hexsha
stringlengths 40
40
| size
int64 3
1.05M
| ext
stringclasses 163
values | lang
stringclasses 53
values | max_stars_repo_path
stringlengths 3
945
| max_stars_repo_name
stringlengths 4
112
| max_stars_repo_head_hexsha
stringlengths 40
78
| max_stars_repo_licenses
listlengths 1
10
| max_stars_count
float64 1
191k
⌀ | max_stars_repo_stars_event_min_datetime
stringlengths 24
24
⌀ | max_stars_repo_stars_event_max_datetime
stringlengths 24
24
⌀ | max_issues_repo_path
stringlengths 3
945
| max_issues_repo_name
stringlengths 4
113
| max_issues_repo_head_hexsha
stringlengths 40
78
| max_issues_repo_licenses
listlengths 1
10
| max_issues_count
float64 1
116k
⌀ | max_issues_repo_issues_event_min_datetime
stringlengths 24
24
⌀ | max_issues_repo_issues_event_max_datetime
stringlengths 24
24
⌀ | max_forks_repo_path
stringlengths 3
945
| max_forks_repo_name
stringlengths 4
113
| max_forks_repo_head_hexsha
stringlengths 40
78
| max_forks_repo_licenses
listlengths 1
10
| max_forks_count
float64 1
105k
⌀ | max_forks_repo_forks_event_min_datetime
stringlengths 24
24
⌀ | max_forks_repo_forks_event_max_datetime
stringlengths 24
24
⌀ | content
stringlengths 3
1.05M
| avg_line_length
float64 1
966k
| max_line_length
int64 1
977k
| alphanum_fraction
float64 0
1
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ed3803151a34a2ac25a5fb042d81590537246662 | 804 | pl | Perl | examples/poe.pl | greg-kennedy/protocol-websocket | 3bf65a13a1d037030fc441a69582a61644df0e99 | [
"Artistic-1.0"
] | 17 | 2015-03-31T18:59:34.000Z | 2020-03-13T21:34:25.000Z | examples/poe.pl | greg-kennedy/protocol-websocket | 3bf65a13a1d037030fc441a69582a61644df0e99 | [
"Artistic-1.0"
] | 27 | 2015-02-12T06:32:42.000Z | 2021-01-13T14:40:06.000Z | examples/poe.pl | greg-kennedy/protocol-websocket | 3bf65a13a1d037030fc441a69582a61644df0e99 | [
"Artistic-1.0"
] | 21 | 2015-01-06T05:19:23.000Z | 2021-03-19T06:13:42.000Z | #!/usr/bin/env perl
use warnings;
use strict;
use Protocol::WebSocket::Handshake::Server;
use Protocol::WebSocket::Frame;
use POE qw(Component::Server::TCP);
my $hs = Protocol::WebSocket::Handshake::Server->new;
my $frame = Protocol::WebSocket::Frame->new;
POE::Component::Server::TCP->new(
Port => 3000,
ClientFilter => 'POE::Filter::Stream',
ClientInput => sub {
my $chunk = $_[ARG0];
if (!$hs->is_done) {
$hs->parse($chunk);
if ($hs->is_done) {
$_[HEAP]{client}->put($hs->to_string);
}
return;
}
$frame->append($chunk);
while (my $message = $frame->next) {
$_[HEAP]{client}->put($frame->new($message)->to_bytes);
}
}
);
POE::Kernel->run;
| 20.615385 | 67 | 0.532338 |
ed3b0cc11b33344ee6b7fb5c4ed823342de81b57 | 3,455 | t | Perl | S12-introspection/WHAT.t | b2gills/roast | 4b689b3c9cc2642fdeb8176a24415ec1540f013f | [
"Artistic-2.0"
] | null | null | null | S12-introspection/WHAT.t | b2gills/roast | 4b689b3c9cc2642fdeb8176a24415ec1540f013f | [
"Artistic-2.0"
] | null | null | null | S12-introspection/WHAT.t | b2gills/roast | 4b689b3c9cc2642fdeb8176a24415ec1540f013f | [
"Artistic-2.0"
] | null | null | null | use v6;
use Test;
plan 37;
# =head1 Introspection
# WHAT the type object of the type
my class A is Array {};
my class H is Hash {};
{
my $a;
ok $a.WHAT === Any, '$a default is Any';
my @a;
ok @a.WHAT === Array, '@a default is Array';
ok @a[0].WHAT === Any, '@a[0] default is Any';
my %a;
ok %a.WHAT === Hash, '%a default is Hash';
ok %a<a>.WHAT === Any, '%a<a> default is Any';
} #5
{
my $a = Array.new;
ok $a.WHAT === Array, 'Array.new default is Array';
ok $a[0].WHAT === Any, 'Array.new[0] default is Any';
my $h = Hash.new;
ok $h.WHAT === Hash, 'Hash.new default is Hash';
ok $h<a>.WHAT === Any, 'Hash.new<a> default is Any';
} #4
{
my $a = A.new;
ok $a.WHAT === A, 'A.new default is A';
ok $a[0].WHAT === Any, 'A.new[0] default is Any';
my $h = H.new;
#?niecza todo
ok $h.WHAT === H, 'H.new default is Hash';
ok $h<a>.WHAT === Any, 'H.new<a> default is Any';
} #4
#?niecza skip "no typed support"
{
my Int $a;
ok $a.WHAT === Int, 'Int $a default is Int';
my Int @a;
ok @a.WHAT === Array[Int], 'Int @a default is Array[Int]';
ok @a[0].WHAT === Int, 'Int @a[0] default is Int';
my Int %a;
ok %a.WHAT === Hash[Int], 'Int %a default is Hash[Int]';
ok %a<a>.WHAT === Int, 'Int %a<a> default is Int';
} #5
#?niecza skip "no typed support"
{
my $a of Int;
ok $a.WHAT === Int, '$a of Int default is Int';
my @a of Int;
ok @a.WHAT === Array[Int], '@a of Int default is Array[Int]';
ok @a[0].WHAT === Int, '@a[0] of Int default is Int';
my %a of Int;
ok %a.WHAT === Hash[Int], '%a of Int default is Hash[Int]';
ok %a<a>.WHAT === Int, '%a<a> of Int default is Int';
} #5
#?niecza skip "no typed support"
{
my Int %a{Str};
ok %a.WHAT === Hash[Int,Str], 'Int %a{Str} default is Hash[Int,Str]';
ok %a<a>.WHAT === Int, 'Int %a{Str}<a> default is Int';
} #2
#?niecza skip "no typed support"
{
my %a{Str} of Int;
ok %a.WHAT === Hash[Int,Str], '%a{Str} of Int default is Hash[Int,Str]';
ok %a<a>.WHAT === Int, '%a{Str}<a> of Int default is Int';
} #2
#?niecza skip "no typed support"
{
my $a = Array[Int].new;
ok $a.WHAT === Array[Int], 'Array[Int].new default is Array';
#?rakudo skip "Foo[Int].new on scalars fails"
ok $a[0].WHAT === Int, 'Array[Int].new[0] default is Int';
my $h = Hash[Int].new;
ok $h.WHAT === Hash[Int], 'Hash[Int].new default is Hash[Int]';
#?rakudo todo "Foo[Int].new on scalars fails"
ok $h<a>.WHAT === Int, 'Hash[Int].new<a> default is Int';
} #4
#?niecza skip "no typed support"
{
my $a = A[Int].new;
ok $a.WHAT === A[Int], 'A[Int].new default is A[Int]';
#?rakudo skip "Foo[Int].new on scalars fails"
ok $a[0].WHAT === Int, 'A[Int].new[0] default is Int';
my $h = H[Int].new;
ok $h.WHAT === H[Int], 'H[Int].new default is H[Int]';
#?rakudo todo "Foo[Int].new on scalars fails"
ok $h<a>.WHAT === Int, 'H[Int].new<a> default is Int';
} #4
#?niecza skip "no typed support"
{
my $h = H[Int,Str].new;
ok $h.WHAT === H[Int,Str], 'H[Int,Str].new default is H[Int,Str]';
#?rakudo todo "Foo[Int,Str].new on scalars fails"
ok $h<a>.WHAT === Int, 'H[Int,Str].new<a> default is Int';
} #2
# vim: ft=perl6
| 30.307018 | 79 | 0.518669 |
ed97a2c5c9ae3d8b1c1196694e4dbc22f6336a33 | 86 | t | Perl | t/00_compile.t | wu-lee/p5-cgi-emulate-psgi | ff7906d763e23eec161c24c70052891903693eea | [
"Artistic-1.0"
] | 6 | 2015-02-28T08:34:43.000Z | 2021-03-24T16:34:16.000Z | t/00_compile.t | wu-lee/p5-cgi-emulate-psgi | ff7906d763e23eec161c24c70052891903693eea | [
"Artistic-1.0"
] | 4 | 2016-02-16T15:14:46.000Z | 2017-05-04T22:07:25.000Z | t/00_compile.t | wu-lee/p5-cgi-emulate-psgi | ff7906d763e23eec161c24c70052891903693eea | [
"Artistic-1.0"
] | 4 | 2015-07-21T15:08:35.000Z | 2018-01-14T06:39:21.000Z | use strict;
use warnings;
use Test::More;
use_ok 'CGI::Emulate::PSGI';
done_testing;
| 12.285714 | 28 | 0.732558 |
ed7917199ec289516d2d46251d3090cfc4a12c48 | 110 | t | Perl | t/test_parseopt.dash.t | chneukirchen/parseopt | be241590fb8a71e611d7f981fa22de4ada7acdf2 | [
"CC0-1.0"
] | 1 | 2018-07-07T14:05:43.000Z | 2018-07-07T14:05:43.000Z | t/test_parseopt.dash.t | chneukirchen/parseopt | be241590fb8a71e611d7f981fa22de4ada7acdf2 | [
"CC0-1.0"
] | null | null | null | t/test_parseopt.dash.t | chneukirchen/parseopt | be241590fb8a71e611d7f981fa22de4ada7acdf2 | [
"CC0-1.0"
] | null | null | null | #!/bin/sh -e
if sh=$(command -v dash); then
exec $sh t/test_parseopt.sh
else
echo "Bail out! no dash"
fi
| 13.75 | 30 | 0.645455 |
ed7fed9a0d5de3f4c28ef53208abe9951266fe8d | 6,475 | pm | Perl | cloud/azure/database/mysql/mode/connections.pm | Maxime-Pegard/centreon-plugins | 7d35c9827d647a5107b22df914d0dd502e4dc6f0 | [
"Apache-2.0"
] | 316 | 2015-01-18T20:37:21.000Z | 2022-03-27T00:20:35.000Z | cloud/azure/database/mysql/mode/connections.pm | Maxime-Pegard/centreon-plugins | 7d35c9827d647a5107b22df914d0dd502e4dc6f0 | [
"Apache-2.0"
] | 2,333 | 2015-04-26T19:10:19.000Z | 2022-03-31T15:35:21.000Z | cloud/azure/database/mysql/mode/connections.pm | Maxime-Pegard/centreon-plugins | 7d35c9827d647a5107b22df914d0dd502e4dc6f0 | [
"Apache-2.0"
] | 371 | 2015-01-18T20:37:23.000Z | 2022-03-22T10:10:16.000Z | #
# Copyright 2021 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package cloud::azure::database::mysql::mode::connections;
use base qw(cloud::azure::custom::mode);
use strict;
use warnings;
sub get_metrics_mapping {
my ($self, %options) = @_;
my $metrics_mapping = {
'active_connections' => {
'output' => 'Active Connections',
'label' => 'connections-active',
'nlabel' => 'azmysql.connections.active.count',
'unit' => '',
'min' => '0'
},
'connections_failed' => {
'output' => 'Failed Connections',
'label' => 'connections-failed',
'nlabel' => 'azmysql.connections.failed.count',
'unit' => '',
'min' => '0'
},
'aborted_connections' => {
'output' => 'Aborted Connections',
'label' => 'connections-aborted',
'nlabel' => 'azmysql.connections.aborted.count',
'unit' => '',
'min' => '0'
},
'total_connections' => {
'output' => 'Total Connections',
'label' => 'connections-total',
'nlabel' => 'azmysql.connections.total.count',
'unit' => '',
'min' => '0'
}
};
return $metrics_mapping;
}
sub new {
my ($class, %options) = @_;
my $self = $class->SUPER::new(package => __PACKAGE__, %options, force_new_perfdata => 1);
bless $self, $class;
$options{options}->add_options(arguments => {
'filter-metric:s' => { name => 'filter_metric' },
'resource:s' => { name => 'resource' },
'resource-group:s' => { name => 'resource_group' },
'resource-type:s' => { name => 'resource_type' }
});
return $self;
}
sub check_options {
my ($self, %options) = @_;
$self->SUPER::check_options(%options);
if (!defined($self->{option_results}->{resource}) || $self->{option_results}->{resource} eq '') {
$self->{output}->add_option_msg(short_msg => 'Need to specify either --resource <name> with --resource-group option or --resource <id>.');
$self->{output}->option_exit();
}
if (!defined($self->{option_results}->{resource_type}) || $self->{option_results}->{resource_type} eq '') {
$self->{output}->add_option_msg(short_msg => 'Need to specify --resource-type option');
$self->{output}->option_exit();
}
my $resource = $self->{option_results}->{resource};
my $resource_group = defined($self->{option_results}->{resource_group}) ? $self->{option_results}->{resource_group} : '';
my $resource_type = $self->{option_results}->{resource_type};
if ($resource =~ /^\/subscriptions\/.*\/resourceGroups\/(.*)\/providers\/Microsoft\.DBforMySQL\/(.*)\/(.*)$/) {
$resource_group = $1;
$resource_type = $2;
$resource = $3;
}
$self->{az_resource} = $resource;
$self->{az_resource_group} = $resource_group;
$self->{az_resource_type} = $resource_type;
$self->{az_resource_namespace} = 'Microsoft.DBforMySQL';
$self->{az_timeframe} = defined($self->{option_results}->{timeframe}) ? $self->{option_results}->{timeframe} : 900;
$self->{az_interval} = defined($self->{option_results}->{interval}) ? $self->{option_results}->{interval} : 'PT5M';
$self->{az_aggregations} = ['Total'];
if (defined($self->{option_results}->{aggregation})) {
$self->{az_aggregations} = [];
foreach my $stat (@{$self->{option_results}->{aggregation}}) {
if ($stat ne '') {
push @{$self->{az_aggregations}}, ucfirst(lc($stat));
}
}
}
my $resource_mapping = {
'servers' => [ 'active_connections', 'connections_failed' ],
'flexibleServers' => [ 'active_connections', 'aborted_connections', 'total_connections' ]
};
my $metrics_mapping_transformed;
foreach my $metric_type (@{$resource_mapping->{$resource_type}}) {
$metrics_mapping_transformed->{$metric_type} = $self->{metrics_mapping}->{$metric_type};
}
foreach my $metric (keys %{$metrics_mapping_transformed}) {
next if (defined($self->{option_results}->{filter_metric}) && $self->{option_results}->{filter_metric} ne ''
&& $metric !~ /$self->{option_results}->{filter_metric}/);
push @{$self->{az_metrics}}, $metric;
}
}
1;
__END__
=head1 MODE
Check Azure Database for MySQL connections status.
Example:
Using resource name :
perl centreon_plugins.pl --plugin=cloud::azure::database::mysql::plugin --mode=connections --custommode=api
--resource=<db_id> --resource-group=<resourcegroup_id> --aggregation='total'
--warning-connections-active='1000' --critical-connections-active='2000'
Using resource id :
perl centreon_plugins.pl --plugin=cloud::azure::integration::servicebus::plugin --mode=connections --custommode=api
--resource='/subscriptions/<subscription_id>/resourceGroups/<resourcegroup_id>/providers/Microsoft.DBforMySQL/servers/<db_id>'
--aggregation='total' --warning-connections-active='1000' --critical-connections-active='2000'
Default aggregation: 'total' / 'average', 'minimum' and 'maximum' are valid.
=over 8
=item B<--resource>
Set resource name or id (Required).
=item B<--resource-group>
Set resource group (Required if resource's name is used).
=item B<--resource-type>
Set resource type (Default: 'servers'). Can be 'servers', 'flexibleServers'.
=item B<--warning-*>
Warning threshold where '*' can be:
'connections-active', 'connections-failed', 'connections-aborted',
'connections-total'.
=item B<--critical-*>
Critical threshold where '*' can be:
'connections-active', 'connections-failed', 'connections-aborted',
'connections-total'.
=back
=cut
| 34.259259 | 146 | 0.625174 |
ed92ed15941efda30ca110f0ba9d7aebda86e149 | 3,524 | t | Perl | cgview_comparison_tool/lib/bioperl-1.2.3/t/Perl.t | kellyhuang21/CircularGenomeVizApp | 4f241aded41258285c7b063cb9728fea459f6400 | [
"MIT"
] | null | null | null | cgview_comparison_tool/lib/bioperl-1.2.3/t/Perl.t | kellyhuang21/CircularGenomeVizApp | 4f241aded41258285c7b063cb9728fea459f6400 | [
"MIT"
] | null | null | null | cgview_comparison_tool/lib/bioperl-1.2.3/t/Perl.t | kellyhuang21/CircularGenomeVizApp | 4f241aded41258285c7b063cb9728fea459f6400 | [
"MIT"
] | null | null | null | # This is -*-Perl-*- code
## Bioperl Test Harness Script for Modules
##
# $Id: Perl.t,v 1.6 2002/12/09 15:45:03 jason Exp $
# Before `make install' is performed this script should be runnable with
# `make test'. After `make install' it should work as `perl test.t'
use strict;
use vars qw($NUMTESTS $DEBUG $BIODBTESTS);
$DEBUG = $ENV{'BIOPERLDEBUG'} || 0;
my $error;
BEGIN {
# to handle systems with no installed Test module
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
eval { require Test; };
$error = 0;
if( $@ ) {
use lib 't';
}
use Test;
$NUMTESTS = 14;
$BIODBTESTS = 5;
plan tests => $NUMTESTS;
eval { require IO::String };
if( $@ ) {
print STDERR "IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping some tests.\n";
for( 1..$BIODBTESTS ) {
skip("IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping some tests",1);
}
$error = 1;
}
}
END {
# clean up after oneself
unlink ( 'Perltmp' );
}
#use Bio::Perl qw( read_sequence
# read_all_sequences
# write_sequence
# new_sequence
# get_sequence translate
# translate_as_string);
use Bio::Perl;
## End of black magic.
##
## Insert additional test code below but remember to change
## the print "1..x\n" in the BEGIN block to reflect the
## total number of tests that will be run.
my ($seq_object,$filename,@seq_object_array);
unless ( $error ) {
# swissprot
eval {
ok ($seq_object = get_sequence('swissprot',"ROA1_HUMAN"));
};
if ($@) {
if($DEBUG) {
warn "Warning: Couldn't connect to SWISS-PROT! Do you have network access?\n";
}
skip('no network access',1);
}
# embl
eval {
ok ($seq_object = get_sequence('embl',"BUM"));
};
if ($@) {
if($DEBUG ) {
warn "Warning: Couldn't connect to EMBL! Do you have network access?\n";
}
skip('no network access',1);
}
# genbank
eval {
ok ($seq_object = get_sequence('genbank',"AI129902"));
};
if ($@) {
if($DEBUG) {
warn "Warning: Couldn't connect to GenBank! Do you have network access?\n";
}
skip( 'no network access',1);
}
# refseq
eval {
ok ($seq_object = get_sequence('genbank',"NM_006732"));
};
if ($@) {
if( $DEBUG ) {
warn "Warning: Couldn't connect to RefSeq! Do you have network access?\n";
}
skip('no network access',1);
}
# genbank
eval {
ok ($seq_object = get_sequence('genpept',"AAC06201"));
};
if ($@) {
if($DEBUG) {
warn "Warning: Couldn't connect to GenPept! Do you have network access?\n";
}
skip( 'no network access',1);
}
}
# will guess file format from extension
$filename = 't/data/cysprot1.fa';
ok ($seq_object = read_sequence($filename));
# forces genbank format
$filename = 't/data/AF165282.gb';
ok ($seq_object = read_sequence($filename,'genbank'));
# reads an array of sequences
$filename = 't/data/amino.fa';
ok (@seq_object_array = read_all_sequences($filename,'fasta'), 2);
$filename = 'Perltmp';
ok write_sequence(">$filename",'genbank',$seq_object);
ok ($seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232"));
my $trans;
ok ($trans = translate($seq_object));
ok ($trans = translate("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
ok ($trans = translate_as_string($seq_object));
ok ($trans = translate_as_string("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
| 24.643357 | 115 | 0.627128 |
ed93a6c289f467b93d0f9aad980e2793c01ed14d | 214 | pl | Perl | silk-src/src/rwaddrcount/tests/rwaddrcount-help.pl | mjschultz/netsa-pkg | 07bf4ff29a73ebc0f58e4aa27d3ad6b1dee7fc83 | [
"Apache-2.0"
] | 3 | 2018-06-01T06:55:14.000Z | 2021-11-14T22:51:04.000Z | silk-src/src/rwaddrcount/tests/rwaddrcount-help.pl | mjschultz/netsa-pkg | 07bf4ff29a73ebc0f58e4aa27d3ad6b1dee7fc83 | [
"Apache-2.0"
] | 3 | 2017-07-02T17:03:34.000Z | 2021-09-09T17:05:31.000Z | silk-src/src/rwaddrcount/tests/rwaddrcount-help.pl | mjschultz/netsa-pkg | 07bf4ff29a73ebc0f58e4aa27d3ad6b1dee7fc83 | [
"Apache-2.0"
] | 4 | 2017-08-14T15:42:31.000Z | 2022-01-24T16:24:27.000Z | #! /usr/bin/perl -w
# STATUS: OK
# TEST: ./rwaddrcount --help
use strict;
use SiLKTests;
my $rwaddrcount = check_silk_app('rwaddrcount');
my $cmd = "$rwaddrcount --help";
exit (check_exit_status($cmd) ? 0 : 1);
| 17.833333 | 48 | 0.668224 |
ed976186e3623782c31608cc8bdeb22cd4de04a0 | 30,236 | pm | Perl | lib/ConditionUtils/ConditionUtilsClient.pm | Tianhao-Gu/ConditionUtils | 6ee5d4a5e1b291b0b6021cb222863e927089fcec | [
"MIT"
] | null | null | null | lib/ConditionUtils/ConditionUtilsClient.pm | Tianhao-Gu/ConditionUtils | 6ee5d4a5e1b291b0b6021cb222863e927089fcec | [
"MIT"
] | 1 | 2018-08-29T22:05:38.000Z | 2018-08-29T22:05:38.000Z | lib/ConditionUtils/ConditionUtilsClient.pm | Tianhao-Gu/ConditionUtils | 6ee5d4a5e1b291b0b6021cb222863e927089fcec | [
"MIT"
] | null | null | null | package ConditionUtils::ConditionUtilsClient;
use JSON::RPC::Client;
use POSIX;
use strict;
use Data::Dumper;
use URI;
use Bio::KBase::Exceptions;
my $get_time = sub { time, 0 };
eval {
require Time::HiRes;
$get_time = sub { Time::HiRes::gettimeofday() };
};
use Bio::KBase::AuthToken;
# Client version should match Impl version
# This is a Semantic Version number,
# http://semver.org
our $VERSION = "0.1.0";
=head1 NAME
ConditionUtils::ConditionUtilsClient
=head1 DESCRIPTION
=cut
sub new
{
my($class, $url, @args) = @_;
my $self = {
client => ConditionUtils::ConditionUtilsClient::RpcClient->new,
url => $url,
headers => [],
};
chomp($self->{hostname} = `hostname`);
$self->{hostname} ||= 'unknown-host';
#
# Set up for propagating KBRPC_TAG and KBRPC_METADATA environment variables through
# to invoked services. If these values are not set, we create a new tag
# and a metadata field with basic information about the invoking script.
#
if ($ENV{KBRPC_TAG})
{
$self->{kbrpc_tag} = $ENV{KBRPC_TAG};
}
else
{
my ($t, $us) = &$get_time();
$us = sprintf("%06d", $us);
my $ts = strftime("%Y-%m-%dT%H:%M:%S.${us}Z", gmtime $t);
$self->{kbrpc_tag} = "C:$0:$self->{hostname}:$$:$ts";
}
push(@{$self->{headers}}, 'Kbrpc-Tag', $self->{kbrpc_tag});
if ($ENV{KBRPC_METADATA})
{
$self->{kbrpc_metadata} = $ENV{KBRPC_METADATA};
push(@{$self->{headers}}, 'Kbrpc-Metadata', $self->{kbrpc_metadata});
}
if ($ENV{KBRPC_ERROR_DEST})
{
$self->{kbrpc_error_dest} = $ENV{KBRPC_ERROR_DEST};
push(@{$self->{headers}}, 'Kbrpc-Errordest', $self->{kbrpc_error_dest});
}
#
# This module requires authentication.
#
# We create an auth token, passing through the arguments that we were (hopefully) given.
{
my %arg_hash2 = @args;
if (exists $arg_hash2{"token"}) {
$self->{token} = $arg_hash2{"token"};
} elsif (exists $arg_hash2{"user_id"}) {
my $token = Bio::KBase::AuthToken->new(@args);
if (!$token->error_message) {
$self->{token} = $token->token;
}
}
if (exists $self->{token})
{
$self->{client}->{token} = $self->{token};
}
}
my $ua = $self->{client}->ua;
my $timeout = $ENV{CDMI_TIMEOUT} || (30 * 60);
$ua->timeout($timeout);
bless $self, $class;
# $self->_validate_version();
return $self;
}
=head2 get_conditions
$result = $obj->get_conditions($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.GetConditionParams
$result is a ConditionUtils.GetConditionOutput
GetConditionParams is a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
conditions has a value which is a reference to a list where each element is a string
ws_condition_set_id is a string
GetConditionOutput is a reference to a hash where the following keys are defined:
conditions has a value which is a reference to a hash where the key is a string and the value is a reference to a hash where the key is a string and the value is a reference to a list where each element is a KBaseExperiments.Factor
Factor is a reference to a hash where the following keys are defined:
factor has a value which is a string
factor_ont_ref has a value which is a string
factor_ont_id has a value which is a string
unit has a value which is a string
unit_ont_ref has a value which is a string
unit_ont_id has a value which is a string
value has a value which is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.GetConditionParams
$result is a ConditionUtils.GetConditionOutput
GetConditionParams is a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
conditions has a value which is a reference to a list where each element is a string
ws_condition_set_id is a string
GetConditionOutput is a reference to a hash where the following keys are defined:
conditions has a value which is a reference to a hash where the key is a string and the value is a reference to a hash where the key is a string and the value is a reference to a list where each element is a KBaseExperiments.Factor
Factor is a reference to a hash where the following keys are defined:
factor has a value which is a string
factor_ont_ref has a value which is a string
factor_ont_id has a value which is a string
unit has a value which is a string
unit_ont_ref has a value which is a string
unit_ont_id has a value which is a string
value has a value which is a string
=end text
=item Description
=back
=cut
sub get_conditions
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function get_conditions (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to get_conditions:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'get_conditions');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.get_conditions",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'get_conditions',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method get_conditions",
status_line => $self->{client}->status_line,
method_name => 'get_conditions',
);
}
}
=head2 file_to_condition_set
$result = $obj->file_to_condition_set($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.FileToConditionSetParams
$result is a ConditionUtils.FileToConditionSetOutput
FileToConditionSetParams is a reference to a hash where the following keys are defined:
input_shock_id has a value which is a string
input_file_path has a value which is a string
output_ws_id has a value which is a string
output_obj_name has a value which is a string
FileToConditionSetOutput is a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.FileToConditionSetParams
$result is a ConditionUtils.FileToConditionSetOutput
FileToConditionSetParams is a reference to a hash where the following keys are defined:
input_shock_id has a value which is a string
input_file_path has a value which is a string
output_ws_id has a value which is a string
output_obj_name has a value which is a string
FileToConditionSetOutput is a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
=end text
=item Description
=back
=cut
sub file_to_condition_set
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function file_to_condition_set (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to file_to_condition_set:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'file_to_condition_set');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.file_to_condition_set",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'file_to_condition_set',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method file_to_condition_set",
status_line => $self->{client}->status_line,
method_name => 'file_to_condition_set',
);
}
}
=head2 condition_set_to_tsv_file
$result = $obj->condition_set_to_tsv_file($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.ConditionSetToTsvFileParams
$result is a ConditionUtils.ConditionSetToTsvFileOutput
ConditionSetToTsvFileParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
destination_dir has a value which is a string
ws_condition_set_id is a string
ConditionSetToTsvFileOutput is a reference to a hash where the following keys are defined:
file_path has a value which is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.ConditionSetToTsvFileParams
$result is a ConditionUtils.ConditionSetToTsvFileOutput
ConditionSetToTsvFileParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
destination_dir has a value which is a string
ws_condition_set_id is a string
ConditionSetToTsvFileOutput is a reference to a hash where the following keys are defined:
file_path has a value which is a string
=end text
=item Description
=back
=cut
sub condition_set_to_tsv_file
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function condition_set_to_tsv_file (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to condition_set_to_tsv_file:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'condition_set_to_tsv_file');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.condition_set_to_tsv_file",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'condition_set_to_tsv_file',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method condition_set_to_tsv_file",
status_line => $self->{client}->status_line,
method_name => 'condition_set_to_tsv_file',
);
}
}
=head2 export_condition_set_tsv
$result = $obj->export_condition_set_tsv($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.ExportConditionSetParams
$result is a ConditionUtils.ExportOutput
ExportConditionSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.ExportConditionSetParams
$result is a ConditionUtils.ExportOutput
ExportConditionSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
=end text
=item Description
=back
=cut
sub export_condition_set_tsv
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function export_condition_set_tsv (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to export_condition_set_tsv:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'export_condition_set_tsv');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.export_condition_set_tsv",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'export_condition_set_tsv',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method export_condition_set_tsv",
status_line => $self->{client}->status_line,
method_name => 'export_condition_set_tsv',
);
}
}
=head2 export_condition_set_excel
$result = $obj->export_condition_set_excel($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.ExportConditionSetParams
$result is a ConditionUtils.ExportOutput
ExportConditionSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.ExportConditionSetParams
$result is a ConditionUtils.ExportOutput
ExportConditionSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
ws_condition_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
=end text
=item Description
=back
=cut
sub export_condition_set_excel
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function export_condition_set_excel (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to export_condition_set_excel:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'export_condition_set_excel');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.export_condition_set_excel",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'export_condition_set_excel',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method export_condition_set_excel",
status_line => $self->{client}->status_line,
method_name => 'export_condition_set_excel',
);
}
}
=head2 export_cluster_set_excel
$result = $obj->export_cluster_set_excel($params)
=over 4
=item Parameter and return types
=begin html
<pre>
$params is a ConditionUtils.ExportClusterSetParams
$result is a ConditionUtils.ExportOutput
ExportClusterSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_cluster_set_id
ws_cluster_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
</pre>
=end html
=begin text
$params is a ConditionUtils.ExportClusterSetParams
$result is a ConditionUtils.ExportOutput
ExportClusterSetParams is a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_cluster_set_id
ws_cluster_set_id is a string
ExportOutput is a reference to a hash where the following keys are defined:
shock_id has a value which is a string
=end text
=item Description
=back
=cut
sub export_cluster_set_excel
{
my($self, @args) = @_;
# Authentication: required
if ((my $n = @args) != 1)
{
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function export_cluster_set_excel (received $n, expecting 1)");
}
{
my($params) = @args;
my @_bad_arguments;
(ref($params) eq 'HASH') or push(@_bad_arguments, "Invalid type for argument 1 \"params\" (value was \"$params\")");
if (@_bad_arguments) {
my $msg = "Invalid arguments passed to export_cluster_set_excel:\n" . join("", map { "\t$_\n" } @_bad_arguments);
Bio::KBase::Exceptions::ArgumentValidationError->throw(error => $msg,
method_name => 'export_cluster_set_excel');
}
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.export_cluster_set_excel",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'export_cluster_set_excel',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method export_cluster_set_excel",
status_line => $self->{client}->status_line,
method_name => 'export_cluster_set_excel',
);
}
}
sub status
{
my($self, @args) = @_;
if ((my $n = @args) != 0) {
Bio::KBase::Exceptions::ArgumentValidationError->throw(error =>
"Invalid argument count for function status (received $n, expecting 0)");
}
my $url = $self->{url};
my $result = $self->{client}->call($url, $self->{headers}, {
method => "ConditionUtils.status",
params => \@args,
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(error => $result->error_message,
code => $result->content->{error}->{code},
method_name => 'status',
data => $result->content->{error}->{error} # JSON::RPC::ReturnObject only supports JSONRPC 1.1 or 1.O
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(error => "Error invoking method status",
status_line => $self->{client}->status_line,
method_name => 'status',
);
}
}
sub version {
my ($self) = @_;
my $result = $self->{client}->call($self->{url}, $self->{headers}, {
method => "ConditionUtils.version",
params => [],
});
if ($result) {
if ($result->is_error) {
Bio::KBase::Exceptions::JSONRPC->throw(
error => $result->error_message,
code => $result->content->{code},
method_name => 'export_cluster_set_excel',
);
} else {
return wantarray ? @{$result->result} : $result->result->[0];
}
} else {
Bio::KBase::Exceptions::HTTP->throw(
error => "Error invoking method export_cluster_set_excel",
status_line => $self->{client}->status_line,
method_name => 'export_cluster_set_excel',
);
}
}
sub _validate_version {
my ($self) = @_;
my $svr_version = $self->version();
my $client_version = $VERSION;
my ($cMajor, $cMinor) = split(/\./, $client_version);
my ($sMajor, $sMinor) = split(/\./, $svr_version);
if ($sMajor != $cMajor) {
Bio::KBase::Exceptions::ClientServerIncompatible->throw(
error => "Major version numbers differ.",
server_version => $svr_version,
client_version => $client_version
);
}
if ($sMinor < $cMinor) {
Bio::KBase::Exceptions::ClientServerIncompatible->throw(
error => "Client minor version greater than Server minor version.",
server_version => $svr_version,
client_version => $client_version
);
}
if ($sMinor > $cMinor) {
warn "New client version available for ConditionUtils::ConditionUtilsClient\n";
}
if ($sMajor == 0) {
warn "ConditionUtils::ConditionUtilsClient version is $svr_version. API subject to change.\n";
}
}
=head1 TYPES
=head2 bool
=over 4
=item Definition
=begin html
<pre>
an int
</pre>
=end html
=begin text
an int
=end text
=back
=head2 ws_condition_set_id
=over 4
=item Description
@id ws KBaseExperiments.ConditionSet
=item Definition
=begin html
<pre>
a string
</pre>
=end html
=begin text
a string
=end text
=back
=head2 ws_cluster_set_id
=over 4
=item Description
@id ws KBaseExperiments.ClusterSet
=item Definition
=begin html
<pre>
a string
</pre>
=end html
=begin text
a string
=end text
=back
=head2 GetConditionParams
=over 4
=item Description
Get condition information in a friendly format
ws_condition_set_id condition_set_ref
list<string> conditions - Optional: Which conditions should be returned. defaults to all conditions in the set
Returns {condition_label: {ontology_type(e.g. GO): [Factors]}}
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
conditions has a value which is a reference to a list where each element is a string
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
conditions has a value which is a reference to a list where each element is a string
=end text
=back
=head2 GetConditionOutput
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
conditions has a value which is a reference to a hash where the key is a string and the value is a reference to a hash where the key is a string and the value is a reference to a list where each element is a KBaseExperiments.Factor
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
conditions has a value which is a reference to a hash where the key is a string and the value is a reference to a hash where the key is a string and the value is a reference to a list where each element is a KBaseExperiments.Factor
=end text
=back
=head2 FileToConditionSetParams
=over 4
=item Description
input_shock_id and input_file_path - alternative input params,
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
input_shock_id has a value which is a string
input_file_path has a value which is a string
output_ws_id has a value which is a string
output_obj_name has a value which is a string
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
input_shock_id has a value which is a string
input_file_path has a value which is a string
output_ws_id has a value which is a string
output_obj_name has a value which is a string
=end text
=back
=head2 FileToConditionSetOutput
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
condition_set_ref has a value which is a ConditionUtils.ws_condition_set_id
=end text
=back
=head2 ConditionSetToTsvFileParams
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
destination_dir has a value which is a string
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
destination_dir has a value which is a string
=end text
=back
=head2 ConditionSetToTsvFileOutput
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
file_path has a value which is a string
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
file_path has a value which is a string
=end text
=back
=head2 ExportConditionSetParams
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_condition_set_id
=end text
=back
=head2 ExportClusterSetParams
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_cluster_set_id
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
input_ref has a value which is a ConditionUtils.ws_cluster_set_id
=end text
=back
=head2 ExportOutput
=over 4
=item Definition
=begin html
<pre>
a reference to a hash where the following keys are defined:
shock_id has a value which is a string
</pre>
=end html
=begin text
a reference to a hash where the following keys are defined:
shock_id has a value which is a string
=end text
=back
=cut
package ConditionUtils::ConditionUtilsClient::RpcClient;
use base 'JSON::RPC::Client';
use POSIX;
use strict;
#
# Override JSON::RPC::Client::call because it doesn't handle error returns properly.
#
sub call {
my ($self, $uri, $headers, $obj) = @_;
my $result;
{
if ($uri =~ /\?/) {
$result = $self->_get($uri);
}
else {
Carp::croak "not hashref." unless (ref $obj eq 'HASH');
$result = $self->_post($uri, $headers, $obj);
}
}
my $service = $obj->{method} =~ /^system\./ if ( $obj );
$self->status_line($result->status_line);
if ($result->is_success) {
return unless($result->content); # notification?
if ($service) {
return JSON::RPC::ServiceObject->new($result, $self->json);
}
return JSON::RPC::ReturnObject->new($result, $self->json);
}
elsif ($result->content_type eq 'application/json')
{
return JSON::RPC::ReturnObject->new($result, $self->json);
}
else {
return;
}
}
sub _post {
my ($self, $uri, $headers, $obj) = @_;
my $json = $self->json;
$obj->{version} ||= $self->{version} || '1.1';
if ($obj->{version} eq '1.0') {
delete $obj->{version};
if (exists $obj->{id}) {
$self->id($obj->{id}) if ($obj->{id}); # if undef, it is notification.
