position
self.surfaceTextureCoord = surfaceTextureCoord
self.lightmapTextureCoord = lightmapTextureCoord
self.normal = normal
self.color = color
}
}
public struct BSPMeshVert {
public let vertexIndexOffset: Int32;
}
public struct BSPEffect {
public let name: String;
public let brushIndex: Int32;
}
public struct BSPFace {
public enum FaceType: Int32 {
case polygon = 1, patch, mesh, billboard;
}
public let textureIndex: Int32;
public let effectIndex: Int32?;
public let type: FaceType;
public let vertexIndices: CountableRange<Int32>;
public let meshVertIndices: CountableRange<Int32>;
public let lightmapIndex: Int32;
public let lightmapStart: int2;
public let lightmapSize: int2;
public let lightmapOrigin: float3;
public let lightmapSVector: float3;
public let lightmapTVector: float3;
public let normal: float3;
public let size: int2;
}
public struct BSPLightmap {
public let lightmap: Array<(UInt8, UInt8, UInt8)>;
}
public struct BSPLightVol {
public let ambientColor: (UInt8, UInt8, UInt8);
public let directionalColor: (UInt8, UInt8, UInt8);
public let direction: (UInt8, UInt8);
}
public struct BSPVisdata {
public let numVectors: Int32;
public let vectorSize: Int32;
public let vectors: Array<UInt8>;
}
| mit |
blockchain/My-Wallet-V3-iOS | Modules/DelegatedSelfCustody/Sources/DelegatedSelfCustodyDomain/DelegatedCustodyTransactionServiceAPI.swift | 1 | 2030 | // Copyright © Blockchain Luxembourg S.A. All rights reserved.
import Combine
import Errors
import Foundation
import MoneyKit
import ToolKit
public protocol DelegatedCustodyTransactionServiceAPI {
func buildTransaction(
_ transaction: DelegatedCustodyTransactionInput
) -> AnyPublisher<DelegatedCustodyTransactionOutput, DelegatedCustodyTransactionServiceError>
func sign(
_ transaction: DelegatedCustodyTransactionOutput,
privateKey: Data
) -> Result<DelegatedCustodySignedTransactionOutput, DelegatedCustodyTransactionServiceError>
func pushTransaction(
_ transaction: DelegatedCustodySignedTransactionOutput,
currency: CryptoCurrency
) -> AnyPublisher<String, DelegatedCustodyTransactionServiceError>
}
public enum DelegatedCustodyTransactionServiceError: Error {
case authenticationError(AuthenticationDataRepositoryError)
case networkError(NetworkError)
case signing(DelegatedCustodySigningError)
}
public enum AuthenticationDataRepositoryError: Error {
case missingGUID
case missingSharedKey
}
public struct DelegatedCustodySignedTransactionOutput {
public struct SignedPreImage {
public let preImage: String
public let signingKey: String
public let signatureAlgorithm: DelegatedCustodySignatureAlgorithm
public let signature: String
public init(
preImage: String,
signingKey: String,
signatureAlgorithm: DelegatedCustodySignatureAlgorithm,
signature: String
) {
self.preImage = preImage
self.signingKey = signingKey
self.signatureAlgorithm = signatureAlgorithm
self.signature = signature
}
}
public let rawTx: JSONValue
public let signatures: [SignedPreImage]
public init(
rawTx: JSONValue,
signatures: [DelegatedCustodySignedTransactionOutput.SignedPreImage]
) {
self.rawTx = rawTx
self.signatures = signatures
}
}
| lgpl-3.0 |
huonw/swift | stdlib/public/SDK/SafariServices/SafariServices.swift | 18 | 860 | //===----------------------------------------------------------------------===//
//
// This source file is part of the Swift.org open source project
//
// Copyright (c) 2014 - 2017 Apple Inc. and the Swift project authors
// Licensed under Apache License v2.0 with Runtime Library Exception
//
// See https://swift.org/LICENSE.txt for license information
// See https://swift.org/CONTRIBUTORS.txt for the list of Swift project authors
//
//===----------------------------------------------------------------------===//
@_exported import SafariServices // Clang module
import _SwiftSafariServicesOverlayShims
#if os(macOS)
@available(macOS, introduced: 10.11)
public func SFSafariServicesAvailable(_ version: SFSafariServicesVersion = SFSafariServicesVersion.version10_0) -> Bool {
return _swift_SafariServices_isSafariServicesAvailable(version)
}
#endif
| apache-2.0 |
Diego5529/tcc-swift | tcc-swift/src/model/User+CoreDataProperties.swift | 1 | 1207 | //
// User+CoreDataProperties.swift
//
//
// Created by Diego on 8/7/16.
//
//
// Choose "Create NSManagedObject Subclass…" from the Core Data editor menu
// to delete and recreate this implementation file for your updated model.
//
import Foundation
import CoreData
extension User {
@NSManaged var birth_date: NSTimeInterval
@NSManaged var created_at: NSTimeInterval
@NSManaged var current_sign_in_at: NSTimeInterval
@NSManaged var current_sign_in_ip: String?
@NSManaged var email: String?
@NSManaged var encrypted_password: String?
@NSManaged var genre: String?
@NSManaged var last_sign_in_at: NSTimeInterval
@NSManaged var last_sign_in_ip: String?
@NSManaged var long_name: String?
@NSManaged var name: String?
@NSManaged var phone_number: String?
@NSManaged var remember_created_at: NSTimeInterval
@NSManaged var reset_password_sent_at: NSTimeInterval
@NSManaged var reset_password_token: String?
@NSManaged var sign_in_count: Int16
@NSManaged var updated_at: NSTimeInterval
@NSManaged var user_id: Int16
@NSManaged var has_many_invitation: Guest?
@NSManaged var has_many_users_company_type: UserCompanyType?
}
| mit |
eofster/Telephone | UseCases/Calls.swift | 1 | 735 | //
// Calls.swift
// Telephone
//
// Copyright © 2008-2016 Alexey Kuznetsov
// Copyright © 2016-2021 64 Characters
//
// Telephone is free software: you can redistribute it and/or modify
// it under the terms of the GNU General Public License as published by
// the Free Software Foundation, either version 3 of the License, or
// (at your option) any later version.
//
// Telephone is distributed in the hope that it will be useful,
// but WITHOUT ANY WARRANTY; without even the implied warranty of
// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
// GNU General Public License for more details.
//
public protocol Calls {
var haveActive: Bool { get }
var haveUnansweredIncoming: Bool { get }
}
| gpl-3.0 |
NickAger/elm-slider | ServerSlider/WebSocketServer/Packages/Reflection-0.14.0/Package.swift | 5 | 75 | import PackageDescription
let package = Package(
name: "Reflection"
)
| mit |
zmian/xcore.swift | Sources/Xcore/Cocoa/Components/UIImage/ImageRepresentable/ImageRepresentable+Transform.swift | 1 | 1159 | //
// Xcore
// Copyright © 2019 Xcore
// MIT license, see LICENSE file for details
//
import UIKit
extension ImageRepresentable {
/// Returns `ImageRepresentable` instance with the given transform.
///
/// **Usage**
///
/// ```swift
/// func setIcon(_ icon: ImageRepresentable) {
/// let newIcon = icon
/// .alignment(.leading)
/// .transform(TintColorImageTransform(tintColor: .white))
/// .alignment(.trailing) // last one wins when using plugin.
///
/// let iconView = UIImageView()
/// iconView.setImage(newIcon)
///
/// let transform: ImageTransform = newIcon.plugin()!
/// print(transform.id)
/// // "TintColorImageTransform-tintColor:(#FFFFFF)"
///
/// let alignment: ImageRepresentableAlignment = newIcon.plugin()!
/// print(alignment)
/// // "trailing"
/// }
/// ```
///
/// - Parameter value: The transform value for the image.
/// - Returns: An `ImageRepresentable` instance.
public func transform(_ value: ImageTransform) -> ImageRepresentable {
append(value)
}
}
| mit |
imagineon/ViewConfigurator | Sources/UIKitExtensionsSorceryGeneration/UITableView+PropertyConfigurationSet.swift | 1 | 6862 | // Generated using Sourcery 0.12.0 — https://github.com/krzysztofzablocki/Sourcery
// DO NOT EDIT
import UIKit
@available(iOS 2.0, *)
public extension ConfigurationSet where Base: UITableView {
func dataSource(_ newValue: UITableViewDataSource?) -> Self {
return set { (configurable: UITableView) in
configurable.dataSource = newValue
}
}
func delegate(_ newValue: UITableViewDelegate?) -> Self {
return set { (configurable: UITableView) in
configurable.delegate = newValue
}
}
@available(iOS 10.0, *)
func prefetchDataSource(_ newValue: UITableViewDataSourcePrefetching?) -> Self {
return set { (configurable: UITableView) in
configurable.prefetchDataSource = newValue
}
}
@available(iOS 11.0, *)
func dragDelegate(_ newValue: UITableViewDragDelegate?) -> Self {
return set { (configurable: UITableView) in
configurable.dragDelegate = newValue
}
}
@available(iOS 11.0, *)
func dropDelegate(_ newValue: UITableViewDropDelegate?) -> Self {
return set { (configurable: UITableView) in
configurable.dropDelegate = newValue
}
}
func rowHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.rowHeight = newValue
}
}
func sectionHeaderHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.sectionHeaderHeight = newValue
}
}
func sectionFooterHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.sectionFooterHeight = newValue
}
}
@available(iOS 7.0, *)
func estimatedRowHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.estimatedRowHeight = newValue
}
}
@available(iOS 7.0, *)
func estimatedSectionHeaderHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.estimatedSectionHeaderHeight = newValue
}
}
@available(iOS 7.0, *)
func estimatedSectionFooterHeight(_ newValue: CGFloat) -> Self {
return set { (configurable: UITableView) in
configurable.estimatedSectionFooterHeight = newValue
}
}
@available(iOS 7.0, *)
func separatorInset(_ newValue: UIEdgeInsets) -> Self {
return set { (configurable: UITableView) in
configurable.separatorInset = newValue
}
}
@available(iOS 11.0, *)
func separatorInsetReference(_ newValue: UITableViewSeparatorInsetReference) -> Self {
return set { (configurable: UITableView) in
configurable.separatorInsetReference = newValue
}
}
@available(iOS 3.2, *)
func backgroundView(_ newValue: UIView?) -> Self {
return set { (configurable: UITableView) in
configurable.backgroundView = newValue
}
}
func isEditing(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.isEditing = newValue
}
}
@available(iOS 3.0, *)
func allowsSelection(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.allowsSelection = newValue
}
}
func allowsSelectionDuringEditing(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.allowsSelectionDuringEditing = newValue
}
}
@available(iOS 5.0, *)
func allowsMultipleSelection(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.allowsMultipleSelection = newValue
}
}
@available(iOS 5.0, *)
func allowsMultipleSelectionDuringEditing(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.allowsMultipleSelectionDuringEditing = newValue
}
}
func sectionIndexMinimumDisplayRowCount(_ newValue: Int) -> Self {
return set { (configurable: UITableView) in
configurable.sectionIndexMinimumDisplayRowCount = newValue
}
}
@available(iOS 6.0, *)
func sectionIndexColor(_ newValue: UIColor?) -> Self {
return set { (configurable: UITableView) in
configurable.sectionIndexColor = newValue
}
}
@available(iOS 7.0, *)
func sectionIndexBackgroundColor(_ newValue: UIColor?) -> Self {
return set { (configurable: UITableView) in
configurable.sectionIndexBackgroundColor = newValue
}
}
@available(iOS 6.0, *)
func sectionIndexTrackingBackgroundColor(_ newValue: UIColor?) -> Self {
return set { (configurable: UITableView) in
configurable.sectionIndexTrackingBackgroundColor = newValue
}
}
func separatorStyle(_ newValue: UITableViewCellSeparatorStyle) -> Self {
return set { (configurable: UITableView) in
configurable.separatorStyle = newValue
}
}
func separatorColor(_ newValue: UIColor?) -> Self {
return set { (configurable: UITableView) in
configurable.separatorColor = newValue
}
}
@available(iOS 8.0, *)
func separatorEffect(_ newValue: UIVisualEffect?) -> Self {
return set { (configurable: UITableView) in
configurable.separatorEffect = newValue
}
}
@available(iOS 9.0, *)
func cellLayoutMarginsFollowReadableWidth(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.cellLayoutMarginsFollowReadableWidth = newValue
}
}
@available(iOS 11.0, *)
func insetsContentViewsToSafeArea(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.insetsContentViewsToSafeArea = newValue
}
}
func tableHeaderView(_ newValue: UIView?) -> Self {
return set { (configurable: UITableView) in
configurable.tableHeaderView = newValue
}
}
func tableFooterView(_ newValue: UIView?) -> Self {
return set { (configurable: UITableView) in
configurable.tableFooterView = newValue
}
}
@available(iOS 9.0, *)
func remembersLastFocusedIndexPath(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.remembersLastFocusedIndexPath = newValue
}
}
@available(iOS 11.0, *)
func dragInteractionEnabled(_ newValue: Bool) -> Self {
return set { (configurable: UITableView) in
configurable.dragInteractionEnabled = newValue
}
}
}
| mit |
robrix/Madness | Madness/Combinator.swift | 1 | 648 | // Copyright © 2015 Rob Rix. All rights reserved.
/// Parses `open`, followed by `parser` and `close`. Returns the value returned by `parser`.
public func between<C: Collection, T, U, V>(_ open: @escaping Parser<C, T>.Function, _ close: @escaping Parser<C, U>.Function) -> (@escaping Parser<C, V>.Function) -> Parser<C, V>.Function {
return { open *> $0 <* close }
}
/// Parses 0 or more `parser` until `end`. Returns the list of values returned by `parser`.
public func manyTill<C: Collection, T, U>(_ parser: @escaping Parser<C, T>.Function, _ end: @escaping Parser<C, U>.Function) -> Parser<C, [T]>.Function {
return many(parser) <* end
}
| mit |
duliodenis/dollhouse | Dollhouse/DollhouseTests/DollhouseTests.swift | 1 | 906 | //
// DollhouseTests.swift
// DollhouseTests
//
// Created by Dulio Denis on 4/11/15.
