Dataset Viewer
Auto-converted to Parquet
Search is not available for this dataset
image
imagewidth (px)
2.4k
3.2k

Author: zahrag

BIOSCAN-1M

Alt Text

Overview

The BIOSCAN-1M dataset offers researchers detailed information about insects, with each record containing four primary attributes:

  • DNA Barcode Sequence
  • Barcode Index Number (BIN)
  • Biological Taxonomy Classification
  • RGB image

Citation

If you make use of the BIOSCAN-1M dataset and/or its code repository, please cite the following paper:

cite as:

@inproceedings{gharaee2023step,
    title={A Step Towards Worldwide Biodiversity Assessment: The {BIOSCAN-1M} Insect Dataset},
    booktitle={Advances in Neural Information Processing Systems},
    author={Gharaee, Z. and Gong, Z. and Pellegrino, N. and Zarubiieva, I. and Haurum, J. B. and Lowe, S. C. and McKeown, J. T. A. and Ho, C. Y. and McLeod, J. and Wei, Y. C. and Agda, J. and Ratnasingham, S. and Steinke, D. and Chang, A. X. and Taylor, G. W. and Fieguth, P.},
    editor={A. Oh and T. Neumann and A. Globerson and K. Saenko and M. Hardt and S. Levine},
    pages={43593--43619},
    publisher={Curran Associates, Inc.},
    year={2023},
    volume={36},
    url={https://proceedings.neurips.cc/paper_files/paper/2023/file/87dbbdc3a685a97ad28489a1d57c45c1-Paper-Datasets_and_Benchmarks.pdf},
}

Dataset Access

To clone this dataset repository, use the following command:

GIT_LFS_SKIP_SMUDGE=1 git clone https://huggingface.co/datasets/bioscan-ml/BIOSCAN-1M

📦 Resources and Access

BIOSCAN-1M Dataset Record

I. DNA barcode sequence

The provided DNA barcode sequence showcases the arrangement of nucleotides:

  • Adenine (A): Red
  • Thymine (T): Blue
  • Cytosine (C): Green
  • Guanine (G): Yellow
TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAACCAGGAATTTTTA ...
Alt Text

II. Barcode Index Number (BIN)

BINs, acting as an alternative to Linnean names, provide a genetic-centric classification for organisms, emphasizing the significance of genetic code in taxonomy.

BOLD:AER5166
Alt Text

III. Biological taxonomy ranking annotations

Taxonomic group ranking annotations categorize organisms hierarchically based on evolutionary relationships. It organizes species into groups based on shared characteristics and genetic relatedness.

Alt Text

IV. RGB image

Original insect images from 16 most densly populated orders of the BIOSCAN-1M Insect dataset. The numbers below each image identify the number of images in each class, and clearly illustrate the degree of class imbalance in the BIOSCAN-1M Insect dataset.

Diptera: 896,234 Hymenoptera: 89,311 Coleoptera: 47,328 Hemiptera: 46,970
Lepidoptera: 32,538 Psocodea: 9,635 Thysanoptera: 2,088 Trichoptera: 1,296
Orthoptera: 1,057 Blattodea: 824 Neuroptera: 676 Ephemeroptera: 96
Dermaptera: 66 Archaeognatha: 63 Plecoptera: 30 Embioptera: 6

Class Distribution

Class distribution and class imbalance in the BIOSCAN-1M Insect dataset. Orders (top) and diptera families (bottom). The image demonstrates that class imbalance is an inherent characteristic within the insect community.

Alt Text
Downloads last month
339