}
else {
$obj->{id} = $self->id || ($self->id('JSON::RPC::Client'));
}
}
else {
# $obj->{id} = $self->id if (defined $self->id);
# Assign a random number to the id if one hasn't been set
$obj->{id} = (defined $self->id) ? $self->id : substr(rand(),2);
}
my $content = $json->encode($obj);
$self->ua->post(
$uri,
Content_Type => $self->{content_type},
Content => $content,
Accept => 'application/json',
@$headers,
($self->{token} ? (Authorization => $self->{token}) : ()),
);
}
1;
| 24.266453 | 232 | 0.670591 |
ed6a67efdacdeb561eedda0cc9ddaa838a853574 | 39,272 | pm | Perl | external/win_perl/lib/Win32/ODBC.pm | phixion/l0phtcrack | 48ee2f711134e178dbedbd925640f6b3b663fbb5 | [
"Apache-2.0",
"MIT"
] | 2 | 2021-10-20T00:25:39.000Z | 2021-11-08T12:52:42.000Z | external/win_perl/lib/Win32/ODBC.pm | Brute-f0rce/l0phtcrack | 25f681c07828e5e68e0dd788d84cc13c154aed3d | [
"Apache-2.0",
"MIT"
] | null | null | null | external/win_perl/lib/Win32/ODBC.pm | Brute-f0rce/l0phtcrack | 25f681c07828e5e68e0dd788d84cc13c154aed3d | [
"Apache-2.0",
"MIT"
] | 1 | 2022-03-14T06:41:16.000Z | 2022-03-14T06:41:16.000Z | package Win32::ODBC;
$VERSION = '0.035';
# Win32::ODBC.pm
# +==========================================================+
# | |
# | ODBC.PM package |
# | --------------- |
# | |
# | Copyright (c) 1996, 1997 Dave Roth. All rights reserved. |
# | This program is free software; you can redistribute |
# | it and/or modify it under the same terms as Perl itself. |
# | |
# +==========================================================+
#
#
# based on original code by Dan DeMaggio (dmag@umich.edu)
#
# Use under GNU General Public License or Larry Wall's "Artistic License"
#
# Check the README.TXT file that comes with this package for details about
# it's history.
#
require Exporter;
require DynaLoader;
$ODBCPackage = "Win32::ODBC";
$ODBCPackage::Version = 970208;
$::ODBC = $ODBCPackage;
$CacheConnection = 0;
# Reserve ODBC in the main namespace for US!
*ODBC::=\%Win32::ODBC::;
@ISA= qw( Exporter DynaLoader );
# Items to export into callers namespace by default. Note: do not export
# names by default without a very good reason. Use EXPORT_OK instead.
# Do not simply export all your public functions/methods/constants.
@EXPORT = qw(
ODBC_ADD_DSN
ODBC_REMOVE_DSN
ODBC_CONFIG_DSN
ODBC_ADD_SYS_DSN
ODBC_REMOVE_SYS_DSN
ODBC_CONFIG_SYS_DSN
SQL_DONT_CLOSE
SQL_DROP
SQL_CLOSE
SQL_UNBIND
SQL_RESET_PARAMS
SQL_FETCH_NEXT
SQL_FETCH_FIRST
SQL_FETCH_LAST
SQL_FETCH_PRIOR
SQL_FETCH_ABSOLUTE
SQL_FETCH_RELATIVE
SQL_FETCH_BOOKMARK
SQL_COLUMN_COUNT
SQL_COLUMN_NAME
SQL_COLUMN_TYPE
SQL_COLUMN_LENGTH
SQL_COLUMN_PRECISION
SQL_COLUMN_SCALE
SQL_COLUMN_DISPLAY_SIZE
SQL_COLUMN_NULLABLE
SQL_COLUMN_UNSIGNED
SQL_COLUMN_MONEY
SQL_COLUMN_UPDATABLE
SQL_COLUMN_AUTO_INCREMENT
SQL_COLUMN_CASE_SENSITIVE
SQL_COLUMN_SEARCHABLE
SQL_COLUMN_TYPE_NAME
SQL_COLUMN_TABLE_NAME
SQL_COLUMN_OWNER_NAME
SQL_COLUMN_QUALIFIER_NAME
SQL_COLUMN_LABEL
SQL_COLATT_OPT_MAX
SQL_COLUMN_DRIVER_START
SQL_COLATT_OPT_MIN
SQL_ATTR_READONLY
SQL_ATTR_WRITE
SQL_ATTR_READWRITE_UNKNOWN
SQL_UNSEARCHABLE
SQL_LIKE_ONLY
SQL_ALL_EXCEPT_LIKE
SQL_SEARCHABLE
);
#The above are included for backward compatibility
sub new
{
my ($n, $self);
my ($type) = shift;
my ($DSN) = shift;
my (@Results) = @_;
if (ref $DSN){
@Results = ODBCClone($DSN->{'connection'});
}else{
@Results = ODBCConnect($DSN, @Results);
}
@Results = processError(-1, @Results);
if (! scalar(@Results)){
return undef;
}
$self = bless {};
$self->{'connection'} = $Results[0];
$ErrConn = $Results[0];
$ErrText = $Results[1];
$ErrNum = 0;
$self->{'DSN'} = $DSN;
$self;
}
####
# Close this ODBC session (or all sessions)
####
sub Close
{
my ($self, $Result) = shift;
$Result = DESTROY($self);
$self->{'connection'} = -1;
return $Result;
}
####
# Auto-Kill an instance of this module
####
sub DESTROY
{
my ($self) = shift;
my (@Results) = (0);
if($self->{'connection'} > -1){
@Results = ODBCDisconnect($self->{'connection'});
@Results = processError($self, @Results);
if ($Results[0]){
undef $self->{'DSN'};
undef @{$self->{'fnames'}};
undef %{$self->{'field'}};
undef %{$self->{'connection'}};
}
}
return $Results[0];
}
sub sql{
return (Sql(@_));
}
####
# Submit an SQL Execute statement for processing
####
sub Sql{
my ($self, $Sql, @Results) = @_;
@Results = ODBCExecute($self->{'connection'}, $Sql);
return updateResults($self, @Results);
}
####
# Retrieve data from a particular field
####
sub Data{
# Change by JOC 06-APR-96
# Altered by Dave Roth <dave@roth.net> 96.05.07
my($self) = shift;
my(@Fields) = @_;
my(@Results, $Results, $Field);
if ($self->{'Dirty'}){
GetData($self);
$self->{'Dirty'} = 0;
}
@Fields = @{$self->{'fnames'}} if (! scalar(@Fields));
foreach $Field (@Fields) {
if (wantarray) {
push(@Results, data($self, $Field));
} else {
$Results .= data($self, $Field);
}
}
return wantarray ? @Results : $Results;
}
sub DataHash{
my($self, @Results) = @_;
my(%Results, $Element);
if ($self->{'Dirty'}){
GetData($self);
$self->{'Dirty'} = 0;
}
@Results = @{$self->{'fnames'}} if (! scalar(@Results));
foreach $Element (@Results) {
$Results{$Element} = data($self, $Element);
}
return %Results;
}
####
# Retrieve data from the data buffer
####
sub data
{ $_[0]->{'data'}->{$_[1]}; }
sub fetchrow{
return (FetchRow(@_));
}
####
# Put a row from an ODBC data set into data buffer
####
sub FetchRow{
my ($self, @Results) = @_;
my ($item, $num, $sqlcode);
# Added by JOC 06-APR-96
# $num = 0;
$num = 0;
undef $self->{'data'};
@Results = ODBCFetch($self->{'connection'}, @Results);
if (! (@Results = processError($self, @Results))){
####
# There should be an innocuous error "No records remain"
# This indicates no more records in the dataset
####
return undef;
}
# Set the Dirty bit so we will go and extract data via the
# ODBCGetData function. Otherwise use the cache.
$self->{'Dirty'} = 1;
# Return the array of field Results.
return @Results;
}
sub GetData{
my($self) = @_;
my @Results;
my $num = 0;
@Results = ODBCGetData($self->{'connection'});
if (!(@Results = processError($self, @Results))){
return undef;
}
####
# This is a special case. Do not call processResults
####
ClearError();
foreach (@Results){
s/ +$// if defined $_; # HACK
$self->{'data'}->{ ${$self->{'fnames'}}[$num] } = $_;
$num++;
}
# return is a hack to interface with a assoc array.
return wantarray? (1, 1): 1;
}
####
# See if any more ODBC Results Sets
# Added by Brian Dunfordshore <Brian_Dunfordshore@bridge.com>
# 96.07.10
####
sub MoreResults{
my ($self) = @_;
my(@Results) = ODBCMoreResults($self->{'connection'});
return (processError($self, @Results))[0];
}
####
# Retrieve the catalog from the current DSN
# NOTE: All Field names are uppercase!!!
####
sub Catalog{
my ($self) = shift;
my ($Qualifier, $Owner, $Name, $Type) = @_;
my (@Results) = ODBCTableList($self->{'connection'}, $Qualifier, $Owner, $Name, $Type);
# If there was an error return 0 else 1
return (updateResults($self, @Results) != 1);
}
####
# Return an array of names from the catalog for the current DSN
# TableList($Qualifier, $Owner, $Name, $Type)
# Return: (array of names of tables)
# NOTE: All Field names are uppercase!!!
####
sub TableList{
my ($self) = shift;
my (@Results) = @_;
if (! scalar(@Results)){
@Results = ("", "", "%", "TABLE");
}
if (! Catalog($self, @Results)){
return undef;
}
undef @Results;
while (FetchRow($self)){
push(@Results, Data($self, "TABLE_NAME"));
}
return sort(@Results);
}
sub fieldnames{
return (FieldNames(@_));
}
####
# Return an array of fieldnames extracted from the current dataset
####
sub FieldNames { $self = shift; return @{$self->{'fnames'}}; }
####
# Closes this connection. This is used mostly for testing. You should
# probably use Close().
####
sub ShutDown{
my($self) = @_;
print "\nClosing connection $self->{'connection'}...";
$self->Close();
print "\nDone\n";
}
####
# Return this connection number
####
sub Connection{
my($self) = @_;
return $self->{'connection'};
}
####
# Returns the current connections that are in use.
####
sub GetConnections{
return ODBCGetConnections();
}
####
# Set the Max Buffer Size for this connection. This determines just how much
# ram can be allocated when a fetch() is performed that requires a HUGE amount
# of memory. The default max is 10k and the absolute max is 100k.
# This will probably never be used but I put it in because I noticed a fetch()
# of a MEMO field in an Access table was something like 4Gig. Maybe I did
# something wrong, but after checking several times I decided to implement
# this limit thingy.
####
sub SetMaxBufSize{
my($self, $Size) = @_;
my(@Results) = ODBCSetMaxBufSize($self->{'connection'}, $Size);
return (processError($self, @Results))[0];
}
####
# Returns the Max Buffer Size for this connection. See SetMaxBufSize().
####
sub GetMaxBufSize{
my($self) = @_;
my(@Results) = ODBCGetMaxBufSize($self->{'connection'});
return (processError($self, @Results))[0];
}
####
# Returns the DSN for this connection as an associative array.
####
sub GetDSN{
my($self, $DSN) = @_;
if(! ref($self)){
$DSN = $self;
$self = 0;
}
if (! $DSN){
$self = $self->{'connection'};
}
my(@Results) = ODBCGetDSN($self, $DSN);
return (processError($self, @Results));
}
####
# Returns an associative array of $XXX{'DSN'}=Description
####
sub DataSources{
my($self, $DSN) = @_;
if(! ref $self){
$DSN = $self;
$self = 0;
}
my(@Results) = ODBCDataSources($DSN);
return (processError($self, @Results));
}
####
# Returns an associative array of $XXX{'Driver Name'}=Driver Attributes
####
sub Drivers{
my($self) = @_;
if(! ref $self){
$self = 0;
}
my(@Results) = ODBCDrivers();
return (processError($self, @Results));
}
####
# Returns the number of Rows that were affected by the previous SQL command.
####
sub RowCount{
my($self, $Connection) = @_;
if (! ref($self)){
$Connection = $self;
$self = 0;
}
if (! $Connection){$Connection = $self->{'connection'};}
my(@Results) = ODBCRowCount($Connection);
return (processError($self, @Results))[0];
}
####
# Returns the Statement Close Type -- how does ODBC Close a statement.
# Types:
# SQL_DROP
# SQL_CLOSE
# SQL_UNBIND
# SQL_RESET_PARAMS
####
sub GetStmtCloseType{
my($self, $Connection) = @_;
if (! ref($self)){
$Connection = $self;
$self = 0;
}
if (! $Connection){$Connection = $self->{'connection'};}
my(@Results) = ODBCGetStmtCloseType($Connection);
return (processError($self, @Results));
}
####
# Sets the Statement Close Type -- how does ODBC Close a statement.
# Types:
# SQL_DROP
# SQL_CLOSE
# SQL_UNBIND
# SQL_RESET_PARAMS
# Returns the newly set value.
####
sub SetStmtCloseType{
my($self, $Type, $Connection) = @_;
if (! ref($self)){
$Connection = $Type;
$Type = $self;
$self = 0;
}
if (! $Connection){$Connection = $self->{'connection'};}
my(@Results) = ODBCSetStmtCloseType($Connection, $Type);
return (processError($self, @Results))[0];
}
sub ColAttributes{
my($self, $Type, @Field) = @_;
my(%Results, @Results, $Results, $Attrib, $Connection, $Temp);
if (! ref($self)){
$Type = $Field;
$Field = $self;
$self = 0;
}
$Connection = $self->{'connection'};
if (! scalar(@Field)){ @Field = $self->fieldnames;}
foreach $Temp (@Field){
@Results = ODBCColAttributes($Connection, $Temp, $Type);
($Attrib) = processError($self, @Results);
if (wantarray){
$Results{$Temp} = $Attrib;
}else{
$Results .= "$Temp";
}
}
return wantarray? %Results:$Results;
}
sub GetInfo{
my($self, $Type) = @_;
my($Connection, @Results);
if(! ref $self){
$Type = $self;
$self = 0;
$Connection = 0;
}else{
$Connection = $self->{'connection'};
}
@Results = ODBCGetInfo($Connection, $Type);
return (processError($self, @Results))[0];
}
sub GetConnectOption{
my($self, $Type) = @_;
my(@Results);
if(! ref $self){
$Type = $self;
$self = 0;
}
@Results = ODBCGetConnectOption($self->{'connection'}, $Type);
return (processError($self, @Results))[0];
}
sub SetConnectOption{
my($self, $Type, $Value) = @_;
if(! ref $self){
$Value = $Type;
$Type = $self;
$self = 0;
}
my(@Results) = ODBCSetConnectOption($self->{'connection'}, $Type, $Value);
return (processError($self, @Results))[0];
}
sub Transact{
my($self, $Type) = @_;
my(@Results);
if(! ref $self){
$Type = $self;
$self = 0;
}
@Results = ODBCTransact($self->{'connection'}, $Type);
return (processError($self, @Results))[0];
}
sub SetPos{
my($self, @Results) = @_;
@Results = ODBCSetPos($self->{'connection'}, @Results);
$self->{'Dirty'} = 1;
return (processError($self, @Results))[0];
}
sub ConfigDSN{
my($self) = shift @_;
my($Type, $Connection);
if(! ref $self){
$Type = $self;
$Connection = 0;
$self = 0;
}else{
$Type = shift @_;
$Connection = $self->{'connection'};
}
my($Driver, @Attributes) = @_;
@Results = ODBCConfigDSN($Connection, $Type, $Driver, @Attributes);
return (processError($self, @Results))[0];
}
sub Version{
my($self, @Packages) = @_;
my($Temp, @Results);
if (! ref($self)){
push(@Packages, $self);
}
my($ExtName, $ExtVersion) = Info();
if (! scalar(@Packages)){
@Packages = ("ODBC.PM", "ODBC.PLL");
}
foreach $Temp (@Packages){
if ($Temp =~ /pll/i){
push(@Results, "ODBC.PM:$Win32::ODBC::Version");
}elsif ($Temp =~ /pm/i){
push(@Results, "ODBC.PLL:$ExtVersion");
}
}
return @Results;
}
sub SetStmtOption{
my($self, $Option, $Value) = @_;
if(! ref $self){
$Value = $Option;
$Option = $self;
$self = 0;
}
my(@Results) = ODBCSetStmtOption($self->{'connection'}, $Option, $Value);
return (processError($self, @Results))[0];
}
sub GetStmtOption{
my($self, $Type) = @_;
if(! ref $self){
$Type = $self;
$self = 0;
}
my(@Results) = ODBCGetStmtOption($self->{'connection'}, $Type);
return (processError($self, @Results))[0];
}
sub GetFunctions{
my($self, @Results)=@_;
@Results = ODBCGetFunctions($self->{'connection'}, @Results);
return (processError($self, @Results));
}
sub DropCursor{
my($self) = @_;
my(@Results) = ODBCDropCursor($self->{'connection'});
return (processError($self, @Results))[0];
}
sub SetCursorName{
my($self, $Name) = @_;
my(@Results) = ODBCSetCursorName($self->{'connection'}, $Name);
return (processError($self, @Results))[0];
}
sub GetCursorName{
my($self) = @_;
my(@Results) = ODBCGetCursorName($self->{'connection'});
return (processError($self, @Results))[0];
}
sub GetSQLState{
my($self) = @_;
my(@Results) = ODBCGetSQLState($self->{'connection'});
return (processError($self, @Results))[0];
}
# ----------- R e s u l t P r o c e s s i n g F u n c t i o n s ----------
####
# Generic processing of data into associative arrays
####
sub updateResults{
my ($self, $Error, @Results) = @_;
undef %{$self->{'field'}};
ClearError($self);
if ($Error){
SetError($self, $Results[0], $Results[1]);
return ($Error);
}
@{$self->{'fnames'}} = @Results;
foreach (0..$#{$self->{'fnames'}}){
s/ +$//;
$self->{'field'}->{${$self->{'fnames'}}[$_]} = $_;
}
return undef;
}
# ----------------------------------------------------------------------------
# ----------------- D e b u g g i n g F u n c t i o n s --------------------
sub Debug{
my($self, $iDebug, $File) = @_;
my(@Results);
if (! ref($self)){
if (defined $self){
$File = $iDebug;
$iDebug = $self;
}
$Connection = 0;
$self = 0;
}else{
$Connection = $self->{'connection'};
}
push(@Results, ($Connection, $iDebug));
push(@Results, $File) if ($File ne "");
@Results = ODBCDebug(@Results);
return (processError($self, @Results))[0];
}
####
# Prints out the current dataset (used mostly for testing)
####
sub DumpData {
my($self) = @_; my($f, $goo);
# Changed by JOC 06-Apr-96
# print "\nDumping Data for connection: $conn->{'connection'}\n";
print "\nDumping Data for connection: $self->{'connection'}\n";
print "Error: \"";
print $self->Error();
print "\"\n";
if (! $self->Error()){
foreach $f ($self->FieldNames){
print $f . " ";
$goo .= "-" x length($f);
$goo .= " ";
}
print "\n$goo\n";
while ($self->FetchRow()){
foreach $f ($self->FieldNames){
print $self->Data($f) . " ";
}
print "\n";
}
}
}
sub DumpError{
my($self) = @_;
my($ErrNum, $ErrText, $ErrConn);
my($Temp);
print "\n---------- Error Report: ----------\n";
if (ref $self){
($ErrNum, $ErrText, $ErrConn) = $self->Error();
($Temp = $self->GetDSN()) =~ s/.*DSN=(.*?);.*/$1/i;
print "Errors for \"$Temp\" on connection " . $self->{'connection'} . ":\n";
}else{
($ErrNum, $ErrText, $ErrConn) = Error();
print "Errors for the package:\n";
}
print "Connection Number: $ErrConn\nError number: $ErrNum\nError message: \"$ErrText\"\n";
print "-----------------------------------\n";
}
####
# Submit an SQL statement and print data about it (used mostly for testing)
####
sub Run{
my($self, $Sql) = @_;
print "\nExcecuting connection $self->{'connection'}\nsql statement: \"$Sql\"\n";
$self->Sql($Sql);
print "Error: \"";
print $self->error;
print "\"\n";
print "--------------------\n\n";
}
# ----------------------------------------------------------------------------
# ----------- E r r o r P r o c e s s i n g F u n c t i o n s ------------
####
# Process Errors returned from a call to ODBCxxxx().
# It is assumed that the Win32::ODBC function returned the following structure:
# ($ErrorNumber, $ResultsText, ...)
# $ErrorNumber....0 = No Error
# >0 = Error Number
# $ResultsText.....if no error then this is the first Results element.
# if error then this is the error text.
####
sub processError{
my($self, $Error, @Results) = @_;
if ($Error){
SetError($self, $Results[0], $Results[1]);
undef @Results;
}
return @Results;
}
####
# Return the last recorded error message
####
sub error{
return (Error(@_));
}
sub Error{
my($self) = @_;
if(ref($self)){
if($self->{'ErrNum'}){
my($State) = ODBCGetSQLState($self->{'connection'});
return (wantarray)? ($self->{'ErrNum'}, $self->{'ErrText'}, $self->{'connection'}, $State) :"[$self->{'ErrNum'}] [$self->{'connection'}] [$State] \"$self->{'ErrText'}\"";
}
}elsif ($ErrNum){
return (wantarray)? ($ErrNum, $ErrText, $ErrConn):"[$ErrNum] [$ErrConn] \"$ErrText\"";
}
return undef
}
####
# SetError:
# Assume that if $self is not a reference then it is just a placeholder
# and should be ignored.
####
sub SetError{
my($self, $Num, $Text, $Conn) = @_;
if (ref $self){
$self->{'ErrNum'} = $Num;
$self->{'ErrText'} = $Text;
$Conn = $self->{'connection'} if ! $Conn;
}
$ErrNum = $Num;
$ErrText = $Text;
####
# Test Section Begin
####
# $! = ($Num, $Text);
####
# Test Section End
####
$ErrConn = $Conn;
}
sub ClearError{
my($self, $Num, $Text) = @_;
if (ref $self){
undef $self->{'ErrNum'};
undef $self->{'ErrText'};
}else{
undef $ErrConn;
undef $ErrNum;
undef $ErrText;
}
ODBCCleanError();
return 1;
}
sub GetError{
my($self, $Connection) = @_;
my(@Results);
if (! ref($self)){
$Connection = $self;
$self = 0;
}else{
if (! defined($Connection)){
$Connection = $self->{'connection'};
}
}
@Results = ODBCGetError($Connection);
return @Results;
}
# ----------------------------------------------------------------------------
# ------------------ A U T O L O A D F U N C T I O N -----------------------
sub AUTOLOAD {
# This AUTOLOAD is used to 'autoload' constants from the constant()
# XS function. If a constant is not found then control is passed
# to the AUTOLOAD in AutoLoader.
my($constname);
($constname = $AUTOLOAD) =~ s/.*:://;
#reset $! to zero to reset any current errors.
local $! = 0;
$val = constant($constname);
if ($! != 0) {
if ($! =~ /Invalid/) {
$AutoLoader::AUTOLOAD = $AUTOLOAD;
goto &AutoLoader::AUTOLOAD;
}
else {
# Added by JOC 06-APR-96
# $pack = 0;
$pack = 0;
($pack,$file,$line) = caller;
print "Your vendor has not defined Win32::ODBC macro $constname, used in $file at line $line.";
}
}
eval "sub $AUTOLOAD { $val }";
goto &$AUTOLOAD;
}
# --------------------------------------------------------------
#
#
# Make sure that we shutdown ODBC and free memory even if we are
# using perlis.dll on Win32 platform!
END{
# ODBCShutDown() unless $CacheConnection;
}
bootstrap Win32::ODBC;
# Preloaded methods go here.
# Autoload methods go after __END__, and are processed by the autosplit program.
1;
__END__
=head1 NAME
Win32::ODBC - ODBC Extension for Win32
=head1 SYNOPSIS
To use this module, include the following statement at the top of your
script:
use Win32::ODBC;
Next, create a data connection to your DSN:
$Data = new Win32::ODBC("MyDSN");
B<NOTE>: I<MyDSN> can be either the I<DSN> as defined in the ODBC
Administrator, I<or> it can be an honest-to-God I<DSN Connect String>.
Example: "DSN=My Database;UID=Brown Cow;PWD=Moo;"
You should check to see if C<$Data> is indeed defined, otherwise there
has been an error.
You can now send SQL queries and retrieve info to your heart's
content! See the description of the methods provided by this module
below and also the file F<TEST.PL> as referred to in L<INSTALLATION
NOTES> to see how it all works.
Finally, B<MAKE SURE> that you close your connection when you are
finished:
$Data->Close();
=head1 DESCRIPTION
=head2 Background
This is a hack of Dan DeMaggio's <dmag@umich.edu> F<NTXS.C> ODBC
implementation. I have recoded and restructured most of it including
most of the F<ODBC.PM> package, but its very core is still based on
Dan's code (thanks Dan!).
The history of this extension is found in the file F<HISTORY.TXT> that
comes with the original archive (see L<INSTALLATION NOTES> below).
=head2 Benefits
And what are the benefits of this module?
=over
=item *
The number of ODBC connections is limited by memory and ODBC itself
(have as many as you want!).
=item *
The working limit for the size of a field is 10,240 bytes, but you can
increase that limit (if needed) to a max of 2,147,483,647 bytes. (You
can always recompile to increase the max limit.)
=item *
You can open a connection by either specifying a DSN or a connection
string!
=item *
You can open and close the connections in any order!
=item *
Other things that I can not think of right now... :)
=back
=head1 CONSTANTS
This package defines a number of constants. You may refer to each of
these constants using the notation C<ODBC::xxxxx>, where C<xxxxx> is
the constant.
Example:
print ODBC::SQL_SQL_COLUMN_NAME, "\n";
=head1 SPECIAL NOTATION
For the method documentation that follows, an B<*> following the
method parameters indicates that that method is new or has been
modified for this version.
=head1 CONSTRUCTOR
=over
=item new ( ODBC_OBJECT | DSN [, (OPTION1, VALUE1), (OPTION2, VALUE2) ...] )
*
Creates a new ODBC connection based on C<DSN>, or, if you specify an
already existing ODBC object, then a new ODBC object will be created
but using the ODBC Connection specified by C<ODBC_OBJECT>. (The new
object will be a new I<hstmt> using the I<hdbc> connection in
C<ODBC_OBJECT>.)
C<DSN> is I<Data Source Name> or a proper C<ODBCDriverConnect> string.
You can specify SQL Connect Options that are implemented before the
actual connection to the DSN takes place. These option/values are the
same as specified in C<GetConnectOption>/C<SetConnectOption> (see
below) and are defined in the ODBC API specs.
Returns a handle to the database on success, or I<undef> on failure.
=back
=head1 METHODS
=over
=item Catalog ( QUALIFIER, OWNER, NAME, TYPE )
Tells ODBC to create a data set that contains table information about
the DSN. Use C<Fetch> and C<Data> or C<DataHash> to retrieve the data.
The returned format is:
[Qualifier] [Owner] [Name] [Type]
Returns I<true> on error.
=item ColAttributes ( ATTRIBUTE [, FIELD_NAMES ] )
Returns the attribute C<ATTRIBUTE> on each of the fields in the list
C<FIELD_NAMES> in the current record set. If C<FIELD_NAMES> is empty,
then all fields are assumed. The attributes are returned as an
associative array.
=item ConfigDSN ( OPTION, DRIVER, ATTRIBUTE1 [, ATTRIBUTE2, ATTRIBUTE3, ...
] )
Configures a DSN. C<OPTION> takes on one of the following values:
ODBC_ADD_DSN.......Adds a new DSN.
ODBC_MODIFY_DSN....Modifies an existing DSN.
ODBC_REMOVE_DSN....Removes an existing DSN.
ODBC_ADD_SYS_DSN.......Adds a new System DSN.
ODBC_MODIFY_SYS_DSN....Modifies an existing System DSN.
ODBC_REMOVE_SYS_DSN....Removes an existing System DSN.
You must specify the driver C<DRIVER> (which can be retrieved by using
C<DataSources> or C<Drivers>).
C<ATTRIBUTE1> B<should> be I<"DSN=xxx"> where I<xxx> is the name of
the DSN. Other attributes can be any DSN attribute such as:
"UID=Cow"
"PWD=Moo"
"Description=My little bitty Data Source Name"
Returns I<true> on success, I<false> on failure.
B<NOTE 1>: If you use C<ODBC_ADD_DSN>, then you must include at least
I<"DSN=xxx"> and the location of the database.
Example: For MS Access databases, you must specify the
I<DatabaseQualifier>:
"DBQ=c:\\...\\MyDatabase.mdb"
B<NOTE 2>: If you use C<ODBC_MODIFY_DSN>, then you need only specify
the I<"DNS=xxx"> attribute. Any other attribute you include will be
changed to what you specify.
B<NOTE 3>: If you use C<ODBC_REMOVE_DSN>, then you need only specify
the I<"DSN=xxx"> attribute.
=item Connection ()
Returns the connection number associated with the ODBC connection.
=item Close ()
Closes the ODBC connection. No return value.
=item Data ( [ FIELD_NAME ] )
Returns the contents of column name C<FIELD_NAME> or the current row
(if nothing is specified).
=item DataHash ( [ FIELD1, FIELD2, ... ] )
Returns the contents for C<FIELD1, FIELD2, ...> or the entire row (if
nothing is specified) as an associative array consisting of:
{Field Name} => Field Data
=item DataSources ()
Returns an associative array of Data Sources and ODBC remarks about them.
They are returned in the form of:
$ArrayName{'DSN'}=Driver
where I<DSN> is the Data Source Name and ODBC Driver used.
=item Debug ( [ 1 | 0 ] )
Sets the debug option to on or off. If nothing is specified, then
nothing is changed.
Returns the debugging value (I<1> or I<0>).
=item Drivers ()
Returns an associative array of ODBC Drivers and their attributes.
They are returned in the form of:
$ArrayName{'DRIVER'}=Attrib1;Attrib2;Attrib3;...
where I<DRIVER> is the ODBC Driver Name and I<AttribX> are the
driver-defined attributes.
=item DropCursor ( [ CLOSE_TYPE ] )
Drops the cursor associated with the ODBC object. This forces the
cursor to be deallocated. This overrides C<SetStmtCloseType>, but the
ODBC object does not lose the C<StmtCloseType> setting. C<CLOSE_TYPE>
can be any valid C<SmtpCloseType> and will perform a close on the stmt
using the specified close type.
Returns I<true> on success, I<false> on failure.
=item DumpData ()
Dumps to the screen the fieldnames and all records of the current data
set. Used primarily for debugging. No return value.
=item Error ()
Returns the last encountered error. The returned value is context
dependent:
If called in a I<scalar> context, then a I<3-element array> is
returned:
( ERROR_NUMBER, ERROR_TEXT, CONNECTION_NUMBER )
If called in a I<string> context, then a I<string> is returned:
"[ERROR_NUMBER] [CONNECTION_NUMBER] [ERROR_TEXT]"
If debugging is on then two more variables are returned:
( ..., FUNCTION, LEVEL )
where C<FUNCTION> is the name of the function in which the error
occurred, and C<LEVEL> represents extra information about the error
(usually the location of the error).
=item FetchRow ( [ ROW [, TYPE ] ] )
Retrieves the next record from the keyset. When C<ROW> and/or C<TYPE>
are specified, the call is made using C<SQLExtendedFetch> instead of
C<SQLFetch>.
B<NOTE 1>: If you are unaware of C<SQLExtendedFetch> and its
implications, stay with just regular C<FetchRow> with no parameters.
B<NOTE 2>: The ODBC API explicitly warns against mixing calls to
C<SQLFetch> and C<SQLExtendedFetch>; use one or the other but not
both.
If I<ROW> is specified, it moves the keyset B<RELATIVE> C<ROW> number
of rows.
If I<ROW> is specified and C<TYPE> is B<not>, then the type used is
B<RELATIVE>.
Returns I<true> when another record is available to read, and I<false>
when there are no more records.
=item FieldNames ()
Returns an array of fieldnames found in the current data set. There is
no guarantee on order.
=item GetConnections ()
Returns an array of connection numbers showing what connections are
currently open.
=item GetConnectOption ( OPTION )
Returns the value of the specified connect option C<OPTION>. Refer to
ODBC documentation for more information on the options and values.
Returns a string or scalar depending upon the option specified.
=item GetCursorName ()
Returns the name of the current cursor as a string or I<undef>.
=item GetData ()
Retrieves the current row from the dataset. This is not generally
used by users; it is used internally.
Returns an array of field data where the first element is either
I<false> (if successful) and I<true> (if B<not> successful).
=item getDSN ( [ DSN ] )
Returns an associative array indicating the configuration for the
specified DSN.
If no DSN is specified then the current connection is used.
The returned associative array consists of:
keys=DSN keyword; values=Keyword value. $Data{$Keyword}=Value
=item GetFunctions ( [ FUNCTION1, FUNCTION2, ... ] )
Returns an associative array indicating the ability of the ODBC Driver
to support the specified functions. If no functions are specified,
then a 100 element associative array is returned containing all
possible functions and their values.
C<FUNCTION> must be in the form of an ODBC API constant like
C<SQL_API_SQLTRANSACT>.
The returned array will contain the results like:
$Results{SQL_API_SQLTRANSACT}=Value
Example:
$Results = $O->GetFunctions(
$O->SQL_API_SQLTRANSACT,
SQL_API_SQLSETCONNECTOPTION
);
$ConnectOption = $Results{SQL_API_SQLSETCONNECTOPTION};
$Transact = $Results{SQL_API_SQLTRANSACT};
=item GetInfo ( OPTION )
Returns a string indicating the value of the particular
option specified.
=item GetMaxBufSize ()
Returns the current allocated limit for I<MaxBufSize>. For more info,
see C<SetMaxBufSize>.
=item GetSQLState () *
Returns a string indicating the SQL state as reported by ODBC. The SQL
state is a code that the ODBC Manager or ODBC Driver returns after the
execution of a SQL function. This is helpful for debugging purposes.
=item GetStmtCloseType ( [ CONNECTION ] )
Returns a string indicating the type of closure that will be used
every time the I<hstmt> is freed. See C<SetStmtCloseType> for details.
By default, the connection of the current object will be used. If
C<CONNECTION> is a valid connection number, then it will be used.
=item GetStmtOption ( OPTION )
Returns the value of the specified statement option C<OPTION>. Refer
to ODBC documentation for more information on the options and values.
Returns a string or scalar depending upon the option specified.
=item MoreResults ()
This will report whether there is data yet to be retrieved from the
query. This can happen if the query was a multiple select.
Example:
"SELECT * FROM [foo] SELECT * FROM [bar]"
B<NOTE>: Not all drivers support this.
Returns I<1> if there is more data, I<undef> otherwise.
=item RowCount ( CONNECTION )
For I<UPDATE>, I<INSERT> and I<DELETE> statements, the returned value
is the number of rows affected by the request or I<-1> if the number
of affected rows is not available.
B<NOTE 1>: This function is not supported by all ODBC drivers! Some
drivers do support this but not for all statements (e.g., it is
supported for I<UPDATE>, I<INSERT> and I<DELETE> commands but not for
the I<SELECT> command).
B<NOTE 2>: Many data sources cannot return the number of rows in a
result set before fetching them; for maximum interoperability,
applications should not rely on this behavior.
Returns the number of affected rows, or I<-1> if not supported by the
driver in the current context.
=item Run ( SQL )
Executes the SQL command B<SQL> and dumps to the screen info about
it. Used primarily for debugging.
No return value.
=item SetConnectOption ( OPTION ) *
Sets the value of the specified connect option B<OPTION>. Refer to
ODBC documentation for more information on the options and values.
Returns I<true> on success, I<false> otherwise.
=item SetCursorName ( NAME ) *
Sets the name of the current cursor.
Returns I<true> on success, I<false> otherwise.
=item SetPos ( ROW [, OPTION, LOCK ] ) *
Moves the cursor to the row C<ROW> within the current keyset (B<not>
the current data/result set).
Returns I<true> on success, I<false> otherwise.
=item SetMaxBufSize ( SIZE )
This sets the I<MaxBufSize> for a particular connection. This will
most likely never be needed but...
The amount of memory that is allocated to retrieve the field data of a
record is dynamic and changes when it need to be larger. I found that
a memo field in an MS Access database ended up requesting 4 Gig of
space. This was a bit much so there is an imposed limit (2,147,483,647
bytes) that can be allocated for data retrieval.