// Copyright (c) 2015 Dulio Denis. All rights reserved.
//
import UIKit
import XCTest
class DollhouseTests: XCTestCase {
override func setUp() {
super.setUp()
// Put setup code here. This method is called before the invocation of each test method in the class.
}
override func tearDown() {
// Put teardown code here. This method is called after the invocation of each test method in the class.
super.tearDown()
}
func testExample() {
// This is an example of a functional test case.
XCTAssert(true, "Pass")
}
func testPerformanceExample() {
// This is an example of a performance test case.
self.measureBlock() {
// Put the code you want to measure the time of here.
}
}
}
| mit |
yeokm1/nus-soc-print-ios | NUS SOC Print/PrintingViewTableCell.swift | 1 | 976 | //
// PrintingViewTableCell.swift
// NUS SOC Print
//
// Created by Yeo Kheng Meng on 17/8/14.
// Copyright (c) 2014 Yeo Kheng Meng. All rights reserved.
//
import Foundation
import UIKit
class PrintingViewTableCell : UITableViewCell {
@IBOutlet weak var header: UILabel!
@IBOutlet weak var smallFooter: UILabel!
@IBOutlet weak var progressBar: UIProgressView!
@IBOutlet weak var tick: UIImageView!
@IBOutlet weak var activityIndicator: UIActivityIndicatorView!
@IBOutlet weak var cross: UIImageView!
override func prepareForReuse() {
super.prepareForReuse()
header.text = ""
smallFooter.text = ""
progressBar.hidden = true
progressBar.setProgress(0, animated: false)
tick.hidden = true
cross.hidden = true
if(activityIndicator.isAnimating()){
activityIndicator.stopAnimating()
}
activityIndicator.hidden = true
}
}
| mit |
ytfhqqu/iCC98 | iCC98/iCC98/BoardTableViewController.swift | 1 | 5597 | //
// BoardTableViewController.swift
// iCC98
//
// Created by Duo Xu on 5/4/17.
// Copyright © 2017 Duo Xu.
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in all
// copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
// SOFTWARE.
//
import UIKit
import SVProgressHUD
import CC98Kit
class BoardTableViewController: BaseTableViewController {
// MARK: - Data
/**
设置数据。
- parameter parentBoardId: 父版面的标识。
*/
func setData(parentBoardId: Int) {
shouldGetRootBoards = false
fetchData(parentBoardId: parentBoardId)
}
/// 表示是否要获取根版面的信息。如果为真，在 `viewDidLoad()` 时自动加载根版面的信息；如果为假，则在使用 `setData(parentBoardId:)` 指定版面后，获取其子版面的信息。
private var shouldGetRootBoards = true
/// 版面的信息。
private var boards = [BoardInfo]() {
didSet {
tableView.reloadData()
}
}
/// 表示是否有数据。
override var hasData: Bool {
return !boards.isEmpty
}
/// 获取根版面的数据。
private func fetchData() {
isLoading = true
_ = CC98API.getRootBoards { [weak self] result in
switch result {
case .success(_, let data):
if let boardInfoArray = data {
self?.boards = boardInfoArray
}
case .failure(let status, let message):
SVProgressHUD.showError(statusCode: status, message: message)
case .noResponse:
SVProgressHUD.showNoResponseError()
}
self?.isLoading = false
}
}
/// 根据父版面获取子版面的数据。
private func fetchData(parentBoardId: Int) {
isLoading = true
_ = CC98API.getSubBoards(ofBoard: parentBoardId, accessToken: OAuthUtility.accessToken) { [weak self] result in
switch result {
case .success(_, let data):
if let boardInfoArray = data {
self?.boards = boardInfoArray
}
case .failure(let status, let message):
SVProgressHUD.showError(statusCode: status, message: message)
case .noResponse:
SVProgressHUD.showNoResponseError()
}
self?.isLoading = false
}
}
// MARK: - View controller lifecycle
override func viewDidLoad() {
super.viewDidLoad()
// 获取根版面的数据
if shouldGetRootBoards {
fetchData()
}
}
// MARK: - Table view data source
override func numberOfSections(in tableView: UITableView) -> Int {
return 1
}
override func tableView(_ tableView: UITableView, numberOfRowsInSection section: Int) -> Int {
return boards.count
}
override func tableView(_ tableView: UITableView, cellForRowAt indexPath: IndexPath) -> UITableViewCell {
let boardInfo = boards[indexPath.row]
let identifier: String
// if let childCount = boardInfo.childCount, childCount > 0 {
// identifier = "Non-leaf Board Cell"
// } else {
identifier = "Leaf Board Cell"
// }
let cell = tableView.dequeueReusableCell(withIdentifier: identifier, for: indexPath)
// Configure the cell...
if let boardCell = cell as? BoardTableViewCell {
boardCell.setData(boardInfo: boardInfo)
}
return cell
}
// MARK: - Navigation
// In a storyboard-based application, you will often want to do a little preparation before navigation
override func prepare(for segue: UIStoryboardSegue, sender: Any?) {
// Get the new view controller using segue.destinationViewController.
// Pass the selected object to the new view controller.
if let cell = sender as? UITableViewCell, let indexPath = tableView.indexPath(for: cell) {
let boardInfo = boards[indexPath.row]
if segue.identifier == "Subboards", let boardTVC = segue.destination as? BoardTableViewController {
boardTVC.setData(parentBoardId: boardInfo.id ?? 0)
boardTVC.navigationItem.title = boardInfo.name
} else if segue.identifier == "Topics", let topicTVC = segue.destination as? TopicTableViewController {
topicTVC.setData(boardId: boardInfo.id ?? 0)
topicTVC.navigationItem.title = boardInfo.name
}
}
}
}
| mit |
Alloc-Studio/Hypnos | Hypnos/Hypnos/ViewModel/Controller/Main/LeftViewController.swift | 2 | 3220 | //
// LeftViewController.swift
// Hypnos
//
// Created by Fay on 16/5/18.
// Copyright © 2016年 DMT312. All rights reserved.
//
import UIKit
class LeftViewController: UITableViewController {
override func viewDidLoad() {
super.viewDidLoad()
// Uncomment the following line to preserve selection between presentations
// self.clearsSelectionOnViewWillAppear = false
// Uncomment the following line to display an Edit button in the navigation bar for this view controller.
// self.navigationItem.rightBarButtonItem = self.editButtonItem()
}
override func didReceiveMemoryWarning() {
super.didReceiveMemoryWarning()
// Dispose of any resources that can be recreated.
}
// MARK: - Table view data source
override func numberOfSectionsInTableView(tableView: UITableView) -> Int {
// #warning Incomplete implementation, return the number of sections
return 1
}
override func tableView(tableView: UITableView, numberOfRowsInSection section: Int) -> Int {
// #warning Incomplete implementation, return the number of rows
return 10
}
/*
override func tableView(tableView: UITableView, cellForRowAtIndexPath indexPath: NSIndexPath) -> UITableViewCell {
let cell = tableView.dequeueReusableCellWithIdentifier("reuseIdentifier", forIndexPath: indexPath)
// Configure the cell...
return cell
}
*/
/*
// Override to support conditional editing of the table view.
override func tableView(tableView: UITableView, canEditRowAtIndexPath indexPath: NSIndexPath) -> Bool {
// Return false if you do not want the specified item to be editable.
return true
}
*/
/*
// Override to support editing the table view.
override func tableView(tableView: UITableView, commitEditingStyle editingStyle: UITableViewCellEditingStyle, forRowAtIndexPath indexPath: NSIndexPath) {
if editingStyle == .Delete {
// Delete the row from the data source
tableView.deleteRowsAtIndexPaths([indexPath], withRowAnimation: .Fade)
} else if editingStyle == .Insert {
// Create a new instance of the appropriate class, insert it into the array, and add a new row to the table view
}
}
*/
/*
// Override to support rearranging the table view.
override func tableView(tableView: UITableView, moveRowAtIndexPath fromIndexPath: NSIndexPath, toIndexPath: NSIndexPath) {
}
*/
/*
// Override to support conditional rearranging of the table view.
override func tableView(tableView: UITableView, canMoveRowAtIndexPath indexPath: NSIndexPath) -> Bool {
// Return false if you do not want the item to be re-orderable.
return true
}
*/
/*
// MARK: - Navigation
// In a storyboard-based application, you will often want to do a little preparation before navigation
override func prepareForSegue(segue: UIStoryboardSegue, sender: AnyObject?) {
// Get the new view controller using segue.destinationViewController.
// Pass the selected object to the new view controller.
}
*/
}
| mit |
cuappdev/eatery | Shared/Models/Eatery.swift | 1 | 8278 | //
// Eatery.swift
// Eatery
//
// Created by William Ma on 3/9/19.
// Copyright © 2019 CUAppDev. All rights reserved.
//
import CoreLocation
import UIKit
// MARK: - Eatery Data
/// Different meals served by eateries
enum Meal: String {
case breakfast = "Breakfast"
case brunch = "Brunch"
case liteLunch = "Lite Lunch"
case lunch = "Lunch"
case dinner = "Dinner"
}
/// Assorted types of payment accepted by an Eatery
enum PaymentMethod: String {
case brb = "Meal Plan - Debit"
case swipes = "Meal Plan - Swipe"
case cash = "Cash"
case cornellCard = "Cornell Card"
case creditCard = "Major Credit Cards"
case nfc = "Mobile Payments"
case other = "Other"
}
/// Different types of eateries on campus
enum EateryType: String {
case dining = "all you care to eat dining room"
case cafe = "cafe"
case cart = "cart"
case foodCourt = "food court"
case convenienceStore = "convenience store"
case coffeeShop = "coffee shop"
case bakery = "bakery"
case unknown = ""
}
enum EateryStatus {
static func equalsIgnoreAssociatedValue(_ lhs: EateryStatus, rhs: EateryStatus) -> Bool {
switch (lhs, rhs) {
case (.openingSoon, .openingSoon),
(.open, .open),
(.closingSoon, .closingSoon),
(.closed, .closed): return true
default: return false
}
}
case openingSoon(minutesUntilOpen: Int)
case open
case closingSoon(minutesUntilClose: Int)
case closed
}
// MARK: - Eatery
protocol Eatery {
/// A string of the form YYYY-MM-dd (ISO 8601 Calendar dates)
/// Read more: https://en.wikipedia.org/wiki/ISO_8601#Calendar_dates
typealias DayString = String
typealias EventName = String
var id: Int { get }
var name: String { get }
var displayName: String { get }
var imageUrl: URL? { get }
var eateryType: EateryType { get }
var address: String { get }
var paymentMethods: [PaymentMethod] { get }
var location: CLLocation { get }
var phone: String { get }
var events: [DayString: [EventName: Event]] { get }
var allEvents: [Event] { get }
}
/// Converts the date to its day for use with eatery events
private let dayFormatter: ISO8601DateFormatter = {
let formatter = ISO8601DateFormatter()
formatter.formatOptions = [.withFullDate, .withDashSeparatorInDate]
formatter.timeZone = TimeZone(identifier: "America/New_York")
return formatter
}()
// MARK: - Utils
extension Eatery {
/// The event at an exact date and time, or nil if such an event does not
/// exist.
func event(atExactly date: Date) -> Event? {
return allEvents.first { $0.dateInterval.contains(date) }
}
/// The events that happen within the specified time interval, regardless of
/// the day the event occurs on
/// i.e. events that are active for any amount of time during the interval.
func events(in dateInterval: DateInterval) -> [Event] {
return allEvents.filter { dateInterval.intersects($0.dateInterval) }
}
/// The events by name that occur on the specified day
// Since events may extend past midnight, this function is required to pick
// a specific day for an event.
func eventsByName(onDayOf date: Date) -> [EventName: Event] {
let dayString = dayFormatter.string(from: date)
return events[dayString] ?? [:]
}
func isOpen(onDayOf date: Date) -> Bool {
return !eventsByName(onDayOf: date).isEmpty
}
func isOpenToday() -> Bool {
return isOpen(onDayOf: Date())
}
func isOpen(atExactly date: Date) -> Bool {
return event(atExactly: date) != nil
}
func activeEvent(atExactly date: Date) -> Event? {
let calendar = Calendar.current
guard let yesterday = calendar.date(byAdding: .day, value: -1, to: date),
let tomorrow = calendar.date(byAdding: .day, value: 1, to: date) else {
return nil
}
return events(in: DateInterval(start: yesterday, end: tomorrow))
.filter {
// disregard events that are not currently happening or that have happened in the past
$0.occurs(atExactly: date) || date < $0.start
}.min { (lhs, rhs) -> Bool in
if lhs.occurs(atExactly: date) {
return true
} else if rhs.occurs(atExactly: date) {
return false
}
let timeUntilLeftStart = lhs.start.timeIntervalSince(date)
let timeUntilRightStart = rhs.start.timeIntervalSince(date)
return timeUntilLeftStart < timeUntilRightStart
}
}
func currentActiveEvent() -> Event? {
return activeEvent(atExactly: Date())
}
func status(onDayOf date: Date) -> EateryStatus {
guard isOpen(onDayOf: date) else {
return .closed
}
guard let event = activeEvent(atExactly: date) else {
return .closed
}
switch event.status(atExactly: date) {
case .notStarted:
return .closed
case .startingSoon:
let minutesUntilOpen = Int(event.start.timeIntervalSinceNow / 60) + 1
return .openingSoon(minutesUntilOpen: minutesUntilOpen)
case .started:
return .open
case .endingSoon:
let minutesUntilClose = Int(event.end.timeIntervalSinceNow / 60) + 1
return .closingSoon(minutesUntilClose: minutesUntilClose)
case .ended:
return .closed
}
}
func currentStatus() -> EateryStatus {
return status(onDayOf: Date())
}
}
// MARK: - User Defaults / Favoriting
extension Eatery {
func isFavorite() -> Bool {
return UserDefaults.standard.stringArray(forKey: "favorites")?.contains(name) ?? false
}
func setFavorite(_ newValue: Bool) {
var ar = UserDefaults.standard.stringArray(forKey: "favorites") ?? []
if newValue {
ar.append(name)
} else {
ar.removeAll(where: { $0 == name })
}
UserDefaults.standard.set(ar, forKey: "favorites")
NotificationCenter.default.post(name: .eateryIsFavoriteDidChange, object: self)
}
}
extension NSNotification.Name {
static let eateryIsFavoriteDidChange = NSNotification.Name("org.cuappdev.eatery.eateryIsFavoriteDidChangeNotificationName")
}
// MARK: - Presentation
struct EateryPresentation {
let statusText: String
let statusColor: UIColor
let nextEventText: String
}
private let timeFormatter: DateFormatter = {
let formatter = DateFormatter()
formatter.dateStyle = .none
formatter.timeStyle = .short
return formatter
}()
extension Eatery {
func currentPresentation() -> EateryPresentation {
let statusText: String
let statusColor: UIColor
let nextEventText: String
switch currentStatus() {
case let .openingSoon(minutesUntilOpen):
statusText = "Opening"
statusColor = .eateryOrange
nextEventText = "in \(minutesUntilOpen)m"
case .open:
statusText = "Open"
statusColor = .eateryGreen
if let currentEvent = currentActiveEvent() {
let endTimeText = timeFormatter.string(from: currentEvent.end)
nextEventText = "until \(endTimeText)"
} else {
nextEventText = ""
}
case let .closingSoon(minutesUntilClose):
statusText = "Closing"
statusColor = .eateryOrange
nextEventText = "in \(minutesUntilClose)m"
case .closed:
statusText = "Closed"
statusColor = .eateryRed
if isOpenToday(), let nextEvent = currentActiveEvent() {
let startTimeText = timeFormatter.string(from: nextEvent.start)
nextEventText = "until \(startTimeText)"
} else {
nextEventText = "today"
}
}
return EateryPresentation(statusText: statusText,
statusColor: statusColor,
nextEventText: nextEventText)
}
}
| mit |
binarylevel/Tinylog-iOS | Tinylog/View Controllers/iPad/TLISplitViewController.swift | 1 | 1590 | //
// TLISplitViewController.swift
// Tinylog
//
// Created by Spiros Gerokostas on 18/10/15.
// Copyright © 2015 Spiros Gerokostas. All rights reserved.
//
import UIKit
class TLISplitViewController: UISplitViewController, UISplitViewControllerDelegate {
var listsViewController:TLIListsViewController?
var listViewController:TLITasksViewController?
override init(nibName nibNameOrNil: String?, bundle nibBundleOrNil: NSBundle?) {
super.init(nibName: nibNameOrNil, bundle: nibBundleOrNil)
listsViewController = TLIListsViewController()
listViewController = TLITasksViewController()
let navigationController1:UINavigationController = UINavigationController(rootViewController: listsViewController!)
let navigationController2:UINavigationController = UINavigationController(rootViewController: listViewController!)
self.viewControllers = [navigationController1, navigationController2]
self.delegate = self
}
required init(coder aDecoder: NSCoder) {
fatalError("init(coder:) has not been implemented")
}
class func sharedSplitViewController()->TLISplitViewController {
return TLIAppDelegate.sharedAppDelegate().window?.rootViewController as! TLISplitViewController
}
override func viewDidLoad() {
super.viewDidLoad()
}
func splitViewController(svc: UISplitViewController, shouldHideViewController vc: UIViewController, inOrientation orientation: UIInterfaceOrientation) -> Bool {
return false
}
}
| mit |
Turistforeningen/SjekkUT | ios/SjekkUt/model/ProjectExtension.swift | 1 | 1537 | //
// ProjectExtension.swift
// SjekkUt
//
// Created by Henrik Hartz on 20/04/2017.
// Copyright © 2017 Den Norske Turistforening. All rights reserved.
//
import Foundation
extension Project {
class func fetchedResults() -> NSFetchedResultsController<Project> {
let fetchRequest = Project.fetchRequest()
let context = ModelController.instance.managedObjectContext!
let results = NSFetchedResultsController.init(fetchRequest: fetchRequest, managedObjectContext: context, sectionNameKeyPath: nil, cacheName: nil)
do {
try results.performFetch()
} catch(let error) {
DntManager.logError(error)
}
return results
}
class var validProjectsPredicate:NSPredicate {
get {
let dateSpan = Project.validDateRange()
let predicate = NSPredicate(format: "name != NULL AND isHidden = NO AND (start == NULL || start <= %@) AND (stop == NULL || stop >= %@)", argumentArray: [dateSpan.stop, dateSpan.start])
return predicate
}
}
class var allProjectsPredicate:NSPredicate {
get {
let predicate = NSPredicate(format: "name != NULL")
return predicate
}
}
var isExpired: Bool {
get {
let expired = (stop?.timeIntervalSinceNow ?? Double.greatestFiniteMagnitude) < -TimeInterval(7 * 24 * 60 * 60)
return expired
}
}
static let placeholderImage = UIImage(named: "project-fallback")!
}
| mit |
robbdimitrov/pixelgram-ios | PixelGram/Classes/Screens/Feed/UsersViewController.swift | 1 | 5067 | //
// UsersViewController.swift
// PixelGram
//
// Created by Robert Dimitrov on 11/21/17.
// Copyright © 2017 Robert Dimitrov. All rights reserved.
//
import UIKit
class UsersViewController: CollectionViewController {
var viewModel: UsersViewModel?
private var dataSource: CollectionViewDataSource?
private var page: Int = 0
// MARK: - View Lifecycle
override func viewDidLoad() {
super.viewDidLoad()
setupRefreshControl()
}
override func viewWillAppear(_ animated: Bool) {
super.viewWillAppear(animated)
loadUsers(for: page) { [weak self] in
self?.collectionView?.reloadData()
}
}
override func viewDidLayoutSubviews() {
super.viewDidLayoutSubviews()
if let collectionView = collectionView, let flowLayout = collectionView.collectionViewLayout as? UICollectionViewFlowLayout {
flowLayout.estimatedItemSize = CGSize(width: collectionView.frame.width, height: 70)
}
}
// MARK: - Data
override func handleRefresh(_ sender: UIRefreshControl) {
page = 0
viewModel?.users.removeAll()
loadUsers(for: page) { [weak self] in
self?.collectionView?.reloadData()
if self?.collectionView?.refreshControl?.isRefreshing ?? false {
self?.collectionView?.refreshControl?.endRefreshing()
}
}
}
func loadUsers(for page: Int, limit: Int = 20, completionBlock: (() -> Void)?) {
guard let imageId = viewModel?.imageId else {
return
}
APIClient.shared.loadUsersLikedImage(withId: imageId, page: page, limit: limit, completion: { [weak self] users in
self?.page = page
self?.viewModel?.users.append(contentsOf: users)
completionBlock?()
}) { [weak self] error in
self?.showError(error: error)
}
}
// MARK: - Helpers
func loadNextPage() {
let oldCount = viewModel?.users.count ?? 0
loadUsers(for: page + 1) { [weak self] in
let count = self?.viewModel?.users.count ?? 0
guard count > oldCount else {
return
}
var indexPaths = [IndexPath]()
for index in oldCount...(count - 1) {
let indexPath = IndexPath(row: index, section: 0)
indexPaths.append(indexPath)
}
self?.collectionView?.insertItems(at: indexPaths)
}
}
// MARK: - Components
func createDataSource() -> CollectionViewDataSource {
let dataSource = CollectionViewDataSource(configureCell: { [weak self] (collectionView, indexPath) -> UICollectionViewCell in
if indexPath.row == (self?.viewModel?.users.count ?? 0) - 1 {
self?.loadNextPage()
}
return (self?.configureCell(collectionView: collectionView, indexPath: indexPath))!
}, numberOfItems: { [weak self] (collectionView, section) -> Int in
return self?.viewModel?.numberOfItems ?? 0
})
return dataSource
}
// MARK: - Cells
func configureCell(collectionView: UICollectionView, indexPath: IndexPath) -> UICollectionViewCell {
let cell = collectionView.dequeueReusableCell(withReuseIdentifier: UserCell.reuseIdentifier, for: indexPath)
if let cell = cell as? UserCell, let userViewModel = viewModel?.userViewModel(forIndex: indexPath.row) {
cell.configure(with: userViewModel)
}
return cell
}
// MARK: - Reactive
func handleCellSelection(collectionView: UICollectionView?) {
collectionView?.rx.itemSelected.bind { [weak self] indexPath in
self?.openUserProfile(atIndex: indexPath.item)
}.disposed(by: disposeBag)
}
// MARK: - Navigation
private func openUserProfile(atIndex index: Int) {
if let userId = viewModel?.users[index].id {
openUserProfile(withUserId: userId)
}
}
private func openUserProfile(withUserId userId: String) {
let viewController = instantiateViewController(withIdentifier:
ProfileViewController.storyboardIdentifier)
(viewController as? ProfileViewController)?.userId = userId
navigationController?.pushViewController(viewController, animated: true)
}
// MARK: - Config
func setupRefreshControl() {
collectionView?.alwaysBounceVertical = true
collectionView?.refreshControl = refreshControl
}
override func setupNavigationItem() {
super.setupNavigationItem()
title = "Likes"
}
override func configureCollectionView() {
dataSource = createDataSource()
collectionView?.dataSource = dataSource
handleCellSelection(collectionView: collectionView)
}
}
| mit |
richardpiazza/LCARSDisplayKit | Sources/LCARSDisplayKit/Arc.swift | 1 | 2971 | #if (os(macOS) || os(iOS) || os(tvOS) || os(watchOS))
import CoreGraphics
import GraphPoint
/// Arc of a circle (a continuous length around the circumference)
public struct Arc: Graphable {
public var size: CGSize = CGSize.zero
public var radius: CGFloat = CGFloat(0)
public var startDegree: CGFloat = CGFloat(0)
public var endDegree: CGFloat = CGFloat(0)
/// A `GraphPoint` used to verticaly/horizontaly clip the starting degree
public var boundedStart: GraphPoint?
/// A `GraphPoint` used to verticaly/horizontaly clip the ending degree
public var boundedEnd: GraphPoint?
public init() {
}
public init(radius: CGFloat, startDegree: CGFloat, endDegree: CGFloat) {
self.radius = radius
self.startDegree = startDegree
self.endDegree = endDegree
}
/// The `GraphPoint` corresponding to the startDegree and radius
public var startPoint: GraphPoint {
if let boundedStart = self.boundedStart {
return GraphPoint.graphPoint(degree: startDegree, radius: radius, boundedBy: boundedStart)
}
return GraphPoint.graphPoint(degree: startDegree, radius: radius)
}
/// The `GraphPoint` corresponding to the endDegree and radius
public var endPoint: GraphPoint {
if let boundedEnd = self.boundedEnd {
return GraphPoint.graphPoint(degree: endDegree, radius: radius, boundedBy: boundedEnd)
}
return GraphPoint.graphPoint(degree: endDegree, radius: radius)
}
/// Calculates the point of the right angle that joins the start and end points.
public var pivot: GraphPoint {
let start = startPoint
let end = endPoint
var pivot = GraphPoint(x: 0, y: 0)
if startDegree < 90 {
pivot.x = end.x
pivot.y = start.y
} else if startDegree < 180 {
pivot.x = start.x
pivot.y = end.y
} else if startDegree < 270 {
pivot.x = end.x
pivot.y = start.y
} else {
pivot.x = start.x
pivot.y = end.y
}
return pivot
}
// MARK: - Graphable
public var graphPoints: [GraphPoint] {
return [startPoint, endPoint]
}
public var graphFrame: GraphFrame {
return GraphFrame.graphFrame(graphPoints: graphPoints, radius: radius, startDegree: startDegree, endDegree: endDegree)
}
public var path: CGMutablePath {
let path: CGMutablePath = CGMutablePath()
let gf = graphFrame
let offset = gf.graphOriginOffset
let translatedPivot = gf.boundedPoint(graphPoint: pivot)
path.addArc(center: offset, radius: radius, startAngle: startDegree.radians, endAngle: endDegree.radians, clockwise: false)
path.addLine(to: translatedPivot)
path.closeSubpath()
return path
}
}
#endif
| mit |
kevinmbeaulieu/Signal-iOS | Signal/src/UserInterface/Strings.swift | 2 | 1011 | //
// Copyright (c) 2017 Open Whisper Systems. All rights reserved.
//
import Foundation
/**
* Strings re-used in multiple places should be added here.
*/
@objc class CallStrings: NSObject {
static let callBackButtonTitle = NSLocalizedString("CALLBACK_BUTTON_TITLE", comment: "notification action")
static let missedCallNotificationBody = NSLocalizedString("MISSED_CALL", comment: "notification title")
static let missedCallNotificationBodyWithCallerName = NSLocalizedString("MSGVIEW_MISSED_CALL_WITH_NAME", comment: "notification title. Embeds {{Caller's Name}}")
static let missedCallNotificationBodyWithoutCallerName = NSLocalizedString("MSGVIEW_MISSED_CALL_WITHOUT_NAME", comment: "notification title.")
static let callStatusFormat = NSLocalizedString("CALL_STATUS_FORMAT", comment: "embeds {{Call Status}} in call screen label. For ongoing calls, {{Call Status}} is a seconds timer like 01:23, otherwise {{Call Status}} is a short text like 'Ringing', 'Busy', or 'Failed Call'")
}
| gpl-3.0 |
austinzheng/swift-compiler-crashes | crashes-duplicates/15200-swift-sourcemanager-getmessage.swift | 11 | 206 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
for {
enum b {
deinit {
class
case ,
| mit |
austinzheng/swift-compiler-crashes | fixed/00020-swift-typechecker-conformstoprotocol.swift | 11 | 189 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
func g<h{class e{}e{ | mit |
austinzheng/swift-compiler-crashes | crashes-duplicates/11005-swift-sourcemanager-getmessage.swift | 11 | 221 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
for in {
func a
{
struct A {
class B {
class
case ,
| mit |
austinzheng/swift-compiler-crashes | crashes-duplicates/21313-std-function-func-swift-type-subst.swift | 10 | 214 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
func h{class B<T where B:A{
var _=b
var b:Int | mit |
dangnguyenhuu/JSQMessagesSwift | Sources/Categories/JSQSystemSoundPlayer+Messages.swift | 1 | 2094 | //
// JSQSystemSoundPlayer.swift
// JSQMessagesViewController
//
// Created by Sylvain FAY-CHATELARD on 19/08/2015.