Since it is possible that someone has a database with field data
greater than 10,240, you can use this function to increase the limit
up to a ceiling of 2,147,483,647 (recompile if you need more).
Returns the max number of bytes.
=item SetStmtCloseType ( TYPE [, CONNECTION ] )
Sets a particular I<hstmt> close type for the connection. This is the
same as C<ODBCFreeStmt(hstmt, TYPE)>. By default, the connection of
the current object will be used. If C<CONNECTION> is a valid
connection number, then it will be used.
C<TYPE> may be one of:
SQL_CLOSE
SQL_DROP
SQL_UNBIND
SQL_RESET_PARAMS
Returns a string indicating the newly set type.
=item SetStmtOption ( OPTION ) *
Sets the value of the specified statement option C<OPTION>. Refer to
ODBC documentation for more information on the options and values.
Returns I<true> on success, I<false> otherwise.
=item ShutDown ()
Closes the ODBC connection and dumps to the screen info about
it. Used primarily for debugging.
No return value.
=item Sql ( SQL_STRING )
Executes the SQL command C<SQL_STRING> on the current connection.
Returns I<?> on success, or an error number on failure.
=item TableList ( QUALIFIER, OWNER, NAME, TYPE )
Returns the catalog of tables that are available in the DSN. For an
unknown parameter, just specify the empty string I<"">.
Returns an array of table names.
=item Transact ( TYPE ) *
Forces the ODBC connection to perform a I<rollback> or I<commit>
transaction.
C<TYPE> may be one of:
SQL_COMMIT
SQL_ROLLBACK
B<NOTE>: This only works with ODBC drivers that support transactions.
Your driver supports it if I<true> is returned from:
$O->GetFunctions($O->SQL_API_SQLTRANSACT)[1]
(See C<GetFunctions> for more details.)
Returns I<true> on success, I<false> otherwise.
=item Version ( PACKAGES )
Returns an array of version numbers for the requested packages
(F<ODBC.pm> or F<ODBC.PLL>). If the list C<PACKAGES> is empty, then
all version numbers are returned.
=back
=head1 LIMITATIONS
What known problems does this thing have?
=over
=item *
If the account under which the process runs does not have write
permission on the default directory (for the process, not the ODBC
DSN), you will probably get a runtime error during a
C<SQLConnection>. I don't think that this is a problem with the code,
but more like a problem with ODBC. This happens because some ODBC
drivers need to write a temporary file. I noticed this using the MS
Jet Engine (Access Driver).
=item *
This module has been neither optimized for speed nor optimized for
memory consumption.
=back
=head1 INSTALLATION NOTES
If you wish to use this module with a build of Perl other than
ActivePerl, you may wish to fetch the original source distribution for
this module at:
ftp://ftp.roth.net:/pub/ntperl/ODBC/970208/Bin/Win32_ODBC_Build_CORE.zip
or one of the other archives at that same location. See the included
README for hints on installing this module manually, what to do if you
get a I<parse exception>, and a pointer to a test script for this
module.
=head1 OTHER DOCUMENTATION
Find a FAQ for Win32::ODBC at:
http://www.roth.net/odbc/odbcfaq.htm
=head1 AUTHOR
Dave Roth <rothd@roth.net>
=head1 CREDITS
Based on original code by Dan DeMaggio <dmag@umich.edu>
=head1 DISCLAIMER
I do not guarantee B<ANYTHING> with this package. If you use it you
are doing so B<AT YOUR OWN RISK>! I may or may not support this
depending on my time schedule.
=head1 HISTORY
Last Modified 1999.09.25.
=head1 COPYRIGHT
Copyright (c) 1996-1998 Dave Roth. All rights reserved.
Courtesy of Roth Consulting: http://www.roth.net/consult/
Use under GNU General Public License. Details can be found at:
http://www.gnu.org/copyleft/gpl.html
=cut
| 26.286479 | 182 | 0.619602 |
ed548cdacac81b21b21f32848830ed089fba9ecc | 43,689 | pm | Perl | lib/SNMP/Info/Layer3/Aruba.pm | semirke/snmp-info | 26320033e9e27e05a5ee835f7ee821e8f5265b52 | [
"BSD-3-Clause"
] | 1 | 2019-05-28T13:20:18.000Z | 2019-05-28T13:20:18.000Z | lib/SNMP/Info/Layer3/Aruba.pm | semirke/snmp-info | 26320033e9e27e05a5ee835f7ee821e8f5265b52 | [
"BSD-3-Clause"
] | null | null | null | lib/SNMP/Info/Layer3/Aruba.pm | semirke/snmp-info | 26320033e9e27e05a5ee835f7ee821e8f5265b52 | [
"BSD-3-Clause"
] | null | null | null | # SNMP::Info::Layer3::Aruba
# $Id$
#
# Copyright (c) 2013 Eric Miller
# All rights reserved.
#
# Redistribution and use in source and binary forms, with or without
# modification, are permitted provided that the following conditions are met:
#
# * Redistributions of source code must retain the above copyright notice,
# this list of conditions and the following disclaimer.
# * Redistributions in binary form must reproduce the above copyright
# notice, this list of conditions and the following disclaimer in the
# documentation and/or other materials provided with the distribution.
# * Neither the name of the University of California, Santa Cruz nor the
# names of its contributors may be used to endorse or promote products
# derived from this software without specific prior written permission.
#
# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
# AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
# ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
# LIABLE FOR # ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
# CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
# SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
# INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
# CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
# POSSIBILITY OF SUCH DAMAGE.
package SNMP::Info::Layer3::Aruba;
use strict;
use Exporter;
use SNMP::Info::Layer3;
use SNMP::Info::LLDP;
@SNMP::Info::Layer3::Aruba::ISA = qw/SNMP::Info::LLDP SNMP::Info::Layer3 Exporter/;
@SNMP::Info::Layer3::Aruba::EXPORT_OK = qw//;
our ($VERSION, %FUNCS, %GLOBALS, %MIBS, %MUNGE);
$VERSION = '3.67';
%MIBS = (
%SNMP::Info::Layer3::MIBS,
%SNMP::Info::LLDP::MIBS,
'WLSR-AP-MIB' => 'wlsrHideSSID',
'WLSX-IFEXT-MIB' => 'ifExtVlanName',
'WLSX-POE-MIB' => 'wlsxPseSlotPowerAvailable',
'WLSX-SWITCH-MIB' => 'wlsxHostname',
'WLSX-SYSTEMEXT-MIB' => 'wlsxSysExtSwitchBaseMacaddress',
'WLSX-USER-MIB' => 'nUserCurrentVlan',
'WLSX-WLAN-MIB' => 'wlanAPFQLN',
#'ALCATEL-IND1-TP-DEVICES' => 'familyOmniAccessWireless',
);
%GLOBALS = (
%SNMP::Info::Layer3::GLOBALS,
%SNMP::Info::LLDP::GLOBALS,
'aruba_serial_old' => 'wlsxSwitchLicenseSerialNumber',
'aruba_serial_new' => 'wlsxSysExtLicenseSerialNumber',
'aruba_model' => 'wlsxModelName',
'mac' => 'wlsxSysExtSwitchBaseMacaddress',
);
%FUNCS = (
%SNMP::Info::Layer3::FUNCS,
%SNMP::Info::LLDP::FUNCS,
# WLSR-AP-MIB::wlsrConfigTable
'aruba_ap_ssidbcast' => 'wlsrHideSSID',
# WLSX-IFEXT-MIB::wlsxIfExtPortTable
'aruba_if_idx' => 'ifExtPortIfIndex',
'aruba_if_mode' => 'ifExtMode',
'aruba_if_pvid' => 'ifExtTrunkNativeVlanId',
'aruba_if_duplex' => 'ifExtPortDuplex',
# WLSX-IFEXT-MIB::wlsxIfExtVlanMemberTable
'aruba_if_vlan_member' => 'ifExtVlanMemberStatus',
# WLSX-IFEXT-MIB::::wlsxIfExtVlanTable
'aruba_v_name' => 'ifExtVlanName',
# Other cd11_ methods are indexed by staPhyAddress, we need to
# strip staAccessPointBSSID from the aruba_cd11_ methods.
# wlanStaRSSI and staSignalToNoiseRatio don't appear to be reporting
# distinct values.
# WLSX-SWITCH-MIB::wlsxSwitchStationMgmtTable
'aruba_cd11_sigqual' => 'staSignalToNoiseRatio',
'aruba_cd11_txrate' => 'staTransmitRate',
# WLSX-SWITCH-MIB::wlsxSwitchStationStatsTable
'aruba_cd11_rxbyte' => 'staRxBytes',
'aruba_cd11_txbyte' => 'staTxBytes',
'aruba_cd11_rxpkt' => 'staRxPackets',
'aruba_cd11_txpkt' => 'staTxPackets',
# WLSX-SYSTEMEXT-MIB::wlsxSysExtCardTable
'aruba_card_type' => 'sysExtCardType',
'aruba_card_serial' => 'sysExtCardSerialNo',
'aruba_card_hw' => 'sysExtCardHwRevision',
'aruba_card_fpga' => 'sysExtCardFpgaRevision',
'aruba_card_no' => 'sysExtCardAssemblyNo',
# WLSX-USER-MIB::wlsxUserTable
'aruba_user_vlan' => 'nUserCurrentVlan',
'aruba_user_bssid' => 'nUserApBSSID',
'aruba_user_name' => 'userName',
# WLSX-WLAN-MIB::wlsxWlanRadioTable
'aruba_apif_ch_num' => 'wlanAPRadioChannel',
'aruba_apif_power' => 'wlanAPRadioTransmitPower',
'aruba_apif_type' => 'wlanAPRadioType',
'aruba_apif_name' => 'wlanAPRadioAPName',
# WLSX-WLAN-MIB::wlsxWlanAPTable
'aruba_ap_fqln' => 'wlanAPFQLN',
'aruba_ap_status' => 'wlanAPStatus',
'aruba_ap_type' => 'wlanAPModel',
'aruba_ap_serial' => 'wlanAPSerialNumber',
'aruba_ap_model' => 'wlanAPModelName',
'aruba_ap_name' => 'wlanAPName',
'aruba_ap_ip' => 'wlanAPIpAddress',
'aruba_ap_hw_ver' => 'wlanAPHwVersion',
'aruba_ap_sw_ver' => 'wlanAPSwVersion',
# WLSX-WLAN-MIB::wlsxWlanESSIDVlanPoolTable
'aruba_ssid_vlan' => 'wlanESSIDVlanPoolStatus',
# WLSX-WLAN-MIB::wlsxWlanAPBssidTable
'aruba_ap_bssid_ssid' => 'wlanAPESSID',
# We pretend to have the CISCO-DOT11-MIB for signal strengths, etc.
# WLSX-WLAN-MIB::wlsxWlanStationTable
'cd11_sigstrength' => 'wlanStaRSSI',
'cd11_ssid' => 'wlanStaAccessPointESSID',
'cd11_uptime' => 'wlanStaUpTime',
);
%MUNGE = (
%SNMP::Info::Layer3::MUNGE,
%SNMP::Info::LLDP::MUNGE,
'aruba_ap_fqln' => \&munge_aruba_fqln,
'aruba_ap_type' => \&SNMP::Info::munge_e_type,
'aruba_card_type' => \&SNMP::Info::munge_e_type,
'aruba_ap_bssid_ssid' => \&SNMP::Info::munge_null,
'aruba_user_bssid' => \&SNMP::Info::munge_mac,
'cd11_ssid' => \&SNMP::Info::munge_null,
);
sub layers {
return '00000111';
}
sub os {
my $aruba = shift;
my %osmap = ( 'alcatel-lucent' => 'aos-w', );
return $osmap{ $aruba->vendor() } || 'airos';
}
sub vendor {
my $aruba = shift;
my $id = $aruba->id() || 'undef';
my %oidmap = ( 6486 => 'alcatel-lucent', );
$id = $1 if ( defined($id) && $id =~ /^\.1\.3\.6\.1\.4\.1\.(\d+)/ );
if ( defined($id) and exists( $oidmap{$id} ) ) {
return $oidmap{$id};
}
else {
return 'aruba';
}
}
sub os_ver {
my $aruba = shift;
my $descr = $aruba->description();
return unless defined $descr;
if ( $descr =~ m/Version\s+(\d+\.\d+\.\d+\.\d+)/ ) {
return $1;
}
return;
}
sub model {
my $aruba = shift;
my $id = $aruba->id();
return unless defined $id;
my $model = &SNMP::translateObj($id);
return $id unless defined $model;
return $model;
}
sub serial {
my $aruba = shift;
return $aruba->aruba_serial_old() || $aruba->aruba_serial_new();
}
# Thin APs do not support ifMIB requirement
sub i_index {
my $aruba = shift;
my $partial = shift;
my $i_index = $aruba->orig_i_index($partial) || {};
my $ap_index = $aruba->aruba_apif_ch_num($partial) || {};
my %if_index;
foreach my $iid ( keys %$i_index ) {
my $index = $i_index->{$iid};
next unless defined $index;
$if_index{$iid} = $index;
}
# Get Attached APs as Interfaces
foreach my $ap_id ( keys %$ap_index ) {
if ( $ap_id =~ /(\d+\.\d+\.\d+\.\d+\.\d+\.\d+)\.(\d+)/ ) {
my $mac = join( ':',
map { sprintf( "%02x", $_ ) } split( /\./, $1 ) );
my $radio = $2;
next unless ( ( defined $mac ) and ( defined $radio ) );
$if_index{$ap_id} = "$mac.$radio";
}
}
return \%if_index;
}
sub interfaces {
my $aruba = shift;
my $partial = shift;
my $i_index = $aruba->i_index($partial) || {};
my $i_name = $aruba->orig_i_name($partial) || {};
my %if;
foreach my $iid ( keys %$i_index ) {
my $index = $i_index->{$iid};
next unless defined $index;
if ( $index =~ /^\d+$/ ) {
# Replace the Index with the ifName field.
my $port = $i_name->{$iid};
next unless defined $port;
$if{$iid} = $port;
}
else {
$if{$iid} = $index;
}
}
return \%if;
}
sub i_name {
my $aruba = shift;
my $partial = shift;
my $i_index = $aruba->i_index($partial) || {};
my $i_name = $aruba->orig_i_name($partial) || {};
my $ap_name = $aruba->aruba_apif_name($partial) || {};
my %i_name;
foreach my $iid ( keys %$i_index ) {
my $index = $i_index->{$iid};
next unless defined $index;
if ( $index =~ /^\d+$/ ) {
my $name = $i_name->{$iid};
next unless defined $name;
$i_name{$iid} = $name;
}
elsif ( $index =~ /(?:[0-9A-Fa-f]{2}:){5}[0-9A-Fa-f]{2}/ ) {
my $name = $ap_name->{$iid};
next unless defined $name;
$i_name{$iid} = $name;
}
else {
$i_name{$iid} = $index;
}
}
return \%i_name;
}
sub i_description {
my $aruba = shift;
my $partial = shift;
my $i_descr = $aruba->orig_i_description($partial) || {};
my $ap_index = $aruba->aruba_apif_ch_num($partial) || {};
my $ap_loc = $aruba->aruba_ap_fqln($partial) || {};
my %descr;
foreach my $iid ( keys %$i_descr ) {
my $descr = $i_descr->{$iid};
next unless defined $descr;
$descr{$iid} = $descr;
}
foreach my $iid ( keys %$ap_index ) {
my @parts = split( /\./, $iid );
my $idx = join( ".", @parts[ 0 .. 5 ] );
my $loc = $ap_loc->{$idx};
next unless defined $loc;
$descr{$iid} = $loc;
}
return \%descr;
}
sub i_type {
my $aruba = shift;
my $partial = shift;
my $i_type = $aruba->orig_i_type($partial) || {};
my $apif_type = $aruba->aruba_apif_type($partial) || {};
my %i_type;
foreach my $iid ( keys %$i_type ) {
my $type = $i_type->{$iid};
next unless defined $type;
$i_type{$iid} = $type;
}
foreach my $iid ( keys %$apif_type ) {
my $type = $apif_type->{$iid};
next unless defined $type;
$i_type{$iid} = $type;
}
return \%i_type;
}
sub i_up {
my $aruba = shift;
my $partial = shift;
my $i_up = $aruba->orig_i_up($partial) || {};
my $ap_index = $aruba->aruba_apif_ch_num($partial) || {};
my $ap_up = $aruba->aruba_ap_status($partial) || {};
my %i_up;
foreach my $iid ( keys %$i_up ) {
my $status = $i_up->{$iid};
next unless defined $status;
$i_up{$iid} = $status;
}
foreach my $iid ( keys %$ap_index ) {
my @parts = split( /\./, $iid );
my $idx = join( ".", @parts[ 0 .. 5 ] );
my $status = $ap_up->{$idx};
next unless defined $status;
$i_up{$iid} = $status;
}
return \%i_up;
}
# Fake this for AP's since admin up if operationally up
sub i_up_admin {
my $aruba = shift;
my $partial = shift;
my $i_up = $aruba->orig_i_up_admin($partial) || {};
my $ap_index = $aruba->aruba_apif_ch_num($partial) || {};
my $ap_up = $aruba->aruba_ap_status($partial) || {};
my %i_up;
foreach my $iid ( keys %$i_up ) {
my $status = $i_up->{$iid};
next unless defined $status;
$i_up{$iid} = $status;
}
foreach my $iid ( keys %$ap_index ) {
my @parts = split( /\./, $iid );
my $idx = join( ".", @parts[ 0 .. 5 ] );
my $status = $ap_up->{$idx};
next unless defined $status;
$i_up{$iid} = $status;
}
return \%i_up;
}
sub i_mac {
my $aruba = shift;
my $partial = shift;
my $i_index = $aruba->i_index($partial) || {};
my $i_mac = $aruba->orig_i_mac($partial) || {};
my %i_mac;
foreach my $iid ( keys %$i_index ) {
my $index = $i_index->{$iid};
next unless defined $index;
if ( $index =~ /^\d+$/ ) {
my $mac = $i_mac->{$iid};
next unless defined $mac;
$i_mac{$iid} = $mac;
}
elsif ( $index =~ /(?:[0-9A-Fa-f]{2}:){5}[0-9A-Fa-f]{2}/ ) {
$index =~ s/\.\d+$//;
next unless defined $index;
$i_mac{$iid} = $index;
}
}
return \%i_mac;
}
sub i_duplex {
my $aruba = shift;
my $partial = shift;
my $index = $aruba->aruba_if_idx();
if ($partial) {
my %r_index = reverse %$index;
$partial = $r_index{$partial};
}
my $ap_duplex = $aruba->aruba_if_duplex($partial) || {};
my %i_duplex;
foreach my $if ( keys %$ap_duplex ) {
my $duplex = $ap_duplex->{$if};
next unless defined $duplex;
my $ifindex = $index->{$if};
next unless defined $ifindex;
$duplex = 'half' if $duplex =~ /half/i;
$duplex = 'full' if $duplex =~ /full/i;
$duplex = 'auto' if $duplex =~ /auto/i;
$i_duplex{$ifindex} = $duplex;
}
return \%i_duplex;
}
sub v_index {
my $aruba = shift;
my $partial = shift;
return $aruba->SUPER::v_index($partial)
if keys %{ $aruba->SUPER::v_index($partial) };
my $v_name = $aruba->v_name($partial);
my %v_index;
foreach my $idx ( keys %$v_name ) {
$v_index{$idx} = $idx;
}
return \%v_index;
}
sub v_name {
my $aruba = shift;
my $partial = shift;
return $aruba->SUPER::v_name() || $aruba->aruba_v_name();
}
sub i_vlan {
my $aruba = shift;
my $partial = shift;
return $aruba->SUPER::i_vlan($partial)
if keys %{ $aruba->SUPER::i_vlan($partial) };
# If we don't have Q-BRIDGE-MIB, we're a wireless controller
my $index = $aruba->aruba_if_idx();
if ($partial) {
my %r_index = reverse %$index;
$partial = $r_index{$partial};
}
my $i_pvid = $aruba->aruba_if_pvid($partial) || {};
my %i_vlan;
foreach my $port ( keys %$i_pvid ) {
my $vlan = $i_pvid->{$port};
my $ifindex = $index->{$port};
next unless defined $ifindex;
$i_vlan{$ifindex} = $vlan;
}
return \%i_vlan;
}
sub i_vlan_membership {
my $aruba = shift;
my $partial = shift;
return $aruba->SUPER::i_vlan_membership($partial)
if keys %{ $aruba->SUPER::i_vlan_membership($partial) };
# If we don't have Q-BRIDGE-MIB, we're a wireless controller
my $essid_ssid = $aruba->aruba_ap_bssid_ssid();
my $ssid_vlans = $aruba->aruba_ssid_vlan();
my $if_vlans = $aruba->aruba_if_vlan_member();
my %vlan_essid;
# Create a hash of vlan and textual ssid
# Possible to have more than one vlan per ssid
foreach my $oid ( keys %$ssid_vlans ) {
my @parts = split( /\./, $oid );
my $ssidlen = shift(@parts);
my $ssid = pack( "C*", splice( @parts, 0, $ssidlen ) );
# Remove any control chars
$ssid =~ s/[[:cntrl:]]//g;
my $vlan = shift(@parts);
$vlan_essid{$vlan} = $ssid;
}
my $i_vlan_membership = {};
# Handle physical ports first
foreach my $oid ( keys %$if_vlans ) {
my @parts = split( /\./, $oid );
my $vlan = shift(@parts);
my $ifindex = shift(@parts);
push( @{ $i_vlan_membership->{$ifindex} }, $vlan );
}
foreach my $oid ( keys %$essid_ssid ) {
my $ssid = $essid_ssid->{$oid};
my @parts = split( /\./, $oid );
my $idx = join( ".", @parts[ 0 .. 6 ] );
my @vlans = grep { $vlan_essid{$_} eq $ssid } keys %vlan_essid;
foreach my $vlan (@vlans) {
push( @{ $i_vlan_membership->{$idx} }, $vlan );
}
}
return $i_vlan_membership;
}
sub i_vlan_membership_untagged {
my $aruba = shift;
my $partial = shift;
return $aruba->SUPER::i_vlan_membership_untagged($partial)
if keys %{ $aruba->SUPER::i_vlan_membership_untagged($partial) };
# If we don't have Q-BRIDGE-MIB, we're a wireless controller
# It is unclear if native VLAN is transmitted untagged
# This assumes Cisco-like behavior on trunks that native VLAN is
# transmitted untagged, if this needs to be changed we will need to
# consider ifExtMode rather than just using i_vlan
my $if_membership = $aruba->i_vlan_membership();
my $if_ = $aruba->i_vlan();
my $if_mode = $aruba->aruba_if_mode();
my $vlans = $aruba->i_vlan($partial);
my $i_vlan_membership = {};
foreach my $port (keys %$vlans) {
my $vlan = $vlans->{$port};
push( @{ $i_vlan_membership->{$port} }, $vlan );
}
return $i_vlan_membership;
}
sub i_80211channel {
my $aruba = shift;
my $partial = shift;
return $aruba->aruba_apif_ch_num($partial);
}
sub dot11_cur_tx_pwr_mw {
my $aruba = shift;
my $partial = shift;
return $aruba->aruba_apif_power($partial);
}
sub i_ssidlist {
my $aruba = shift;
my $partial = shift;
my $essid_ssid = $aruba->aruba_ap_bssid_ssid($partial) || {};
my %i_ssidlist;
foreach my $oid ( keys %$essid_ssid ) {
my $ssid = $essid_ssid->{$oid};
my @parts = split( /\./, $oid );
# Give the SSID a numeric value based upon tail of BSSID
my $id = pop(@parts);
# Get i_index
my $iid = join( ".", @parts[ 0 .. 6 ] );
$i_ssidlist{"$iid.$id"} = $ssid;
}
return \%i_ssidlist;
}
sub i_ssidbcast {
my $aruba = shift;
my $partial = shift;
my $essid_ssid = $aruba->aruba_ap_bssid_ssid($partial) || {};
my $ap_bc = $aruba->aruba_ap_ssidbcast($partial) || {};
my %i_bc;
foreach my $oid ( keys %$essid_ssid ) {
my @parts = split( /\./, $oid );
# Give the SSID a numeric value based upon tail of BSSID
my $id = $parts[-1];
my $iid = join( ".", splice( @parts, 0, 7 ) );
my $bssid = join( ':', @parts );
my $bc = $ap_bc->{$bssid};
next unless defined $bc;
$bc = ( $bc ? 0 : 1 );
$i_bc{"$iid.$id"} = $bc;
}
return \%i_bc;
}
sub i_ssidmac {
my $aruba = shift;
my $partial = shift;
my $essid_ssid = $aruba->aruba_ap_bssid_ssid($partial) || {};
my %i_ssidmac;
foreach my $oid ( keys %$essid_ssid ) {
my @parts = split( /\./, $oid );
# Give the SSID a numeric value based upon tail of BSSID
my $id = $parts[-1];
my $iid = join( ".", splice( @parts, 0, 7 ) );
my $bssid = join( ':', map { sprintf( "%02x", $_ ) } @parts );
$i_ssidmac{"$iid.$id"} = $bssid;
}
return \%i_ssidmac;
}
# Wireless switches do not support the standard Bridge MIB
# Wired switches currently (AOS 7.2.0.0) do, but it seems only for
# dot1q ports or access ports that are 'untrusted' ?
sub bp_index {
my $aruba = shift;
my $partial = shift;
my $i_index = $aruba->ifExtPortIfIndex($partial) || {};
my $essid_ssid = $aruba->aruba_ap_bssid_ssid($partial) || {};
# Collect standard bp_index first
my $wired_bp_index = $aruba->SUPER::bp_index($partial) || {};
my %bp_index;
my %offset;
foreach my $iid ( keys %$wired_bp_index ) {
my $index = $wired_bp_index->{$iid};
my $delta = $iid - $index;
$offset{$delta}++;
$bp_index{$iid} = $index;
}
# If the offset between dot1dBasePortIfIndex and ifIndex is consistent
# add potentially missing mappings
if ( keys %offset == 1 ) {
foreach my $iid ( keys %$i_index ) {
my $index = $i_index->{$iid};
next unless defined $index;
# Only augment bp_index, don't overwrite any existing mappings
my $iid = (keys %offset)[0] + $index;
next if exists $bp_index{$iid};
$bp_index{$iid} = $index;
}
}
# Get Attached APs as Interfaces
foreach my $oid ( keys %$essid_ssid ) {
my @parts = split( /\./, $oid );
my $iid = join( ".", splice( @parts, 0, 7 ) );
my $bssid = join( '.', @parts );
$bp_index{$bssid} = $iid;
}
return \%bp_index;
}
sub fw_port {
my $aruba = shift;
my $partial = shift;
my $fw_idx = $aruba->aruba_user_bssid($partial) || {};
my $wired_fw_port = $aruba->SUPER::qb_fw_port($partial) || {};
my %fw_port = %$wired_fw_port;
foreach my $idx ( keys %$fw_idx ) {
my $port = $fw_idx->{$idx};
next unless $port;
my $iid = join( '.', map { hex($_) } split( ':', $port ) );
$fw_port{$idx} = $iid;
}
return \%fw_port;
}
sub fw_mac {
my $aruba = shift;
my $partial = shift;
my $fw_idx = $aruba->aruba_user_bssid($partial) || {};
my $wired_fw_mac = $aruba->SUPER::qb_fw_mac($partial) || {};
my %fw_mac = %$wired_fw_mac;
foreach my $idx ( keys %$fw_idx ) {
my @parts = split( /\./, $idx );
my $mac = join( ':', map { sprintf( "%02x", $_ ) } @parts[ 0 .. 5 ] );
$fw_mac{$idx} = $mac;
}
return \%fw_mac;
}
sub qb_fw_vlan {
my $aruba = shift;
my $partial = shift;
my $vlans = $aruba->aruba_user_vlan($partial) || {};
my $wired_fw_vlan = $aruba->SUPER::qb_fw_vlan($partial) || {};
my %fw_vlan = %$wired_fw_vlan;
foreach my $idx ( keys %$vlans ) {
my $vlan = $vlans->{$idx};
next unless $vlan;
$fw_vlan{$idx} = $vlan;
}
return \%fw_vlan;
}
sub cd11_mac {
my $aruba = shift;
my $cd11_sigstrength = $aruba->cd11_sigstrength();
my $ret = {};
foreach my $idx ( keys %$cd11_sigstrength ) {
my $mac = join( ":", map { sprintf "%02x", $_ } split /\./, $idx );
$ret->{$idx} = $mac;
}
return $ret;
}
sub cd11_sigqual {
my $aruba = shift;
my $cd11_sigqual = $aruba->aruba_cd11_sigqual();
my $ret = {};
foreach my $idx ( keys %$cd11_sigqual ) {
my $value = $cd11_sigqual->{$idx};
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = $value;
}
return $ret;
}
sub cd11_txrate {
my $aruba = shift;
my $cd11_txrate = $aruba->aruba_cd11_txrate();
my $ret = {};
foreach my $idx ( keys %$cd11_txrate ) {
my $value = $cd11_txrate->{$idx};
my @rates;
if ( $value =~ /(\d+)Mbps/ ) {
push @rates, $1;
}
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = \@rates;
}
return $ret;
}
sub cd11_rxbyte {
my $aruba = shift;
my $cd11_rxbyte = $aruba->aruba_cd11_rxbyte();
my $ret = {};
foreach my $idx ( keys %$cd11_rxbyte ) {
my $value = $cd11_rxbyte->{$idx};
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = $value;
}
return $ret;
}
sub cd11_txbyte {
my $aruba = shift;
my $cd11_txbyte = $aruba->aruba_cd11_txbyte();
my $ret = {};
foreach my $idx ( keys %$cd11_txbyte ) {
my $value = $cd11_txbyte->{$idx};
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = $value;
}
return $ret;
}
sub cd11_rxpkt {
my $aruba = shift;
my $cd11_rxpkt = $aruba->aruba_cd11_rxpkt();
my $ret = {};
foreach my $idx ( keys %$cd11_rxpkt ) {
my $value = $cd11_rxpkt->{$idx};
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = $value;
}
return $ret;
}
sub cd11_txpkt {
my $aruba = shift;
my $cd11_txpkt = $aruba->aruba_cd11_txpkt();
my $ret = {};
foreach my $idx ( keys %$cd11_txpkt ) {
my $value = $cd11_txpkt->{$idx};
$idx =~ s/(.\d+){6}$//;
$ret->{$idx} = $value;
}
return $ret;
}
# Pseudo ENTITY-MIB methods
sub e_index {
my $aruba = shift;
my $ap_model = $aruba->aruba_ap_model() || {};
my $ap_cards = $aruba->aruba_card_serial() || {};
my %e_index;
# Chassis
$e_index{0} = 1;
# Cards
foreach my $idx ( keys %$ap_cards ) {
$e_index{$idx} = $idx + 1;
}
# We're going to hack an index to capture APs
foreach my $idx ( keys %$ap_model ) {
# Create the integer index by joining the last three octets of the MAC.
# Hopefully, this will be unique since the manufacturer should be
# limited to Aruba. We can't use the entire MAC since
# we would exceed the integer size limit.
if ( $idx =~ /(\d+\.\d+\.\d+)$/ ) {
my $index = int(
join( '', map { sprintf "%03d", $_ } split /\./, $1 ) );
$e_index{$idx} = $index;
}
}
return \%e_index;
}
sub e_class {
my $aruba = shift;
my $e_idx = $aruba->e_index() || {};
my %e_class;
foreach my $iid ( keys %$e_idx ) {
if ( $iid eq 0 ) {
$e_class{$iid} = 'chassis';
}
elsif ( $iid =~ /\d+/ ) {
$e_class{$iid} = 'module';
}
# This isn't a valid PhysicalClass, but we're hacking this anyway
else {
$e_class{$iid} = 'ap';
}
}
return \%e_class;
}
sub e_name {
my $aruba = shift;
my $e_idx = $aruba->e_index() || {};
my %e_name;
foreach my $iid ( keys %$e_idx ) {
if ( $iid eq 0 ) {
$e_name{$iid} = 'WLAN Controller';
}
elsif ( $iid =~ /^\d+$/ ) {
$e_name{$iid} = "Card $iid";
}
else {
# APs
$e_name{$iid} = 'AP';
}
}
return \%e_name;
}
sub e_descr {
my $aruba = shift;
my $ap_model = $aruba->aruba_ap_model() || {};
my $ap_name = $aruba->aruba_ap_name() || {};
my $ap_loc = $aruba->aruba_ap_fqln() || {};
my $card_type = $aruba->aruba_card_type() || {};
my $card_assy = $aruba->aruba_card_no() || {};
my %e_descr;
# Chassis
$e_descr{0} = $aruba->aruba_model();
#Cards
foreach my $iid ( keys %$card_type ) {
my $card = $card_type->{$iid};
next unless defined $card;
my $assy = $card_assy->{$iid} || 'unknown';
$e_descr{$iid} = "$card Assembly: $assy";
}
# APs
foreach my $iid ( keys %$ap_name ) {
my $name = $ap_name->{$iid};
next unless defined $name;
my $model = $ap_model->{$iid} || 'AP';
my $loc = $ap_loc->{$iid} || 'unknown';
$e_descr{$iid} = "$model: $name ($loc)";
}
return \%e_descr;
}
sub e_model {
my $aruba = shift;
my $ap_model = $aruba->aruba_ap_model() || {};
my $card_model = $aruba->aruba_card_type() || {};
my %e_model;
# Chassis
$e_model{0} = $aruba->aruba_model();
#Cards
foreach my $iid ( keys %$card_model ) {
my $card = $card_model->{$iid};
next unless defined $card;
$e_model{$iid} = $card;
}
# APs
foreach my $iid ( keys %$ap_model ) {
my $model = $ap_model->{$iid};
next unless defined $model;
$e_model{$iid} = $model;
}
return \%e_model;
}
sub e_type {
my $aruba = shift;
return $aruba->aruba_ap_type() || {};
}
sub e_hwver {
my $aruba = shift;
my $ap_hw = $aruba->aruba_card_hw() || {};
my $ap_fpga = $aruba->aruba_card_fpga() || {};
my $ap_hw_ver = $aruba->aruba_ap_hw_ver() || {};
my %e_hwver;
# Cards
foreach my $iid ( keys %$ap_hw ) {
my $hw = $ap_hw->{$iid};
next unless defined $hw;
my $fpga = $ap_fpga->{$iid} || 'unknown';
$e_hwver{$iid} = "$hw $fpga";
}
# APs
foreach my $idx ( keys %$ap_hw_ver ) {
my $hw_ver = $ap_hw_ver->{$idx};
next unless defined $hw_ver;
$e_hwver{$idx} = "$hw_ver";
}
return \%e_hwver;
}
sub e_swver {
my $aruba = shift;
my $ap_sw_ver = $aruba->aruba_ap_hw_ver() || {};
my %e_swver;
# APs
foreach my $idx ( keys %$ap_sw_ver ) {
my $sw_ver = $ap_sw_ver->{$idx};
next unless defined $sw_ver;
$e_swver{$idx} = "$sw_ver";
}
return \%e_swver;
}
sub e_vendor {
my $aruba = shift;
my $e_idx = $aruba->e_index() || {};
my %e_vendor;
foreach my $iid ( keys %$e_idx ) {
$e_vendor{$iid} = 'aruba';
}
return \%e_vendor;
}
sub e_serial {
my $aruba = shift;
my $ap_serial = $aruba->aruba_ap_serial() || {};
my $card_serial = $aruba->aruba_card_serial() || {};
my %e_serial;
# Chassis
$e_serial{0} = $aruba->serial() || '';
# Cards
foreach my $iid ( keys %$card_serial ) {
my $serial = $card_serial->{$iid};
next unless defined $serial;
$e_serial{$iid} = $serial;
}
# APs
foreach my $iid ( keys %$ap_serial ) {
my $serial = $ap_serial->{$iid};
next unless defined $serial;
$e_serial{$iid} = $serial;
}
return \%e_serial;
}
sub e_pos {
my $aruba = shift;
my $e_idx = $aruba->e_index() || {};
my %e_pos;
# $pos is for AP's, set it high enough that cards come first
my $pos = 100;
foreach my $iid ( sort keys %$e_idx ) {
if ( $iid eq 0 ) {
$e_pos{$iid} = -1;
next;
}
elsif ( $iid =~ /^\d+$/ ) {
$e_pos{$iid} = $iid;
next;
}
else {
$pos++;
$e_pos{$iid} = $pos;
}
}
return \%e_pos;
}
sub e_parent {
my $aruba = shift;
my $e_idx = $aruba->e_index() || {};
my %e_parent;
foreach my $iid ( sort keys %$e_idx ) {
if ( $iid eq 0 ) {
$e_parent{$iid} = 0;
next;
}
else {
$e_parent{$iid} = 1;
}
}
return \%e_parent;