// Copyright (c) 2015 Dviance. All rights reserved.
//
//import JSQSystemSoundPlayer_Swift
//
//let kJSQMessageReceivedSoundName = "message_received"
//let kJSQMessageSentSoundName = "message_sent"
//
//extension JSQSystemSoundPlayer {
//
// public class func jsq_playMessageReceivedSound() {
//
// JSQSystemSoundPlayer.jsq_playSoundFromJSQMessagesBundle(name: kJSQMessageReceivedSoundName, asAlert: false)
// }
//
// public class func jsq_playMessageReceivedAlert() {
//
// JSQSystemSoundPlayer.jsq_playSoundFromJSQMessagesBundle(name: kJSQMessageReceivedSoundName, asAlert: true)
// }
//
// public class func jsq_playMessageSentSound() {
//
// JSQSystemSoundPlayer.jsq_playSoundFromJSQMessagesBundle(name: kJSQMessageSentSoundName, asAlert: false)
// }
//
// public class func jsq_playMessageSentAlert() {
//
// JSQSystemSoundPlayer.jsq_playSoundFromJSQMessagesBundle(name: kJSQMessageSentSoundName, asAlert: true)
// }
//
// fileprivate class func jsq_playSoundFromJSQMessagesBundle(name: String, asAlert: Bool) {
//
// // Save sound player original bundle
// let originalPlayerBundleIdentifier = JSQSystemSoundPlayer.sharedPlayer.bundle
//
// if let bundle = Bundle.jsq_messagesBundle() {
//
// JSQSystemSoundPlayer.sharedPlayer.bundle = bundle
// }
//
// let filename = "JSQMessagesAssets.bundle/Sounds/\(name)"
//
// if asAlert {
//
// JSQSystemSoundPlayer.sharedPlayer.playAlertSound(filename, fileExtension: JSQSystemSoundPlayer.TypeAIFF, completion: nil)
// }
// else {
//
// JSQSystemSoundPlayer.sharedPlayer.playSound(filename, fileExtension: JSQSystemSoundPlayer.TypeAIFF, completion: nil)
// }
//
// JSQSystemSoundPlayer.sharedPlayer.bundle = originalPlayerBundleIdentifier
// }
//}
| apache-2.0 |
raymondshadow/SwiftDemo | SwiftApp/Pods/Swiftz/Sources/Swiftz/EitherExt.swift | 3 | 5841 | //
// EitherExt.swift
// Swiftz
//
// Created by Robert Widmann on 6/21/15.
// Copyright © 2015 TypeLift. All rights reserved.
//
#if SWIFT_PACKAGE
import Operadics
import Swiftx
#endif
extension Either /*: Bifunctor*/ {
public typealias B = Any
public typealias D = Any
public typealias PAC = Either<L, R>
public typealias PAD = Either<L, D>
public typealias PBC = Either<B, R>
public typealias PBD = Either<B, D>
public func bimap<B, D>(_ f : (L) -> B, _ g : ((R) -> D)) -> Either<B, D> {
switch self {
case let .Left(bx):
return Either<B, D>.Left(f(bx))
case let .Right(bx):
return Either<B, D>.Right(g(bx))
}
}
public func leftMap<B>(_ f : @escaping (L) -> B) -> Either<B, R> {
return self.bimap(f, identity)
}
public func rightMap(_ g : @escaping (R) -> D) -> Either<L, D> {
return self.bimap(identity, g)
}
}
extension Either /*: Functor*/ {
public typealias FB = Either<L, B>
public func fmap<B>(_ f : (R) -> B) -> Either<L, B> {
return f <^> self
}
}
extension Either /*: Pointed*/ {
public typealias A = R
public static func pure(_ r : R) -> Either<L, R> {
return .Right(r)
}
}
extension Either /*: Applicative*/ {
public typealias FAB = Either<L, (R) -> B>
public func ap<B>(_ f : Either<L, (R) -> B>) -> Either<L, B> {
return f <*> self
}
}
extension Either /*: Cartesian*/ {
public typealias FTOP = Either<L, ()>
public typealias FTAB = Either<L, (A, B)>
public typealias FTABC = Either<L, (A, B, C)>
public typealias FTABCD = Either<L, (A, B, C, D)>
public static var unit : Either<L, ()> { return .Right(()) }
public func product<B>(_ r : Either<L, B>) -> Either<L, (A, B)> {
switch self {
case let .Left(c):
return .Left(c)
case let .Right(d):
switch r {
case let .Left(e):
return .Left(e)
case let .Right(f):
return .Right((d, f))
}
}
}
public func product<B, C>(_ r : Either<L, B>, _ s : Either<L, C>) -> Either<L, (A, B, C)> {
switch self {
case let .Left(c):
return .Left(c)
case let .Right(d):
switch r {
case let .Left(e):
return .Left(e)
case let .Right(f):
switch s {
case let .Left(g):
return .Left(g)
case let .Right(h):
return .Right((d, f, h))
}
}
}
}
public func product<B, C, D>(_ r : Either<L, B>, _ s : Either<L, C>, _ t : Either<L, D>) -> Either<L, (A, B, C, D)> {
switch self {
case let .Left(c):
return .Left(c)
case let .Right(d):
switch r {
case let .Left(e):
return .Left(e)
case let .Right(f):
switch s {
case let .Left(g):
return .Left(g)
case let .Right(h):
switch t {
case let .Left(i):
return .Left(i)
case let .Right(j):
return .Right((d, f, h, j))
}
}
}
}
}
}
extension Either /*: ApplicativeOps*/ {
public typealias C = Any
public typealias FC = Either<L, C>
public typealias FD = Either<L, D>
public static func liftA<B>(_ f : @escaping (A) -> B) -> (Either<L, A>) -> Either<L, B> {
return { (a : Either<L, A>) -> Either<L, B> in Either<L, (A) -> B>.pure(f) <*> a }
}
public static func liftA2<B, C>(_ f : @escaping (A) -> (B) -> C) -> (Either<L, A>) -> (Either<L, B>) -> Either<L, C> {
return { (a : Either<L, A>) -> (Either<L, B>) -> Either<L, C> in { (b : Either<L, B>) -> Either<L, C> in f <^> a <*> b } }
}
public static func liftA3<B, C, D>(_ f : @escaping (A) -> (B) -> (C) -> D) -> (Either<L, A>) -> (Either<L, B>) -> (Either<L, C>) -> Either<L, D> {
return { (a : Either<L, A>) -> (Either<L, B>) -> (Either<L, C>) -> Either<L, D> in { (b : Either<L, B>) -> (Either<L, C>) -> Either<L, D> in { (c : Either<L, C>) -> Either<L, D> in f <^> a <*> b <*> c } } }
}
}
extension Either /*: Monad*/ {
public func bind<B>(_ f : (A) -> Either<L, B>) -> Either<L, B> {
return self >>- f
}
}
extension Either /*: MonadOps*/ {
public static func liftM<B>(_ f : @escaping (A) -> B) -> (Either<L, A>) -> Either<L, B> {
return { (m1 : Either<L, A>) -> Either<L, B> in m1 >>- { (x1 : A) -> Either<L, B> in Either<L, B>.pure(f(x1)) } }
}
public static func liftM2<B, C>(_ f : @escaping (A) -> (B) -> C) -> (Either<L, A>) -> (Either<L, B>) -> Either<L, C> {
return { (m1 : Either<L, A>) -> (Either<L, B>) -> Either<L, C> in { (m2 : Either<L, B>) -> Either<L, C> in m1 >>- { (x1 : A) in m2 >>- { (x2 : B) in Either<L, C>.pure(f(x1)(x2)) } } } }
}
public static func liftM3<B, C, D>(_ f : @escaping (A) -> (B) -> (C) -> D) -> (Either<L, A>) -> (Either<L, B>) -> (Either<L, C>) -> Either<L, D> {
return { (m1 : Either<L, A>) -> (Either<L, B>) -> (Either<L, C>) -> Either<L, D> in { (m2 : Either<L, B>) -> (Either<L, C>) -> Either<L, D> in { (m3 : Either<L, C>) -> Either<L, D> in m1 >>- { (x1 : A) in m2 >>- { (x2 : B) in m3 >>- { (x3 : C) in Either<L, D>.pure(f(x1)(x2)(x3)) } } } } } }
}
}
public func >>->> <L, A, B, C>(_ f : @escaping (A) -> Either<L, B>, g : @escaping (B) -> Either<L, C>) -> ((A) -> Either<L, C>) {
return { x in f(x) >>- g }
}
public func <<-<< <L, A, B, C>(g : @escaping (B) -> Either<L, C>, f : @escaping (A) -> Either<L, B>) -> ((A) -> Either<L, C>) {
return f >>->> g
}
extension Either /*: Foldable*/ {
public func foldr<B>(k : (A) -> (B) -> B, _ i : B) -> B {
switch self {
case .Left(_):
return i
case .Right(let y):
return k(y)(i)
}
}
public func foldl<B>(k : (B) -> (A) -> B, _ i : B) -> B {
switch self {
case .Left(_):
return i
case .Right(let y):
return k(i)(y)
}
}
public func foldMap<M : Monoid>(_ f : (A) -> M) -> M {
switch self {
case .Left(_):
return M.mempty
case .Right(let y):
return f(y)
}
}
}
public func sequence<L, R>(_ ms : [Either<L, R>]) -> Either<L, [R]> {
return ms.reduce(Either<L, [R]>.pure([]), { n, m in
return n.bind { xs in
return m.bind { x in
return Either<L, [R]>.pure(xs + [x])
}
}
})
}
| apache-2.0 |
deltaDNA/ios-sdk | DeltaDNA/NWPathProtocol.swift | 1 | 210 | import Network
@available(iOS 12.0, *)
internal protocol NWPathProtocol {
var status: NWPath.Status { get }
var isExpensive: Bool { get }
}
@available(iOS 12.0, *)
extension NWPath: NWPathProtocol {}
| apache-2.0 |
emilstahl/swift | validation-test/compiler_crashers_fixed/2103-swift-typebase-getcanonicaltype.swift | 13 | 481 | // RUN: not %target-swift-frontend %s -parse
// Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
protocol c {
protocol C {
typealias f : C {
class d("[0x31] as String
w>? {
class func f<T, l func a() -> String {
}
extension Array {
}
protocol A {
return NSData()) {
class func d: a {
}
private class A : String {
}
}
}
}
typealias B : f{ class B {
}
}
}
}
if c {
| apache-2.0 |
Nirma/UIDeviceComplete | Sources/DeviceFamily.swift | 1 | 1724 | //
// DeviceFamily.swift
//
// Copyright (c) 2017-2019 Nicholas Maccharoli
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in all
// copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
// SOFTWARE.
public enum DeviceFamily: String {
case iPhone
case iPod
case iPad
case unknown
public init(rawValue: String) {
switch rawValue {
case "iPhone":
self = .iPhone
case "iPod":
self = .iPod
case "iPad":
self = .iPad
default:
self = .unknown
}
}
}
// MARK: Simulator Detection
extension DeviceFamily {
public var isSimulator: Bool {
#if arch(i386) || arch(x86_64)
return true
#else
return false
#endif
}
}
| mit |
Jamonek/School-For-Me | School For Me/StringExt.swift | 1 | 549 | //
// StringExt.swift
// School For Me
//
// Created by Jamone Alexander Kelly on 1/7/16.
// Copyright © 2016 Jamone Kelly. All rights reserved.
//
import Foundation
import UIKit
extension String {
// phone number extension coming soon..
}
extension NSAttributedString {
convenience init?(string text:String, font:UIFont!, kerning: CGFloat!, color:UIColor!) {
self.init(string: text, attributes: [NSAttributedStringKey.kern:kerning, NSAttributedStringKey.font:font, NSAttributedStringKey.foregroundColor:color])
}
}
| apache-2.0 |
mathcamp/swiftz | swiftz/Num.swift | 2 | 2576 | //
// Num.swift
// swiftz
//
// Created by Maxwell Swadling on 3/06/2014.
// Copyright (c) 2014 Maxwell Swadling. All rights reserved.
//
// Num 'typeclass'
public protocol Num {
typealias N
func zero() -> N
func succ(n: N) -> N
func add(x: N, y: N) -> N
func multiply(x: N, y: N) -> N
}
public let nint8 = NInt8()
public class NInt8: Num {
public typealias N = Int8
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nint16 = NInt16()
public class NInt16: Num {
public typealias N = Int16
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nint32 = NInt32()
public class NInt32: Num {
public typealias N = Int32
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nint64 = NInt64()
public class NInt64: Num {
public typealias N = Int64
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nuint8 = NUInt8()
public class NUInt8: Num {
public typealias N = UInt8
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nuint16 = NUInt16()
public class NUInt16: Num {
public typealias N = UInt16
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nuint32 = NUInt32()
public class NUInt32: Num {
public typealias N = UInt32
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
public let nuint64 = NUInt64()
public class NUInt64: Num {
public typealias N = UInt64
public func zero() -> N { return 0 }
public func succ(n: N) -> N { return n + 1 }
public func add(x: N, y: N) -> N { return x + y }
public func multiply(x: N, y: N) -> N { return x * y }
}
| bsd-3-clause |
GPWiOS/DouYuLive | DouYuTV/DouYuTV/AppDelegate.swift | 1 | 2171 | //
// AppDelegate.swift
// DouYuTV
//
// Created by GaiPengwei on 2017/4/24.
// Copyright © 2017年 GaiPengwei. All rights reserved.