}
# arpnip:
#
# This is the controller snooping on the MAC->IP mappings.
# Pretending this is arpnip data allows us to get MAC->IP
# mappings even for stations that only communicate locally.
# We also use the controller's knowledge of the APs' MAC and
# IP addresses to augment the data.
sub at_paddr {
my $aruba = shift;
my $user_mac = $aruba->aruba_user_bssid();
my $ap_ip = $aruba->aruba_ap_ip();
my %at_paddr;
foreach my $idx ( keys %$user_mac ) {
$idx =~ s/(.\d+){4}$//;
my $mac = join( ":", map { sprintf "%02x", $_ } split /\./, $idx );
next unless $mac;
$at_paddr{$idx} = $mac;
}
foreach my $idx ( keys %$ap_ip ) {
next if ( $ap_ip->{$idx} eq '0.0.0.0' );
my $mac = join( ":", map { sprintf "%02x", $_ } split /\./, $idx );
$at_paddr{$idx} = $mac;
}
return \%at_paddr;
}
sub at_netaddr {
my $aruba = shift;
my $user_mac = $aruba->aruba_user_bssid();
my $ap_ip = $aruba->aruba_ap_ip();
my %at_netaddr;
foreach my $idx ( keys %$ap_ip ) {
next if ( $ap_ip->{$idx} eq '0.0.0.0' );
$at_netaddr{$idx} = $ap_ip->{$idx};
}
foreach my $idx ( keys %$user_mac ) {
my @parts = split( /\./, $idx );
my $iid = join( ".", splice( @parts, 0, 6 ) );
my $ip = join( ".", @parts );
next unless ( $ip =~ /^(\d+\.){3}(\d+)$/ );
next if ( $idx eq '0.0.0.0' );
$at_netaddr{$iid} = $ip;
}
return \%at_netaddr;
}
sub munge_aruba_fqln {
my $loc = shift;
$loc =~ s/\\\.0//g;
return $loc;
}
# The index of wlsxPsePortTable is wlsxPsePortIndex which equals
# ifIndex; however, to emulate POWER-ETHERNET-MIB we need a "module.port"
# index. If ifDescr has the format x/x/x use it to determine the module
# otherwise default to 1. Unfortunately, this means we can't map any
# wlsxPsePortTable leafs directly and partials will not be supported.
sub peth_port_ifindex {
my $aruba = shift;
my $indexes = $aruba->wlsxPsePortAdminStatus();
my $descrs = $aruba->i_description();
my $peth_port_ifindex = {};
foreach my $i ( keys %$indexes ) {
my $descr = $descrs->{$i};
next unless $descr;
my $new_idx = "1.$i";
if ( $descr =~ /(\d+)\/\d+\/\d+/ ) {
$new_idx = "$1.$i";
}
$peth_port_ifindex->{$new_idx} = $i;
}
return $peth_port_ifindex;
}
sub peth_port_admin {
my $aruba = shift;
my $p_index = $aruba->peth_port_ifindex() || {};
my $admin_states = $aruba->wlsxPsePortAdminStatus() || {};
my $peth_port_admin = {};
foreach my $i ( keys %$p_index ) {
my ( $module, $port ) = split( /\./, $i );
my $state = $admin_states->{$port};
if ( $state =~ /enable/ ) {
$peth_port_admin->{$i} = 'true';
}
else {
$peth_port_admin->{$i} = 'false';
}
}
return $peth_port_admin;
}
sub peth_port_neg_power {
my $aruba = shift;
my $p_index = $aruba->peth_port_ifindex() || {};
my $port_alloc = $aruba->wlsxPsePortPowerAllocated() || {};
my $peth_port_neg_power = {};
foreach my $i ( keys %$p_index ) {
my ( $module, $port ) = split( /\./, $i );
my $power = $port_alloc->{$port};
next unless $power;
$peth_port_neg_power->{$i} = $power;
}
return $peth_port_neg_power;
}
sub peth_port_power {
my $aruba = shift;
my $p_index = $aruba->peth_port_ifindex() || {};
my $port_consumed = $aruba->wlsxPsePortPowerConsumed() || {};
my $peth_port_power = {};
foreach my $i ( keys %$p_index ) {
my ( $module, $port ) = split( /\./, $i );
my $power = $port_consumed->{$port};
next unless $power;
$peth_port_power->{$i} = $power;
}
return $peth_port_power;
}
sub peth_port_class {
my $aruba = shift;
my $p_index = $aruba->peth_port_ifindex() || {};
my $port_class = $aruba->wlsxPsePortPdClass() || {};
my $peth_port_class = {};
foreach my $i ( keys %$p_index ) {
my ( $module, $port ) = split( /\./, $i );
my $power = $port_class->{$port};
next unless $power;
$peth_port_class->{$i} = $power;
}
return $peth_port_class;
}
sub peth_port_status {
my $aruba = shift;
my $p_index = $aruba->peth_port_ifindex() || {};
my $admin_states = $aruba->wlsxPsePortState() || {};
my $peth_port_status = {};
foreach my $i ( keys %$p_index ) {
my ( $module, $port ) = split( /\./, $i );
my $state = $admin_states->{$port};
if ( $state eq 'on' ) {
$peth_port_status->{$i} = 'deliveringPower';
}
else {
$peth_port_status->{$i} = 'disabled';
}
}
return $peth_port_status;
}
sub peth_power_status {
my $aruba = shift;
my $partial = shift;
my $watts = $aruba->wlsxPseSlotPowerAvailable($partial) || {};
my $offset = (exists $watts->{0}) ? 1 : 0;
my $peth_power_status = {};
foreach my $i ( keys %$watts ) {
$peth_power_status->{$i + $offset} = 'on';
}
return $peth_power_status;
}
sub peth_power_watts {
my $aruba = shift;
my $partial = shift;
my $watts_total = $aruba->wlsxPseSlotPowerAvailable($partial) || {};
my $offset = (exists $watts_total->{0}) ? 1 : 0;
my $peth_power_watts = {};
foreach my $i ( keys %$watts_total ) {
my $total = $watts_total->{$i};
next unless $total;
$peth_power_watts->{$i + $offset} = $total;
}
return $peth_power_watts;
}
sub peth_power_consumption {
my $aruba = shift;
my $watts = $aruba->wlsxPseSlotPowerConsumption() || {};
my $offset = (exists $watts->{0}) ? 1 : 0;
my $peth_power_consumed = {};
foreach my $i ( keys %$watts ) {
my $total = $watts->{$i};
next unless $total;
$peth_power_consumed->{$i + $offset} = $total;
}
return $peth_power_consumed;
}
1;
__END__
=head1 NAME
SNMP::Info::Layer3::Aruba - SNMP Interface to Aruba wireless switches
=head1 AUTHOR
Eric Miller
=head1 SYNOPSIS
my $aruba = new SNMP::Info(
AutoSpecify => 1,
Debug => 1,
DestHost => 'myswitch',
Community => 'public',
Version => 2
)
or die "Can't connect to DestHost.\n";
my $class = $aruba->class();
print " Using device sub class : $class\n";
=head1 DESCRIPTION
SNMP::Info::Layer3::Aruba is a subclass of SNMP::Info that provides an
interface to Aruba wireless switches. The Aruba platform utilizes
intelligent wireless switches which control thin access points. The thin
access points themselves are unable to be polled for end station information.
This class emulates bridge functionality for the wireless switch. This enables
end station MAC addresses collection and correlation to the thin access point
the end station is using for communication.
For speed or debugging purposes you can call the subclass directly, but not
after determining a more specific class using the method above.
my $aruba = new SNMP::Info::Layer3::Aruba(...);
=head2 Inherited Classes
=over
=item SNMP::Info::Layer3
=back
=head2 Required MIBs
=over
=item F<WLSR-AP-MIB>
=item F<WLSX-IFEXT-MIB>
=item F<WLSX-POE-MIB>
=item F<WLSX-SWITCH-MIB>
=item F<WLSX-SYSTEMEXT-MIB>
=item F<WLSX-USER-MIB>
=item F<WLSX-WLAN-MIB>
=back
=head2 Inherited MIBs
See L<SNMP::Info::Layer3/"Required MIBs"> for its MIB requirements.
=head1 GLOBALS
These are methods that return scalar value from SNMP
=over
=item $aruba->model()
Returns model type. Cross references $aruba->id() with product IDs in the
Aruba MIB.
=item $aruba->vendor()
Returns 'aruba'
=item $aruba->os()
Returns 'airos'
=item $aruba->os_ver()
Returns the software version extracted from C<sysDescr>
=back
=head2 Overrides
=over
=item $aruba->layers()
Returns 00000111. Class emulates Layer 2 and Layer 3functionality for
Thin APs through proprietary MIBs.
=item $aruba->serial()
Returns the device serial number extracted
from C<wlsxSwitchLicenseSerialNumber> or C<wlsxSysExtLicenseSerialNumber>
=back
=head2 Globals imported from SNMP::Info::Layer3
See L<SNMP::Info::Layer3/"GLOBALS"> for details.
=head1 TABLE METHODS
These are methods that return tables of information in the form of a reference
to a hash.
=over
=item $aruba->i_80211channel()
Returns reference to hash. Current operating frequency channel of the radio
interface.
(C<wlanAPRadioChannel>)
=item $aruba->dot11_cur_tx_pwr_mw()
Returns reference to hash. Current transmit power, in milliwatts, of the
radio interface.
(C<wlanAPRadioTransmitPower>)
=item $aruba->i_ssidlist()
Returns reference to hash. SSID's recognized by the radio interface.
(C<wlanAPESSID>)
=item $aruba->i_ssidbcast()
Returns reference to hash. Indicates whether the SSID is broadcast, true or
false.
(C<wlsrHideSSID>)
=item $aruba->i_ssidmac()
With the same keys as i_ssidlist, returns the Basic service set
identification (BSSID), MAC address, the AP is using for the SSID.
=item $aruba->cd11_mac()
Returns client radio interface MAC addresses.
=item $aruba->cd11_sigqual()
Returns client signal quality.
=item $aruba->cd11_txrate()
Returns to hash of arrays. Client transmission speed in Mbs.
=item $aruba->cd11_rxbyte()
Total bytes received by the wireless client.
=item $aruba->cd11_txbyte()
Total bytes transmitted by the wireless client.
=item $aruba->cd11_rxpkt()
Total packets received by the wireless client.
=item $aruba->cd11_txpkt()
Total packets transmitted by the wireless client.
=back
=head2 Overrides
=over
=item $aruba->i_index()
Returns reference to map of IIDs to Interface index.
Extends C<ifIndex> to support APs as device interfaces.
=item $aruba->interfaces()
Returns reference to map of IIDs to ports. Thin APs are implemented as
device interfaces. The thin AP MAC address and radio number
(C<wlanAPRadioNumber>) are combined as the port identifier.
=item $aruba->i_name()
Interface name. Returns (C<ifName>) for Ethernet interfaces and
(C<wlanAPRadioAPName>) for AP interfaces.
=item $aruba->i_description()
Returns reference to map of IIDs to interface descriptions. Returns
C<ifDescr> for Ethernet interfaces and the Fully Qualified Location Name
(C<wlanAPFQLN>) for AP interfaces.
=item $aruba->i_type()
Returns reference to map of IIDs to interface types. Returns
C<ifType> for Ethernet interfaces and C<wlanAPRadioType> for AP
interfaces.
=item $aruba->i_up()
Returns reference to map of IIDs to link status of the interface. Returns
C<ifOperStatus> for Ethernet interfaces and C<wlanAPStatus> for AP
interfaces.
=item $aruba->i_up_admin()
Returns reference to map of IIDs to administrative status of the interface.
Returns C<ifAdminStatus> for Ethernet interfaces and C<wlanAPStatus>
for AP interfaces.
=item $aruba->i_mac()
Interface MAC address. Returns interface MAC address for Ethernet
interfaces of ports and APs.
=item $aruba->i_duplex()
Returns reference to map of IIDs to current link duplex. Ethernet interfaces
only.
=item $aruba->v_index()
Returns VLAN IDs.
=item $aruba->v_name()
Human-entered name for vlans.
=item $aruba->i_vlan()
Returns reference to map of IIDs to VLAN ID of the interface.
=item $aruba->i_vlan_membership()
Returns reference to hash of arrays: key = C<ifIndex>, value = array of VLAN
IDs. These are the VLANs for which the port is a member.
=item $aruba->i_vlan_membership_untagged()
Returns reference to hash of arrays: key = C<ifIndex>, value = array of VLAN
IDs. These are the VLANs which are members of the untagged egress list for
the port.
=item $aruba->bp_index()
Augments the bridge MIB by returning reference to a hash containing the
index mapping of BSSID to device port (AP).
=item $aruba->fw_port()
Augments the bridge MIB by including the BSSID a wireless end station is
communicating through (C<nUserApBSSID>).
=item $aruba->fw_mac()
Augments the bridge MIB by including the wireless end station MAC
(C<nUserApBSSID>) as extracted from the IID.
=item $aruba->qb_fw_vlan()
Augments the bridge MIB by including wireless end station VLANs
(C<nUserCurrentVlan>).
=back
=head2 Pseudo F<ENTITY-MIB> information
These methods emulate F<ENTITY-MIB> Physical Table methods using
F<WLSX-WLAN-MIB> and F<WLSX-SYSTEMEXT-MIB>. APs are included as
subcomponents of the wireless controller.
=over
=item $aruba->e_index()
Returns reference to hash. Key: IID and Value: Integer. The index for APs is
created with an integer representation of the last three octets of the
AP MAC address.
=item $aruba->e_class()
Returns reference to hash. Key: IID, Value: General hardware type. Returns
'ap' for wireless access points.
=item $aruba->e_name()
More computer friendly name of entity. Name is 'WLAN Controller' for the
chassis, Card # for modules, or 'AP'.
=item $aruba->e_descr()
Returns reference to hash. Key: IID, Value: Human friendly name.
=item $aruba->e_model()
Returns reference to hash. Key: IID, Value: Model name.
=item $aruba->e_type()
Returns reference to hash. Key: IID, Value: Type of component.
=item $aruba->e_hwver()
Returns reference to hash. Key: IID, Value: Hardware revision.
=item $aruba->e_swver()
Returns reference to hash. Key: IID, Value: Software revision.
=item $aruba->e_vendor()
Returns reference to hash. Key: IID, Value: aruba.
=item $aruba->e_serial()
Returns reference to hash. Key: IID, Value: Serial number.
=item $aruba->e_pos()
Returns reference to hash. Key: IID, Value: The relative position among all
entities sharing the same parent. Chassis cards are ordered to come before
APs.
=item $aruba->e_parent()
Returns reference to hash. Key: IID, Value: The value of e_index() for the
entity which 'contains' this entity.
=back
=head2 Power Over Ethernet Port Table
These methods emulate the F<POWER-ETHERNET-MIB> Power Source Entity (PSE)
Port Table C<pethPsePortTable> methods using the F<WLSX-POE-MIB> Power
over Ethernet Port Table C<wlsxPsePortTable>.
=over
=item $aruba->peth_port_ifindex()
Creates an index of module.port to align with the indexing of the
C<wlsxPsePortTable> with a value of C<ifIndex>. The module defaults 1
if otherwise unknown.
=item $aruba->peth_port_admin()
Administrative status: is this port permitted to deliver power?
C<wlsxPsePortAdminStatus>
=item $aruba->peth_port_status()
Current status: is this port delivering power.
=item $aruba->peth_port_class()
Device class: if status is delivering power, this represents the 802.3af
class of the device being powered.
=item $aruba->peth_port_neg_power()
The power, in milliwatts, that has been committed to this port.
This value is derived from the 802.3af class of the device being
powered.
=item $aruba->peth_port_power()
The power, in milliwatts, that the port is delivering.
=back
=head2 Power Over Ethernet Module Table
These methods emulate the F<POWER-ETHERNET-MIB> Main Power Source Entity
(PSE) Table C<pethMainPseTable> methods using the F<WLSX-POE-MIB> Power
over Ethernet Port Table C<wlsxPseSlotTable>.
=over
=item $aruba->peth_power_watts()
The power supply's capacity, in watts.
=item $aruba->peth_power_status()
The power supply's operational status.
=item $aruba->peth_power_consumption()
How much power, in watts, this power supply has been committed to
deliver.
=back
=head2 Arp Cache Table Augmentation
The controller has knowledge of MAC->IP mappings for wireless clients.
Augmenting the arp cache data with these MAC->IP mappings enables visibility
for stations that only communicate locally. We also capture the AP MAC->IP
mappings.
=over
=item $aruba->at_paddr()
Adds MAC addresses extracted from the index of C<nUserApBSSID>.
=item $aruba->at_netaddr()
Adds IP addresses extracted from the index of C<nUserApBSSID>.
=back
=head2 Table Methods imported from SNMP::Info::Layer3
See L<SNMP::Info::Layer3/"TABLE METHODS"> for details.
=head1 Data Munging Callback Subroutines
=over
=item $aruba->munge_aruba_fqln()
Remove nulls encoded as '\.0' from the Fully Qualified Location Name
(C<wlanAPFQLN>).
=back
=cut
| 23.756933 | 89 | 0.618371 |
ed05f6497616601c3e5b86c795059b5ded72e7fe | 661 | pl | Perl | examples/Perl/taskvent.pl | gaubert/zguide | e24c02481c47b129a37f261d1109140572f255f4 | [
"Zed",
"X11",
"MIT"
] | 1 | 2015-11-05T03:41:04.000Z | 2015-11-05T03:41:04.000Z | examples/Perl/taskvent.pl | gaubert/zguide | e24c02481c47b129a37f261d1109140572f255f4 | [
"Zed",
"X11",
"MIT"
] | null | null | null | examples/Perl/taskvent.pl | gaubert/zguide | e24c02481c47b129a37f261d1109140572f255f4 | [
"Zed",
"X11",
"MIT"
] | null | null | null | No-one has translated the taskvent example into Perl yet. Be the first to create
taskvent in Perl and get one free Internet! If you're the author of the Perl
binding, this is a great way to get people to use 0MQ in Perl.
To submit a new translation email it to zeromq-dev@lists.zeromq.org. Please:
* Stick to identical functionality and naming used in examples so that readers
can easily compare languages.
* You MUST place your name as author in the examples so readers can contact you.
* You MUST state in the email that you license your code under the MIT/X11
license.
Subscribe to this list at http://lists.zeromq.org/mailman/listinfo/zeromq-dev.
| 47.214286 | 81 | 0.77761 |
ed8c929c16b3819e385d3aada186d906324dfe6d | 8,018 | pm | Perl | CloverPackage/package/bin/po4a/lib/Locale/Po4a/Xhtml.pm | harperse/CloverBootloader | 8d1baad2a62c66aae776cfd45d832399632c299e | [
"BSD-2-Clause"
] | null | null | null | CloverPackage/package/bin/po4a/lib/Locale/Po4a/Xhtml.pm | harperse/CloverBootloader | 8d1baad2a62c66aae776cfd45d832399632c299e | [
"BSD-2-Clause"
] | null | null | null | CloverPackage/package/bin/po4a/lib/Locale/Po4a/Xhtml.pm | harperse/CloverBootloader | 8d1baad2a62c66aae776cfd45d832399632c299e | [
"BSD-2-Clause"
] | null | null | null | #!/usr/bin/perl
# Po4a::Xhtml.pm
#
# extract and translate translatable strings from XHTML documents.
#
# This code extracts plain text from tags and attributes from strict XHTML
# documents.
#
# Copyright (c) 2005 by Yves Rütschlé <po4a@rutschle.net>
# Copyright (c) 2007-2008 by Nicolas François <nicolas.francois@centraliens.net>
#
# This program is free software; you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
# the Free Software Foundation; either version 2 of the License, or
# (at your option) any later version.
#
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
#
# You should have received a copy of the GNU General Public License
# along with this program; if not, write to the Free Software
# Foundation, Inc., 675 Mass Ave, Cambridge, MA 02139, USA.
#
########################################################################
=encoding UTF-8
=head1 NAME
Locale::Po4a::Xhtml - convert XHTML documents from/to PO files
=head1 DESCRIPTION
The po4a (PO for anything) project goal is to ease translations (and more
interestingly, the maintenance of translations) using gettext tools on
areas where they were not expected like documentation.
Locale::Po4a::Xhtml is a module to help the translation of XHTML documents into
other [human] languages.
=head1 OPTIONS ACCEPTED BY THIS MODULE
These are this module's particular options:
=over 4
=item B<includessi>[B<=>I<rootpath>]
Include files specified by an include SSI (Server Side Includes) element
(e.g. <!--#include virtual="/foo/bar.html" -->).
B<Note:> You should use it only for static files.
An additional I<rootpath> parameter can be specified. It specifies the root
path to find files included by a B<virtual> attribute.
=back
=head1 STATUS OF THIS MODULE
This module is fully functional, as it relies in the L<Locale::Po4a::Xml>
module. This only defines the translatable tags and attributes.
"It works for me", which means I use it successfully on my personal Web site.
However, YMMV: please let me know if something doesn't work for you. In
particular, tables are getting no testing whatsoever, as we don't use them.
=head1 SEE ALSO
L<Locale::Po4a::TransTractor(3pm)>, L<Locale::Po4a::Xml(3pm)>, L<po4a(7)|po4a.7>
=head1 AUTHORS
Yves Rütschlé <po4a@rutschle.net>
Nicolas François <nicolas.francois@centraliens.net>
=head1 COPYRIGHT AND LICENSE
Copyright (c) 2004 by Yves Rütschlé <po4a@rutschle.net>
Copyright (c) 2007-2008 by Nicolas François <nicolas.francois@centraliens.net>
This program is free software; you may redistribute it and/or modify it
under the terms of GPL (see the COPYING file).
=cut
package Locale::Po4a::Xhtml;
use 5.006;
use strict;
use warnings;
use Locale::Po4a::Xml;
use vars qw(@tag_types);
*tag_types = \@Locale::Po4a::Xml::tag_types;
use Locale::Po4a::Common;
use Carp qw(croak);
use vars qw(@ISA);
@ISA = qw(Locale::Po4a::Xml);
sub tag_extract_SSI {
my ($self,$remove)=(shift,shift);
my ($eof,@tag)=$self->get_string_until("-->",
{include=>1,
remove=>$remove,
unquoted=>1});
my ($t,$r) = @tag;
if ($t =~ m/<!--#include (file|virtual)="(.*?)"\s-->/s) {
my $includefile;
if ($1 eq "file") {
$includefile = ".";
} else {
$includefile = $self->{options}{'includessi'};
}
$includefile .= $2;
if (!$remove) {
$self->get_string_until("-->",
{include=>1,
remove=>1,
unquoted=>1});
}
my $linenum=0;
my @include;
open (my $in, $includefile)
or croak wrap_mod("po4a::xml",
dgettext("po4a", "Can't read from %s: %s"),
$includefile, $!);
while (defined (my $includeline = <$in>)) {
$linenum++;
my $includeref=$includefile.":$linenum";
push @include, ($includeline,$includeref);
}
close $in
or croak wrap_mod("po4a::xml",
dgettext("po4a", "Can't close %s after reading: %s"),
$includefile, $!);
while (@include) {
my ($ir, $il) = (pop @include, pop @include);
$self->unshiftline($il,$ir);
}
$t =~ s/<!--#include/<!-- SSI included by po4a: /;
$self->unshiftline($t, $r);
}
return ($eof,@tag);
}
sub initialize {
my $self = shift;
my %options = @_;
$self->{options}{'includessi'}='';
$self->SUPER::initialize(%options);
$self->{options}{'wrap'}=1;
$self->{options}{'doctype'}=$self->{options}{'doctype'} || 'html';
# Default tags are translated (text rewrapped), and introduce a
# break.
# The following list indicates the list of tags which should be
# translated without rewrapping.
$self->{options}{'_default_translated'}.='
W<pre>
';
# The following list indicates the list of tags which should be
# translated inside the current block, whithout introducing a
# break.
$self->{options}{'_default_inline'}.='
<a>
<abbr>
<acronym>
<b>
<big>
<bdo>
<button>
<cite>
<code>
<del>
<dfn>
<em>
<i>
<ins>
<input>
<kbd>
<label>
<object>
<q>
<samp>
<select>
<small>
<span>
<strong>
<sub>
<sup>
<textarea>
<tt>
<u>
<var>
';
# Ignored tags: <img>
# Technically, <img> is an inline tag, but setting it as such is
# annoying, and not usually useful, unless you use images to
# write text (in which case you have bigger problems than this
# program not inlining img: you now have to translate all your
# images. That'll teach you).
# If you choose to translate images, you may also want to set
# <map> as placeholder and <area> as inline.
$self->{options}{'_default_attributes'}.='
alt
lang
title
';
$self->treat_options;
if ( defined $self->{options}{'includessi'}
and length $self->{options}{'includessi'}) {
foreach (@tag_types) {
if ($_->{beginning} eq "!--#") {
$_->{f_extract} = \&tag_extract_SSI;
}
}
# FIXME: the directory may be named "1" ;(
if ($self->{options}{'includessi'} eq "1") {
$self->{options}{'includessi'} = ".";
}
}
}
| 33.689076 | 81 | 0.50424 |
ed1333f781f14a157d367a8c2cc8d8d2d0e0f73c | 2,595 | pm | Perl | auto-lib/Paws/LexModels/GetSlotTypeResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 164 | 2015-01-08T14:58:53.000Z | 2022-02-20T19:16:24.000Z | auto-lib/Paws/LexModels/GetSlotTypeResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 348 | 2015-01-07T22:08:38.000Z | 2022-01-27T14:34:44.000Z | auto-lib/Paws/LexModels/GetSlotTypeResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 87 | 2015-04-22T06:29:47.000Z | 2021-09-29T14:45:55.000Z |
package Paws::LexModels::GetSlotTypeResponse;
use Moose;
has Checksum => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'checksum');
has CreatedDate => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'createdDate');
has Description => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'description');
has EnumerationValues => (is => 'ro', isa => 'ArrayRef[Paws::LexModels::EnumerationValue]', traits => ['NameInRequest'], request_name => 'enumerationValues');
has LastUpdatedDate => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'lastUpdatedDate');
has Name => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'name');
has ParentSlotTypeSignature => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'parentSlotTypeSignature');
has SlotTypeConfigurations => (is => 'ro', isa => 'ArrayRef[Paws::LexModels::SlotTypeConfiguration]', traits => ['NameInRequest'], request_name => 'slotTypeConfigurations');
has ValueSelectionStrategy => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'valueSelectionStrategy');
has Version => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'version');
has _request_id => (is => 'ro', isa => 'Str');
1;
### main pod documentation begin ###
=head1 NAME
Paws::LexModels::GetSlotTypeResponse
=head1 ATTRIBUTES
=head2 Checksum => Str
Checksum of the C<$LATEST> version of the slot type.
=head2 CreatedDate => Str
The date that the slot type was created.
=head2 Description => Str
A description of the slot type.
=head2 EnumerationValues => ArrayRef[L<Paws::LexModels::EnumerationValue>]
A list of C<EnumerationValue> objects that defines the values that the
slot type can take.
=head2 LastUpdatedDate => Str
The date that the slot type was updated. When you create a resource,
the creation date and last update date are the same.
=head2 Name => Str
The name of the slot type.
=head2 ParentSlotTypeSignature => Str
The built-in slot type used as a parent for the slot type.
=head2 SlotTypeConfigurations => ArrayRef[L<Paws::LexModels::SlotTypeConfiguration>]
Configuration information that extends the parent built-in slot type.
=head2 ValueSelectionStrategy => Str
The strategy that Amazon Lex uses to determine the value of the slot.
For more information, see PutSlotType.
Valid values are: C<"ORIGINAL_VALUE">, C<"TOP_RESOLUTION">
=head2 Version => Str
The version of the slot type.
=head2 _request_id => Str
=cut
| 30.529412 | 175 | 0.696724 |
edab58769cb5b57c90a1d1d36a62c69bbdb065f4 | 1,032 | pl | Perl | gen_traces.pl | rispoli/nesy | 324172e705d3eb59383088a54c674011c0eab9a0 | [
"Unlicense"
] | 1 | 2020-03-10T10:16:15.000Z | 2020-03-10T10:16:15.000Z | gen_traces.pl | rispoli/nesy | 324172e705d3eb59383088a54c674011c0eab9a0 | [
"Unlicense"
] | null | null | null | gen_traces.pl | rispoli/nesy | 324172e705d3eb59383088a54c674011c0eab9a0 | [
"Unlicense"
] | null | null | null | :- [nn2m].
gen_traces(HowMany, Length, NRules, Observations, Output) :-
rule_placeholder(NRules, Rules_Placeholder),
io_layer(Rules_Placeholder, Observations, IO_layer, _),
tell(Output),
print_n_traces(HowMany, Length, IO_layer, Observations),
told.
rule_placeholder(0, []) :- !.
rule_placeholder(N, [r(_) | Ps]) :-
N_ is N - 1, rule_placeholder(N_, Ps).
print_n_traces(0, _, _, _) :- !.
print_n_traces(HowMany, Length, IO_layer, Observations) :-
gen_trace_of_length(Length, Observations, Trace),
print_trace(Trace, IO_layer, 'trace = ['),
HowMany_ is HowMany - 1,
print_n_traces(HowMany_, Length, IO_layer, Observations).
gen_trace_of_length(0, _, []) :- !.
gen_trace_of_length(Length, Observations, [Rand_Ob | Output]) :-
take_obs_rand(Observations, Rand_Ob),
Length_ is Length - 1,
gen_trace_of_length(Length_, Observations, Output).
take_obs_rand([], []).
take_obs_rand([H_ | T], [H | O]) :-
R is random(2),
((R = 1) -> H = H_; H = -H_),
take_obs_rand(T, O).
| 32.25 | 64 | 0.668605 |
ed6200d9bb17e2783a8890ba9d1d20c08ea49418 | 1,880 | al | Perl | benchmark/benchmarks/FASP-benchmarks/data/random/random-0302-120-492.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/random/random-0302-120-492.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/random/random-0302-120-492.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | 1 10 31 33 46 111
2 32 40 116
3 32 43 68 107 116
4 32 100
5 9 25 35 79 93
6 58 61
7 11 43 56 86 90 112
8 5 27 86 93
9
10 41 61 85 98
11 4 45 86 102
12 2 46 68 74 97
13 1 11 40 49 100
14 22 52 86 102 119
15 13 35 48 94
16
17 7 36 84 98
18 5 118
19 32 34 36 52 66 69
20 7 64
21 14 63 84 99
22 11 18 38 58 60
23 25 47 59 96
24 20
25 16 99 102
26 11 58 74 90
27 70 86 97 120
28 48 64 89 100
29 12 23 30 35 52 54 62 119
30 24 54 84 111
31 9 14 18 70 77 113
32 93
33 45 69 90
34 56 80 90
35 20 25 79 95
36 18 57 89
37 19 26 114
38 3 35 65 95 99 102 107 110
39 40 45 62 71 86 87 100 111 117
40 11 49 105
41 9 36 84
42 13 28 49 56 83 89
43 1 11 21 45 69 95
44 4 26 30 58 72 77 87
45 16 35 50 66 98
46 3 21 34 45 63 77 85 87
47 26 57 62
48 24 63 71
49 17 30 67 88 101 116 120
50 17 39 100
51 80 111
52 10 42 46
53 1 6 24 101 116 119
54 19 29 39 55 87
55 24 99
56 99
57 40 61 88 92
58 17 29 47 87 96 105 118
59 26 65 82 89
60 37 64
61 15 21 27 32 63 81 91 111
62 23 26 38 58 103
63 8 38 46 114
64 30 71
65 25 82 102
66 12 16 40 55 91 96 111
67 5 43 55 62 82
68 39 49 56 101 107
69 4 17 40 48 107 116
70 17 48 56
71 5 32 91
72 12 21 59 98 111
73 7 30 89 92 96 111 118
74 19 35 73 79 81 91 102
75 5 10 19 35
76 8 27 73
77 3 7 32 45 99
78 1 2 7 22 62 89 95
79 2 36 110
80 22 42 84 88
81 10 51
82 29 44 84 88 96 103
83 4 19 90
84 71
85 8 18 19 91 109 111
86 19 74 87
87 29 39 60 98
88
89 63 81 91 96 114
90 72 112
91 88 97 102
92 24 113 120
93 7 48 73 117 119
94 8 52 70 78 112
95 16 44 50 53 108
96 24 59 64 75 80 84 117
97 14
98 8 55 60 96 113 119
99 46 115
100 4 29 42 67
101 33 46 53 81 86 92
102 54 55 57
103 30 64 65 84 86
104 38 107
105 29 59
106 13 19 27 65 70 76
107 39 43 72 79 117
108 1 3
109 33 39 81 88 120
110 96 115
111 39 86
112 51 81
113
114 2 30 37
115 12 18 24 90
116 29 31 50 58 61 74 93 108
117 16 44 49 66 95 107
118 4 12 44 51 84 101
119 8 20 33 41 55 76 105
120 13 38 96 | 15.666667 | 32 | 0.675 |
ed54670e82e9c692a24c3152c8887e8d12131cc5 | 954 | t | Perl | tests/directedgraph/callback.t | Gaia-Interactive/gaia_core_php | c6ef27682e4ed96cd8d55ae4649e9ed59d18e02a | [
"BSD-3-Clause"
] | 3 | 2015-02-23T19:57:07.000Z | 2020-07-13T16:02:01.000Z | tests/directedgraph/callback.t | Gaia-Interactive/gaia_core_php | c6ef27682e4ed96cd8d55ae4649e9ed59d18e02a | [
"BSD-3-Clause"
] | null | null | null | tests/directedgraph/callback.t | Gaia-Interactive/gaia_core_php | c6ef27682e4ed96cd8d55ae4649e9ed59d18e02a | [
"BSD-3-Clause"
] | 4 | 2015-03-03T08:14:12.000Z | 2019-01-09T04:46:43.000Z | #!/usr/bin/env php
<?php
include_once __DIR__ . '/../common.php';
use Gaia\Test\Tap;
use Gaia\DirectedGraph\Node;
use Gaia\DirectedGraph\Execution;
Tap::plan(4);
// one --> two --> three
// | |
// +---<---+
class TestCallee {
public $invoke = 0;
public function run(){ $this->invoke++; }
}
$callee = new TestCallee;
$action_callee = new TestCallee;
$acb = array($action_callee, 'run');
$one = new Node( array( $callee, 'run') );
$two = new Node( array( $callee, 'run') );
$one->add('leave-node', $acb);
$two->add('enter-node', $acb);
$one->add("continue",$two);
$execution = new Execution($one);
Tap::ok($one === $execution->node, 'at the start, on the first node');
$execution->event("continue");
Tap::ok($two === $execution->node, 'after continue, at the second node');
Tap::ok($callee->invoke == 1, 'after continue, the callee has been invoked once');
Tap::ok($action_callee->invoke == 2, 'two action callbacks have been fired');
| 28.058824 | 82 | 0.637317 |
eda87c87e39b6cf405fb801db2e1cfafd844c730 | 6,875 | pm | Perl | modules/Bio/EnsEMBL/Analysis/Hive/RunnableDB/HiveBaseRunnableDB.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Analysis/Hive/RunnableDB/HiveBaseRunnableDB.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Analysis/Hive/RunnableDB/HiveBaseRunnableDB.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | #!/usr/bin/env perl
# Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
package Bio::EnsEMBL::Analysis::Hive::RunnableDB::HiveBaseRunnableDB;
use strict;
use Carp;
use Bio::EnsEMBL::Hive::Utils ('stringify');
use Bio::EnsEMBL::Utils::Exception qw(verbose throw warning info);
use Bio::EnsEMBL::Analysis::Tools::FeatureFactory;
use feature 'say';
use parent ('Bio::EnsEMBL::Hive::Process');
sub run {
my ($self) = @_;
foreach my $runnable(@{$self->runnable}){
$runnable->run;
$self->output($runnable->output);
}
return $self->param('output');
}
sub output {
my ($self, $output) = @_;
unless($self->param_is_defined('_output')){
$self->param('_output',[]);
}
if($output){
if(ref($output) ne 'ARRAY'){
throw('Must pass RunnableDB:output an array ref not a '.$output);
}
push(@{$self->param('_output')}, @$output);
}
return $self->param('_output');
}
sub runnable {
my ($self, $runnable) = @_;
if(!$self->param('runnable')){
$self->param('runnable',[]);
}
if($runnable){
unless($runnable->isa('Bio::EnsEMBL::Analysis::Runnable')) {
throw("Must pass RunnableDB:runnable a Bio::EnsEMBL::Analysis::Runnable not a ".$runnable);
}
push(@{$self->param('runnable')}, $runnable);
}
return $self->param('runnable');
}
sub query {
my $self = shift;
my $slice = shift;
if($slice) {
unless($slice->isa('Bio::EnsEMBL::Slice')) {
throw("Must pass RunnableDB:query a Bio::EnsEMBL::Slice not a ".$slice);
}
$self->param('slice',$slice);
}
return $self->param('slice');
}
sub analysis {
my $self = shift;
my $analysis = shift;
if($analysis){
unless($analysis->isa('Bio::EnsEMBL::Analysis')) {
throw("Must pass RunnableDB:analysis a Bio::EnsEMBL::Analysis not a ".$analysis);
}
$self->param('analysis',$analysis);
}
return $self->param('analysis');
}
sub input_id {
my $self = shift;
my $value = shift;
# Note this sub is special. It overrides Hive::Process::input_id and parses the hive input_id into
# a normal genebuild style input_id. The issue here is that for the moment I'm going to make this
# a getter and not a setter as the two functions are somewhat different in this context. It would
# be wrong to have the get function look for and parse the hive input id but then allow the set
# function to set a new input id. Also a point to note is that overriding input_id in Process
# should be fine as it is not the input_id call that the hive itself uses
my $input_id_string = $self->Bio::EnsEMBL::Hive::Process::input_id;
unless($input_id_string =~ /.+\=\>.+\"(.+)\"/) {
throw("Could not parse the value from the input id. Input id string:\n".$input_id_string);
}
$input_id_string = $1;
return($input_id_string);
}
sub hrdb_set_con {
my ($self,$dba,$dba_con_name) = @_;
unless($dba->isa('Bio::EnsEMBL::DBSQL::DBAdaptor')) {
throw("Expected a DBAdaptor object as input. If you want to retrieve a DBAdaptor then ".
"use the getter sub instead (hrdb_get_con)");
}
if($dba_con_name){
$self->param('_'.$dba_con_name,$dba);
} else {
$self->param('_hrdbadaptor',$dba);
}
}
sub hrdb_get_con {
my ($self,$dba_con_name) = @_;
if($dba_con_name) {
return $self->param('_'.$dba_con_name);
} else {
return $self->param('_hrdbadaptor');
}
}
sub hrdb_get_dba {
my ($self,$connection_info) = @_;
my $dba;
if(ref($connection_info)=~ m/HASH/) {
eval {
$dba = new Bio::EnsEMBL::DBSQL::DBAdaptor(%$connection_info);
};
if($@) {
throw("Error while setting up database connection:\n".$@);
}
} else {
throw("DB connection info passed in was not a hash:\n".$connection_info);
}
$dba->dbc->disconnect_when_inactive(1);
return $dba;
}
sub feature_factory {
my ($self, $feature_factory) = @_;
if($feature_factory) {
$self->param('feature_factory',$feature_factory);
}
if(!$self->param('feature_factory')) {
$self->param('feature_factory',Bio::EnsEMBL::Analysis::Tools::FeatureFactory->new());
}
return $self->param('feature_factory');
}
sub fetch_sequence {
my ($self, $name, $db, $repeat_masking, $soft_masking) = @_;
if(!$db){
$db = $self->db;
}
if(!$name){
$name = $self->parse_hive_input_id;
}
my $sa = $db->get_SliceAdaptor;
my $slice = $sa->fetch_by_name($name);
$repeat_masking = [] unless($repeat_masking);
if(!$slice){
throw("Failed to fetch slice ".$name);
}
if(@$repeat_masking){
my $sequence = $slice->get_repeatmasked_seq($repeat_masking, $soft_masking);
$slice = $sequence
}
return $slice;
}
sub parameters_hash {
my ($self, $string) = @_;
if(!$string){
$string = $self->analysis->parameters;
}
my %parameters_hash;
if ($string) {
if($string =~ /,/ || $string =~ /=>/){
my @pairs = split (/,/, $string);
foreach my $pair(@pairs){
my ($key, $value) = split (/=>/, $pair);
if ($key && ($value || $value eq '0')) {
$key =~ s/^\s+//g;
$key =~ s/\s+$//g;
$value =~ s/^\s+//g;
$value =~ s/\s+$//g;
$parameters_hash{$key} = $value;
} else {
$parameters_hash{$key} = 1;
}
}
}else{
$parameters_hash{'-options'} = $string;
}
}
return \%parameters_hash;
}
sub require_module {
my ($self, $module) = @_;
my $class;
($class = $module) =~ s/::/\//g;
eval{
require "$class.pm";
};
throw("Couldn't require ".$class." Blast:require_module $@") if($@);
return $module;
}
sub ignore_config_file {
my $self = shift;
my $value = shift;
if($value) {
$self->param('ignore_config',$value) = shift if(@_);
}
return $self->param('ignore_config');
}
sub no_config_exception {
my $self = shift;
my $value = shift;
if($value) {
$self->param('no_config_exception',$value);
}
return $self->param('no_config_exception');
}
sub input_is_void {
my $self = shift;
my $value = shift;
if($value) {
$self->param('input_is_void',$value);
}
return $self->param('input_is_void');
}
sub failing_job_status {
my $self = shift;
my $value = shift;
if($value) {
$self->param('failing_status',$value);
}
return $self->param('failing_status');
}
1;
| 25.091241 | 102 | 0.625309 |
ed3b988fe138ab27ca87431cb204074e2bebb769 | 7,093 | al | Perl | Modules/System/Azure Blob Services API/src/Helper/ABSHttpContentHelper.Codeunit.al | manjulchauhan/ALAppExtensions | 3f2f1d6e5337188b1af9c0275420f1c1de036a7f | [
"MIT"
] | 127 | 2018-04-17T18:03:03.000Z | 2019-05-06T18:54:17.000Z | Modules/System/Azure Blob Services API/src/Helper/ABSHttpContentHelper.Codeunit.al | snu-development/ALAppExtensions | 371a27fe48483be776642dde19483a87ae27289c | [
"MIT"
] | 2,279 | 2018-09-12T12:01:49.000Z | 2019-05-06T13:59:35.000Z | Modules/System/Azure Blob Services API/src/Helper/ABSHttpContentHelper.Codeunit.al | snu-development/ALAppExtensions | 371a27fe48483be776642dde19483a87ae27289c | [
"MIT"
] | 41 | 2018-05-17T11:19:52.000Z | 2019-04-30T17:30:38.000Z | // ------------------------------------------------------------------------------------------------
// Copyright (c) Microsoft Corporation. All rights reserved.
// Licensed under the MIT License. See License.txt in the project root for license information.
// ------------------------------------------------------------------------------------------------
codeunit 9049 "ABS HttpContent Helper"
{
Access = Internal;
var
ContentLengthLbl: Label '%1', Comment = '%1 = Length', Locked = true;
[NonDebuggable]
procedure AddBlobPutBlockBlobContentHeaders(var HttpContent: HttpContent; ABSOperationPayload: Codeunit "ABS Operation Payload"; var SourceInStream: InStream)
var
BlobType: Enum "ABS Blob Type";
begin
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, SourceInStream, BlobType::BlockBlob)
end;
[NonDebuggable]
procedure AddBlobPutBlockBlobContentHeaders(var HttpContent: HttpContent; ABSOperationPayload: Codeunit "ABS Operation Payload"; SourceText: Text)
var
BlobType: Enum "ABS Blob Type";
begin
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, SourceText, BlobType::BlockBlob)
end;
[NonDebuggable]
procedure AddBlobPutPageBlobContentHeaders(ABSOperationPayload: Codeunit "ABS Operation Payload"; ContentLength: Integer; ContentType: Text)
var
BlobType: Enum "ABS Blob Type";
HttpContent: HttpContent;
begin
if ContentLength = 0 then
ContentLength := 512;
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, BlobType::PageBlob, ContentLength, ContentType)
end;
[NonDebuggable]
procedure AddBlobPutAppendBlobContentHeaders(ABSOperationPayload: Codeunit "ABS Operation Payload"; ContentType: Text)
var
BlobType: Enum "ABS Blob Type";
HttpContent: HttpContent;
begin
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, BlobType::AppendBlob, 0, ContentType)
end;
[NonDebuggable]
local procedure AddBlobPutContentHeaders(var HttpContent: HttpContent; ABSOperationPayload: Codeunit "ABS Operation Payload"; var SourceInStream: InStream; BlobType: Enum "ABS Blob Type")
var
Length: Integer;
begin
// Do this before calling "GetContentLength", because for some reason the system errors out with "Cannot access a closed Stream."
HttpContent.WriteFrom(SourceInStream);
Length := GetContentLength(SourceInStream);
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, BlobType, Length, 'application/octet-stream');
end;
[NonDebuggable]
local procedure AddBlobPutContentHeaders(var HttpContent: HttpContent; ABSOperationPayload: Codeunit "ABS Operation Payload"; SourceText: Text; BlobType: Enum "ABS Blob Type")
var
Length: Integer;
begin
HttpContent.WriteFrom(SourceText);
Length := GetContentLength(SourceText);
AddBlobPutContentHeaders(HttpContent, ABSOperationPayload, BlobType, Length, 'text/plain; charset=UTF-8');
end;
[NonDebuggable]
local procedure AddBlobPutContentHeaders(var HttpContent: HttpContent; ABSOperationPayload: Codeunit "ABS Operation Payload"; BlobType: Enum "ABS Blob Type"; ContentLength: Integer; ContentType: Text)
var
Headers: HttpHeaders;
BlobServiceAPIOperation: Enum "ABS Operation";
begin
if ContentType = '' then
ContentType := 'application/octet-stream';
HttpContent.GetHeaders(Headers);
if not (ABSOperationPayload.GetOperation() in [BlobServiceAPIOperation::PutPage]) then
ABSOperationPayload.AddContentHeader('HttpContent-Type', ContentType);
case BlobType of
BlobType::PageBlob:
begin
ABSOperationPayload.AddRequestHeader('x-ms-blob-content-length', StrSubstNo(ContentLengthLbl, ContentLength));
ABSOperationPayload.AddContentHeader('HttpContent-Length', StrSubstNo(ContentLengthLbl, 0));
end;
else
ABSOperationPayload.AddContentHeader('HttpContent-Length', StrSubstNo(ContentLengthLbl, ContentLength));
end;
if not (ABSOperationPayload.GetOperation() in [BlobServiceAPIOperation::PutBlock, BlobServiceAPIOperation::PutPage, BlobServiceAPIOperation::AppendBlock]) then
ABSOperationPayload.AddRequestHeader('x-ms-blob-type', Format(BlobType));
end;
[NonDebuggable]
procedure AddTagsContent(var HttpContent: HttpContent; var ABSOperationPayload: Codeunit "ABS Operation Payload"; Document: XmlDocument)
begin
AddXmlDocumentAsContent(HttpContent, ABSOperationPayload, Document);
end;
[NonDebuggable]
procedure AddBlockListContent(var HttpContent: HttpContent; var ABSOperationPayload: Codeunit "ABS Operation Payload"; Document: XmlDocument)
begin
AddXmlDocumentAsContent(HttpContent, ABSOperationPayload, Document);
end;
[NonDebuggable]
local procedure AddXmlDocumentAsContent(var HttpContent: HttpContent; var ABSOperationPayload: Codeunit "ABS Operation Payload"; Document: XmlDocument)
var
Headers: HttpHeaders;
Length: Integer;
DocumentAsText: Text;
begin
DocumentAsText := Format(Document);
Length := StrLen(DocumentAsText);
HttpContent.WriteFrom(DocumentAsText);
HttpContent.GetHeaders(Headers);
ABSOperationPayload.AddContentHeader('HttpContent-Type', 'application/xml');
ABSOperationPayload.AddContentHeader('HttpContent-Length', Format(Length));
end;
[NonDebuggable]
procedure ContentSet(HttpContent: HttpContent): Boolean
var
VarContent: Text;
begin
HttpContent.ReadAs(VarContent);
if StrLen(VarContent) > 0 then
exit(true);
exit(VarContent <> '');
end;
/// <summary>
/// Retrieves the length of the given stream (used for "HttpContent-Length" header in PUT-operations)
/// </summary>
/// <param name="SourceInStream">The InStream for Request Body.</param>
/// <returns>The length of the current stream</returns>
[NonDebuggable]
local procedure GetContentLength(var SourceInStream: InStream): Integer
var
MemoryStream: DotNet MemoryStream;
Length: Integer;
begin
// Load the memory stream and get the size
MemoryStream := MemoryStream.MemoryStream();
CopyStream(MemoryStream, SourceInStream);
Length := MemoryStream.Length();
Clear(SourceInStream);
exit(Length);
end;
/// <summary>
/// Retrieves the length of the given stream (used for "HttpContent-Length" header in PUT-operations)
/// </summary>
/// <param name="SourceText">The Text for Request Body.</param>
/// <returns>The length of the current stream</returns>
[NonDebuggable]
local procedure GetContentLength(SourceText: Text): Integer
var
Length: Integer;
begin
Length := StrLen(SourceText);
exit(Length);
end;
} | 40.531429 | 204 | 0.684196 |
edac505349ef7bb797182ded5d843e6a6307e5a3 | 2,652 | pm | Perl | lib/ISDB/Schema/Result/SummaryByGene.pm | MullinsLab/ISDB | 1792bd8f788373314d290b08ea7f216bfc78c1c6 | [
"CC-BY-4.0"
] | 2 | 2018-09-01T21:41:01.000Z | 2020-04-08T05:21:58.000Z | lib/ISDB/Schema/Result/SummaryByGene.pm | MullinsLab/ISDB | 1792bd8f788373314d290b08ea7f216bfc78c1c6 | [
"CC-BY-4.0"
] | 3 | 2018-04-13T16:18:57.000Z | 2018-04-18T12:50:03.000Z | lib/ISDB/Schema/Result/SummaryByGene.pm | MullinsLab/ISDB | 1792bd8f788373314d290b08ea7f216bfc78c1c6 | [
"CC-BY-4.0"
] | 4 | 2017-11-22T23:34:26.000Z | 2019-11-11T03:11:22.000Z | use utf8;
package ISDB::Schema::Result::SummaryByGene;
# Created by DBIx::Class::Schema::Loader
# DO NOT MODIFY THE FIRST PART OF THIS FILE
=head1 NAME
ISDB::Schema::Result::SummaryByGene
=cut
use strict;
use warnings;
use base 'DBIx::Class::Core';
=head1 COMPONENTS LOADED
=over 4
=item * L<ISDB::Schema::InflateColumn::JSON>
=item * L<ISDB::Schema::SerializableAsJSON>
=back
=cut
__PACKAGE__->load_components(
"+ISDB::Schema::InflateColumn::JSON",
"+ISDB::Schema::SerializableAsJSON",
);
__PACKAGE__->table_class("DBIx::Class::ResultSource::View");
=head1 TABLE: C<summary_by_gene>
=cut
__PACKAGE__->table("summary_by_gene");
=head1 ACCESSORS
=head2 environment
data_type: 'integration_environment'
is_nullable: 1
=head2 ncbi_gene_id
data_type: 'integer'
is_nullable: 1
=head2 gene
data_type: 'text'
is_nullable: 1
=head2 gene_type
data_type: 'gene_type'
is_nullable: 1
=head2 subjects
data_type: 'bigint'
is_nullable: 1
=head2 unique_sites
data_type: 'bigint'
is_nullable: 1
=head2 proliferating_sites
data_type: 'bigint'
is_nullable: 1
=head2 total_in_gene
data_type: 'numeric'
is_nullable: 1
=cut
__PACKAGE__->add_columns(
"environment",
{ data_type => "integration_environment", is_nullable => 1 },
"ncbi_gene_id",
{ data_type => "integer", is_nullable => 1 },
"gene",
{ data_type => "text", is_nullable => 1 },
"gene_type",
{ data_type => "gene_type", is_nullable => 1 },
"subjects",
{ data_type => "bigint", is_nullable => 1 },
"unique_sites",
{ data_type => "bigint", is_nullable => 1 },
"proliferating_sites",
{ data_type => "bigint", is_nullable => 1 },
"total_in_gene",
{ data_type => "numeric", is_nullable => 1 },
);
# Created by DBIx::Class::Schema::Loader v0.07045 @ 2017-03-21 10:59:42
# DO NOT MODIFY THIS OR ANYTHING ABOVE! md5sum:zohC1KAEt1l6hqlqsOUqAQ
=head2 ncbi_gene
Type: belongs_to
Related object: L<ISDB::Schema::Result::NCBIGene>
=cut
__PACKAGE__->belongs_to(
"ncbi_gene",
"ISDB::Schema::Result::NCBIGene",
{ ncbi_gene_id => "ncbi_gene_id" },
{
is_deferrable => 0,
join_type => "LEFT",
on_delete => "NO ACTION",
on_update => "NO ACTION",
},
);
=head2 gene_locations
Type: has_many
Related object: L<ISDB::Schema::Result::NCBIGeneLocation>
=cut
__PACKAGE__->has_many(
"gene_locations",
"ISDB::Schema::Result::NCBIGeneLocation",
{ "foreign.ncbi_gene_id" => "self.ncbi_gene_id" },
{ cascade_copy => 0, cascade_delete => 0 },
);
sub as_hash {
my $self = shift;
return {
$self->get_columns,
ncbi_gene => $self->ncbi_gene->as_hash,
};
}
1;
| 17.333333 | 71 | 0.677602 |
ed49239b265d4e80d82a9c75ea98ee83aef9e793 | 16,102 | pm | Perl | perl/vendor/lib/File/chmod.pm | mnikolop/Thesis_project_CyberDoc | 9a37fdd5a31de24cb902ee31ef19eb992faa1665 | [
"Apache-2.0"
] | 4 | 2018-04-20T07:27:13.000Z | 2021-12-21T05:19:24.000Z | perl/vendor/lib/File/chmod.pm | mnikolop/Thesis_project_CyberDoc | 9a37fdd5a31de24cb902ee31ef19eb992faa1665 | [
"Apache-2.0"
] | 4 | 2021-03-10T19:10:00.000Z | 2021-05-11T14:58:19.000Z | perl/vendor/lib/File/chmod.pm | mnikolop/Thesis_project_CyberDoc | 9a37fdd5a31de24cb902ee31ef19eb992faa1665 | [
"Apache-2.0"
] | 1 | 2019-11-12T02:29:26.000Z | 2019-11-12T02:29:26.000Z | package File::chmod;
use Carp;
use strict;
use vars qw(
$VERSION @ISA @EXPORT @EXPORT_OK $DEBUG
$UMASK $MASK $VAL $W $MODE
);
require Exporter;
@ISA = qw( Exporter );
@EXPORT = qw( chmod getchmod );
@EXPORT_OK = qw( symchmod lschmod getsymchmod getlschmod getmod );
$VERSION = '0.32';
$DEBUG = 1;
$UMASK = 1;
$MASK = umask;
my ($SYM,$LS) = (1,2);
my %ERROR = (
EDETMOD => "use of determine_mode is deprecated",
ENEXLOC => "cannot set group execute on locked file",
ENLOCEX => "cannot set file locking on group executable file",
ENSGLOC => "cannot set-gid on locked file",
ENLOCSG => "cannot set file locking on set-gid file",
ENEXUID => "execute bit must be on for set-uid",
ENEXGID => "execute bit must be on for set-gid",
ENULSID => "set-id has no effect for 'others'",
ENULSBG => "sticky bit has no effect for 'group'",
ENULSBO => "sticky bit has no effect for 'others'",
);
sub getmod {
my @return = map { (stat)[2] & 07777 } @_;
return wantarray ? @return : $return[0];
}
sub chmod {
my $mode = shift;
my $how = mode($mode);
return symchmod($mode,@_) if $how == $SYM;
return lschmod($mode,@_) if $how == $LS;
return CORE::chmod($mode,@_);
}
sub getchmod {
my $mode = shift;
my $how = mode($mode);
return getsymchmod($mode,@_) if $how == $SYM;
return getlschmod($mode,@_) if $how == $LS;
return wantarray ? (($mode) x @_) : $mode;
}
sub symchmod {
my $mode = shift;
my @return = getsymchmod($mode,@_);
my $ret = 0;
for (@_){ $ret++ if CORE::chmod(shift(@return),$_) }
return $ret;
}
sub getsymchmod {
my $mode = shift;
my @return;
croak "symchmod received non-symbolic mode: $mode" if mode($mode) != $SYM;
for (@_){
local $VAL = getmod($_);
for my $this (split /,/, $mode){
local $W = 0;
my $or;
for (split //, $this){
if (not defined $or and /[augo]/){
/a/ and $W |= 7, next;
/u/ and $W |= 1, next;
/g/ and $W |= 2, next;
/o/ and $W |= 4, next;
}
if (/[-+=]/){
$W ||= 7;
$or = (/[=+]/ ? 1 : 0);
clear() if /=/;
next;
}
croak "Bad mode $this" if not defined $or;
croak "Unknown mode: $mode" if !/[ugorwxslt]/;
/u/ and $or ? u_or() : u_not();
/g/ and $or ? g_or() : g_not();
/o/ and $or ? o_or() : o_not();
/r/ and $or ? r_or() : r_not();
/w/ and $or ? w_or() : w_not();
/x/ and $or ? x_or() : x_not();
/s/ and $or ? s_or() : s_not();
/l/ and $or ? l_or() : l_not();
/t/ and $or ? t_or() : t_not();
}
}
$VAL &= ~$MASK if $UMASK;
push @return, $VAL;
}
return wantarray ? @return : $return[0];
}
sub lschmod {
my $mode = shift;
return CORE::chmod(getlschmod($mode,@_),@_);
}
sub getlschmod {
my $mode = shift;
my $VAL = 0;
croak "lschmod received non-ls mode: $mode" if mode($mode) != $LS;
my ($u,$g,$o) = ($mode =~ /^.(...)(...)(...)$/);
for ($u){
$VAL |= 0400 if /r/;
$VAL |= 0200 if /w/;
$VAL |= 0100 if /[xs]/;
$VAL |= 04000 if /[sS]/;
}
for ($g){
$VAL |= 0040 if /r/;
$VAL |= 0020 if /w/;
$VAL |= 0010 if /[xs]/;
$VAL |= 02000 if /[sS]/;
}
for ($o){
$VAL |= 0004 if /r/;
$VAL |= 0002 if /w/;
$VAL |= 0001 if /[xt]/;
$VAL |= 01000 if /[Tt]/;
}
return wantarray ? (($VAL) x @_) : $VAL;
}
sub mode {
my $mode = shift;
return 0 if $mode !~ /\D/;
return $SYM if $mode =~ /[augo=+,]/;
return $LS if $mode =~ /^.([r-][w-][xSs-]){2}[r-][w-][xTt-]$/;
return $SYM;
}
sub determine_mode {
warn $ERROR{EDECMOD};
mode(@_);
}
sub clear {
$W & 1 and $VAL &= 02077;
$W & 2 and $VAL &= 05707;
$W & 4 and $VAL &= 07770;
}
sub u_or {
my $val = $VAL;
$W & 2 and ($VAL |= (($val & 0700)>>3 | ($val & 04000)>>1));
$W & 4 and ($VAL |= (($val & 0700)>>6));
}
sub u_not {
my $val = $VAL;
$W & 1 and $VAL &= ~(($val & 0700) | ($val & 05000));
$W & 2 and $VAL &= ~(($val & 0700)>>3 | ($val & 04000)>>1);
$W & 4 and $VAL &= ~(($val & 0700)>>6);
}
sub g_or {
my $val = $VAL;
$W & 1 and $VAL |= (($val & 070)<<3 | ($val & 02000)<<1);
$W & 4 and $VAL |= ($val & 070)>>3;
}
sub g_not {
my $val = $VAL;
$W & 1 and $VAL &= ~(($val & 070)<<3 | ($val & 02000)<<1);
$W & 2 and $VAL &= ~(($val & 070) | ($val & 02000));
$W & 4 and $VAL &= ~(($val & 070)>>3);
}
sub o_or {
my $val = $VAL;
$W & 1 and $VAL |= (($val & 07)<<6);
$W & 2 and $VAL |= (($val & 07)<<3);
}
sub o_not {
my $val = $VAL;
$W & 1 and $VAL &= ~(($val & 07)<<6);
$W & 2 and $VAL &= ~(($val & 07)<<3);
$W & 4 and $VAL &= ~($val & 07);
}
sub r_or {
$W & 1 and $VAL |= 0400;
$W & 2 and $VAL |= 0040;
$W & 4 and $VAL |= 0004;
}
sub r_not {
$W & 1 and $VAL &= ~0400;
$W & 2 and $VAL &= ~0040;
$W & 4 and $VAL &= ~0004;
}
sub w_or {
$W & 1 and $VAL |= 0200;
$W & 2 and $VAL |= 0020;
$W & 4 and $VAL |= 0002;
}
sub w_not {
$W & 1 and $VAL &= ~0200;
$W & 2 and $VAL &= ~0020;
$W & 4 and $VAL &= ~0002;
}
sub x_or {
if ($VAL & 02000){ $DEBUG and warn($ERROR{ENEXLOC}), return }
$W & 1 and $VAL |= 0100;
$W & 2 and $VAL |= 0010;
$W & 4 and $VAL |= 0001;
}
sub x_not {
$W & 1 and $VAL &= ~0100;
$W & 2 and $VAL &= ~0010;
$W & 4 and $VAL &= ~0001;
}
sub s_or {
if ($VAL & 02000){ $DEBUG and warn($ERROR{ENSGLOC}), return }
if (not $VAL & 00100){ $DEBUG and warn($ERROR{ENEXUID}), return }
if (not $VAL & 00010){ $DEBUG and warn($ERROR{ENEXGID}), return }
$W & 1 and $VAL |= 04000;
$W & 2 and $VAL |= 02000;
$W & 4 and $DEBUG and warn $ERROR{ENULSID};
}
sub s_not {
$W & 1 and $VAL &= ~04000;
$W & 2 and $VAL &= ~02000;
$W & 4 and $DEBUG and warn $ERROR{ENULSID};
}
sub l_or {
if ($VAL & 02010){ $DEBUG and warn($ERROR{ENLOCSG}), return }
if ($VAL & 00010){ $DEBUG and warn($ERROR{ENLOCEX}), return }
$VAL |= 02000;
}
sub l_not {
$VAL &= ~02000 if not $VAL & 00010;
}
sub t_or {
$W & 1 and $VAL |= 01000;
$W & 2 and $DEBUG and warn $ERROR{ENULSBG};
$W & 4 and $DEBUG and warn $ERROR{ENULSBO};
}
sub t_not {
$W & 1 and $VAL &= ~01000;
$W & 2 and $DEBUG and warn $ERROR{ENULSBG};
$W & 4 and $DEBUG and warn $ERROR{ENULSBO};
}
1;
__END__
=head1 NAME
File::chmod - Implements symbolic and ls chmod modes
=head1 VERSION
This is File::chmod v0.32.
=head1 SYNOPSIS
use File::chmod;
# chmod takes all three types
# these all do the same thing
chmod(0666,@files);
chmod("=rw",@files);
chmod("-rw-rw-rw-",@files);
# or
use File::chmod qw( symchmod lschmod );
chmod(0666,@files); # this is the normal chmod
symchmod("=rw",@files); # takes symbolic modes only
lschmod("-rw-rw-rw-",@files); # takes "ls" modes only
# more functions, read on to understand
=head1 DESCRIPTION
File::chmod is a utility that allows you to bypass system calls or bit
processing of a file's permissions. It overloads the chmod() function
with its own that gets an octal mode, a symbolic mode (see below), or
an "ls" mode (see below). If you wish not to overload chmod(), you can
export symchmod() and lschmod(), which take, respectively, a symbolic
mode and an "ls" mode.
Symbolic modes are thoroughly described in your chmod(1) man page, but
here are a few examples.
# NEW: if $UMASK is true, symchmod() applies a bit-mask found in $MASK
chmod("+x","file1","file2"); # overloaded chmod(), that is...
# turns on the execute bit for all users on those two files
chmod("o=,g-w","file1","file2");
# removes 'other' permissions, and the write bit for 'group'
chmod("=u","file1","file2");
# sets all bits to those in 'user'
"ls" modes are the type produced on the left-hand side of an C<ls -l> on a
directory. Examples are:
chmod("-rwxr-xr-x","file1","file2");
# the 0755 setting; user has read-write-execute, group and others
# have read-execute priveleges
chmod("-rwsrws---","file1","file2");
# sets read-write-execute for user and group, none for others
# also sets set-uid and set-gid bits
The regular chmod() and lschmod() are absolute; that is, they are not
appending to or subtracting from the current file mode. They set it,
regardless of what it had been before. symchmod() is useful for allowing
the modifying of a file's permissions without having to run a system call
or determining the file's permissions, and then combining that with whatever
bits are appropriate. It also operates separately on each file.
An added feature to version 0.30 is the $UMASK variable, explained below; if
symchmod() is called and this variable is true, then the function uses the
(also new) $MASK variable (which defaults to umask()) as a mask against the
new mode. This is documented below more clearly.
=head2 Functions
Exported by default:
=over 4
=item chmod(MODE,FILES)
Takes an octal, symbolic, or "ls" mode, and then chmods each file
appropriately.
=item getchmod(MODE,FILES)
Returns a list of modified permissions, without chmodding files.
Accepts any of the three kinds of modes.
@newmodes = getchmod("+x","file1","file2");
# @newmodes holds the octal permissons of the files'
# modes, if they were to be sent through chmod("+x"...)
=back
Exported by request:
=over 4
=item symchmod(MODE,FILES)
Takes a symbolic permissions mode, and chmods each file.
=item lschmod(MODE,FILES)
Takes an "ls" permissions mode, and chmods each file.
=item getsymchmod(MODE,FILES)
Returns a list of modified permissions, without chmodding files.
Accepts only symbolic permisson modes.
=item getlschmod(MODE,FILES)
Returns a list of modified permissions, without chmodding files.
Accepts only "ls" permisson modes.
=item getmod(FILES)
Returns a list of the current mode of each file.
=back
=head2 Variables
=over 4
=item $File::chmod::DEBUG
If set to a true value, it will report warnings, similar to those produced
by chmod() on your system. Otherwise, the functions will not report errors.
Example: a file can not have file-locking and the set-gid bits on at the
same time. If $File::chmod::DEBUG is true, the function will report an
error. If not, you are not warned of the conflict. It is set to 1 as
default.
=item $File::chmod::MASK
Contains the umask to apply to new file modes when using getsymchmod(). This
defaults to the return value of umask() at compile time. Is only applied if
$UMASK is true.
=item $File::chmod::UMASK
This is a boolean which tells getsymchmod() whether or not to apply the umask
found in $MASK. It defaults to true.
=back
=head1 REVISIONS
I<Note: this section was started with version 0.30.>
This is an in-depth look at the changes being made from version to version.
=head2 0.31 to 0.32
=over 4
=item B<license added>
I added a license to this module so that it can be used places without asking
my permission. Sorry, Adam.
=back
=head2 0.30 to 0.31
=over 4
=item B<fixed getsymchmod() bug>
Whoa. getsymchmod() was doing some crazy ish. That's about all I can say.
I did a great deal of debugging, and fixed it up. It ALL had to do with two
things:
$or = (/+=/ ? 1 : 0); # should have been /[+=]/
/u/ && $ok ? u_or() : u_not(); # should have been /u/ and $ok
=item B<fixed getmod() bug>
I was using map() incorrectly in getmod(). Fixed that.
=item B<condensed lschmod()>
I shorted it up, getting rid a variable.
=back
=head2 0.21 to 0.30
=over 4
=item B<added umask() honoring for symchmod()>
The symchmod() function now honors the $UMASK and $MASK variables. $UMASK is
a boolean which indicates whether or not to honor the $MASK variable. $MASK
holds a umask, and it defaults to umask(). $UMASK defaults to true. These
variables are NOT exported. They must explictly set (i.e. $File::chmod::UMASK
= 0).
=item B<function name changes>
Renamed internal function determine_mode() to mode(). However, if you happen
to be using determine_mode() somewhere, mode() will be called, but you'll also
get a warning about deprecation.
Renamed internal functions {or,not}_{l,s,t} to {l,s,t}_{or,not}. This is to
keep in standard with the OTHER 6 pairs of bitwise functions, such as r_or()
and g_not(). I don't know WHY the others had 'not' or 'or' in the front.
=item B<fixed debugging bugs>
Certain calls to warn() were not guarded by the $DEBUG variable, and now they
are. Also, for some reason, I left a debugging check (that didn't check to
see if $DEBUG was true) in getsymchmod(), line 118. It printed "ENTERING /g/".
It's gone now.
=item B<fixed set-uid and set-gid bug>
Heh, it seems that in the previous version of File::chmod, the following code
went along broken:
# or_s sub, File/chmod.pm, v0.21, line 330
($VAL & 00100) && do {
$DEBUG && warn("execute bit must be on for set-uid"); 1;
} && next;
Aside from me using '&&' more than enough (changed in the new code), this is
broken. This is now fixed.
=item B<fixed file lock/set-gid bug>
The not_l() function (now renamed to l_not()) used to take the file mode and
bit-wise NOT it with ~02000. However, it did not check if the file was locked
vs. set-gid. Now, the function is C<$VAL &= ~02000 if not $VAL & 00010;>.
=item B<removed useless data structures>
I do not know why I had the $S variable, or %r, %w, and %x hashes. In fact,
$S was declared in C<use vars qw( ... );>, but never given a value, and the
%r, %w, and %x hashes had a 'full' key which never got used. And the hashes
themselves weren't really needed anyway. Here is a list of the variables no
longer in use, and what they have been replaced with (if any):
$S nothing
$U, $G, $O $W
%r, %w, %x octal numbers
@files @_ (I had @files = @_; in nearly EVERY sub)
$c $_
=item B<compacted code>
The first version of File::chmod that was published was 0.13, and it was
written in approximately 10 days, being given the off-and-on treatment I end
up having to give several projects, due to more pressing matters. Well, since
then, most of the code has stayed the same, although bugs were worked out.
Well, I got rid of a lot of slow, clunky, and redundant sections of code in
this version. Sections include the processing of each character of the mode
in getsymchmod(), the getmod() subroutine, um, nearly ALL of the getsymchmod()
function, now that I look at it.
Here's part of the getsymchmod() rewrite:
for ($c){
if (/u/){
u_or() if $MODE eq "+" or $MODE eq "=";
u_not() if $MODE eq "-";
}
...
}
# changed to
/u/ && $or ? u_or() : u_and();
# note: operating on $_, $c isn't used anymore
# note: $or holds 1 if the $MODE was + or =, 0 if $MODE was -
# note: previous was redundant. didn't need $MODE eq "-" check
# because u_or() and u_not() both go to the next character
=back
=head1 PORTING
This is only good on Unix-like boxes. I would like people to help me work on
File::chmod for any OS that deserves it. If you would like to help, please
email me (address below) with the OS and any information you might have on how
chmod() should work on it; if you don't have any specific information, but
would still like to help, hey, that's good too. I have the following
information (from L</perlport>):
=over 4
=item Win32
Only good for changing "owner" read-write access, "group", and "other" bits
are meaningless. I<NOTE: Win32::File and Win32::FileSecurity already do
this. I do not currently see a need to port File::chmod.>
=item MacOS
Only limited meaning. Disabling/enabling write permission is mapped to
locking/unlocking the file.
=item RISC OS
Only good for changing "owner" and "other" read-write access.
=back
=head1 AUTHOR
Jeff C<japhy> Pinyan, F<japhy.734+CPAN@gmail.com>, CPAN ID: PINYAN
=head1 SEE ALSO
Stat::lsMode (by Mark-James Dominus, CPAN ID: MJD)
chmod(1) manpage
perldoc -f chmod
perldoc -f stat
=head1 COPYRIGHT AND LICENCE
Copyright (C) 2007 by Jeff Pinyan
This library is free software; you can redistribute it and/or modify
it under the same terms as Perl itself, either Perl version 5.8.8 or,
at your option, any later version of Perl 5 you may have available.
=cut
| 24.848765 | 79 | 0.630853 |
ed608a0c98ecaceabcb0d5aa352cf16711f76af1 | 7,931 | pm | Perl | modules/Bio/EnsEMBL/Production/Pipeline/Base.pm | dbolser-ebi/ensembl-production | 70af4644b051b1b6b288871ad1b16efc8d65da90 | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Production/Pipeline/Base.pm | dbolser-ebi/ensembl-production | 70af4644b051b1b6b288871ad1b16efc8d65da90 | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Production/Pipeline/Base.pm | dbolser-ebi/ensembl-production | 70af4644b051b1b6b288871ad1b16efc8d65da90 | [
"Apache-2.0"
] | null | null | null | =head1 LICENSE
Copyright [1999-2013] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
=cut
package Bio::EnsEMBL::Production::Pipeline::Base;
use strict;
use warnings;
use base qw/Bio::EnsEMBL::Hive::Process/;
use Bio::EnsEMBL::Utils::Exception qw/throw/;
use Bio::EnsEMBL::Utils::IO qw/work_with_file/;
use Bio::EnsEMBL::Utils::Scalar qw/check_ref/;
use File::Find;
use File::Spec;
use File::Path qw/mkpath/;
use POSIX qw/strftime/;
# Takes in a key, checks if the current $self->param() was an empty array
# and replaces it with the value from $self->param_defaults()
sub reset_empty_array_param {
my ($self, $key) = @_;
my $param_defaults = $self->param_defaults();
my $current = $self->param($key);
my $replacement = $self->param_defaults()->{$key};
if(check_ref($current, 'ARRAY') && check_ref($replacement, 'ARRAY')) {
if(! @{$current}) {
$self->fine('Restting param %s because the given array was empty', $key);
$self->param($key, $replacement);
}
}
return;
}
=head2 get_Slices
Arg[1] : String type of DB to use (defaults to core)
Arg[2] : Boolean should we filter the slices if it is human
Example : my $slices = $self->get_Slices('core', 1);
Description : Basic get_Slices() method to return all distinct slices
for a species but also optionally filters for the
first portion of Human Y which is a non-informative region
(composed solely of N's). The code will only filter for
GRCh37 forcing the developer to update the test for other
regions.