//
import UIKit
@UIApplicationMain
class AppDelegate: UIResponder, UIApplicationDelegate {
var window: UIWindow?
func application(_ application: UIApplication, didFinishLaunchingWithOptions launchOptions: [UIApplicationLaunchOptionsKey: Any]?) -> Bool {
UITabBar.appearance().tintColor = UIColor.orange
return true
}
func applicationWillResignActive(_ application: UIApplication) {
// Sent when the application is about to move from active to inactive state. This can occur for certain types of temporary interruptions (such as an incoming phone call or SMS message) or when the user quits the application and it begins the transition to the background state.
// Use this method to pause ongoing tasks, disable timers, and invalidate graphics rendering callbacks. Games should use this method to pause the game.
}
func applicationDidEnterBackground(_ application: UIApplication) {
// Use this method to release shared resources, save user data, invalidate timers, and store enough application state information to restore your application to its current state in case it is terminated later.
// If your application supports background execution, this method is called instead of applicationWillTerminate: when the user quits.
}
func applicationWillEnterForeground(_ application: UIApplication) {
// Called as part of the transition from the background to the active state; here you can undo many of the changes made on entering the background.
}
func applicationDidBecomeActive(_ application: UIApplication) {
// Restart any tasks that were paused (or not yet started) while the application was inactive. If the application was previously in the background, optionally refresh the user interface.
}
func applicationWillTerminate(_ application: UIApplication) {
// Called when the application is about to terminate. Save data if appropriate. See also applicationDidEnterBackground:.
}
}
| mit |
ifelseboyxx/xx_Notes | contents/XcodeTemplate/Template/CustomVC.xctemplate/CustomVCSwift/___FILEBASENAME___.swift | 1 | 3111 | //
// ___FILENAME___
// ___PROJECTNAME___
//
// Created by ___FULLUSERNAME___ on ___DATE___.
//___COPYRIGHT___
//
/*
* .,:,,, .::,,,::.
* .::::,,;;, .,;;:,,....:i:
* :i,.::::,;i:. ....,,:::::::::,.... .;i:,. ......;i.
* :;..:::;::::i;,,:::;:,,,,,,,,,,..,.,,:::iri:. .,:irsr:,.;i.
* ;;..,::::;;;;ri,,,. ..,,:;s1s1ssrr;,.;r,
* :;. ,::;ii;:, . ................... .;iirri;;;,,;i,
* ,i. .;ri:. ... ............................ .,,:;:,,,;i:
* :s,.;r:... ....................................... .::;::s;
* ,1r::. .............,,,.,,:,,........................,;iir;
* ,s;........... ..::.,;:,,. ...............,;1s
* :i,..,. .,:,,::,. .......... .......;1,
* ir,....:rrssr;:, ,,.,::. .r5S9989398G95hr;. ....,.:s,
* ;r,..,s9855513XHAG3i .,,,,,,,. ,S931,.,,.;s;s&BHHA8s.,..,..:r:
* :r;..rGGh, :SAG;;G@BS:.,,,,,,,,,.r83: hHH1sXMBHHHM3..,,,,.ir.
* ,si,.1GS, sBMAAX&MBMB5,,,,,,:,,.:&8 3@HXHBMBHBBH#X,.,,,,,,rr
* ;1:,,SH: .A@&&B#&8H#BS,,,,,,,,,.,5XS, 3@MHABM&59M#As..,,,,:,is,
* .rr,,,;9&1 hBHHBB&8AMGr,,,,,,,,,,,:h&&9s; r9&BMHBHMB9: . .,,,,;ri.
* :1:....:5&XSi;r8BMBHHA9r:,......,,,,:ii19GG88899XHHH&GSr. ...,:rs.
* ;s. .:sS8G8GG889hi. ....,,:;:,.:irssrriii:,. ...,,i1,
* ;1, ..,....,,isssi;, .,,. ....,.i1,
* ;h: i9HHBMBBHAX9: . ...,,,rs,
* ,1i.. :A#MBBBBMHB##s ....,,,;si.
* .r1,.. ,..;3BMBBBHBB#Bh. .. ....,,,,,i1;
* :h;.. .,..;,1XBMMMMBXs,.,, .. :: ,. ....,,,,,,ss.
* ih: .. .;;;, ;;:s58A3i,.. ,. ,.:,,. ...,,,,,:,s1,
* .s1,.... .,;sh, ,iSAXs;. ,. ,,.i85 ...,,,,,,:i1;
* .rh: ... rXG9XBBM#M#MHAX3hss13&&HHXr .....,,,,,,,ih;
* .s5: ..... i598X&&A&AAAAAA&XG851r: ........,,,,:,,sh;
* . ihr, ... . .. ........,,,,,;11:.
* ,s1i. ... ..,,,..,,,.,,.,,.,.. ........,,.,,.;s5i.
* .:s1r,...................... ..............;shs,
* . .:shr:. .... ..............,ishs.
* .,issr;,... ...........................,is1s;.
* .,is1si;:,....................,:;ir1sr;,
* ..:isssssrrii;::::::;;iirsssssr;:..
* .,::iiirsssssssssrri;;:.
*/
import UIKit
class ___FILEBASENAMEASIDENTIFIER___: UIViewController {
//MARK: - LifeCyle
override func viewDidLoad() {
super.viewDidLoad()
}
deinit {
print("\(object_getClassName(self)) - 释放了!")
}
//MARK: - Intial Methods
//MARK: - Target Methods
//MARK: - Private Method
//MARK: - Setter Getter Methods
//MARK: - External Delegate
}
| mit |
shaps80/InkKit | Pod/Classes/GridLayout.swift | 1 | 109 | //
// GridLayout.swift
// Pods
//
// Created by Shahpour Benkau on 11/05/2017.
//
//
import CoreGraphics
| mit |
ben-ng/swift | validation-test/compiler_crashers_fixed/26008-swift-modulefile-getdecl.swift | 1 | 422 | // This source file is part of the Swift.org open source project
// Copyright (c) 2014 - 2016 Apple Inc. and the Swift project authors
// Licensed under Apache License v2.0 with Runtime Library Exception
//
// See https://swift.org/LICENSE.txt for license information
// See https://swift.org/CONTRIBUTORS.txt for the list of Swift project authors
// RUN: not %target-swift-frontend %s -typecheck
T>
class B{var d={{{}}{
| apache-2.0 |
ben-ng/swift | test/Interpreter/protocol_extensions.swift | 10 | 4915 | // RUN: %target-run-simple-swift | %FileCheck %s
// REQUIRES: executable_test
// Extend a protocol with a property.
extension Sequence {
final var myCount: Int {
var result = 0
for _ in self {
result += 1
}
return result
}
}
// CHECK: 4
print(["a", "b", "c", "d"].myCount)
// Extend a protocol with a function.
extension Collection {
final var myIndices: Range<Index> {
return startIndex..<endIndex
}
func clone() -> Self {
return self
}
}
// CHECK: 4
print(["a", "b", "c", "d"].clone().myCount)
extension Sequence {
final public func myEnumerated() -> EnumeratedSequence<Self> {
return self.enumerated()
}
}
// CHECK: (0, a)
// CHECK-NEXT: (1, b)
// CHECK-NEXT: (2, c)
for (index, element) in ["a", "b", "c"].myEnumerated() {
print("(\(index), \(element))")
}
extension Sequence {
final public func myReduce<T>(
_ initial: T, combine: (T, Self.Iterator.Element) -> T
) -> T {
var result = initial
for value in self {
result = combine(result, value)
}
return result
}
}
// CHECK: 15
print([1, 2, 3, 4, 5].myReduce(0, combine: +))
extension Sequence {
final public func myZip<S : Sequence>(_ s: S) -> Zip2Sequence<Self, S> {
return Zip2Sequence(_sequence1: self, _sequence2: s)
}
}
// CHECK: (1, a)
// CHECK-NEXT: (2, b)
// CHECK-NEXT: (3, c)
for (a, b) in [1, 2, 3].myZip(["a", "b", "c"]) {
print("(\(a), \(b))")
}
// Mutating algorithms.
extension MutableCollection
where Self: RandomAccessCollection, Self.Iterator.Element : Comparable {
public final mutating func myPartition() -> Index {
let first = self.first
return self.partition(by: { $0 >= first! })
}
}
extension RangeReplaceableCollection {
public final func myJoin<S : Sequence where S.Iterator.Element == Self>(
_ elements: S
) -> Self {
var result = Self()
var iter = elements.makeIterator()
if let first = iter.next() {
result.append(contentsOf: first)
while let next = iter.next() {
result.append(contentsOf: self)
result.append(contentsOf: next)
}
}
return result
}
}
// CHECK: a,b,c
print(
String(
",".characters.myJoin(["a".characters, "b".characters, "c".characters])
)
)
// Constrained extensions for specific types.
extension Collection where Self.Iterator.Element == String {
final var myCommaSeparatedList: String {
if startIndex == endIndex { return "" }
var result = ""
var first = true
for x in self {
if first { first = false }
else { result += ", " }
result += x
}
return result
}
}
// CHECK: x, y, z
print(["x", "y", "z"].myCommaSeparatedList)
// CHECK: {{[tuv], [tuv], [tuv]}}
print((["t", "u", "v"] as Set).myCommaSeparatedList)
// Existentials
protocol ExistP1 {
func existP1()
}
extension ExistP1 {
final func runExistP1() {
print("runExistP1")
self.existP1()
}
}
struct ExistP1_Struct : ExistP1 {
func existP1() {
print(" - ExistP1_Struct")
}
}
class ExistP1_Class : ExistP1 {
func existP1() {
print(" - ExistP1_Class")
}
}
// CHECK: runExistP1
// CHECK-NEXT: - ExistP1_Struct
var existP1: ExistP1 = ExistP1_Struct()
existP1.runExistP1()
// CHECK: runExistP1
// CHECK-NEXT: - ExistP1_Class
existP1 = ExistP1_Class()
existP1.runExistP1()
protocol P {
mutating func setValue(_ b: Bool)
func getValue() -> Bool
}
extension P {
final var extValue: Bool {
get { return getValue() }
set(newValue) { setValue(newValue) }
}
}
extension Bool : P {
mutating func setValue(_ b: Bool) { self = b }
func getValue() -> Bool { return self }
}
class C : P {
var theValue: Bool = false
func setValue(_ b: Bool) { theValue = b }
func getValue() -> Bool { return theValue }
}
func toggle(_ value: inout Bool) {
value = !value
}
var p: P = true
// CHECK: Bool
print("Bool")
// CHECK: true
p.extValue = true
print(p.extValue)
// CHECK: false
p.extValue = false
print(p.extValue)
// CHECK: true
toggle(&p.extValue)
print(p.extValue)
// CHECK: C
print("C")
p = C()
// CHECK: true
p.extValue = true
print(p.extValue)
// CHECK: false
p.extValue = false
print(p.extValue)
// CHECK: true
toggle(&p.extValue)
print(p.extValue)
// Logical lvalues of existential type.
struct HasP {
var _p: P
var p: P {
get { return _p }
set { _p = newValue }
}
}
var hasP = HasP(_p: false)
// CHECK: true
hasP.p.extValue = true
print(hasP.p.extValue)
// CHECK: false
toggle(&hasP.p.extValue)
print(hasP.p.extValue)
// rdar://problem/20739719
class Super: Init {
required init(x: Int) { print("\(x) \(type(of: self))") }
}
class Sub: Super {}
protocol Init { init(x: Int) }
extension Init { init() { self.init(x: 17) } }
// CHECK: 17 Super
_ = Super()
// CHECK: 17 Sub
_ = Sub()
// CHECK: 17 Super
var sup: Super.Type = Super.self
_ = sup.init()
// CHECK: 17 Sub
sup = Sub.self
_ = sup.init()
// CHECK: DONE
print("DONE")
| apache-2.0 |
cnoon/swift-compiler-crashes | crashes-duplicates/18441-no-stacktrace.swift | 11 | 255 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
for in
{
case
let
{
protocol a {
enum e {
func b {
[
{
class A {
var b {
class
case ,
| mit |
cnoon/swift-compiler-crashes | crashes-duplicates/16337-swift-sourcemanager-getmessage.swift | 11 | 219 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
if true {
for {
struct A {
class A {
class
case ,
| mit |
cnoon/swift-compiler-crashes | crashes-duplicates/06332-swift-constraints-constraintgraph-removeconstraint.swift | 11 | 243 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
func c<b> () {
class A {
func b
struct B
var b = B
class A {
func a<T : a
| mit |
cnoon/swift-compiler-crashes | crashes-duplicates/18631-swift-sourcemanager-getmessage.swift | 11 | 218 | // Distributed under the terms of the MIT license
// Test case submitted to project by https://github.com/practicalswift (practicalswift)
// Test case found by fuzzing
enum e {
func b {
(
var {
class C {
class
case ,
| mit |
rakaramos/networklayer | NetworkLayer/Request/BaseRequest.swift | 1 | 3231 | import Foundation
public class BaseRequest: NSOperation {
var theURL = NSURL()
var bandwidth: Double {
return benchmark.bandwidth(incomingData)
}
private let incomingData = NSMutableData()
private var sessionTask: NSURLSessionTask?
private var benchmark: Benchmark = Benchmark()
private var localURLSession: NSURLSession {
return NSURLSession(configuration: localConfig, delegate: self, delegateQueue: nil)
}
private var localConfig: NSURLSessionConfiguration {
return NSURLSessionConfiguration.defaultSessionConfiguration()
}
var average: Double {
get {
return benchmark.average
}
}
var innerFinished: Bool = false {
didSet {
if(innerFinished) {
benchmark.stop()
}
}
}
override public var finished: Bool {
get {
return innerFinished
}
//Note that I am triggering a KVO notification on isFinished as opposed to finished which is what the property name is. This seems to be a Swift-ism as the NSOperation get accessor is called isFinished instead of getFinished and I suspect that is part of why I need to tickle the accessor name instead of the property name.
set (newValue) {
willChangeValueForKey("isFinished")
innerFinished = newValue
didChangeValueForKey("isFinished")
}
}
convenience public init(URL: NSURL) {
self.init()
self.theURL = URL
}
override public func start() {
print("Start fetching \(theURL)")
if cancelled {
finished = true
return
}
let request = NSMutableURLRequest(URL: theURL)
sessionTask = localURLSession.dataTaskWithRequest(request)
sessionTask?.resume()
}
func finish() {
finished = true
sessionTask?.cancel()
}
}
extension BaseRequest: NSURLSessionDelegate {
func URLSession(session: NSURLSession, dataTask: NSURLSessionDataTask, didReceiveResponse response: NSURLResponse, completionHandler: (NSURLSessionResponseDisposition) -> Void) {
print("Start downloading \(theURL) \(queuePriority.rawValue)")
benchmark.start()
if cancelled {
finish()
return
}
//Check the response code and react appropriately
completionHandler(.Allow)
}
func URLSession(session: NSURLSession, dataTask: NSURLSessionDataTask, didReceiveData data: NSData) {
if cancelled {
finish()
return
}
incomingData.appendData(data)
benchmark.tick(incomingData, feshData: data)
}
public func URLSession(session: NSURLSession, task: NSURLSessionTask, didCompleteWithError error: NSError?) {
defer {
finished = true
}
if cancelled {
sessionTask?.cancel()
return
}
if NSThread.isMainThread() { print("Main Thread!") }
if error != nil {
print("Failed to receive response: \(error)")
return
}
//processData()
}
} | mit |
SuPair/VPNOn | VPNOnKit/VPNManager.swift | 1 | 7157 | //
// VPNManager.swift
// VPNOn
//
// Created by Lex Tang on 12/5/14.