Returntype : ArrayRef[Bio::EnsEMBL::Slice]
Exceptions : Thrown if you are filtering Human but also are not on GRCh37
=cut
sub get_Slices {
my ($self, $type, $filter_human) = @_;
my $dba = $self->get_DBAdaptor($type);
throw "Cannot get a DB adaptor" unless $dba;
my $sa = $dba->get_SliceAdaptor();
my @slices = @{$sa->fetch_all('toplevel', undef, 1, undef, undef)};
if($filter_human) {
my $production_name = $self->production_name();
if($production_name eq 'homo_sapiens') {
my ($cs) = @{$dba->get_CoordSystem()->fetch_all()};
my $expected = 'GRCh37';
if($cs->version() ne $expected) {
throw sprintf(q{Cannot continue as %s's coordinate system %s is not the expected %s }, $production_name, $cs->version(), $expected);
}
@slices = grep {
if($_->seq_region_name() eq 'Y' && $_->end() < 2649521) {
$self->info('Filtering small Y slice');
0;
}
else {
1;
}
} @slices;
}
}
return [ sort { $b->length() <=> $a->length() } @slices ];
}
# Registry is loaded by Hive (see beekeeper_extra_cmdline_options() in conf)
sub get_DBAdaptor {
my ($self, $type) = @_;
$type ||= 'core';
my $species = ($type eq 'production')?'multi':$self->param('species');
return Bio::EnsEMBL::Registry->get_DBAdaptor($species, $type);
}
sub cleanup_DBAdaptor {
my ($self, $type) = @_;
my $dba = $self->get_DBAdaptor($type);
$dba->clear_caches;
$dba->dbc->disconnect_if_idle;
return;
}
sub get_dir {
my ($self, @extras) = @_;
my $base_dir = $self->param('base_path');
my $dir = File::Spec->catdir($base_dir, @extras);
mkpath($dir);
return $dir;
}
sub web_name {
my ($self) = @_;
# my $mc = $self->get_DBAdaptor()->get_MetaContainer();
# my $name = $mc->single_value_by_key('species.url'); # change back
my $name = ucfirst($self->production_name());
return $name;
}
sub scientific_name {
my ($self) = @_;
my $dba = $self->get_DBAdaptor();
my $mc = $dba->get_MetaContainer();
my $name = $mc->get_scientific_name();
$dba->dbc()->disconnect_if_idle();
return $name;
}
sub assembly {
my ($self) = @_;
my $dba = $self->get_DBAdaptor();
return $dba->get_CoordSystemAdaptor()->fetch_all()->[0]->version();
}
sub production_name {
my ($self, $name) = @_;
my $dba;
if($name) {
$dba = Bio::EnsEMBL::Registry->get_DBAdaptor($name, 'core');
}
else {
$dba = $self->get_DBAdaptor();
}
my $mc = $dba->get_MetaContainer();
my $prod = $mc->get_production_name();
$dba->dbc()->disconnect_if_idle();
return $prod;
}
# Closes file handle, and deletes the file stub if no data was written to
# the file handle (using tell). We can also only close a file handle and unlink
# the data if it was open otherwise we just ignore it
# Returns success if we managed to delete the file
sub tidy_file_handle {
my ($self, $fh, $path) = @_;
if($fh->opened()) {
my $unlink = ($fh->tell() == 0) ? 1 : 0;
$fh->close();
if($unlink && -f $path) {
unlink($path);
return 1;
}
}
return 0;
}
sub info {
my ($self, $msg, @params) = @_;
if ($self->debug() > 1) {
my $formatted_msg;
if(scalar(@params)) {
$formatted_msg = sprintf($msg, @params);
}
else {
$formatted_msg = $msg;
}
printf STDERR "INFO [%s]: %s %s\n", $self->_memory_consumption(), strftime('%c',localtime()), $formatted_msg;
}
return
}
sub fine {
my ($self, $msg, @params) = @_;
if ($self->debug() > 2) {
my $formatted_msg;
if(scalar(@params)) {
$formatted_msg = sprintf($msg, @params);
}
else {
$formatted_msg = $msg;
}
printf STDERR "FINE [%s]: %s %s\n", $self->_memory_consumption(), strftime('%c',localtime()), $formatted_msg;
}
return
}
sub _memory_consumption {
my ($self) = @_;
my $content = `ps -o rss $$ | grep -v RSS`;
return q{?MB} if $? >> 8 != 0;
$content =~ s/\s+//g;
my $mem = $content/1024;
return sprintf('%.2fMB', $mem);
}
sub find_files {
my ($self, $dir, $boolean_callback) = @_;
$self->throw("Cannot find path $dir") unless -d $dir;
my @files;
find(sub {
my $path = $File::Find::name;
if($boolean_callback->($_)) {
push(@files, $path);
}
}, $dir);
return \@files;
}
sub unlink_all_files {
my ($self, $dir) = @_;
$self->info('Removing files from the directory %s', $dir);
#Delete anything which is a file & not the current or higher directory
my $boolean_callback = sub {
return ( $_[0] =~ /^\.\.?$/) ? 0 : 1;
};
my $files = $self->find_files($dir, $boolean_callback);
foreach my $file (@{$files}) {
$self->fine('Unlinking %s', $file);
unlink $file;
}
$self->info('Removed %d file(s)', scalar(@{$files}));
return;
}
sub assert_executable {
my ($self, $exe) = @_;
if(! -x $exe) {
my $output = `which $exe 2>&1`;
chomp $output;
my $rc = $? >> 8;
if($rc != 0) {
my $possible_location = `locate -l 1 $exe 2>&1`;
my $loc_rc = $? >> 8;
if($loc_rc != 0) {
my $msg = 'Cannot find the executable "%s" after trying "which" and "locate -l 1". Please ensure it is on your PATH or use an absolute location and try again';
$self->throw(sprintf($msg, $exe));
}
}
}
return 1;
}
# Runs the given command and returns a list of exit code and output
sub run_cmd {
my ($self, $cmd) = @_;
$self->info('About to run "%s"', $cmd);
my $output = `$cmd 2>&1`;
my $rc = $? >> 8;
$self->throw("Cannot run program '$cmd'. Return code was ${rc}. Program output was $output") if $rc;
return ($rc, $output);
}
## Production database adaptor
sub get_production_DBAdaptor {
my ($self) = @_;
return Bio::EnsEMBL::Registry->get_DBAdaptor('multi', 'production');
}
1;
| 28.024735 | 167 | 0.61619 |
edabbd35c1fb42e3a34b588a4b910888c58605cf | 421 | pl | Perl | Task/Modular-exponentiation/Perl/modular-exponentiation.pl | mullikine/RosettaCodeData | 4f0027c6ce83daa36118ee8b67915a13cd23ab67 | [
"Info-ZIP"
] | 1 | 2021-05-05T13:42:20.000Z | 2021-05-05T13:42:20.000Z | Task/Modular-exponentiation/Perl/modular-exponentiation.pl | mullikine/RosettaCodeData | 4f0027c6ce83daa36118ee8b67915a13cd23ab67 | [
"Info-ZIP"
] | null | null | null | Task/Modular-exponentiation/Perl/modular-exponentiation.pl | mullikine/RosettaCodeData | 4f0027c6ce83daa36118ee8b67915a13cd23ab67 | [
"Info-ZIP"
] | null | null | null | use bigint;
sub expmod {
my($a, $b, $n) = @_;
my $c = 1;
do {
($c *= $a) %= $n if $b % 2;
($a *= $a) %= $n;
} while ($b = int $b/2);
$c;
}
my $a = 2988348162058574136915891421498819466320163312926952423791023078876139;
my $b = 2351399303373464486466122544523690094744975233415544072992656881240319;
my $m = 10 ** 40;
print expmod($a, $b, $m), "\n";
print $a->bmodpow($b, $m), "\n";
| 22.157895 | 79 | 0.56057 |
eda0c6b6f9ec4e9aad37ddebed64db5322e41608 | 4,486 | pm | Perl | lib/CXGN/Pedigree/AddCrossInfo.pm | dwaring87/sgn | 1d7b7de9c4fdb1f3b22a1fcff070f2c3846e4fd0 | [
"MIT"
] | null | null | null | lib/CXGN/Pedigree/AddCrossInfo.pm | dwaring87/sgn | 1d7b7de9c4fdb1f3b22a1fcff070f2c3846e4fd0 | [
"MIT"
] | null | null | null | lib/CXGN/Pedigree/AddCrossInfo.pm | dwaring87/sgn | 1d7b7de9c4fdb1f3b22a1fcff070f2c3846e4fd0 | [
"MIT"
] | null | null | null | package CXGN::Pedigree::AddCrossInfo;
=head1 NAME
CXGN::Pedigree::AddCrossInfo - a module to add cross information such as date of pollination, number of flowers pollinated, number of fruits set as stock properties for cross.
=head1 USAGE
my $cross_add_info = CXGN::Pedigree::AddCrossInfo->new({ chado_schema => $chado_schema, cross_name => $cross_name, key => $info_type, value => $value, data_type => $data_type} );
$cross_add_info->add_info();
=head1 DESCRIPTION
Adds cross properties in json string format to stock of type cross. The cross must already exist in the database. This module is intended to be used in independent loading scripts and interactive dialogs.
=head1 AUTHORS
Jeremy D. Edwards (jde22@cornell.edu)
Titima Tantikanjana (tt15@cornell.edu)
=cut
use Moose;
use MooseX::FollowPBP;
use Moose::Util::TypeConstraints;
use Try::Tiny;
use CXGN::Stock::StockLookup;
use SGN::Model::Cvterm;
use Data::Dumper;
use JSON;
has 'chado_schema' => (
is => 'rw',
isa => 'DBIx::Class::Schema',
predicate => 'has_chado_schema',
required => 1,
);
has 'cross_name' => (isa =>'Str', is => 'rw', predicate => 'has_cross_name', required => 1,);
has 'key' => (isa =>'Str', is => 'rw', predicate => 'has_key', required => 1,);
has 'value' => (isa =>'Str', is => 'rw', predicate => 'has_value', required => 1,);
has 'data_type' => (isa =>'Str', is => 'rw', predicate => 'has_type', required => 1,);
sub add_info {
my $self = shift;
my $schema = $self->get_chado_schema();
my $transaction_error;
#add all cross info in a single transaction
my $coderef = sub {
#get cross (stock of type cross)
my $cross_stock = $self->_get_cross($self->get_cross_name());
if (!$cross_stock) {
print STDERR "Cross could not be found\n";
return;
}
# get cvterm of cross info type (crossing_metadata_json or cross_additional_info)
my $cross_info_type = $self->get_data_type();
# print STDERR "DATA TYPE =".Dumper($cross_info_type)."\n";
my $cross_info_cvterm;
if (($cross_info_type eq 'crossing_metadata_json') || ($cross_info_type eq 'cross_additional_info')) {
$cross_info_cvterm = SGN::Model::Cvterm->get_cvterm_row($schema, $cross_info_type, 'stock_property');
} else {
print STDERR "Invalid type"."\n";
return;
}
my $cross_json_string;
my $cross_json_hash = {};
my $previous_stockprop_rs = $cross_stock->stockprops({type_id=>$cross_info_cvterm->cvterm_id});
if ($previous_stockprop_rs->count == 1){
$cross_json_string = $previous_stockprop_rs->first->value();
$cross_json_hash = decode_json $cross_json_string;
$cross_json_string = _generate_property_hash($self->get_key, $self->get_value, $cross_json_hash);
$previous_stockprop_rs->first->update({value=>$cross_json_string});
} elsif ($previous_stockprop_rs->count > 1) {
print STDERR "More than one found!\n";
return;
} else {
$cross_json_string = _generate_property_hash($self->get_key, $self->get_value, $cross_json_hash);
$cross_stock->create_stockprops({$cross_info_cvterm->name() => $cross_json_string});
}
# print STDERR "CROSS JSON STRING =".Dumper($cross_json_string)."\n";
};
#try to add all cross info in a transaction
try {
$schema->txn_do($coderef);
} catch {
$transaction_error = $_;
};
if ($transaction_error) {
print STDERR "Transaction error storing information for cross: $transaction_error\n";
return;
}
return 1;
}
sub _generate_property_hash {
my $key = shift;
my $value = shift;
my $cross_json_hash = shift;
$cross_json_hash->{$key} = $value;
#print STDERR Dumper $cross_json_hash;
my $cross_json_string = encode_json $cross_json_hash;
return $cross_json_string;
}
sub _get_cross {
my $self = shift;
my $cross_name = shift;
my $schema = $self->get_chado_schema();
my $stock_lookup = CXGN::Stock::StockLookup->new(schema => $schema);
my $stock;
my $cross_cvterm = SGN::Model::Cvterm->get_cvterm_row($schema, 'cross', 'stock_type');
$stock_lookup->set_stock_name($cross_name);
$stock = $stock_lookup->get_cross_exact();
if (!$stock) {
print STDERR "Cross name does not exist\n";
return;
}
return $stock;
}
#######
1;
#######
| 33.477612 | 204 | 0.645341 |
eda1cbfc4a71f45369c96e1c635be0adfc86d6c0 | 2,941 | t | Perl | modules/t/genomicFeatureDiseaseLogAdaptor.t | olaaustine/ensembl-gene2phenotype | feedcf790df2c2dab1545bfc705f78de818e1463 | [
"Apache-2.0"
] | null | null | null | modules/t/genomicFeatureDiseaseLogAdaptor.t | olaaustine/ensembl-gene2phenotype | feedcf790df2c2dab1545bfc705f78de818e1463 | [
"Apache-2.0"
] | null | null | null | modules/t/genomicFeatureDiseaseLogAdaptor.t | olaaustine/ensembl-gene2phenotype | feedcf790df2c2dab1545bfc705f78de818e1463 | [
"Apache-2.0"
] | null | null | null | =head1 LICENSE
See the NOTICE file distributed with this work for additional information
regarding copyright ownership.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
=cut
use strict;
use warnings;
use Test::More;
use Test::Exception;
use Bio::EnsEMBL::Test::MultiTestDB;
use Bio::EnsEMBL::Test::TestUtils;
my $multi = Bio::EnsEMBL::Test::MultiTestDB->new('homo_sapiens');
my $g2pdb = $multi->get_DBAdaptor('gene2phenotype');
my $gfd_adaptor = $g2pdb->get_GenomicFeatureDiseaseAdaptor;
my $gfd_log_adaptor = $g2pdb->get_GenomicFeatureDiseaseLogAdaptor;
my $ua = $g2pdb->get_UserAdaptor;
ok($gfd_adaptor && $gfd_adaptor->isa('Bio::EnsEMBL::G2P::DBSQL::GenomicFeatureDiseaseAdaptor'), 'isa GenomicFeatureDiseaseAdaptor');
ok($gfd_log_adaptor && $gfd_log_adaptor->isa('Bio::EnsEMBL::G2P::DBSQL::GenomicFeatureDiseaseLogAdaptor'), 'isa GenomicFeatureDiseaseLogAdaptor');
# store: is tested in genomicFeatureDiseaseAdaptor.t
#fetch_by_dbID
my $dbID = 22;
my $gfd_log = $gfd_log_adaptor->fetch_by_dbID($dbID);
ok($gfd_log->dbID == $dbID, 'fetch_by_dbID');
ok($gfd_log->allelic_requirement eq 'monoallelic_autosomal', 'fetch_by_dbID allelic_requirement');
ok($gfd_log->allelic_requirement_attrib eq '64', 'fetch_by_dbID allelic_requirement_attrib');
ok($gfd_log->mutation_consequence eq 'altered gene product structure', 'fetch_by_dbID mutation_consequence');
ok($gfd_log->mutation_consequence_attrib eq '77', 'fetch_by_dbID mutation_consequence_attrib');
ok($gfd_log->created eq '2015-07-22 16:14:09', 'fetch_by_dbID created');
ok($gfd_log->user_id == 4, 'fetch_by_dbID user_id');
ok($gfd_log->action eq 'create', 'fetch_by_dbID action');
# fetch_all_by_GenomicFeatureDisease
my $gfd = $gfd_adaptor->fetch_by_dbID(2181);
my $gfd_logs = $gfd_log_adaptor->fetch_all_by_GenomicFeatureDisease($gfd);
ok(scalar @$gfd_logs == 2, 'fetch_all_by_GenomicFeatureDisease');
# fetch_all_most_recent
$gfd_logs = $gfd_log_adaptor->fetch_all_by_most_recent;
ok(scalar @$gfd_logs == 10, 'fetch_all_by_most_recent');
my $limit = undef;
my $action = 'update';
$gfd_logs = $gfd_log_adaptor->fetch_all_by_most_recent($limit, $action);
my $count = grep {$_->action eq $action} @$gfd_logs;
ok($count == 10, 'fetch_all_by_most_recent action=update');
$limit = 20;
$action = undef;
$gfd_logs = $gfd_log_adaptor->fetch_all_by_most_recent($limit, $action);
$count = grep {$_->action eq 'create'} @$gfd_logs;
ok($count == 20, 'fetch_all_by_most_recent limit=20');
done_testing();
1;
| 39.743243 | 146 | 0.773206 |
ed8fcd4e76dfd24884f1575ecb89b3c45eec133b | 26,947 | pl | Perl | books/build/make_cert_help.pl | nzt/acl2 | 31c179001a2ebbe262131ef02e15b1fb833485f4 | [
"BSD-3-Clause"
] | null | null | null | books/build/make_cert_help.pl | nzt/acl2 | 31c179001a2ebbe262131ef02e15b1fb833485f4 | [
"BSD-3-Clause"
] | null | null | null | books/build/make_cert_help.pl | nzt/acl2 | 31c179001a2ebbe262131ef02e15b1fb833485f4 | [
"BSD-3-Clause"
] | null | null | null | #!/usr/bin/env perl
# cert.pl build system
# Copyright (C) 2008-2014 Centaur Technology
#
# Contact:
# Centaur Technology Formal Verification Group
# 7600-C N. Capital of Texas Highway, Suite 300, Austin, TX 78731, USA.
# http://www.centtech.com/
#
# License: (An MIT/X11-style license)
#
# Permission is hereby granted, free of charge, to any person obtaining a
# copy of this software and associated documentation files (the "Software"),
# to deal in the Software without restriction, including without limitation
# the rights to use, copy, modify, merge, publish, distribute, sublicense,
# and/or sell copies of the Software, and to permit persons to whom the
# Software is furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included in
# all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
# FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
# DEALINGS IN THE SOFTWARE.
#
# Original authors: Sol Swords <sswords@centtech.com>
# Jared Davis <jared@centtech.com>
# make_cert_help.pl -- this is a companion file that is used by "make_cert".
# It is the core script responsible for certifying a single ACL2 book. The
# code here is largely similar to the %.cert: %.lisp rule from
# Makefile-generic, but with several extensions. For instance,
#
# - We try to gracefully NFS lag
# - We support cert-flags comments that say how to run certify-book
# - We can certify certain books with other save-images, using .image files
# - We support .acl2x files and two-pass certification,
# - We support adding #PBS directives to limit memory and wall time
# - We support running ACL2 via an external queuing mechanism.
#
# We only expect to invoke this through make_cert, so it is not especially
# user-friendly. We rely on several environment variables that are given to us
# by make_cert. See make_cert for the defaults and meanings of, e.g., ACL2 and
# other variables used in this script.
# Usage: make_cert_help.pl TARGET STEP
# - TARGET is like "foo" for "foo.lisp"
# - STEP is "cert", "acl2x", "acl2xskip", "acl2xcert", "pcert", or "convert"
# The meaning of the steps is as follows:
# "cert" -- conventional single-pass certification
# "acl2x" -- first pass of a two-pass certification, not skipping proofs
# "acl2xskip" -- first pass of a two-pass or provisional certification, skipping proofs
# "pcert" -- second pass of a provisional certification
# "convert" -- third pass of a provisional certification
use warnings;
use strict;
use File::Spec;
use File::Path qw(make_path);
# problematic to get this from cpan on msys
# use File::Which qw(which);
use FindBin qw($RealBin);
use POSIX qw(strftime);
use Cwd;
use utf8;
use lib "$RealBin/lib";
use Cygwin_paths;
use Bookscan;
# Use ms-precision timing if we can load the Time::HiRes module,
# otherwise gracefully default to second precision.
# Note (Sol): I tried
# Time::Hires->import('time')
# and just using time() instead of defining mytime() specially, but it
# didn't work for me (always seemed to use 1-second precision); maybe
# there's a problem with compile- versus run-time resolution of the
# function name.
my $msectiming = eval {
require Time::HiRes;
Time::HiRes->import();
1;
};
sub mytime {
if ($msectiming) {
return Time::HiRes::time();
} else {
return time();
}
}
binmode(STDOUT,':utf8');
sub trim
{
my $str = shift;
$str =~ s/^\s+//;
$str =~ s/\s+$//;
return $str;
}
sub read_whole_file
{
my $filename = shift;
open (my $fh, "<", $filename) or die("Can't open $filename: $!\n");
local $/ = undef;
my $ret = <$fh>;
close($fh);
return $ret;
}
sub read_whole_file_if_exists
{
my $filename = shift;
return "" if (! -f $filename);
return read_whole_file($filename);
}
# Takes a string, a nesting depth, and a starting index. Scans the
# string for parens and keeps track of the depth. Stops when the
# depth reaches 0. If it reaches the end of the string, returns the
# current depth. Returns three results: a flag which is 1 if it
# reached the end before depth 0 and 0 otherwise, the nesting depth at
# the end (only valid if it reached the end), and the index after the
# closing paren. BOZO doesn't care about string quotes etc.
sub find_matching_parens {
my ($str, $depth, $pos) = @_;
while (1) {
my $next_open = index($str, "(", $pos);
my $next_close = index($str, ")", $pos);
my $open_next = ($next_open != -1)
&& (($next_close == -1) || $next_open < $next_close);
my $close_next = ($next_close != -1)
&& (($next_open == -1) || $next_close < $next_open);
if ($open_next) {
$pos = $next_open+1;
$depth = $depth+1;
} elsif ($close_next) {
$pos = $next_close+1;
$depth = $depth-1;
if ($depth == 0) {
return (0, -1, $pos);
}
} else {
# reached end of string with no more parens
return (1, $depth, -1);
}
}
}
sub skip_certify_books {
my $str = shift;
my $pos = 0;
my @strs = ();
my @match;
while ($str =~ m/(\((?:acl2::)?certify-book)/gi) {
my $beg = pos($str) - length($1);
my $end = pos($str);
push (@strs, substr($str,$pos,$beg-$pos));
my ($done, $depth, $newpos) = find_matching_parens($str, 1, $end);
if ($done) {
return join("", @strs);
}
$pos = $newpos;
pos($str) = $pos;
}
push (@strs, substr($str, $pos));
return join("", @strs);
}
sub read_file_except_certify {
my $filename = shift;
my $str = read_whole_file($filename);
return skip_certify_books($str);
# my @lines = ();
# open (my $fh, "<", $filename) or die("Can't open $filename: $!\n");
# my $line;
# my $parens_deep = -1;
# while (my $line = <$fh>) {
# chomp($line);
# if ($parens_deep == -1) {
# my $start = index($line, "(certify-book"
# $line =~ s/\(certify-book [^)]*\)//;
# push (@lines, $line);
# }
# my $ret = join("\n", @lines);
# return $ret;
}
sub remove_file_if_exists
{
my $filename = shift;
if (-f $filename) {
unlink($filename) or die("Can't remove $filename: $!\n");
}
}
sub nfs_file_exists
{
# In theory, this is just -f $filename. In practice, NFS client caching
# may mean that -f $filename does not mean what you think it does.
#
# Jared's notes. I originally tried to just use a -f $filename when
# waiting for NFS files to come into existence. But it appears that, at
# least under some configurations of NFS, the NFS client (not perl or
# something) can cache whether a file exists or not.
#
# This caching can last for a long time, at least several minutes, perhaps
# indefinitely. (I literally went down the hall and got a lesson on NFS
# from the sysamin, and when we came back to my office my "ls" loop was
# still running and not seeing the file.)
#
# For our particular network setup, the file in question was not visible
# from fv-hpc, but was visible from the compute nodes. We used "df" to
# investigate which NFS servers the compute nodes and fv-hpc were connected
# to for that particular drive, and found that some nodes using the same
# server could see the file. Hence, we concluded it was not a server-side
# issue.
#
# We then did an "ls" in the directory, and suddenly the client got a
# refreshed view of the directory and could see the file. So, it seems
# that the client was caching the individual file, but not the directory
# list.
#
# So, to really try to test whether the NFS file exists, we first do an
# "ls" which apparently seems to be sufficient to clear the NFS cache for
# that directory, and then ask if the file exists. This seems to be good
# enough for our setup. If it doesn't work for somebody else's setup,
# maybe they can figure out a better solution.
my $filename = shift;
my $blah = `ls`; # hit the directory again, to try to get NFS to not cache things
return -f $filename;
# my $output = `test -f '$filename'`;
# my $status = $? >> 8;
# return $status == 0;
}
sub wait_for_nfs
{
my $filename = shift;
my $max_lag = shift;
for(my $i = 0; $i < $max_lag; $i++)
{
print "NFS Lag? Waited $i seconds for $filename...\n";
sleep(1);
return 1 if nfs_file_exists($filename);
}
return 0;
}
sub write_whole_file
{
my $filename = shift;
my $contents = shift;
open(my $fd, ">", $filename) or die("Can't open $filename: $!\n");
print $fd $contents;
close($fd);
}
sub scan_source_file
{
my $filename = shift;
my $events = scan_src_run($filename);
my $max_mem = 0;
my $max_time = 0;
my @includes = ();
my @pbs = ();
my $ifdef_level = 0;
my $ifdef_skipping_level = 0;
my %defines = ();
foreach my $event (@$events) {
my $type = shift @$event;
if ($type eq ifdef_event) {
(my $neg, my $var) = @$event;
my $value = exists($defines{$var}) ? $defines{$var} : ($ENV{$var} || "");
$ifdef_level = $ifdef_level+1;
if (($value eq "") xor $neg) {
if ($ifdef_skipping_level == 0) {
# print "Skipping: $var\n";
$ifdef_skipping_level = $ifdef_level;
}
}
} elsif ($type eq endif_event) {
if ($ifdef_skipping_level == $ifdef_level) {
# print "Leaving skipping ifdef\n";
$ifdef_skipping_level = 0;
}
$ifdef_level = $ifdef_level-1;
} elsif ($ifdef_skipping_level == 0) {
if ($type eq set_max_mem_event) {
$max_mem = $event->[0];
} elsif ($type eq set_max_time_event) {
$max_time = $event->[0];
} elsif ($type eq ifdef_define_event) {
(my $neg, my $var) = @$event;
$defines{$var} = $neg ? "" : "1";
} elsif ($type eq include_book_event) {
(my $book, my $dir, my $noport) = @$event;
if (! $noport) {
push (@includes, [$book, $dir]);
}
} elsif ($type eq pbs_event) {
push @pbs, $event->[0];
}
}
}
return ( $max_mem, $max_time, \@includes, \@pbs );
}
sub extract_pbs_from_acl2file
{
# PBS directives placed in .acl2 files are extracted and used. An
# example of a PBS directive is:
#
# ;PBS -l host=<my-host-name>
my $filename = shift;
(my $max_mem, my $max_time, my $includes, my $pbs) = scan_source_file($filename);
return $pbs;
}
sub maybe_switch_to_tempdir
{
# This implements CERT_PL_TEMP_DIR. When CERT_PL_TEMP_DIR points to some
# temporary directory, we use that temporary directory for all temporary
# files such as workxxx files and .cert.out files. We take two arguments:
my $fulldir = shift; # The dir where the .lisp file to certify is
my $tmpfilename = shift; # The temporary filename we want
# We essentially create TMPDIR/FULLDIR if it doesn't exist already, and
# then return TMPDIR/FULLDIR/TMPFILENAME.
my $tmpdir = $ENV{"CERT_PL_TEMP_DIR"};
if (!$tmpdir)
{
# NOT using CERT_PL_TEMP_DIR, so we don't want to do any of this,
# just create a temporary file in the current directory.
return $tmpfilename;
}
die "Invalid CERT_PL_TEMP_DIR: not a directory: $tmpdir\n" if (! -d $tmpdir);
die "Invalid $fulldir in maybe_switch_to_tempdir: $fulldir\n" if (! -d $fulldir);
(my $tmp_vol, my $tmp_dirs, undef) = File::Spec->splitpath($tmpdir, 1);
(undef, my $full_dirs, undef) = File::Spec->splitpath($fulldir, 1);
my $all_dirs = File::Spec->catdir($tmp_dirs, $full_dirs);
my $fullpath = File::Spec->catpath($tmp_vol, $all_dirs);
# print "Full path: $fullpath\n";
if (! -d $fullpath) {
make_path($fullpath);
}
my $ret = File::Spec->catpath($tmp_vol, $all_dirs, $tmpfilename);
# print "Changed $tmpfilename to $ret\n";
return $ret;
}
# sub scan_for_set_max_mem
# {
# my $filename = shift;
# open(my $fd, "<", $filename) or die("Can't open $filename: $!\n");
# while(<$fd>) {
# my $line = $_;
# chomp($line);
# if ($line =~ m/^[^;]*\((acl2::)?set-max-mem (.*)\)/)
# {
# my $gb = parse_max_mem_arg($filename, $2);
# close $fd;
# return $gb;
# }
# }
# close $fd;
# return 0;
# }
# sub scan_for_set_max_time
# {
# my $filename = shift;
# open(my $fd, "<", $filename) or die("Can't open $filename: $!\n");
# while(<$fd>) {
# my $line = $_;
# chomp($line);
# if ($line =~ m/^[^;]*\((acl2::)?set-max-time ([0-9]*)\)/)
# {
# my $minutes = $2;
# close $fd;
# return $minutes;
# }
# }
# close $fd;
# return 0;
# }
sub parse_certify_flags
{
my $filename = shift; # just for error messages
my $str = shift; # contents of the .acl2 file as a string
my @lines = split /^/, $str;
# default: any number of portcullis commands are fine, and let's set the
# compile flag to true.
my $ret = "? t";
my $seen = 0;
foreach my $line (@lines) {
chomp($line);
if ($line =~ m/^[ \t]*;[; \t]*cert-flags: (.*)$/) {
die("Multiple cert-flags directives are not allowed.") if $seen;
$ret = $1;
}
}
return $ret;
}
my $TARGET = shift;
my $STEP = shift; # certify, acl2x, acl2xskip, pcertify, pcertifyplus, convert, or complete
my $ACL2X = shift; # "yes" or otherwise no. use ACL2X file in certify/pcertify/pcertifyplus/convert steps
# Bug fix 2017-02-09: Uses of this variable #PREREQS only exist in code
# that is commented out. Therefore commenting this assignment out to
# fix the "argument list too long" issue.
# Refer to https://github.com/acl2/acl2/issues/694 for more information.
# my $PREREQS = \@ARGV;
# print "Prereqs for $TARGET $STEP: \n";
# foreach my $prereq (@$PREREQS) {
# print "$prereq\n";
# }
my $startdir = getcwd;
my $TARGETEXT;
if ($STEP eq "complete" || $STEP eq "certify") {
$TARGETEXT = "cert";
} elsif ($STEP eq "convert" || $STEP eq "pcertifyplus") {
$TARGETEXT = "pcert1";
} elsif ($STEP eq "pcertify") {
$TARGETEXT = "pcert0";
} elsif ($STEP eq "acl2x" || $STEP eq "acl2xskip") {
$TARGETEXT = "acl2x";
} else {
die("Unrecognized step type: $STEP");
}
# normalize acl2x flag to Boolean
$ACL2X = ($ACL2X eq "yes") ? ":acl2x t" : "";
my $INHIBIT = $ENV{"INHIBIT"} || "";
my $HEADER = $ENV{"OUTFILE_HEADER"} || "";
my $MAX_NFS_LAG = $ENV{"MAX_NFS_LAG"} || 100;
my $DEBUG = $ENV{"ACL2_BOOKS_DEBUG"} ? 1 : 0;
my $TIME_CERT = $ENV{"TIME_CERT"} ? 1 : 0;
my $STARTJOB = $ENV{"STARTJOB"} || "";
my $ON_FAILURE_CMD = $ENV{"ON_FAILURE_CMD"} || "";
my $ACL2 = $ENV{"ACL2"} || "acl2";
# Figure out what ACL2 points to before we switch directories.
if ($ENV{"ACL2_BIN_DIR"}) {
(my $vol, my $dir, my $file) = File::Spec->splitpath($ENV{"ACL2_BIN_DIR"});
my $canon_bin_dir = File::Spec->canonpath(File::Spec->catpath($vol, $dir, $file));
print "canonical bin dir: $canon_bin_dir\n" if $DEBUG;
$ENV{"PATH"} = $ENV{"PATH"} ? "$canon_bin_dir:$ENV{'PATH'}" : $canon_bin_dir;
}
# fix up the acl2 path as in cert.pl
my $devnull = File::Spec->devnull;
$ACL2 = path_import($ACL2);
my $default_acl2 = `which $ACL2 2>$devnull`;
if (($? >> 8) != 0) {
print "Error: failed to find \$ACL2 ($ACL2) in the PATH.\n";
exit(1);
}
chomp($default_acl2);
my $PCERT = "";
if ($STEP eq "pcertify") {
$PCERT = ":pcert :create";
} elsif ($STEP eq "convert") {
$PCERT = ":pcert :convert";
} elsif ($STEP eq "pcertifyplus") {
$PCERT = ":pcert t";
} elsif ($STEP eq "complete") {
$PCERT = ":pcert :complete";
}
if ($DEBUG)
{
print "-- Starting up make_cert_help.pl in debug mode.\n";
print "-- TARGET = $TARGET\n";
print "-- STEP = $STEP\n";
print "-- TARGETEXT = $TARGETEXT\n";
print "-- INHIBIT = $INHIBIT\n";
print "-- MAX_NFS_LAG = $MAX_NFS_LAG\n";
print "-- PCERT = $PCERT\n";
print "-- ACL2X = $ACL2X\n";
print "-- HEADER = $HEADER\n";
print "-- Default ACL2 = $default_acl2\n" if $DEBUG;
}
my $full_file = File::Spec->rel2abs($TARGET);
(my $vol, my $dir, my $file) = File::Spec->splitpath($full_file);
my $goal = "$file.$TARGETEXT";
my $printgoal = path_export("$full_file.$TARGETEXT");
print "Making $printgoal on " . strftime('%d-%b-%Y %H:%M:%S',localtime) . "\n";
my $fulldir = File::Spec->canonpath(File::Spec->catpath($vol, $dir, ""));
print "-- Entering directory $fulldir\n" if $DEBUG;
chdir($fulldir) || die("Error switching to $fulldir: $!\n");
my $status;
my $timefile = "$file.$TARGETEXT.time";
my $outfile = maybe_switch_to_tempdir($fulldir, "$file.$TARGETEXT.out");
print "-- Removing files to be generated.\n" if $DEBUG;
remove_file_if_exists($goal);
remove_file_if_exists($timefile);
remove_file_if_exists($outfile);
write_whole_file($outfile, $HEADER);
# Override ACL2 per the image file, as appropriate.
my $acl2 = read_whole_file_if_exists("$file.image");
$acl2 = read_whole_file_if_exists("cert.image") if !$acl2;
$acl2 = $default_acl2 if !$acl2;
$acl2 = trim($acl2);
$ENV{"ACL2"} = $acl2;
print "-- Image to use = $acl2\n" if $DEBUG;
die("Can't determine which ACL2 to use.") if !$acl2;
# Set ACL2_CUSTOMIZATION to NONE. Not sure why make_cert isn't doing this in my case.
$ENV{"ACL2_CUSTOMIZATION"}="NONE";
# ------------ TEMPORARY LISP FILE FOR ACL2 INSTRUCTIONS ----------------------
my $rnd = int(rand(2**30));
my $tmpbase = "workxxx.$goal.$rnd";
# upper-case .LISP so if it doesn't get deleted, we won't try to certify it
my $lisptmp = maybe_switch_to_tempdir($fulldir, "$tmpbase.LISP");
print "-- Temporary lisp file: $lisptmp\n" if $DEBUG;
my $instrs = "";
# I think this strange :q/lp dance is needed for lispworks or something?
$instrs .= "(acl2::value :q)\n";
$instrs .= "(acl2::in-package \"ACL2\")\n";
$instrs .= "; see github issue #638 (waterfall-parallelism and profiling): \n";
$instrs .= "#+(and hons (not acl2-par)) (profile-fn 'prove)\n";
$instrs .= "#+(and hons (not acl2-par)) (profile-fn 'certify-book-fn)\n";
$instrs .= "(acl2::lp)\n";
# We used to comment this out, but maybe it's better to leave this enabled by default?
$instrs .= "(set-debugger-enable :bt)\n";
$instrs .= "(acl2::in-package \"ACL2\")\n\n";
$instrs .= "(set-ld-error-action (quote (:exit 1)) state)\n";
$instrs .= "(set-write-acl2x t state)\n" if ($STEP eq "acl2x");
$instrs .= "(set-write-acl2x '(t) state)\n" if ($STEP eq "acl2xskip");
$instrs .= "$INHIBIT\n" if ($INHIBIT);
$instrs .= "\n";
# --- Scan the source file for includes (to collect the portculli) and resource limits ----
my ($max_mem, $max_time, $includes, $book_pbs) = scan_source_file("$file.lisp");
$max_mem = $max_mem ? ($max_mem + 3) : 4;
$max_time = $max_time || 240;
# Get the certification instructions from foo.acl2 or cert.acl2, if either
# exists, or make a generic certify-book command.
my $acl2file = (-f "$file.acl2") ? "$file.acl2"
: (-f "cert.acl2") ? "cert.acl2"
: "";
my $usercmds = $acl2file ? read_file_except_certify($acl2file) : "";
my $acl2_pbs = $acl2file ? extract_pbs_from_acl2file($acl2file) : [];
# Don't hideously underapproximate timings in event summaries
$instrs .= "(acl2::assign acl2::get-internal-time-as-realtime acl2::t)\n";
# Don't hide GC messages -- except for CMUCL, which dumps them to the terminal.
$instrs .= "#-cmucl (acl2::gc-verbose t)\n";
$instrs .= "; instructions from .acl2 file $acl2file:\n";
$instrs .= "$usercmds\n\n";
$instrs .= "; Prevent reset-prehistory while loading .port files\n";