// Copyright (c) 2014 LexTang.com. All rights reserved.
//
import Foundation
import NetworkExtension
import CoreData
let kAppGroupIdentifier = "group.VPNOn"
final public class VPNManager
{
lazy var manager: NEVPNManager = {
return NEVPNManager.sharedManager()
}()
lazy var defaults: NSUserDefaults = {
return NSUserDefaults(suiteName: kAppGroupIdentifier)!
}()
public lazy var wormhole: Wormhole = {
return Wormhole(appGroupIdentifier: kAppGroupIdentifier, messageDirectoryName: "Wormhole")
}()
public var status: NEVPNStatus {
get {
return manager.connection.status
}
}
private let kVPNOnDisplayFlags = "displayFlags"
public var displayFlags: Bool {
get {
if let value = defaults.objectForKey(kVPNOnDisplayFlags) as! Int? {
return Bool(value)
}
return true
}
set {
defaults.setObject(Int(newValue), forKey: kVPNOnDisplayFlags)
defaults.synchronize()
}
}
public class var sharedManager : VPNManager
{
struct Static
{
static let sharedInstance : VPNManager = {
let instance = VPNManager()
instance.manager.loadFromPreferencesWithCompletionHandler {
(error: NSError!) -> Void in
if let err = error {
debugPrint("Failed to load preferences: \(err.localizedDescription)")
}
}
instance.manager.localizedDescription = "VPN On"
instance.manager.enabled = true
return instance
}()
}
return Static.sharedInstance
}
public func connectIPSec(title: String, server: String, account: String?, group: String?, alwaysOn: Bool = true, passwordRef: NSData?, secretRef: NSData?, certificate: NSData?) {
let p = NEVPNProtocolIPSec()
p.authenticationMethod = NEVPNIKEAuthenticationMethod.None
p.useExtendedAuthentication = true
p.serverAddress = server
p.disconnectOnSleep = !alwaysOn
manager.localizedDescription = "VPN On - \(title)"
if let grp = group {
p.localIdentifier = grp
} else {
p.localIdentifier = "VPN"
}
if let username = account {
p.username = username
}
if let password = passwordRef {
p.passwordReference = password
}
if let secret = secretRef {
p.authenticationMethod = NEVPNIKEAuthenticationMethod.SharedSecret
p.sharedSecretReference = secret
}
if let certficiateData = certificate {
p.authenticationMethod = NEVPNIKEAuthenticationMethod.Certificate
p.identityData = certficiateData
}
manager.enabled = true
manager.`protocol` = p
configOnDemand()
#if (arch(i386) || arch(x86_64)) && os(iOS) // #if TARGET_IPHONE_SIMULATOR for Swift
print("I'm afraid you can not connect VPN in simulators.")
#else
manager.saveToPreferencesWithCompletionHandler {
(error: NSError!) -> Void in
if let err = error {
debugPrintln("Failed to save profile: \(err.localizedDescription)")
} else {
var connectError : NSError?
self.manager.connection.startVPNTunnelAndReturnError(&connectError)
if let connectErr = connectError {
debugPrintln("Failed to start tunnel: \(connectErr.localizedDescription)")
}
}
}
#endif
}
public func connectIKEv2(title: String, server: String, account: String?, group: String?, alwaysOn: Bool = true, passwordRef: NSData?, secretRef: NSData?, certificate: NSData?) {
let p = NEVPNProtocolIKEv2()
p.authenticationMethod = NEVPNIKEAuthenticationMethod.None
p.useExtendedAuthentication = true
p.serverAddress = server
p.remoteIdentifier = server
p.disconnectOnSleep = !alwaysOn
p.deadPeerDetectionRate = NEVPNIKEv2DeadPeerDetectionRate.Medium
// TODO: Add an option into config page
manager.localizedDescription = "VPN On - \(title)"
if let grp = group {
p.localIdentifier = grp
} else {
p.localIdentifier = "VPN"
}
if let username = account {
p.username = username
}
if let password = passwordRef {
p.passwordReference = password
}
if let secret = secretRef {
p.authenticationMethod = NEVPNIKEAuthenticationMethod.SharedSecret
p.sharedSecretReference = secret
}
if let certficiateData = certificate {
p.authenticationMethod = NEVPNIKEAuthenticationMethod.Certificate
p.serverCertificateCommonName = server
p.serverCertificateIssuerCommonName = server
p.identityData = certficiateData
}
manager.enabled = true
manager.`protocol` = p
configOnDemand()
manager.saveToPreferencesWithCompletionHandler {
(error: NSError!) -> Void in
if let err = error {
debugPrint("Failed to save profile: \(err.localizedDescription)")
} else {
var connectError : NSError?
do {
try self.manager.connection.startVPNTunnelAndReturnError()
} catch var error as NSError {
connectError = error
if let connectErr = connectError {
debugPrint("Failed to start IKEv2 tunnel: \(connectErr.localizedDescription)")
}
} catch {
fatalError()
}
}
}
}
public func configOnDemand() {
if onDemandDomainsArray.count > 0 && onDemand {
let connectionRule = NEEvaluateConnectionRule(
matchDomains: onDemandDomainsArray,
andAction: NEEvaluateConnectionRuleAction.ConnectIfNeeded
)
let ruleEvaluateConnection = NEOnDemandRuleEvaluateConnection()
ruleEvaluateConnection.connectionRules = [connectionRule]
manager.onDemandRules = [ruleEvaluateConnection]
manager.onDemandEnabled = true
} else {
manager.onDemandRules = [AnyObject]()
manager.onDemandEnabled = false
}
}
public func disconnect() {
manager.connection.stopVPNTunnel()
}
public func removeProfile() {
manager.removeFromPreferencesWithCompletionHandler {
(error: NSError!) -> Void in
}
}
}
| mit |
masters3d/xswift | exercises/hamming/Tests/HammingTests/HammingTests.swift | 3 | 2157 | import XCTest
@testable import Hamming
class HammingTests: XCTestCase {
func testNoDifferenceBetweenEmptyStrands() {
let result = Hamming.compute("", against: "")!
let expected = 0
XCTAssertEqual(expected, result)
}
func testNoDifferenceBetweenIdenticalStrands() {
let result = Hamming.compute("GGACTGA", against:"GGACTGA")!
let expected = 0
XCTAssertEqual(expected, result)
}
func testCompleteHammingDistanceInSmallStrand() {
let result = Hamming.compute("ACT", against: "GGA")!
let expected = 3
XCTAssertEqual(expected, result)
}
func testSmallHammingDistanceInMiddleSomewhere() {
let result = Hamming.compute("GGACG", against:"GGTCG")!
let expected = 1
XCTAssertEqual(expected, result)
}
func testLargerDistance() {
let result = Hamming.compute("ACCAGGG", against:"ACTATGG")!
let expected = 2
XCTAssertEqual(expected, result)
}
func testReturnsNilWhenOtherStrandLonger() {
let result = Hamming.compute("AAACTAGGGG", against:"AGGCTAGCGGTAGGAC")
XCTAssertNil(result, "Different length strands return nil")
}
func testReturnsNilWhenOriginalStrandLonger() {
let result = Hamming.compute("GACTACGGACAGGGTAGGGAAT", against:"GACATCGCACACC")
XCTAssertNil(result, "Different length strands return nil")
}
static var allTests: [(String, (HammingTests) -> () throws -> Void)] {
return [
("testNoDifferenceBetweenEmptyStrands", testNoDifferenceBetweenEmptyStrands),
("testNoDifferenceBetweenIdenticalStrands", testNoDifferenceBetweenIdenticalStrands),
("testCompleteHammingDistanceInSmallStrand", testCompleteHammingDistanceInSmallStrand),
("testSmallHammingDistanceInMiddleSomewhere", testSmallHammingDistanceInMiddleSomewhere),
("testLargerDistance", testLargerDistance),
("testReturnsNilWhenOtherStrandLonger", testReturnsNilWhenOtherStrandLonger),
("testReturnsNilWhenOriginalStrandLonger", testReturnsNilWhenOriginalStrandLonger),
]
}
}
| mit |
auth0/Lock.swift | Lock/DatabasePresenter.swift | 1 | 16523 | // DatabasePresenter.swift
//
// Copyright (c) 2016 Auth0 (http://auth0.com)
//
// Permission is hereby granted, free of charge, to any person obtaining a copy
// of this software and associated documentation files (the "Software"), to deal
// in the Software without restriction, including without limitation the rights
// to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
// copies of the Software, and to permit persons to whom the Software is
// furnished to do so, subject to the following conditions:
//
// The above copyright notice and this permission notice shall be included in
// all copies or substantial portions of the Software.
//
// THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
// IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
// FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
// AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
// LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
// OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
// THE SOFTWARE.
import Foundation
import SafariServices
class DatabasePresenter: Presentable, Loggable {
let database: DatabaseConnection
let options: Options
let style: Style
var authenticator: DatabaseAuthenticatable
var creator: DatabaseUserCreator
var navigator: Navigable
var messagePresenter: MessagePresenter? {
didSet {
self.authPresenter?.messagePresenter = self.messagePresenter
}
}
var authPresenter: AuthPresenter?
var enterpriseInteractor: EnterpriseDomainInteractor?
var initialEmail: String? { return self.authenticator.validEmail ? self.authenticator.email : nil }
var initialUsername: String? { return self.authenticator.validUsername ? self.authenticator.username : nil }
weak var databaseView: DatabaseOnlyView?
var currentScreen: DatabaseScreen?
convenience init(interactor: DatabaseInteractor, connection: DatabaseConnection, navigator: Navigable, options: Options, style: Style) {
self.init(authenticator: interactor, creator: interactor, connection: connection, navigator: navigator, options: options, style: style)
}
init(authenticator: DatabaseAuthenticatable, creator: DatabaseUserCreator, connection: DatabaseConnection, navigator: Navigable, options: Options, style: Style) {
self.authenticator = authenticator
self.creator = creator
self.database = connection
self.navigator = navigator
self.options = options
self.style = style
}
var view: View {
let initialScreen = self.options.initialScreen
let allow = self.options.allow
let database = DatabaseOnlyView(allowedModes: allow)
database.navigator = self.navigator
database.switcher?.onSelectionChange = { [unowned self, weak database] switcher in
let selected = switcher.selected
guard let view = database else { return }
self.logger.debug("selected \(selected)")
self.navigator.resetScroll(false)
switch selected {
case .signup:
self.showSignup(inView: view, username: self.initialUsername, email: self.initialEmail)
case .login:
self.showLogin(inView: view, identifier: self.authenticator.identifier)
}
}
if allow.contains(.Login) && initialScreen == .login {
database.switcher?.selected = .login
showLogin(inView: database, identifier: authenticator.identifier)
} else if allow.contains(.Signup) && (initialScreen == .signup || !allow.contains(.Login)) {
database.switcher?.selected = .signup
showSignup(inView: database, username: initialUsername, email: initialEmail)
}
self.databaseView = database
return database
}
private func showLogin(inView view: DatabaseView, identifier: String?) {
self.messagePresenter?.hideCurrent()
let authCollectionView = self.authPresenter?.newViewToEmbed(withInsets: UIEdgeInsets(top: 0, left: 20, bottom: 0, right: 20), isLogin: true)
let style = self.database.requiresUsername ? self.options.usernameStyle : [.Email]
view.showLogin(withIdentifierStyle: style, identifier: identifier, authCollectionView: authCollectionView, showPassword: self.options.allowShowPassword)
self.currentScreen = .login
let form = view.form
form?.onValueChange = self.handleInput
form?.onSubmit = { [weak form] input in
form?.onValueChange(input)
guard let attribute = self.getUserAttribute(from: input.type) else { return false }
do {
try self.authenticator.update(attribute, value: input.text)
return true
} catch {
return false
}
}
let action = { [weak form] (button: PrimaryButton) in
guard let isValid = form?.shouldSubmit(), isValid else { return }
self.messagePresenter?.hideCurrent()
self.logger.info("Perform login for email: \(self.authenticator.email.verbatim())")
button.inProgress = true
let errorHandler: (LocalizableError?) -> Void = { error in
Queue.main.async {
button.inProgress = false
guard let error = error else {
self.logger.debug("Logged in!")
let message = "You have logged in successfully.".i18n(key: "com.auth0.lock.database.login.success.message", comment: "User logged in")
if !self.options.autoClose {
self.messagePresenter?.showSuccess(message)
}
return
}
if case CredentialAuthError.multifactorRequired = error {
self.navigator.navigate(.multifactor)
return
} else if case CredentialAuthError.multifactorTokenRequired(let token) = error {
self.navigator.navigate(.multifactorWithToken(token))
return
} else {
form?.needsToUpdateState()
self.messagePresenter?.showError(error)
self.logger.error("Failed with error \(error)")
}
}
}
if let connection = self.enterpriseInteractor?.connection, let domain = self.enterpriseInteractor?.domain {
if self.options.enterpriseConnectionUsingActiveAuth.contains(connection.name) {
self.navigator.navigate(.enterpriseActiveAuth(connection: connection, domain: domain))
} else {
self.enterpriseInteractor?.login(errorHandler)
}
} else {
self.authenticator.login(errorHandler)
}
}
let primaryButton = view.primaryButton
view.form?.onReturn = { [weak primaryButton] field in
guard let button = primaryButton, field.returnKey == .done else { return } // FIXME: Log warn
action(button)
}
view.primaryButton?.onPress = action
view.secondaryButton?.title = "Don’t remember your password?".i18n(key: "com.auth0.lock.database.button.forgot_password", comment: "Forgot password")
view.secondaryButton?.color = .clear
view.secondaryButton?.onPress = { _ in
self.navigator.navigate(.forgotPassword)
}
}
private func showSignup(inView view: DatabaseView, username: String?, email: String?) {
self.messagePresenter?.hideCurrent()
let authCollectionView = self.authPresenter?.newViewToEmbed(withInsets: UIEdgeInsets(top: 0, left: 20, bottom: 0, right: 20), isLogin: false)
let interactor = self.authenticator as? DatabaseInteractor
let passwordPolicyValidator = interactor?.passwordValidator as? PasswordPolicyValidator
self.currentScreen = .signup
interactor?.user.reset()
view.showSignUp(withUsername: self.database.requiresUsername, username: username, email: email, authCollectionView: authCollectionView, additionalFields: self.options.customSignupFields, passwordPolicyValidator: passwordPolicyValidator, showPassword: self.options.allowShowPassword, showTerms: options.showTerms || options.mustAcceptTerms)
view.allFields?.filter { $0.text != nil && !$0.text!.isEmpty }.forEach(self.handleInput)
let form = view.form
view.form?.onValueChange = self.handleInput
form?.onSubmit = { [weak form] input in
form?.onValueChange(input)
guard let attribute = self.getUserAttribute(from: input.type) else { return false }
do {
try self.authenticator.update(attribute, value: input.text)
return true
} catch {
return false
}
}
let action = { [weak form, weak view] (button: PrimaryButton) in
guard let isValid = form?.shouldSubmit(), isValid else { return }
self.messagePresenter?.hideCurrent()
self.logger.info("Perform sign up for email \(self.creator.email.verbatim())")
view?.allFields?.forEach { self.handleInput($0) }
let interactor = self.creator
button.inProgress = true
interactor.create { createError, loginError in
Queue.main.async {
button.inProgress = false
guard createError != nil || loginError != nil else {
if !self.options.loginAfterSignup {
let message = "Thanks for signing up.".i18n(key: "com.auth0.lock.database.signup.success.message", comment: "User signed up")
if let databaseView = self.databaseView, self.options.allow.contains(.Login) {
self.databaseView?.switcher?.selected = .login
self.showLogin(inView: databaseView, identifier: self.creator.identifier)
}
if self.options.allow.contains(.Login) || !self.options.autoClose {
self.messagePresenter?.showSuccess(message)
}
}
return
}
if let error = loginError, case .multifactorRequired = error {
self.navigator.navigate(.multifactor)
return
} else if let error = loginError, case .multifactorTokenRequired(let token) = error {
self.navigator.navigate(.multifactorWithToken(token))
return
}
let error: LocalizableError = createError ?? loginError!
form?.needsToUpdateState()
self.messagePresenter?.showError(error)
self.logger.error("Failed with error \(error)")
}
}
}
let checkTermsAndSignup = { [weak view] (button: PrimaryButton) in
if self.options.mustAcceptTerms {
let validForm = view?.allFields?
.filter { !$0.state.isValid }
.isEmpty ?? false
if validForm { self.showTermsPrompt(atButton: button) { _ in action(button) } }
} else {
action(button)
}
}
view.form?.onReturn = { [weak view] field in
guard let button = view?.primaryButton, field.returnKey == .done else { return } // FIXME: Log warn
checkTermsAndSignup(button)
}
view.primaryButton?.onPress = checkTermsAndSignup
view.secondaryButton?.title = "By signing up, you agree to our terms of\n service and privacy policy".i18n(key: "com.auth0.lock.database.button.tos", comment: "tos & privacy")
view.secondaryButton?.color = self.style.termsButtonColor
view.secondaryButton?.titleColor = self.style.termsButtonTitleColor
view.secondaryButton?.onPress = { button in
let alert = UIAlertController(title: nil, message: nil, preferredStyle: .actionSheet)
alert.popoverPresentationController?.sourceView = button
alert.popoverPresentationController?.sourceRect = button.bounds
let cancel = UIAlertAction(title: "Cancel".i18n(key: "com.auth0.lock.database.tos.sheet.cancel", comment: "Cancel"), style: .cancel, handler: nil)
let tos = UIAlertAction(title: "Terms of Service".i18n(key: "com.auth0.lock.database.tos.sheet.title", comment: "ToS"), style: .default, handler: safariBuilder(forURL: self.options.termsOfServiceURL as URL, navigator: self.navigator))
let privacy = UIAlertAction(title: "Privacy Policy".i18n(key: "com.auth0.lock.database.tos.sheet.privacy", comment: "Privacy"), style: .default, handler: safariBuilder(forURL: self.options.privacyPolicyURL as URL, navigator: self.navigator))
[cancel, tos, privacy].forEach { alert.addAction($0) }
self.navigator.present(alert)
}
}
private func handleInput(_ input: InputField) {
self.messagePresenter?.hideCurrent()
self.logger.verbose("new value: \(input.text.verbatim()) for type: \(input.type)")
guard let attribute = getUserAttribute(from: input.type) else { return }
var updateHRD: Bool = false
switch attribute {
case .email: updateHRD = true
case .emailOrUsername: updateHRD = true
default: break
}
do {
try self.authenticator.update(attribute, value: input.text)
input.showValid()
if self.currentScreen == .login && updateHRD {
try? self.enterpriseInteractor?.updateEmail(input.text)
if let connection = self.enterpriseInteractor?.connection {
self.logger.verbose("Enterprise connection detected: \(connection)")
if self.databaseView?.ssoBar == nil { self.databaseView?.presentEnterprise() }
} else {
self.databaseView?.removeEnterprise()
}
}
} catch let error as InputValidationError {
input.showError(error.localizedMessage(withConnection: self.database))
} catch {
input.showError()
}
}
private func getUserAttribute(from inputType: InputField.InputType) -> UserAttribute? {
switch inputType {
case .email: return .email
case .emailOrUsername: return .emailOrUsername
case .password: return .password(enforcePolicy: self.currentScreen == .signup)
case .username: return .username
case .custom(let name, _, _, let storage, _, _, _, _, _, _, _):
return .custom(name: name, storage: storage)
default: return nil
}
}
func showTermsPrompt(atButton button: PrimaryButton, successHandler: @escaping (PrimaryButton) -> Void) {
let terms = "Terms & Policy".i18n(key: "com.auth0.lock.database.button.tos.title", comment: "tos title")
let alert = UIAlertController(title: terms, message: "By signing up, you agree to our terms of\n service and privacy policy".i18n(key: "com.auth0.lock.database.button.tos", comment: "tos & privacy"), preferredStyle: .alert)
alert.popoverPresentationController?.sourceView = button
alert.popoverPresentationController?.sourceRect = button.bounds
let cancelAction = UIAlertAction(title: "Cancel".i18n(key: "com.auth0.lock.database.tos.sheet.cancel", comment: "Cancel"), style: .cancel, handler: nil)
let okAction = UIAlertAction(title: "Accept".i18n(key: "com.auth0.lock.database.tos.sheet.accept", comment: "Accept"), style: .default) { _ in
successHandler(button)
}
[cancelAction, okAction].forEach { alert.addAction($0) }
self.navigator.present(alert)
}
}
private func safariBuilder(forURL url: URL, navigator: Navigable) -> (UIAlertAction) -> Void {
return { _ in
let safari = SFSafariViewController(url: url)
navigator.present(safari)
}
}
| mit |
sstanic/Shopfred | Shopfred/Shopfred/Tools/SettingsData.swift | 1 | 917 | //
// SettingsData.swift
// Shopfred
//
// Created by Sascha Stanic on 7/9/17.
// Copyright © 2017 Sascha Stanic. All rights reserved.
//
import Foundation
import CoreData
/**
Management struct for core data entities.
# Initializer
- name: The name of the entity instance
- displayText: The text that is displayed in the UI for an entity
- type: The type of the entity
*/
struct SettingsData {
// MARK: - Public Attributes
var name: String!
var displayText: String!
var type: AnyObject.Type!
// MARK: - Initializer
init(name: String) {
self.name = name
self.displayText = name
}
init(name: String, displayText: String) {
self.init(name: name)
self.displayText = displayText
}
init(name: String, type: AnyObject.Type) {
self.init(name: name)
self.type = type
}
}
| mit |
sgtsquiggs/WordSearch | WordSearch/Puzzle.swift | 1 | 2892 | //
// Puzzle.swift
// WordSearch
//
// Created by Matthew Crenshaw on 11/7/15.
// Copyright © 2015 Matthew Crenshaw. All rights reserved.
//
import Foundation
/// ASSUMPTION: `character_grid` will always be a square 2d array
struct Puzzle {
let sourceLanguage: String
let targetLanguage: String
let word: String
let characterGrid: [[String]]
let wordLocations: [WordLocation]
let rows: Int
let columns: Int
/// Decodes `Puzzle` from json.
static func decodeJson(json: AnyObject) -> Puzzle? {
guard let dict = json as? [String:AnyObject] else {
assertionFailure("json is not a dictionary")
return nil
}
guard let sourceLanguage_field: AnyObject = dict["source_language"] else {
assertionFailure("field 'source_language' is mising")
return nil
}
guard let sourceLanguage: String = String.decodeJson(sourceLanguage_field) else {
assertionFailure("field 'source_language' is not a String")
return nil
}
guard let targetLanguage_field: AnyObject = dict["target_language"] else {
assertionFailure("field 'target_language' is mising")
return nil
}
guard let targetLanguage: String = String.decodeJson(targetLanguage_field) else {
assertionFailure("field 'target_language' is not a String")
return nil
}
guard let word_field: AnyObject = dict["word"] else {
assertionFailure("field 'word_field' is mising")
return nil
}
guard let word: String = String.decodeJson(word_field) else {
assertionFailure("field 'word_field' is not a String")
return nil
}
guard let characterGrid_field: AnyObject = dict["character_grid"] else {
assertionFailure("field 'character_grid' is missing")
return nil
}
guard let characterGrid: [[String]] = Array.decodeJson({ Array.decodeJson({ String.decodeJson($0) }, $0) }, characterGrid_field) else {
assertionFailure("field 'character_grid' is not a [[String]]")
return nil
}
guard let wordLocations_field: AnyObject = dict["word_locations"] else {
assertionFailure("field 'word_locations' is missing")
return nil
}
guard let wordLocations: [WordLocation] = WordLocation.decodeJson(wordLocations_field) else {
assertionFailure("field word_locations is not word locations")
return nil
}
let rows = characterGrid.count
let columns = characterGrid.first!.count
return Puzzle(sourceLanguage: sourceLanguage, targetLanguage: targetLanguage, word: word, characterGrid: characterGrid, wordLocations: wordLocations, rows: rows, columns: columns)
}
}
| mit |
LamGiauKhongKhoTeam/LGKK | ModulesTests/CryptoSwiftTests/PBKDF.swift | 1 | 4251 | //
// PBKDF.swift
// CryptoSwift
//
// Created by Marcin Krzyzanowski on 04/04/16.
// Copyright © 2016 Marcin Krzyzanowski. All rights reserved.
//
import XCTest
@testable import CryptoSwift
class PBKDF: XCTestCase {
func testPBKDF1() {
let password: Array<UInt8> = [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64]
let salt: Array<UInt8> = [0x78, 0x57, 0x8E, 0x5A, 0x5D, 0x63, 0xCB, 0x06]
let value = try! PKCS5.PBKDF1(password: password, salt: salt, iterations: 1000, keyLength: 16).calculate()
XCTAssertEqual(value.toHexString(), "dc19847e05c64d2faf10ebfb4a3d2a20")
}
func testPBKDF2() {
// P = "password", S = "salt", c = 1, dkLen = 20
XCTAssertEqual([0x0c, 0x60, 0xc8, 0x0f, 0x96, 0x1f, 0x0e, 0x71, 0xf3, 0xa9, 0xb5, 0x24, 0xaf, 0x60, 0x12, 0x06, 0x2f, 0xe0, 0x37, 0xa6],
try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x6C, 0x74], iterations: 1, keyLength: 20, variant: .sha1).calculate())
// P = "password", S = "salt", c = 2, dkLen = 20
XCTAssertEqual([0xea, 0x6c, 0x01, 0x4d, 0xc7, 0x2d, 0x6f, 0x8c, 0xcd, 0x1e, 0xd9, 0x2a, 0xce, 0x1d, 0x41, 0xf0, 0xd8, 0xde, 0x89, 0x57],
try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x6C, 0x74], iterations: 2, keyLength: 20, variant: .sha1).calculate())
// P = "password", S = "salt", c = 4096, dkLen = 20
XCTAssertEqual([0x4b, 0x00, 0x79, 0x01, 0xb7, 0x65, 0x48, 0x9a, 0xbe, 0xad, 0x49, 0xd9, 0x26, 0xf7, 0x21, 0xd0, 0x65, 0xa4, 0x29, 0xc1],
try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x6C, 0x74], iterations: 4096, keyLength: 20, variant: .sha1).calculate())
// P = "password", S = "salt", c = 16777216, dkLen = 20
// Commented because it takes a lot of time with Debug build to finish.