# Since reset-prehistory is never redundant, this is important to
# prevent exponential growth in the number of reset-prehistory
# commands when building on a saved image that uses reset-prehistory.
$instrs .= "(acl2::assign acl2::skip-reset-prehistory acl2::t)\n";
$instrs .= "; portculli for included books:\n";
foreach my $pair (@$includes) {
my ($incname, $incdir) = @$pair;
if ($incdir) {
$instrs .= "(acl2::ld \"$incname.port\" :dir :$incdir :ld-missing-input-ok t)\n";
} else {
$instrs .= "(acl2::ld \"$incname.port\" :ld-missing-input-ok t)\n";
}
}
# LD'd files above may change the current package
$instrs .= "#!ACL2 (set-ld-error-action (quote :continue) state)\n";
my $cert_flags = parse_certify_flags($acl2file, $usercmds);
$instrs .= "\n; certify-book command flags: $cert_flags\n";
my $cert_cmds = "#!ACL2 (er-progn (time\$ (certify-book \"$file\" $cert_flags $PCERT $ACL2X))
(value (prog2\$ #+hons (memsum)
#-hons nil
(exit 43))))\n";
$instrs .= $cert_cmds;
if ($DEBUG) {
print "-- ACL2 Instructions: $lisptmp --\n";
print "$instrs\n";
print "-------------------------------------------------------\n\n";
}
write_whole_file($lisptmp, $instrs);
# ------------ TEMPORARY SHELL SCRIPT FOR RUNNING ACL2 ------------------------
# upper-case .SH to agree with upper-case .LISP
my $shtmp = maybe_switch_to_tempdir($fulldir, "$tmpbase.SH");
my $shinsts = "#!/bin/sh\n\n";
# If we find a set-max-mem line, add 3 gigs of padding for the stacks and to
# allow the lisp to have some room to go over. Default to 4 gigs.
# If we find a set-max-time line, honor it directly; otherwise default to
# 240 minutes.
print "-- Resource limits: $max_mem gigabytes, $max_time minutes.\n\n" if $DEBUG;
$shinsts .= "#PBS -l pmem=${max_mem}gb\n";
$shinsts .= "#PBS -l walltime=${max_time}:00\n\n";
foreach my $directive (@$acl2_pbs) {
$shinsts .= "#PBS $directive\n";
}
foreach my $directive (@$book_pbs) {
$shinsts .= "#PBS $directive\n";
}
# $shinsts .= "echo List directories of prereqs >> $outfile\n";
# $shinsts .= "time ( ls @$prereq_dirs > /dev/null ) 2> $outfile\n";
# foreach my $prereq (@$PREREQS) {
# $shinsts .= "echo prereq: $prereq >> $outfile\n";
# $shinsts .= "ls -l $startdir/$prereq >> $outfile 2>&1 \n";
# }
$shinsts .= "echo >> '$outfile'\n";
$shinsts .= "pwd >> '$outfile'\n";
$shinsts .= "echo -n 'HOST: ' >> '$outfile'\n";
$shinsts .= "hostname >> '$outfile'\n";
$shinsts .= "echo >> '$outfile'\n";
$shinsts .= "echo Environment variables: >> '$outfile'\n";
my @relevant_env_vars = ("ACL2_CUSTOMIZATION", "ACL2_SYSTEM_BOOKS", "ACL2");
foreach my $var (@relevant_env_vars) {
if (exists $ENV{$var}) {
$shinsts .= "echo $var=$ENV{$var} >> '$outfile'\n";
}
}
$shinsts .= "echo >> '$outfile'\n";
$shinsts .= "echo Temp lisp file: >> '$outfile'\n";
$shinsts .= "cat '$lisptmp' >> '$outfile'\n";
$shinsts .= "echo --- End temp lisp file --- >> '$outfile'\n";
$shinsts .= "echo >> '$outfile'\n";
$shinsts .= "echo TARGET: $TARGET >> '$outfile'\n";
$shinsts .= "echo STEP: $STEP >> '$outfile'\n";
$shinsts .= "echo Start of output: >> '$outfile'\n";
$shinsts .= "echo >> '$outfile'\n";
$shinsts .= "export ACL2_WRITE_PORT=t\n";
if ($TIME_CERT) {
$shinsts .= "(time (($acl2 < '$lisptmp' 2>&1) >> '$outfile')) 2> '$timefile'\n";
}
else {
$shinsts .= "($acl2 < '$lisptmp' 2>&1) >> '$outfile'\n";
}
$shinsts .= "EXITCODE=\$?\n";
$shinsts .= "echo Exit code from ACL2 is \$EXITCODE >> '$outfile'\n";
$shinsts .= "ls -l '$goal' >> '$outfile' || echo '$goal' seems to be missing >> '$outfile'\n";
$shinsts .= "exit \$EXITCODE\n";
if ($DEBUG) {
print "-- Wrapper Script: $shtmp --\n";
print "$shinsts\n";
print "-------------------------------------------------------\n\n";
}
write_whole_file($shtmp, $shinsts);
# Run it! ------------------------------------------------
my $START_TIME = mytime();
# Single quotes to try to protect against file names with dollar signs and similar.
system("$STARTJOB '$shtmp'");
$status = $? >> 8;
my $END_TIME = mytime();
unlink($lisptmp) if !$DEBUG;
unlink($shtmp) if !$DEBUG;
# Success or Failure Detection -------------------------------
# We should know immediately whether we've succeeded or failed,
# because we should exit 43 if we succeeded and not if we don't.
# But we still want to wait for the target file to show up.
my $success = 0;
if ($status == 43) {
if (-f $goal) {
$success = 1;
print "-- Immediate success detected\n" if $DEBUG;
} else {
# if ($STEP eq "cert" && $status == 43) {
# The exit code indicates that the file certified successfully, so why
# doesn't it exist? Maybe there's NFS lag. Let's try waiting to see if
# the file will show up.
$success = wait_for_nfs($goal, $MAX_NFS_LAG);
print "-- After waiting for NFS, success is $success\n" if $DEBUG;
}
}
sub extract_hostname_from_outfile
{
my $filename = shift;
my $ret = "";
open(my $fd, "<", $filename) or die("Can't open $filename: $!\n");
while(<$fd>) {
my $line = $_;
chomp($line);
if ($line =~ m/^HOST: (.*)$/)
{
$ret = $1;
last;
}
}
close($fd);
return $ret;
}
if ($success) {
my $black = chr(27) . "[0m";
my $boldred = chr(27) . "[31;1m";
my $red = chr(27) . "[31m";
my $boldyellow = chr(27) . "[33;1m";
my $yellow = chr(27) . "[33m";
my $green = chr(27) . "[32m";
my $boldgreen = chr(27) . "[32;1m";
my $ELAPSED = $END_TIME - $START_TIME;
my $color = ($ELAPSED > 300) ? $boldred
: ($ELAPSED > 60) ? $red
: ($ELAPSED > 40) ? $boldyellow
: ($ELAPSED > 20) ? $yellow
: ($ELAPSED > 10) ? $green
: $boldgreen;
if ($ENV{"CERT_PL_NO_COLOR"}) {
$color = "";
$black = "";
}
if ($ENV{"CERT_PL_RM_OUTFILES"}) {
unlink($outfile);
}
my $hostname = "";
if ($ENV{"CERT_PL_SHOW_HOSTNAME"}) {
$hostname = " " . extract_hostname_from_outfile($outfile);
}
printf("%sBuilt %s (%.3fs%s)%s\n", $color, $printgoal, $ELAPSED, $hostname, $black);
} else {
my $taskname = ($STEP eq "acl2x" || $STEP eq "acl2xskip") ? "ACL2X GENERATION" :
($STEP eq "certify") ? "CERTIFICATION" :
($STEP eq "pcertify") ? "PROVISIONAL CERTIFICATION" :
($STEP eq "pcertifyplus") ? "PROVISIONAL CERTIFICATION+" :
($STEP eq "convert") ? "PCERT0->PCERT1 CONVERSION" :
($STEP eq "complete") ? "PCERT1->CERT COMLETION" : "UNKNOWN";
print "**$taskname FAILED** for $dir$file.lisp\n\n";
system("tail -300 $outfile | sed 's/^/ | /'") if $outfile;
print "\n\n";
if ($ON_FAILURE_CMD) {
system($ON_FAILURE_CMD);
}
print "**$taskname FAILED** for $dir$file.lisp\n\n";
exit(1);
}
print "-- Final result appears to be success.\n" if $DEBUG;
# Else, we made it!
system("ls -l '$goal'") if $DEBUG;
exit(0);
| 31.739694 | 109 | 0.613018 |
ed723b61c6d373a5d7458d42faf3f1acef8b87c8 | 1,475 | pm | Perl | lib/Alien/TidyHTML5.pm | robrwo/Alien-TidyHTML5 | cb2bfda5ccd4a4366c2095141342340a254d9c87 | [
"ClArtistic"
] | null | null | null | lib/Alien/TidyHTML5.pm | robrwo/Alien-TidyHTML5 | cb2bfda5ccd4a4366c2095141342340a254d9c87 | [
"ClArtistic"
] | 4 | 2018-05-05T09:38:13.000Z | 2021-09-30T05:22:53.000Z | lib/Alien/TidyHTML5.pm | robrwo/Alien-TidyHTML5 | cb2bfda5ccd4a4366c2095141342340a254d9c87 | [
"ClArtistic"
] | 1 | 2018-10-29T13:34:02.000Z | 2018-10-29T13:34:02.000Z | package Alien::TidyHTML5;
# ABSTRACT: Download and install HTML Tidy
use v5.8;
use strict;
use warnings;
use base qw/ Alien::Base /;
use File::Spec::Functions qw/ catfile /;
use List::Util qw/ first /;
use namespace::autoclean;
our $VERSION = 'v0.3.5';
=head1 DESCRIPTION
This distribution provides tidy (a.k.a. "libtidy" or "html-tidy")
v5.6.0 or newer, so that it can be used by other Perl
distributions. It does this by first trying to detect an existing
install of tidy on your system. If found it will use that. If it
cannot be found, the source code will be downloaded from the official
git repository, and it will be installed in a private share location
for the use of other modules.
=head1 METHODS
=head2 C<exe>
This returns the name of the F<tidy> executable, which I<may> be
the path to the executable.
=cut
sub exe {
my ($self) = @_;
$self->runtime_prop->{command};
}
=head1 SEE ALSO
L<http://www.html-tidy.org/>
L<Alien::Build::Manual::AlienUser>
=head2 Other CPAN Modules
L<HTML::Tidy5> uses the the tidy library, but may not make use of the
library installed by this distribution. You may want to use
L<HTML::T5> as an alternative.
L<HTML::Valid> includes a version of the tidy library as part of the
distribution.
L<HTML::Tidy> uses an older (pre-HTML5) version of the tidy library.
=head1 append:AUTHOR
The initial development of this module was sponsored by Science Photo
Library L<https://www.sciencephoto.com>.
=cut
1;
| 20.774648 | 69 | 0.733559 |
ed6461ddef787d01ab4e64af507bedddd4b3fe83 | 2,030 | t | Perl | t/regression/chart_area05.t | jmcnamara/excel-writer-xlsx | bf5c38ea46f95cbd7e0c00ec00704a9de11627da | [
"Artistic-1.0-Perl"
] | 61 | 2015-02-03T02:49:53.000Z | 2022-02-13T09:17:53.000Z | t/regression/chart_area05.t | jmcnamara/excel-writer-xlsx | bf5c38ea46f95cbd7e0c00ec00704a9de11627da | [
"Artistic-1.0-Perl"
] | 167 | 2015-01-02T09:25:11.000Z | 2022-02-16T22:04:20.000Z | t/regression/chart_area05.t | jmcnamara/excel-writer-xlsx | bf5c38ea46f95cbd7e0c00ec00704a9de11627da | [
"Artistic-1.0-Perl"
] | 31 | 2015-02-16T12:06:45.000Z | 2021-10-14T13:03:22.000Z | ###############################################################################
#
# Tests the output of Excel::Writer::XLSX against Excel generated files.
#
# Copyright 2000-2021, John McNamara, jmcnamara@cpan.org
#
use lib 't/lib';
use TestFunctions qw(_compare_xlsx_files _is_deep_diff);
use strict;
use warnings;
use Test::More tests => 1;
###############################################################################
#
# Tests setup.
#
my $filename = 'chart_area05.xlsx';
my $dir = 't/regression/';
my $got_filename = $dir . "ewx_$filename";
my $exp_filename = $dir . 'xlsx_files/' . $filename;
my $ignore_members = [];
my $ignore_elements = {};
###############################################################################
#
# Test the creation of a simple Excel::Writer::XLSX file.
#
use Excel::Writer::XLSX;
my $workbook = Excel::Writer::XLSX->new( $got_filename );
my $worksheet = $workbook->add_worksheet();
my $chart = $workbook->add_chart( type => 'area', embedded => 1 );
# For testing, copy the randomly generated axis ids in the target xlsx file.
$chart->{_axis_ids} = [ 60957824, 60959360 ];
my $data = [
[ 1, 2, 3, 4, 5 ],
[ 8, 7, 6, 8, 10 ],
[ 3, 6, 9, 12, 15 ],
];
$worksheet->write( 'A1', $data );
$chart->add_series(
categories => '=Sheet1!$A$1:$A$5',
values => '=Sheet1!$B$1:$B$5',
);
$chart->add_series(
categories => '=Sheet1!$A$1:$A$5',
values => '=Sheet1!$C$1:$C$5',
);
$worksheet->insert_chart( 'E9', $chart, {description => "Some alternative text"} );
$workbook->close();
###############################################################################
#
# Compare the generated and existing Excel files.
#
my ( $got, $expected, $caption ) = _compare_xlsx_files(
$got_filename,
$exp_filename,
$ignore_members,
$ignore_elements,
);
_is_deep_diff( $got, $expected, $caption );
###############################################################################
#
# Cleanup.
#
unlink $got_filename;
__END__
| 22.065217 | 83 | 0.504433 |
ed9d57bbc39ecb01c87bc9d99b725b8b3233c4b9 | 3,503 | t | Perl | t/pointer.t | FGasper/p5-TOML-XS | 1996dd17e6da83914981a7cb94407a7c49bf43c2 | [
"MIT"
] | 4 | 2021-05-03T22:38:35.000Z | 2022-01-24T12:54:59.000Z | t/pointer.t | FGasper/p5-TOML-XS | 1996dd17e6da83914981a7cb94407a7c49bf43c2 | [
"MIT"
] | 2 | 2021-04-09T20:32:23.000Z | 2021-04-15T22:03:54.000Z | t/pointer.t | FGasper/p5-TOML-XS | 1996dd17e6da83914981a7cb94407a7c49bf43c2 | [
"MIT"
] | null | null | null | ## Please see file perltidy.ERR
## Please see file perltidy.ERR
## Please see file perltidy.ERR
#!/usr/bin/env perl
use strict;
use warnings;
use Test::More;
use Test::FailWarnings;
use Test::Deep;
use Config;
use TOML::XS;
my $toml = <<END;
# This is a TOML document
"Löwe" = "Löwe"
boolean = false
integer = 123
double = 34.5
timestamp = 1979-05-27T07:32:00-08:00
somearray = []
[checkextra]
"Löwe" = "Löwe"
alltypes = [ "a string", true, false, 123, 34.5, 1979-05-27T07:32:00-08:00, {} ]
boolean = false
integer = 123
double = 34.5
timestamp = 1979-05-27T07:32:00-08:00
END
my $the_timestamp_cmp = all(
Isa('TOML::XS::Timestamp'),
methods(
to_string => '1979-05-27T07:32:00-08:00',
year => 1979,
month => 5,
day => 27,
date => 27,
hour => 7,
hours => 7,
minute => 32,
second => 0,
millisecond => undef,
milliseconds => undef,
timezone => '-08:00',
),
);
my $docobj = TOML::XS::from_toml($toml);
my $struct_cmp = {
"L\xf6we" => "L\xf6we",
boolean => TOML::XS::false,
integer => 123,
double => 34.5,
timestamp => $the_timestamp_cmp,
somearray => [],
checkextra => {
"L\xf6we" => "L\xf6we",
boolean => TOML::XS::false,
integer => 123,
double => 34.5,
timestamp => $the_timestamp_cmp,
'alltypes' => [
'a string',
TOML::XS::true,
TOML::XS::false,
123,
'34.5',
$the_timestamp_cmp,
{},
],
},
};
my $struct = $docobj->parse();
cmp_deeply(
$struct,
$struct_cmp,
'struct as expected',
) or diag explain $struct;
is(
$docobj->parse("L\xf6we"),
"L\xf6we",
'non-ASCII pointer',
);
eval { diag explain $docobj->parse('timestamp', 'foo') };
my $err = $@;
like( $err, qr<timestamp>, 'JSON pointer in too-deep error' );
unlike( $err, qr<timestamp/foo>, 'JSON pointer in too-deep error (no too-deep element)' );
#----------------------------------------------------------------------
eval { diag explain $docobj->parse('checkextra', undef) };
$err = $@;
like( $err, qr<1>, 'Undef in pointer triggers exception (table)' );
eval { diag explain $docobj->parse('checkextra', 'alltypes', undef) };
$err = $@;
like( $err, qr<2>, 'Undef in pointer triggers exception (array)' );
#----------------------------------------------------------------------
eval { diag explain $docobj->parse('checkextra', "\xf6\xf6\xf6") };
$err = $@;
like( $err, qr<checkextra/\xf6\xf6\xf6>, 'pointer refers to nonexistent table key' );
#----------------------------------------------------------------------
eval { diag explain $docobj->parse('checkextra', 'alltypes', "\xf6\xf6\xf6") };
$err = $@;
like( $err, qr<checkextra/alltypes>, 'pointer is non-numeric into array' );
unlike( $err, qr<checkextra/alltypes/\xf6\xf6\xf6>, 'pointer is non-numeric into array - JSON pointer is to the array' );
like( $err, qr<\xf6\xf6\xf6>, 'non-numeric array index' );
#----------------------------------------------------------------------
cmp_deeply(
$docobj->parse('checkextra', 'alltypes', 6),
{},
'fetch last array element',
);
eval { diag explain $docobj->parse('checkextra', 'alltypes', 7) };
$err = $@;
like( $err, qr<checkextra/alltypes/7>, 'excess array index' );
like( $err, qr<6>, 'max index given' );
done_testing;
| 24.843972 | 121 | 0.522124 |
73d60c40eab5cb8cbc9d24f8f6fbdfe9f9122fba | 673 | pm | Perl | auto-lib/Paws/ACM/GetCertificateResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 164 | 2015-01-08T14:58:53.000Z | 2022-02-20T19:16:24.000Z | auto-lib/Paws/ACM/GetCertificateResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 348 | 2015-01-07T22:08:38.000Z | 2022-01-27T14:34:44.000Z | auto-lib/Paws/ACM/GetCertificateResponse.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 87 | 2015-04-22T06:29:47.000Z | 2021-09-29T14:45:55.000Z |
package Paws::ACM::GetCertificateResponse;
use Moose;
has Certificate => (is => 'ro', isa => 'Str');
has CertificateChain => (is => 'ro', isa => 'Str');
has _request_id => (is => 'ro', isa => 'Str');
### main pod documentation begin ###
=head1 NAME
Paws::ACM::GetCertificateResponse
=head1 ATTRIBUTES
=head2 Certificate => Str
The ACM-issued certificate corresponding to the ARN specified as input.
=head2 CertificateChain => Str
Certificates forming the requested certificate's chain of trust. The
chain consists of the certificate of the issuing CA and the
intermediate certificates of any other subordinate CAs.
=head2 _request_id => Str
=cut
1; | 19.228571 | 71 | 0.713224 |
eda72207dde2c0a35f752d98297a482cb733511a | 1,013 | pm | Perl | misc-scripts/xref_mapping/XrefMapper/Methods/ExonerateUngappedBest1.pm | arnaudxk/ensembl | 2baa0f180dde74e9d89b7ac0495d15c79bc63ff3 | [
"Apache-2.0"
] | null | null | null | misc-scripts/xref_mapping/XrefMapper/Methods/ExonerateUngappedBest1.pm | arnaudxk/ensembl | 2baa0f180dde74e9d89b7ac0495d15c79bc63ff3 | [
"Apache-2.0"
] | null | null | null | misc-scripts/xref_mapping/XrefMapper/Methods/ExonerateUngappedBest1.pm | arnaudxk/ensembl | 2baa0f180dde74e9d89b7ac0495d15c79bc63ff3 | [
"Apache-2.0"
] | 1 | 2016-02-17T09:50:07.000Z | 2016-02-17T09:50:07.000Z | =head1 LICENSE
Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
=cut
package XrefMapper::Methods::ExonerateUngappedBest1;
use XrefMapper::Methods::ExonerateBasic;
use vars '@ISA';
@ISA = qw{XrefMapper::Methods::ExonerateBasic};
sub options {
return ('--model', 'affine:bestfit', '--subopt', 'no', '--bestn', '1');
}
sub query_identity_threshold {
return 100;
}
sub target_identity_threshold {
return 100;
}
1;
| 20.673469 | 100 | 0.755183 |
73f3c471f17573d46bd4e03ca0b4c98a4ae33148 | 2,575 | pm | Perl | network/cyberoam/snmp/mode/services.pm | nribault/centreon-plugins | e99276ba80ba202392791e78d72b00f1306d1a99 | [
"Apache-2.0"
] | null | null | null | network/cyberoam/snmp/mode/services.pm | nribault/centreon-plugins | e99276ba80ba202392791e78d72b00f1306d1a99 | [
"Apache-2.0"
] | null | null | null | network/cyberoam/snmp/mode/services.pm | nribault/centreon-plugins | e99276ba80ba202392791e78d72b00f1306d1a99 | [
"Apache-2.0"
] | null | null | null | #
# Copyright 2020 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package network::cyberoam::snmp::mode::services;
use base qw(centreon::plugins::templates::hardware);
use strict;
use warnings;
sub set_system {
my ($self, %options) = @_;
$self->{cb_hook2} = 'snmp_execute';
$self->{thresholds} = {
default => [
['untouched', 'OK'],
['stopped', 'CRITICAL'],
['initializing', 'OK'],
['running', 'OK'],
['exiting', 'CRITICAL'],
['dead', 'CRITICAL'],
['unregistered', 'OK'],
['frozen', 'CRITICAL']
]
};
$self->{components_path} = 'network::cyberoam::snmp::mode::components';
$self->{components_module} = ['service'];
}
sub snmp_execute {
my ($self, %options) = @_;
$self->{snmp} = $options{snmp};
$self->{results} = $self->{snmp}->get_multiple_table(
oids => $self->{request},
return_type => 1
);
}
sub new {
my ($class, %options) = @_;
my $self = $class->SUPER::new(package => __PACKAGE__, %options, no_absent => 1, no_performance => 1, force_new_perfdata => 1);
bless $self, $class;
$options{options}->add_options(arguments => {});
return $self;
}
1;
__END__
=head1 MODE
Check services.
=over 8
=item B<--component>
Which component to check (Default: '.*').
Can be: 'service'.
=item B<--filter>
Exclude some parts (comma seperated list)
Can also exclude specific instance: --filter=service,pop
=item B<--no-component>
Return an error if no compenents are checked.
If total (with skipped) is 0. (Default: 'critical' returns).
=item B<--threshold-overload>
Set to overload default threshold values (syntax: section,[instance,]status,regexp)
It used before default thresholds (order stays).
Example: --threshold-overload='service,imap4,OK,stopped'
=back
=cut
| 24.759615 | 130 | 0.64932 |
ed47206df7dbcf0c66a4d005f2fcee65fab3ea8e | 12,192 | al | Perl | benchmark/benchmarks/FASP-benchmarks/data/planar-triangulations/triangulation-0785-790-2364.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/planar-triangulations/triangulation-0785-790-2364.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/planar-triangulations/triangulation-0785-790-2364.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | 1 180 250 484 488
2 281 318
3 169 336 571 694
4 156 191 673
5 119
6 207 561 617 686
7 423 587
8 699 731
9 467 568
10 383 471
11 60 382 511 715
12 323 331 486 549
13 483 538 607
14 157 723
15 85 114 337 400 553 608
16 295 309 530 604
17 174 181 443 450
18 126 277 501
19 490
20 564 605 617
21 61 316
22 129 604 689
23 122 509 705
24 174 548 690
25 436
26 413 766
27 157 203 789
28 254 373
29 510 693
30 234 242 268 739
31 479
32 461 495
33 338 689 715
34 360 788
35 111 290 785
36 374 522 547 602 631
37 226 598 678
38 117 145
39 83 203 208 231
40 25 131 436 701
41 304 337 620
42 34 292 360
43 429 481
44 7 541 570
45 86 116 236 312 513 573
46 76 298 303 440 610
47 87 377 576 735 780
48 38 117 589
49 134 454
50 486 694 785
51 394 609 652 696
52 612
53 221 230 479 527 726
54 301 512 738
55 49 123 381 454 591
56 16 63 295 406
57 191 240
58 141 464 756 770
59 293 601 735 780
60 190 419 511
61
62 406 506 540 788
63 39 88 292 437 530
64 192
65 72 241
66 629 654 659
67 46 76 501 722
68 253 358 502 759
69 120 565 691
70 221 644 776
71 2 467 692 763
72 322 586
73 150 167 635
74 64 92 192 370 517
75 103 315 652 784
76 219 670 722
77 245 509 786
78 346 381 716
79 698 704
80 330 378 776
81 384 423 460 619
82 253 584
83 208 643
84 368 409
85 337
86 496 498
87 576 622 780
88 16 124 437 696
89 55 170 371 499 536 591 614
90 87 325 350
91
92 64 500 566 637
93 43 299 616
94 412 453 763
95 352 566 675 681
96 37 324 598 658
97 28 254 373 744
98 20 186 369 605
99 439
100 18 126 172 435
101 210 224 279 287 470 718
102 9 260 343 641
103 315 562 695
104 127 251 300 390 774 783
105 255
106 10 35 290 517
107 138 457
108 29
109 379 611 736
110 127 258 297 569 693
111 442 785
112 238 274
113 84 368 409 779
114 445 608
115 79 175 698 714
116 47 377 498 576
117 560
118 28 245 348 449 466
119 70 199 708 710
120 20 691
121 27 42 424
122 474 481 658
123 346
124 16 604
125 634
126 435 473
127 183 248 300 579
128 215 270
129 269 519 604
130 32 240 495 742
131 25
132 103
133 151 375 613 702
134
135 86 155 431 502 685
136 5 119 185
137 249 618
138 146 310 508 760
139 102 153 260
140 91 255 472
141 458 668 765
142 80 378 463
143 566 767
144 9 153 339 568
145 432 516 743
146 107 508 546
147 168 188 558 790
148 216
149 145 349 516
150 167 412
151 237
152 65 193 364
153 9 102 411
154 789
155 68 312 358 465
156 109 191 446
157 125 387 552
158 66 161 654
159 261 271
160 262 458 464 493
161 195 341
162 8 190 236 415 699
163 380 494 601
164 298 643
165 377 397 735
166 115 626 714
167 412 635 680
168 313
169 434 452 654 659
170 499 757
171 13 326 436 607
172
173 201 353 455 495 506
174 395
175 79 166
176 246 534
177 81 460 475 533
178
179 164 187 433
180 484 507 659
181 523 550 584 595
182 213 572
183 110 352
184 84 402 545
185 142 439
186 364 564
187 83 164 535
188 313 339 790
189 270 329
190 11 382 699
191 109 736
192 597
193 302 428 564
194 702
195 294
196 359
197 239 285
198 263 347 462 583
199 70 171 436
200 82 555
201 32 79 166 175 706
202 374 421 738
203 63 121
204 392
205 204 224 355 532 569
206 126 132 435 661
207 228 407 686
208 63 187 535
209 104
210 29 52 108 224 603 612
211 138 753 766
212 489 640 671 746
213 263 289 371 728
214 29 278 612
215 270
216 385 424
217 21 61 577 603 632
218 116 397
219 610 670
220 1 537
221 230 527
222 597 767
223 402
224
225 4 241 447
226 97 744
227 53
228 37 480 651 678
229 327 724
230 227
231 27 83 789
232 112 238 274 480
233 22 626 689
234 242 288 745
235 196 359
236 382 415 459
237 194 624 716
238 235 247 328 588 598
239 285 550 581 750
240 191 503
241 72 364 663
242 276 633
243 26 61
244 75 315 652
245 288 348 449
246 283
247 235 717 770
248 70 183 390 527 776
249 370 618 674
250 488
251 80 330 774 776 783
252 548 578
253 502
254 37 449 646 744
255 219 664
256 136 185 361 395
257 590 653
258 108
259 250 488 787
260 411 482 727
261 93 403 616 765
262 41 539
263 283 347
264 79 133 151 320 704 754
265 328
266 21 278 766
267 158 161
268 229 259 389 777
269 60 190 376 699
270 257 329 590 653
271 31 370 403
272 10 383
273 123 346 591
274 207 398 407 565
275 38 48 145 149 366 589
276 77 234 245 288 340
277 100 172 303 501
278 457
279 749 767
280 114 157 398 487 723
281 94 257 688
282 205 569
283 176
284 209 439 443 523 750
285 146 546 559
286 107 146 285 642
287 649 718
288
289 182 572
290 192 517
291 167 416 582
292 34 56 121 203
293 648
294 111 336 442 785
295
296 215
297 108 210 258 569
298 179 433 440 606
299 43 261
300 209 420 750 775
301 344 477
302 367 489 518
303 67 100 172 501
304 58 262 464
305 343 396 467 649 712
306 363 656 729
307 217 396 577 632 649
308 112 274 456 733
309 22 233 295 575 604
310 278 457
311 216 360 424 448
312 86 135 236
313 147 405 413
314 296 557
315 132 394 435 609
316 26 61 243 266 766
317 425 729
318 71 94 281
319 143 222 597
320 79
321 66 180 484 659
322 65 152 399 408
323 178 563 694
324 196
325 200 239 550 581 772
326 119 199 708 741
327 268
328 112 456
329 128 490 711
330 463 525 707 783
331 323 549
332 23 449 509 658
333 306 317 363
334 192 290 597 636
335 409 656
336 50 161 195 267 694 785
337 400 538 539
338 524 698
339 153 482
340 77 633 713
341 195 294 526 529
342 38 117 327 425 560 720
343 260 641
344 54 194 624
345 103 162 415
346 381
347 283 623
348 288
349 365 379 384 475
350 87 576
351 25 160 493
352 110 204 282 392
353
354 69 121 487 552
355 143 204 392 532 566
356 684 711
357 191 240 503 657
358
359 43 96 247 324 756
360
361 386 515
362 149 275 365 366 673 725
363 667
364 65 564
365 149 379 611
366 212
367 193 226 428 678 748
368 545 667
369 148 186 241 364 605 691
370 159 517
371 182
372 340 639 713 786
373 466 518
374 134 602 738
375 468
376 51 129 696 784
377 218 397 735
378 5 136 185
379 611
380 59 293 601 648
381 49 123 716
382 162 459 544 596
383 441 705
384 516 679 778
385 148 311
386 556 708
387 114 125 280 445
388 563 712 749
389 30 220 528
390 127 774
391 275 640
392 95 566
393 414 689
394 244 609
395 99 185 450 548
396 260 343 649
397 662 740 757
398 308 487 531
399 72 725 746
400 114 620
401 50 290 334 486
402 438 477 600
403 31 159 227 479 668 701
404 34 56 62 292
405 26 188 243 339 482
406 404 455 732
407 561 565
408 152 193 212 399 746
409 184 582 656 779
410 69 121 354 424
411 139 339
412 453 680
413 168 405 648 768
414 33 338 524 689
415 312 465 593
416 167 582 635
417 25 160 171 262 351 607
418 57 130 240
419 22 129 269 511 638
420 239 285 286 592 750
421 73 374 574
422 133 151 194 237 702
423 545 619
424 42 69 360 691
425 333 363 660 787
426 362 366
427 105 114 445 608
428 686
429 93 122 474
430 229 666 773
431 155 502
432 38 342 720
433 46 303
434 467 625 763
435 132
436 70 417 701
437 51 179 208 535 609 696
438 7 423 545 587
439 142 395 443 450 525
440 606 610
441 10 615
442 35 471 529 713
443 523
444 302 489 497
445 105 634
446 4 365 611 769
447 4 241 586 673
448 34 360 647 788
449 28 77
450 99 174 443
451 89 170 687 757
452 167 291 434 680
453 150 281
454 89 134 374 614 631
455 309 506 575 706
456 112 265
457 138 697
458 131 464 668
459 45 513 544
460 7 44 423
461 130 133 704
462 492 504
463 439 707
464 141 262
465 312
466 28 497 518
467 102 692
468 613
469 257 692
470 224 279 532
471 35 106 372 713
472 105 255 427 700
473 18 68 595 759
474 93 491 705
475 81 109 379 384 533 736
476 347 462 504 544 672
477 223 512 574
478 27 39 203 231
479 227
480 37 207 274 598
481 96 359 429 658
482 411 727
483 171 326
484 66 220 629
485 451
486
487 565
488 317 729
489 193 408 640
490 128 163 494 645 711 771
491 93 137 616 618
492 198 218
493 25 131 458
494 19 380 557 558 768
495 201 240 353 503 506
496 90 325 350 498
497 391 518 589 773
498 45 350 554
499 371 583
500 64 192 319 566
501 473 595 734
502 155 555
503 657
504 513 544
505 170 218 492 583
506 353 406
507 291 335 452 582 656
508 753
509 449 615
510 214 278 693
511
512 301 738
513 462 573
514 265 400 588 620 628 733
515 15 252 386 553 761
516 349 743
517 10 192 249 272 618
518 97 444 748
519 88 124 376
520 273 534 591
521 6 120 565 617
522 270
523 17
524 115 393 714 752
525 284 463 783
526 161 528 537 629 739
527 70 637 669 681 726
528 30 567 739
529 294 526
530 56 88
531 114 280 308
532 143 224 279 767
533 468 570
534 78 273 346 621
535 179
536 451 485 711
537 389 484 567
538 483 539 709
539 41
540 495 503 506 657 721
541 194 301 344 702
542 21 52 217 266 603
543 54 134 374
544 513
545 84 402 619
546 87 508 581 622
547 270 356 522 631
548 174 256 578
549 597
550 200 284 523 781
551 125 154 157 634
552 27 121
553 91 608 664
554 350
555 82 253
556 15 85 515 762
557 19 558
558
559 197 239 546 581
560 48 229 327 589 724 773
561 207 521 565
562 75 269 376
563 331 764
564 6 98 152 428 686
565 120 354 398
566 319
567 389 526
568 215 590 692
569 210 224 352
570 177 460 468
571 178 323 563 694
572 213 520
573 116 218 462 492
574 73 202 223 512 635
575 295 406 732
576 498 554
577 287 718
578 255 585 722 734
579 104 390
580 223 416 574
581 87 90
582 184 335 600
583 170 371 492 728
584 473 595 759
585 219 255 670
586 241 673 725
587 44 402
588 58 265 304 328 717
589 391
590 215 469 692
591 123 182 371 572
592 286 300 510 693 697
593 345 465 737
594 144 188 215 296 314 339 568
595 17 24 174
596 11 544
597 500 636 767
598 196 232 235 324
599 163 490
600 184 223 416 580
601 599 719 730
602 73 150 421 522
603 52 577
604 519
605 120
606 154 164 703 789
607 262 538 539
608 700
609 100 179 303 433 435
610 76 105 255 703
611 156
612 29 266 278 542
613 375 461 533 742
614 356 536 631
615 383 782
616 159 370
617 120 564
618 272 383
619 660 679 720
620 337 628
621 176 213 263 283 520 572
622 293 508 648
623 246 283 476 758
624 54 134 194 543 716
625 3 169 305 467 712
626 201 706
627 198 347 462 476
628 41 304 588
629 158 161 537
630 14 157 354 552
631 356 374
632 61 747