// XCTAssertEqual([0xee, 0xfe, 0x3d, 0x61, 0xcd, 0x4d, 0xa4, 0xe4, 0xe9, 0x94, 0x5b, 0x3d, 0x6b, 0xa2, 0x15, 0x8c, 0x26, 0x34, 0xe9, 0x84],
// try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x6C, 0x74], iterations: 16777216, keyLength: 20, variant: .sha1).calculate())
// P = "passwordPASSWORDpassword", S = "saltSALTsaltSALTsaltSALTsaltSALTsalt", c = 4096, dkLen = 25
XCTAssertEqual([0x3d, 0x2e, 0xec, 0x4f, 0xe4, 0x1c, 0x84, 0x9b, 0x80, 0xc8, 0xd8, 0x36, 0x62, 0xc0, 0xe4, 0x4a, 0x8b, 0x29, 0x1a, 0x96, 0x4c, 0xf2, 0xf0, 0x70, 0x38],
try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64, 0x50, 0x41, 0x53, 0x53, 0x57, 0x4F, 0x52, 0x44, 0x70, 0x61, 0x73, 0x73, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x6C, 0x74, 0x53, 0x41, 0x4C, 0x54, 0x73, 0x61, 0x6C, 0x74, 0x53, 0x41, 0x4C, 0x54, 0x73, 0x61, 0x6C, 0x74, 0x53, 0x41, 0x4C, 0x54, 0x73, 0x61, 0x6C, 0x74, 0x53, 0x41, 0x4C, 0x54, 0x73, 0x61, 0x6C, 0x74], iterations: 4096, keyLength: 25, variant: .sha1).calculate())
// P = "pass\0word", S = "sa\0lt", c = 4096, dkLen = 16
XCTAssertEqual([0x56, 0xfa, 0x6a, 0xa7, 0x55, 0x48, 0x09, 0x9d, 0xcc, 0x37, 0xd7, 0xf0, 0x34, 0x25, 0xe0, 0xc3],
try PKCS5.PBKDF2(password: [0x70, 0x61, 0x73, 0x73, 0x00, 0x77, 0x6F, 0x72, 0x64], salt: [0x73, 0x61, 0x00, 0x6C, 0x74], iterations: 4096, keyLength: 16, variant: .sha1).calculate())
}
func testPBKDF2Length() {
let password: Array<UInt8> = Array("s33krit".utf8)
let salt: Array<UInt8> = Array("nacl".utf8)
let value = try! PKCS5.PBKDF2(password: password, salt: salt, iterations: 2, keyLength: 8, variant: .sha1).calculate()
XCTAssert(value.toHexString() == "a53cf3df485e5cd9", "PBKDF2 fail")
}
func testPerformance() {
let password: Array<UInt8> = Array("s33krit".utf8)
let salt: Array<UInt8> = Array("nacl".utf8)
measureMetrics([XCTPerformanceMetric_WallClockTime], automaticallyStartMeasuring: true, for: { () -> Void in
let _ = try! PKCS5.PBKDF2(password: password, salt: salt, iterations: 65536, keyLength: 32, variant: .sha1).calculate()
})
}
}
| mit |
vknabel/Taps | Tests/TapsTests/ReadmeExamples.swift | 1 | 837 | import RxSwift
@testable import Taps
import Dispatch
fileprivate func async(_ call: @escaping () -> Void) {
DispatchQueue.global().async {
call() // Todo: Really async operation
}
}
fileprivate func someInt() -> Int {
return 1
}
fileprivate struct MyService {
func someObservable() -> Observable<Int> {
return Observable.of(3, 4, 3)
}
}
func describeReadmeExamples(t: Taps) {
t.test("asynchronous test") { t in
async {
t.pass()
t.end()
}
}
t.test("synchronous test", plan: 1) { t in
t.equal(someInt(), 1)
}
t.rx.test("reactive test") { (t: Test) -> Observable<Int> in
let myService = MyService()
return myService.someObservable()
.test(
onNext: t.equal(to: 3, "should only emit 3"),
onError: t.fail(with: "should not throw")
)
}
}
| mit |
carlospaelinck/pokebattle | PokéBattle/PokémonInstance.swift | 1 | 4574 | //
// PokémonInstance.swift
// PokéBattle
//
// Created by Carlos Paelinck on 4/11/16.
// Copyright © 2016 Carlos Paelinck. All rights reserved.
//
import Foundation
class PokémonInstance: NSObject, NSCoding {
var basePokémon: Pokémon
var level: Int
var nature: Nature
var IVs: Stats
var EVs: Stats
var attacks: [Attack]
init(basePokémon: Pokémon, level: Int, nature: Nature, IVs: Stats, EVs: Stats, attacks: [Attack]) {
self.basePokémon = basePokémon
self.level = level
self.nature = nature
self.IVs = IVs
self.EVs = EVs
self.attacks = attacks
}
required init?(coder aDecoder: NSCoder) {
basePokémon = aDecoder.decodeObjectForKey("basePokémon") as! Pokémon
level = aDecoder.decodeObjectForKey("level") as! Int
IVs = aDecoder.decodeObjectForKey("IVs") as! Stats
EVs = aDecoder.decodeObjectForKey("EVs") as! Stats
attacks = aDecoder.decodeObjectForKey("attacks") as! [Attack]
let natureValue = aDecoder.decodeObjectForKey("nature") as! Int
nature = Nature(rawValue: natureValue)!
}
func encodeWithCoder(aCoder: NSCoder) {
aCoder.encodeObject(basePokémon, forKey: "basePokémon")
aCoder.encodeObject(level, forKey: "level")
aCoder.encodeObject(IVs, forKey: "IVs")
aCoder.encodeObject(EVs, forKey: "EVs")
aCoder.encodeObject(attacks, forKey: "attacks")
aCoder.encodeObject(nature.rawValue, forKey: "nature")
}
var hitPoints: Double {
let base = 2 * Double(basePokémon.stats.hitPoints) + Double(IVs.hitPoints) + floor(Double(EVs.hitPoints) / 4.0)
return floor((floor(base * Double(level)) / 100) + Double(level) + 10.0)
}
var attack: Double {
let natureMultiplier: Double
switch nature {
case .Adamant, .Brave, .Lonely, .Naughty:
natureMultiplier = 1.1
case .Bold, .Modest, .Calm, .Timid:
natureMultiplier = 0.9
default: natureMultiplier = 1
}
let base = 2 * Double(basePokémon.stats.attack) + Double(IVs.attack) + floor(Double(EVs.attack) / 4.0)
return floor((floor((base * Double(level)) / 100) + 5.0) * natureMultiplier)
}
var defense: Double {
let natureMultiplier: Double
switch nature {
case .Bold, .Relaxed, .Impish, .Lax:
natureMultiplier = 1.1
case .Lonely, .Hasty, .Mild, .Gentle:
natureMultiplier = 0.9
default: natureMultiplier = 1
}
let base = 2 * Double(basePokémon.stats.defense) + Double(IVs.defense) + floor(Double(EVs.defense) / 4.0)
return floor((floor((base * Double(level)) / 100) + 5.0) * natureMultiplier)
}
var specialAttack: Double {
let natureMultiplier: Double
switch nature {
case .Modest, .Mild, .Quiet, .Rash:
natureMultiplier = 1.1
case .Adamant, .Jolly, .Impish, .Careful:
natureMultiplier = 0.9
default: natureMultiplier = 1
}
let base = 2 * Double(basePokémon.stats.specialAttack) + Double(IVs.specialAttack) + floor(Double(EVs.specialAttack) / 4.0)
return floor((floor((base * Double(level)) / 100) + 5.0) * natureMultiplier)
}
var specialDefense: Double {
let natureMultiplier: Double
switch nature {
case .Calm, .Careful, .Sassy, .Gentle:
natureMultiplier = 1.1
case .Naughty, .Naive, .Rash, .Lax:
natureMultiplier = 0.9
default: natureMultiplier = 1
}
let base = 2 * Double(basePokémon.stats.specialDefense) + Double(IVs.specialDefense) + floor(Double(EVs.specialDefense) / 4.0)
return floor((floor((base * Double(level)) / 100) + 5.0) * natureMultiplier)
}
var speed: Double {
let natureMultiplier: Double
switch nature {
case .Timid, .Jolly, .Hasty, .Naive:
natureMultiplier = 1.1
case .Quiet, .Sassy, .Brave, .Relaxed:
natureMultiplier = 0.9
default: natureMultiplier = 1
}
let base = 2 * Double(basePokémon.stats.speed) + Double(IVs.speed) + floor(Double(EVs.speed) / 4.0)
return floor((floor((base * Double(level)) / 100) + 5.0) * natureMultiplier)
}
override var description: String {
return "\(basePokémon.name) @ Lv.\(level)\n---\nHP: \(hitPoints)\nAtk: \(attack)\nDef: \(defense)\nSpAtk: \(specialAttack)\nSpDef: \(specialDefense)\nSpd: \(speed)"
}
} | mit |
AlvinL33/TownHunt | TownHunt-1.9/TownHunt/PinPackMapViewController.swift | 1 | 2300 | //
// PinPackMapViewController.swift
// TownHunt
//
// Created by Alvin Lee on 07/04/2017.
// Copyright © 2017 LeeTech. All rights reserved.
//
import MapKit
import CoreData
import Foundation
class PinPackMapViewController: UIViewController {
override func viewDidLoad() {
super.viewDidLoad()
// Do any additional setup after loading the view.
}
override func didReceiveMemoryWarning() {
super.didReceiveMemoryWarning()
// Dispose of any resources that can be recreated.
}
// Returns an array of Pin Location objects
func getListOfPinLocations(packData: [String: Any]) -> [PinLocation] {
let packDetailPinList = packData["Pins"] as! [[String:String]]
var gamePins: [PinLocation] = []
if packDetailPinList.isEmpty {
print(packDetailPinList)
print("No Pins in pack")
} else{
print("There are pins in the loaded pack")
for pin in packDetailPinList{
let pinToAdd = PinLocation(title: pin["Title"]!, hint: pin["Hint"]!, codeword: pin["Codeword"]!, coordinate: CLLocationCoordinate2D(latitude: Double(pin["CoordLatitude"]!)!, longitude: Double(pin["CoordLongitude"]!)!), pointVal: Int(pin["PointValue"]!)!)
gamePins.append(pinToAdd)
}
}
return gamePins
}
// Returns all of the pack data loaded from local storage
func loadPackFromFile(filename: String, userPackDictName: String, selectedPackKey: String, userID: String) -> [String : AnyObject]{
var packData: [String : AnyObject] = [:]
let defaults = UserDefaults.standard
let localStorageHandler = LocalStorageHandler(fileName: filename, subDirectory: "User-\(userID)-Packs", directory: .documentDirectory)
let retrievedJSON = localStorageHandler.retrieveJSONData()
packData = retrievedJSON as! [String : AnyObject]
return packData
}
func displayAlertMessage(alertTitle: String, alertMessage: String){
let alertCon = UIAlertController(title: alertTitle, message: alertMessage, preferredStyle: .alert)
alertCon.addAction(UIAlertAction(title: "Ok", style: .default, handler: nil))
self.present(alertCon, animated: true, completion: nil)
}
}
| apache-2.0 |
arnaudbenard/npm-stats | Pods/Charts/Charts/Classes/Data/CandleChartDataSet.swift | 19 | 3016 | //
// CandleChartDataSet.swift
// Charts
//
// Created by Daniel Cohen Gindi on 4/3/15.
//
// Copyright 2015 Daniel Cohen Gindi & Philipp Jahoda
// A port of MPAndroidChart for iOS
// Licensed under Apache License 2.0
//
// https://github.com/danielgindi/ios-charts
//
import Foundation
import CoreGraphics
import UIKit
public class CandleChartDataSet: BarLineScatterCandleChartDataSet
{
/// the width of the candle-shadow-line in pixels.
/// :default: 3.0
public var shadowWidth = CGFloat(1.5)
/// the space between the candle entries
/// :default: 0.1 (10%)
private var _bodySpace = CGFloat(0.1)
/// the color of the shadow line
public var shadowColor: UIColor?
/// use candle color for the shadow
public var shadowColorSameAsCandle = false
/// color for open <= close
public var decreasingColor: UIColor?
/// color for open > close
public var increasingColor: UIColor?
/// Are decreasing values drawn as filled?
public var decreasingFilled = false
/// Are increasing values drawn as filled?
public var increasingFilled = true
public override init(yVals: [ChartDataEntry]?, label: String?)
{
super.init(yVals: yVals, label: label)
}
internal override func calcMinMax(#start: Int, end: Int)
{
if (yVals.count == 0)
{
return
}
var entries = yVals as! [CandleChartDataEntry]
var endValue : Int
if end == 0
{
endValue = entries.count - 1
}
else
{
endValue = end
}
_lastStart = start
_lastEnd = end
_yMin = entries[start].low
_yMax = entries[start].high
for (var i = start + 1; i <= endValue; i++)
{
var e = entries[i]
if (e.low < _yMin)
{
_yMin = e.low
}
if (e.high > _yMax)
{
_yMax = e.high
}
}
}
/// the space that is left out on the left and right side of each candle,
/// :default: 0.1 (10%), max 0.45, min 0.0
public var bodySpace: CGFloat
{
set
{
_bodySpace = newValue
if (_bodySpace < 0.0)
{
_bodySpace = 0.0
}
if (_bodySpace > 0.45)
{
_bodySpace = 0.45
}
}
get
{
return _bodySpace
}
}
/// Is the shadow color same as the candle color?
public var isShadowColorSameAsCandle: Bool { return shadowColorSameAsCandle }
/// Are increasing values drawn as filled?
public var isIncreasingFilled: Bool { return increasingFilled; }
/// Are decreasing values drawn as filled?
public var isDecreasingFilled: Bool { return decreasingFilled; }
} | mit |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.