633 276 713 739
634 154 387 703
635 580
636 12 401 486 549
637 669 681
638 11 22 33 511 715
639 77 340
640 444 497 671
641 305 467
642 107 457 592
643 187 231 606
644 221 230 436
645 19 128 215 296 314 557
646 37 96 332 449
647 225 311 385 655 788
648 26 211 766
649 577 677 712
650 259 317 425 488 787
651 367 428 686
652 376 394 784
653 150 281 453 522 602
654 3 267 336 659
655 4 191 225 357 788
656 1 180 729
657 62
658 23 646
659 452 507
660 363 368 545 667
661 68 126 358 473
662 165 730
663 148 225 369 385 647
664 91 140 252 515 578
665 78 176 264 320 534 698 754
666 118 348 466 773
667 113 306 779
668 40 131 261 701
669 74 92 271 370 726
670 578 722
671 275 366 391
672 544 596 623 715 758
673 365
674 137 370 491 616
675 92 566 637 681
676 44 375 468 570 702
677 101 279 287 712
678 226 651
679 81
680 434 763
681 183 248 352
682 44 301 402 477 541 587
683 451 485 599 719 757
684 189 270 547
685 86 496 502 555 772
686 228
687 170
688 2 257 469
689 626 638 714
690 501 548 578 595
691 148 216 605
692 2 9 688
693 108 127 258 300
694 12 178 486
695 8 162 345 562
696 519
697 278 510 642
698 176 246 320 524 758
699 562 731
700 91 140 427 553
701 227 230 644
702 44 375
703 105 154 440 445
704 32 133 201
705 122 491 509 615 618
706 173 233 309
707 80 142
708 136 256 361 762
709 326 337 483 741
710 5 70 80 378 776
711 189 485 614 684 771
712 3 563 571 749
713 529 739
714 626
715 338 596
716 49 134
717 238
718 210 603
719 397 599 662 730 757
720 425 660 778
721 503 657
722
723 157 354 487 630
724 430
725 72 426 673
726 31 271 479
727 307 396 405 632
728 198 263 371
729 1 333
730 59 165 735
731 562 695
732 56 295
733 114 265 400 456 531
734 67 690 722
735
736 57 418 533 613
737 103 132 155 206 345 358 465 661
738 543 574
739 242 529
740 218 505 757
741 85 337 762
742 418 461 736
743 432 778
744 37
745 288 348 666 777
746 366 426 725
747 61 243 405 727
748 97 226 302
749 677
750 550 775
751 1 220 250 259 268 389
752 393 689 714
753 138 622 648
754 78 151 237 716
755 204 205 282 352
756 43 299 765
757 505 687
758 246 338 715
759 82 253
760 211 278 310 766
761 252 256 361 548
762 85 326 386
763 318 412 467
764 279 331 388 749
765 58 299 668
766 278
767 319 331 549 764
768 147 168 380 558 648
769 4 365 673
770 359 588 717 756
771 485 599 683
772 200 496 555
773 466 589 724
774 776
775 209 284
776 390
777 30 229 234 430 666
778 432 516 619 679
779 306 656
780 293 622 735
781 82 181 200 584
782 10 372 441 471 509
783 209 284
784 562
785 290 401
786 509 639 782
787 268 327 342
788 357 404 657
789 157 551 643
790 314 557 558 594 | 15.432911 | 35 | 0.741388 |
ed733147eddbb297bce8f801f548ed6e770f026b | 848 | t | Perl | core/server/t/20_xml/4.t | ptomulik/openxpki | 0e9459fc4b24f5bf9652c3345ea4ed68fdbc4381 | [
"Apache-2.0"
] | null | null | null | core/server/t/20_xml/4.t | ptomulik/openxpki | 0e9459fc4b24f5bf9652c3345ea4ed68fdbc4381 | [
"Apache-2.0"
] | null | null | null | core/server/t/20_xml/4.t | ptomulik/openxpki | 0e9459fc4b24f5bf9652c3345ea4ed68fdbc4381 | [
"Apache-2.0"
] | null | null | null |
use strict;
use warnings;
use English;
use Test::More;
use OpenXPKI::XML::Cache;
use Time::HiRes;
plan tests => 4;
print STDERR "SCHEMA VALIDATION\n" if $ENV{VERBOSE};
TODO: {
local $TODO = 'Schema is outdated, see #1702814';
## create new object
my $obj = eval {OpenXPKI::XML::Cache->new(CONFIG => "t/config_test.xml",
SCHEMA => "openxpki.xsd")};
is($EVAL_ERROR, '', 'Config object created successfully');
ok(defined $obj, 'Config object is defined');
is(ref $obj, 'OpenXPKI::XML::Cache', 'Config object has correct type');
}
## try an incorrect XML file
my $obj;
eval { $obj = OpenXPKI::XML::Cache->new(CONFIG => "t/25_crypto/token.xml",
SCHEMA => "openxpki.xsd"); };
ok($EVAL_ERROR, 'Incorrect XML file detected correctly');
1;
| 29.241379 | 76 | 0.597877 |
ed587b3f2e71cab8c1c161a2687917b7f7651924 | 12,011 | ph | Perl | rootfs/usr/lib/perl/5.14.2/stddef.ph | kappaIO-Dev/kappaIO-sdk-armhf-crosscompile | 66fc5fc21e6235f7a3be72a7ccac68e2224b7fb2 | [
"MIT"
] | null | null | null | rootfs/usr/lib/perl/5.14.2/stddef.ph | kappaIO-Dev/kappaIO-sdk-armhf-crosscompile | 66fc5fc21e6235f7a3be72a7ccac68e2224b7fb2 | [
"MIT"
] | null | null | null | rootfs/usr/lib/perl/5.14.2/stddef.ph | kappaIO-Dev/kappaIO-sdk-armhf-crosscompile | 66fc5fc21e6235f7a3be72a7ccac68e2224b7fb2 | [
"MIT"
] | null | null | null | require '_h2ph_pre.ph';
no warnings qw(redefine misc);
if((!defined(&_STDDEF_H) && !defined(&_STDDEF_H_) && !defined(&_ANSI_STDDEF_H) && !defined(&__STDDEF_H__)) || defined(&__need_wchar_t) || defined(&__need_size_t) || defined(&__need_ptrdiff_t) || defined(&__need_NULL) || defined(&__need_wint_t)) {
if((!defined(&__need_wchar_t) && !defined(&__need_size_t) && !defined(&__need_ptrdiff_t) && !defined(&__need_NULL) && !defined(&__need_wint_t))) {
eval 'sub _STDDEF_H () {1;}' unless defined(&_STDDEF_H);
eval 'sub _STDDEF_H_ () {1;}' unless defined(&_STDDEF_H_);
eval 'sub _ANSI_STDDEF_H () {1;}' unless defined(&_ANSI_STDDEF_H);
eval 'sub __STDDEF_H__ () {1;}' unless defined(&__STDDEF_H__);
}
unless(defined(&__sys_stdtypes_h)) {
if(defined (&__BSD_NET2__) || defined (&____386BSD____) || (defined (&__FreeBSD__) && ((defined(&__FreeBSD__) ? &__FreeBSD__ : undef) < 5)) || defined(&__NetBSD__)) {
require 'machine/ansi.ph';
}
if(defined (&__FreeBSD__) && ((defined(&__FreeBSD__) ? &__FreeBSD__ : undef) >= 5)) {
require 'sys/_types.ph';
}
if(defined(&_ANSI_H_) || defined(&_MACHINE_ANSI_H_) || defined(&_X86_64_ANSI_H_) || defined(&_I386_ANSI_H_)) {
if(!defined(&_SIZE_T_) && !defined(&_BSD_SIZE_T_)) {
eval 'sub _SIZE_T () {1;}' unless defined(&_SIZE_T);
}
if(!defined(&_PTRDIFF_T_) && !defined(&_BSD_PTRDIFF_T_)) {
eval 'sub _PTRDIFF_T () {1;}' unless defined(&_PTRDIFF_T);
}
if(!defined(&_WCHAR_T_) && !defined(&_BSD_WCHAR_T_)) {
unless(defined(&_BSD_WCHAR_T_)) {
eval 'sub _WCHAR_T () {1;}' unless defined(&_WCHAR_T);
}
}
if(defined (&__need_ptrdiff_t) || defined (&_STDDEF_H_)) {
undef(&_PTRDIFF_T_) if defined(&_PTRDIFF_T_);
undef(&_BSD_PTRDIFF_T_) if defined(&_BSD_PTRDIFF_T_);
}
if(defined (&__need_size_t) || defined (&_STDDEF_H_)) {
undef(&_SIZE_T_) if defined(&_SIZE_T_);
undef(&_BSD_SIZE_T_) if defined(&_BSD_SIZE_T_);
}
if(defined (&__need_wchar_t) || defined (&_STDDEF_H_)) {
undef(&_WCHAR_T_) if defined(&_WCHAR_T_);
undef(&_BSD_WCHAR_T_) if defined(&_BSD_WCHAR_T_);
}
}
if(defined (&__sequent__) && defined (&_PTRDIFF_T_)) {
undef(&_PTRDIFF_T_) if defined(&_PTRDIFF_T_);
}
if(defined (&_TYPE_ptrdiff_t) && (defined (&__need_ptrdiff_t) || defined (&_STDDEF_H_))) {
undef(&_TYPE_ptrdiff_t) if defined(&_TYPE_ptrdiff_t);
}
if(defined (&_TYPE_size_t) && (defined (&__need_size_t) || defined (&_STDDEF_H_))) {
undef(&_TYPE_size_t) if defined(&_TYPE_size_t);
}
if(defined (&_TYPE_wchar_t) && (defined (&__need_wchar_t) || defined (&_STDDEF_H_))) {
undef(&_TYPE_wchar_t) if defined(&_TYPE_wchar_t);
}
if(defined (&_STDDEF_H) || defined (&__need_ptrdiff_t)) {
unless(defined(&_PTRDIFF_T)) {
unless(defined(&_T_PTRDIFF_)) {
unless(defined(&_T_PTRDIFF)) {
unless(defined(&__PTRDIFF_T)) {
unless(defined(&_PTRDIFF_T_)) {
unless(defined(&_BSD_PTRDIFF_T_)) {
unless(defined(&___int_ptrdiff_t_h)) {
unless(defined(&_GCC_PTRDIFF_T)) {
eval 'sub _PTRDIFF_T () {1;}' unless defined(&_PTRDIFF_T);
eval 'sub _T_PTRDIFF_ () {1;}' unless defined(&_T_PTRDIFF_);
eval 'sub _T_PTRDIFF () {1;}' unless defined(&_T_PTRDIFF);
eval 'sub __PTRDIFF_T () {1;}' unless defined(&__PTRDIFF_T);
eval 'sub _PTRDIFF_T_ () {1;}' unless defined(&_PTRDIFF_T_);
eval 'sub _BSD_PTRDIFF_T_ () {1;}' unless defined(&_BSD_PTRDIFF_T_);
eval 'sub ___int_ptrdiff_t_h () {1;}' unless defined(&___int_ptrdiff_t_h);
eval 'sub _GCC_PTRDIFF_T () {1;}' unless defined(&_GCC_PTRDIFF_T);
unless(defined(&__PTRDIFF_TYPE__)) {
eval 'sub __PTRDIFF_TYPE__ () {\'long int\';}' unless defined(&__PTRDIFF_TYPE__);
}
}
}
}
}
}
}
}
}
undef(&__need_ptrdiff_t) if defined(&__need_ptrdiff_t);
}
if(defined (&_STDDEF_H) || defined (&__need_size_t)) {
unless(defined(&__size_t__)) {
unless(defined(&__SIZE_T__)) {
unless(defined(&_SIZE_T)) {
unless(defined(&_SYS_SIZE_T_H)) {
unless(defined(&_T_SIZE_)) {
unless(defined(&_T_SIZE)) {
unless(defined(&__SIZE_T)) {
unless(defined(&_SIZE_T_)) {
unless(defined(&_BSD_SIZE_T_)) {
unless(defined(&_SIZE_T_DEFINED_)) {
unless(defined(&_SIZE_T_DEFINED)) {
unless(defined(&_BSD_SIZE_T_DEFINED_)) {
unless(defined(&_SIZE_T_DECLARED)) {
unless(defined(&___int_size_t_h)) {
unless(defined(&_GCC_SIZE_T)) {
unless(defined(&_SIZET_)) {
unless(defined(&__size_t)) {
eval 'sub __size_t__ () {1;}' unless defined(&__size_t__);
eval 'sub __SIZE_T__ () {1;}' unless defined(&__SIZE_T__);
eval 'sub _SIZE_T () {1;}' unless defined(&_SIZE_T);
eval 'sub _SYS_SIZE_T_H () {1;}' unless defined(&_SYS_SIZE_T_H);
eval 'sub _T_SIZE_ () {1;}' unless defined(&_T_SIZE_);
eval 'sub _T_SIZE () {1;}' unless defined(&_T_SIZE);
eval 'sub __SIZE_T () {1;}' unless defined(&__SIZE_T);
eval 'sub _SIZE_T_ () {1;}' unless defined(&_SIZE_T_);
eval 'sub _BSD_SIZE_T_ () {1;}' unless defined(&_BSD_SIZE_T_);
eval 'sub _SIZE_T_DEFINED_ () {1;}' unless defined(&_SIZE_T_DEFINED_);
eval 'sub _SIZE_T_DEFINED () {1;}' unless defined(&_SIZE_T_DEFINED);
eval 'sub _BSD_SIZE_T_DEFINED_ () {1;}' unless defined(&_BSD_SIZE_T_DEFINED_);
eval 'sub _SIZE_T_DECLARED () {1;}' unless defined(&_SIZE_T_DECLARED);
eval 'sub ___int_size_t_h () {1;}' unless defined(&___int_size_t_h);
eval 'sub _GCC_SIZE_T () {1;}' unless defined(&_GCC_SIZE_T);
eval 'sub _SIZET_ () {1;}' unless defined(&_SIZET_);
if((defined (&__FreeBSD__) && ((defined(&__FreeBSD__) ? &__FreeBSD__ : undef) >= 5)) || defined(&__FreeBSD_kernel__)) {
} else {
eval 'sub __size_t () {1;}' unless defined(&__size_t);
}
unless(defined(&__SIZE_TYPE__)) {
eval 'sub __SIZE_TYPE__ () {\'long unsigned int\';}' unless defined(&__SIZE_TYPE__);
}
if(!(defined (&__GNUG__) && defined )) {
if(defined(&__BEOS__)) {
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
undef(&__need_size_t) if defined(&__need_size_t);
}
if(defined (&_STDDEF_H) || defined (&__need_wchar_t)) {
unless(defined(&__wchar_t__)) {
unless(defined(&__WCHAR_T__)) {
unless(defined(&_WCHAR_T)) {
unless(defined(&_T_WCHAR_)) {
unless(defined(&_T_WCHAR)) {
unless(defined(&__WCHAR_T)) {
unless(defined(&_WCHAR_T_)) {
unless(defined(&_BSD_WCHAR_T_)) {
unless(defined(&_BSD_WCHAR_T_DEFINED_)) {
unless(defined(&_BSD_RUNE_T_DEFINED_)) {
unless(defined(&_WCHAR_T_DECLARED)) {
unless(defined(&_WCHAR_T_DEFINED_)) {
unless(defined(&_WCHAR_T_DEFINED)) {
unless(defined(&_WCHAR_T_H)) {
unless(defined(&___int_wchar_t_h)) {
unless(defined(&__INT_WCHAR_T_H)) {
unless(defined(&_GCC_WCHAR_T)) {
eval 'sub __wchar_t__ () {1;}' unless defined(&__wchar_t__);
eval 'sub __WCHAR_T__ () {1;}' unless defined(&__WCHAR_T__);
eval 'sub _WCHAR_T () {1;}' unless defined(&_WCHAR_T);
eval 'sub _T_WCHAR_ () {1;}' unless defined(&_T_WCHAR_);
eval 'sub _T_WCHAR () {1;}' unless defined(&_T_WCHAR);
eval 'sub __WCHAR_T () {1;}' unless defined(&__WCHAR_T);
eval 'sub _WCHAR_T_ () {1;}' unless defined(&_WCHAR_T_);
eval 'sub _BSD_WCHAR_T_ () {1;}' unless defined(&_BSD_WCHAR_T_);
eval 'sub _WCHAR_T_DEFINED_ () {1;}' unless defined(&_WCHAR_T_DEFINED_);
eval 'sub _WCHAR_T_DEFINED () {1;}' unless defined(&_WCHAR_T_DEFINED);
eval 'sub _WCHAR_T_H () {1;}' unless defined(&_WCHAR_T_H);
eval 'sub ___int_wchar_t_h () {1;}' unless defined(&___int_wchar_t_h);
eval 'sub __INT_WCHAR_T_H () {1;}' unless defined(&__INT_WCHAR_T_H);
eval 'sub _GCC_WCHAR_T () {1;}' unless defined(&_GCC_WCHAR_T);
eval 'sub _WCHAR_T_DECLARED () {1;}' unless defined(&_WCHAR_T_DECLARED);
if(defined(&_BSD_WCHAR_T_)) {
undef(&_BSD_WCHAR_T_) if defined(&_BSD_WCHAR_T_);
if(defined(&_BSD_RUNE_T_)) {
if(!defined (&_ANSI_SOURCE) && !defined (&_POSIX_SOURCE)) {
eval 'sub _BSD_WCHAR_T_DEFINED_ () {1;}' unless defined(&_BSD_WCHAR_T_DEFINED_);
eval 'sub _BSD_RUNE_T_DEFINED_ () {1;}' unless defined(&_BSD_RUNE_T_DEFINED_);
if(defined (&__FreeBSD__) && ((defined(&__FreeBSD__) ? &__FreeBSD__ : undef) < 5)) {
undef(&_BSD_RUNE_T_) if defined(&_BSD_RUNE_T_);
}
}
}
}
if(defined (&__FreeBSD__) && ((defined(&__FreeBSD__) ? &__FreeBSD__ : undef) >= 5)) {
if(!defined (&_ANSI_SOURCE) && !defined (&_POSIX_SOURCE)) {
if((defined(&__BSD_VISIBLE) ? &__BSD_VISIBLE : undef)) {
unless(defined(&_RUNE_T_DECLARED)) {
eval 'sub _RUNE_T_DECLARED () {1;}' unless defined(&_RUNE_T_DECLARED);
}
}
}
}
unless(defined(&__WCHAR_TYPE__)) {
eval 'sub __WCHAR_TYPE__ () {\'int\';}' unless defined(&__WCHAR_TYPE__);
}
unless(defined(&__cplusplus)) {
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
}
undef(&__need_wchar_t) if defined(&__need_wchar_t);
}
if(defined (&__need_wint_t)) {
unless(defined(&_WINT_T)) {
eval 'sub _WINT_T () {1;}' unless defined(&_WINT_T);
unless(defined(&__WINT_TYPE__)) {
eval 'sub __WINT_TYPE__ () {\'unsigned int\';}' unless defined(&__WINT_TYPE__);
}
}
undef(&__need_wint_t) if defined(&__need_wint_t);
}
if(defined(&_ANSI_H_) || defined(&_MACHINE_ANSI_H_) || defined(&_X86_64_ANSI_H_) || defined(&_I386_ANSI_H_)) {
if(defined(&_GCC_PTRDIFF_T_)) {
undef(&_PTRDIFF_T_) if defined(&_PTRDIFF_T_);
undef(&_BSD_PTRDIFF_T_) if defined(&_BSD_PTRDIFF_T_);
}
if(defined(&_GCC_SIZE_T_)) {
undef(&_SIZE_T_) if defined(&_SIZE_T_);
undef(&_BSD_SIZE_T_) if defined(&_BSD_SIZE_T_);
}
if(defined(&_GCC_WCHAR_T_)) {
undef(&_WCHAR_T_) if defined(&_WCHAR_T_);
undef(&_BSD_WCHAR_T_) if defined(&_BSD_WCHAR_T_);
}
if(defined(&_GCC_PTRDIFF_T)) {
undef(&_PTRDIFF_T_) if defined(&_PTRDIFF_T_);
undef(&_BSD_PTRDIFF_T_) if defined(&_BSD_PTRDIFF_T_);
}
if(defined(&_GCC_SIZE_T)) {
undef(&_SIZE_T_) if defined(&_SIZE_T_);
undef(&_BSD_SIZE_T_) if defined(&_BSD_SIZE_T_);
}
if(defined(&_GCC_WCHAR_T)) {
undef(&_WCHAR_T_) if defined(&_WCHAR_T_);
undef(&_BSD_WCHAR_T_) if defined(&_BSD_WCHAR_T_);
}
}
}
if(defined (&_STDDEF_H) || defined (&__need_NULL)) {
undef(&NULL) if defined(&NULL);
if(defined(&__GNUG__)) {
eval 'sub NULL () { &__null;}' unless defined(&NULL);
} else {
unless(defined(&__cplusplus)) {
eval 'sub NULL () {(( &void *)0);}' unless defined(&NULL);
} else {
eval 'sub NULL () {0;}' unless defined(&NULL);
}
}
}
undef(&__need_NULL) if defined(&__need_NULL);
if(defined(&_STDDEF_H)) {
eval 'sub offsetof {
my($TYPE, $MEMBER) = @_;
eval q( &__builtin_offsetof ($TYPE, $MEMBER));
}' unless defined(&offsetof);
if((defined (&__STDC_VERSION__) && (defined(&__STDC_VERSION__) ? &__STDC_VERSION__ : undef) >= 201112) || (defined(&__cplusplus) && (defined(&__cplusplus) ? &__cplusplus : undef) >= 201103)) {
unless(defined(&_GCC_MAX_ALIGN_T)) {
eval 'sub _GCC_MAX_ALIGN_T () {1;}' unless defined(&_GCC_MAX_ALIGN_T);
}
}
}
}
1;
| 41.417241 | 249 | 0.603197 |
ed6bb4a2a9f6599ecd3b73d2d9579ecf6da386a4 | 13,855 | pm | Perl | database/postgres/mode/statistics.pm | cstegm/centreon-plugins | b29bdb670de52a22d3520661dc7b9d2548ae7a1a | [
"Apache-2.0"
] | null | null | null | database/postgres/mode/statistics.pm | cstegm/centreon-plugins | b29bdb670de52a22d3520661dc7b9d2548ae7a1a | [
"Apache-2.0"
] | null | null | null | database/postgres/mode/statistics.pm | cstegm/centreon-plugins | b29bdb670de52a22d3520661dc7b9d2548ae7a1a | [
"Apache-2.0"
] | null | null | null | #
# Copyright 2019 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package database::postgres::mode::statistics;
use base qw(centreon::plugins::mode);
use strict;
use warnings;
use centreon::plugins::values;
use centreon::plugins::statefile;
use Digest::MD5 qw(md5_hex);
my $maps_counters = {
database => {
'000_commit' => { set => {
key_values => [ { name => 'commit', diff => 1 }, { name => 'name' }, ],
output_template => 'Commit : %s',
perfdatas => [
{ label => 'commit', value => 'commit_absolute', template => '%s',
min => 0, label_extra_instance => 1, instance_use => 'name_absolute' },
],
}
},
'001_rollback' => { set => {
key_values => [ { name => 'rollback', diff => 1 }, { name => 'name' }, ],
output_template => 'Rollback : %s',
perfdatas => [
{ label => 'rollback', value => 'rollback_absolute', template => '%s',
min => 0, label_extra_instance => 1, instance_use => 'name_absolute' },
],
}
},
'002_insert' => { set => {
key_values => [ { name => 'insert', diff => 1 }, { name => 'name' }, ],
output_template => 'Insert : %s',
perfdatas => [
{ label => 'insert', value => 'insert_absolute', template => '%s',
min => 0, label_extra_instance => 1, instance_use => 'name_absolute' },
],
}
},
'003_update' => { set => {
key_values => [ { name => 'update', diff => 1 }, { name => 'name' }, ],
output_template => 'Update : %s',
perfdatas => [
{ label => 'update', value => 'update_absolute', template => '%s',
min => 0, label_extra_instance => 1, instance_use => 'name_absolute' },
],
}
},
'004_delete' => { set => {
key_values => [ { name => 'delete', diff => 1 }, { name => 'name' }, ],
output_template => 'Delete : %s',
perfdatas => [
{ label => 'delete', value => 'delete_absolute', template => '%s',
min => 0, label_extra_instance => 1, instance_use => 'name_absolute' },
],
}
},
},
total => {
'000_total-commit' => { set => {
key_values => [ { name => 'commit', diff => 1 } ],
output_template => 'Commit : %s',
perfdatas => [
{ label => 'commit', value => 'commit_absolute', template => '%s', min => 0 },
],
}
},
'001_total-rollback' => { set => {
key_values => [ { name => 'rollback', diff => 1 } ],
output_template => 'Rollback : %s',
perfdatas => [
{ label => 'rollback', value => 'rollback_absolute', template => '%s', min => 0 },
],
}
},
'002_total-insert' => { set => {
key_values => [ { name => 'insert', diff => 1 } ],
output_template => 'Insert : %s',
perfdatas => [
{ label => 'insert', value => 'insert_absolute', template => '%s', min => 0 },
],
}
},
'003_total-update' => { set => {
key_values => [ { name => 'update', diff => 1 } ],
output_template => 'Update : %s',
perfdatas => [
{ label => 'update', value => 'update_absolute', template => '%s', min => 0 },
],
}
},
'004_total-delete' => { set => {
key_values => [ { name => 'delete', diff => 1 } ],
output_template => 'Delete : %s',
perfdatas => [
{ label => 'delete', value => 'delete_absolute', template => '%s', min => 0 },
],
}
},
}
};
sub new {
my ($class, %options) = @_;
my $self = $class->SUPER::new(package => __PACKAGE__, %options);
bless $self, $class;
$self->{version} = '1.0';
$options{options}->add_options(arguments =>
{
"filter-database:s" => { name => 'filter_database' },
});
$self->{statefile_value} = centreon::plugins::statefile->new(%options);
foreach my $key (('database', 'total')) {
foreach (keys %{$maps_counters->{$key}}) {
my ($id, $name) = split /_/;
if (!defined($maps_counters->{$key}->{$_}->{threshold}) || $maps_counters->{$key}->{$_}->{threshold} != 0) {
$options{options}->add_options(arguments => {
'warning-' . $name . ':s' => { name => 'warning-' . $name },
'critical-' . $name . ':s' => { name => 'critical-' . $name },
});
}
$maps_counters->{$key}->{$_}->{obj} = centreon::plugins::values->new(statefile => $self->{statefile_value},
output => $self->{output}, perfdata => $self->{perfdata},
label => $name);
$maps_counters->{$key}->{$_}->{obj}->set(%{$maps_counters->{$key}->{$_}->{set}});
}
}
return $self;
}
sub check_options {
my ($self, %options) = @_;
$self->SUPER::init(%options);
foreach my $key (('database', 'total')) {
foreach (keys %{$maps_counters->{$key}}) {
$maps_counters->{$key}->{$_}->{obj}->init(option_results => $self->{option_results});
}
}
$self->{statefile_value}->check_options(%options);
}
sub check_total {
my ($self, %options) = @_;
my ($short_msg, $short_msg_append, $long_msg, $long_msg_append) = ('', '', '', '');
my @exits = ();
foreach (sort keys %{$maps_counters->{total}}) {
my $obj = $maps_counters->{total}->{$_}->{obj};
$obj->set(instance => 'global');
my ($value_check) = $obj->execute(values => $self->{global},
new_datas => $self->{new_datas});
if ($value_check != 0) {
$long_msg .= $long_msg_append . $obj->output_error();
$long_msg_append = ', ';
next;
}
my $exit2 = $obj->threshold_check();
push @exits, $exit2;
my $output = $obj->output();
$long_msg .= $long_msg_append . $output;
$long_msg_append = ', ';
if (!$self->{output}->is_status(litteral => 1, value => $exit2, compare => 'ok')) {
$short_msg .= $short_msg_append . $output;
$short_msg_append = ', ';
}
$obj->perfdata();
}
my $exit = $self->{output}->get_most_critical(status => [ @exits ]);
if (!$self->{output}->is_status(litteral => 1, value => $exit, compare => 'ok')) {
$self->{output}->output_add(severity => $exit,
short_msg => "Total $short_msg"
);
} else {
$self->{output}->output_add(short_msg => "Total $long_msg");
}
}
sub run {
my ($self, %options) = @_;
# $options{sql} = sqlmode object
$self->{sql} = $options{sql};
$self->manage_selection();
$self->{new_datas} = {};
$self->{statefile_value}->read(statefile => "postgres_" . $self->{mode} . '_' . $self->{sql}->get_unique_id4save() . '_' . (defined($self->{option_results}->{filter_database}) ? md5_hex($self->{option_results}->{filter_database}) : md5_hex('.*')));
$self->{new_datas}->{last_timestamp} = time();
my $multiple = 1;
if (scalar(keys %{$self->{db_selected}}) == 1) {
$multiple = 0;
}
if ($multiple == 1) {
$self->check_total();
}
####
# By database
if ($multiple == 1) {
$self->{output}->output_add(severity => 'OK',
short_msg => 'All database statistics are ok');
}
foreach my $id (sort keys %{$self->{db_selected}}) {
my ($short_msg, $short_msg_append, $long_msg, $long_msg_append) = ('', '', '', '');
my @exits = ();
foreach (sort keys %{$maps_counters->{database}}) {
my $obj = $maps_counters->{database}->{$_}->{obj};
$obj->set(instance => $id);
my ($value_check) = $obj->execute(values => $self->{db_selected}->{$id},
new_datas => $self->{new_datas});
if ($value_check != 0) {
$long_msg .= $long_msg_append . $obj->output_error();
$long_msg_append = ', ';
next;
}
my $exit2 = $obj->threshold_check();
push @exits, $exit2;
my $output = $obj->output();
$long_msg .= $long_msg_append . $output;
$long_msg_append = ', ';
if (!$self->{output}->is_status(litteral => 1, value => $exit2, compare => 'ok')) {
$short_msg .= $short_msg_append . $output;
$short_msg_append = ', ';
}
$maps_counters->{database}->{$_}->{obj}->perfdata(level => 1, extra_instance => $multiple);
}
$self->{output}->output_add(long_msg => "Database '" . $self->{db_selected}->{$id}->{name} . "' $long_msg");
my $exit = $self->{output}->get_most_critical(status => [ @exits ]);
if (!$self->{output}->is_status(litteral => 1, value => $exit, compare => 'ok')) {
$self->{output}->output_add(severity => $exit,
short_msg => "Database '" . $self->{db_selected}->{$id}->{name} . "' $short_msg"
);
}
if ($multiple == 0) {
$self->{output}->output_add(short_msg => "Database '" . $self->{db_selected}->{$id}->{name} . "' $long_msg");
}
}
$self->{statefile_value}->write(data => $self->{new_datas});
$self->{output}->display();
$self->{output}->exit();
}
sub manage_selection {
my ($self, %options) = @_;
$self->{db_selected} = {};
$self->{global} = { commit => 0, rollback => 0, insert => 0, update => 0, delete => 0 };
my $query = q{
SELECT d.datname as name, pg_stat_get_db_xact_commit(d.oid) as commit,
pg_stat_get_db_xact_rollback(d.oid) as rollback,
pg_stat_get_tuples_inserted(d.oid) as insert,
pg_stat_get_tuples_updated(d.oid) as update, pg_stat_get_tuples_updated(d.oid) as delete
FROM pg_database d;
};
$self->{sql}->connect();
$self->{sql}->query(query => $query);
while ((my $row = $self->{sql}->fetchrow_hashref())) {
if (defined($self->{option_results}->{filter_database}) && $self->{option_results}->{filter_database} ne '' &&
$row->{name} !~ /$self->{option_results}->{filter_database}/) {
$self->{output}->output_add(long_msg => "Skipping '" . $row->{name} . "': no matching filter.");
next;
}
$self->{db_selected}->{$row->{name}} = {%$row};
foreach (keys %{$self->{global}}) {
$self->{global}->{$_} += $row->{$_};
}
}
if (scalar(keys %{$self->{db_selected}}) <= 0) {
$self->{output}->add_option_msg(short_msg => "No database found.");
$self->{output}->option_exit();
}
}
1;
__END__
=head1 MODE
Check database statistics: commit, rollback, insert, delete, update.
=over 8
=item B<--warning-*>
Threshold warning.
Can be: 'total-*', 'total-*', '*', The '*' can be: 'commit', 'rollback', 'insert', 'delete', 'update'.
Examples: --warning-total-commit='', --warning-delete='', --warning-total-rollback=''
=item B<--critical-*>
Threshold critical.
Can be: 'total-*', 'total-*', '*', The '*' can be: 'commit', 'rollback', 'insert', 'delete', 'update'.
Examples: --warning-total-commit='', --warning-delete='', --warning-total-rollback=''
=item B<--filter-database>
Filter database (can be a regexp).
=back
=cut
| 39.927954 | 252 | 0.452039 |
ed4b9d580c7ebe9826178b9aa079db388967d7b0 | 874 | pm | Perl | lib/Milter/SMTPAuth/Limit/CountryCountWeight.pm | sischkg/smtpauth-manager | fb913154102dc6924c8b1119e4bff026471b90a3 | [
"Unlicense"
] | null | null | null | lib/Milter/SMTPAuth/Limit/CountryCountWeight.pm | sischkg/smtpauth-manager | fb913154102dc6924c8b1119e4bff026471b90a3 | [
"Unlicense"
] | null | null | null | lib/Milter/SMTPAuth/Limit/CountryCountWeight.pm | sischkg/smtpauth-manager | fb913154102dc6924c8b1119e4bff026471b90a3 | [
"Unlicense"
] | null | null | null |
package Milter::SMTPAuth::Limit::CountryCountWeight;
use Moose;
use Sys::Syslog;
use Milter::SMTPAuth::Exception;
use Milter::SMTPAuth::Limit::Role;
with 'Milter::SMTPAuth::Limit::Role';
has 'ratio' => ( isa => 'Num', is => 'rw', default => 1 );
sub load_config {
my $this = shift;
my ( $config_data ) = @_;
if ( !exists( $config_data->{country_count} )
&& !exists( $config_data->{country_count}->{ratio} ) ) {
return;
}
$this->ratio( $config_data->{country_count}->{ratio} );
}
sub get_weight {
my $this = shift;
my ( $messages ) = @_;
my %countries = ();
foreach my $message ( @{$messages} ) {
$countries{ $message->country() } = 1;
}
delete $countries{undef};
my $count = keys( %countries );
return $this->ratio()**( $count - 1 );
}
no Moose;
__PACKAGE__->meta->make_immutable;
1;
| 20.325581 | 64 | 0.584668 |
ed13d32732954018b586eaaa1b0aef376f82a4ad | 347 | al | Perl | perl/src/Cross/android/perl/5.10.0/auto/POSIX/pow.al | nokibsarkar/sl4a | d3c17dca978cbeee545e12ea240a9dbf2a6999e9 | [
"Apache-2.0"
] | 2,293 | 2015-01-02T12:46:10.000Z | 2022-03-29T09:45:43.000Z | perl/src/Cross/android/perl/5.10.0/auto/POSIX/pow.al | nokibsarkar/sl4a | d3c17dca978cbeee545e12ea240a9dbf2a6999e9 | [
"Apache-2.0"
] | 315 | 2015-05-31T11:55:46.000Z | 2022-01-12T08:36:37.000Z | perl/src/Cross/android/perl/5.10.0/auto/POSIX/pow.al | nokibsarkar/sl4a | d3c17dca978cbeee545e12ea240a9dbf2a6999e9 | [
"Apache-2.0"
] | 1,033 | 2015-01-04T07:48:40.000Z | 2022-03-24T09:34:37.000Z | # NOTE: Derived from ../../lib/../xlib/arm/POSIX.pm.
# Changes made here will be lost when autosplit is run again.
# See AutoSplit.pm.
package POSIX;
#line 186 "../../lib/../xlib/arm/POSIX.pm (autosplit into ../../lib/../xlib/arm/auto/POSIX/pow.al)"
sub pow {
usage "pow(x,exponent)" if @_ != 2;
$_[0] ** $_[1];
}
# end of POSIX::pow
1;
| 24.785714 | 99 | 0.610951 |
ed9fbf87c7ca3fa26b26b2fcab9ab15a9763cdd2 | 2,790 | pm | Perl | lib/Smartcat/Client/ApiFactory.pm | ta2-1/smartcat-api-perl | 584f1a4c0f61a635bb28700011003bad632e188b | [
"Apache-2.0"
] | null | null | null | lib/Smartcat/Client/ApiFactory.pm | ta2-1/smartcat-api-perl | 584f1a4c0f61a635bb28700011003bad632e188b | [
"Apache-2.0"
] | 1 | 2020-07-20T18:06:22.000Z | 2020-07-20T23:33:45.000Z | lib/Smartcat/Client/ApiFactory.pm | ta2-1/smartcat-api-perl | 584f1a4c0f61a635bb28700011003bad632e188b | [
"Apache-2.0"
] | null | null | null |
=begin comment
Smartcat Integration API
No description provided (generated by Swagger Codegen https://github.com/swagger-api/swagger-codegen)
OpenAPI spec version: v1
Generated by: https://github.com/swagger-api/swagger-codegen.git
=end comment
=cut
#
# NOTE: This class is auto generated by the swagger code generator program.
# Do not edit the class manually.
# Ref: https://github.com/swagger-api/swagger-codegen
#
package Smartcat::Client::ApiFactory;
use strict;
use warnings;
use utf8;
use Carp;
use Module::Find;
usesub Smartcat::Client::Object;
use Smartcat::Client::ApiClient;
=head1 Name
Smartcat::Client::ApiFactory - constructs APIs to retrieve Smartcat::Client objects
=head1 Synopsis
package My::Petstore::App;
use Smartcat::Client::ApiFactory;
my $api_factory = Smartcat::Client::ApiFactory->new( ... ); # any args for ApiClient constructor
# later...
my $pet_api = $api_factory->get_api('Pet');
# $pet_api isa Smartcat::Client::PetApi
my $pet = $pet_api->get_pet_by_id(pet_id => $pet_id);
# object attributes have proper accessors:
printf "Pet's name is %s", $pet->name;
# change the value stored on the object:
$pet->name('Dave');
=cut
# Load all the API classes and construct a lookup table at startup time
my %_apis = map { $_ =~ /^Smartcat::Client::(.*)$/; $1 => $_ }
grep { $_ =~ /Api$/ } usesub 'Smartcat::Client';
=head1 new($api_client)
create a new Smartcat::Client::ApiFactory instance with the given Smartcat::Client::ApiClient instance.
=head1 new(%parameters)
Any parameters are optional, and are passed to and stored on the api_client object.
See L<Smartcat::Client::ApiClient> and L<Smartcat::Client::Configuration> for valid parameters
=cut
sub new {
my ($class) = shift;
my $api_client;
if ( $_[0] && ref $_[0] && ref $_[0] eq 'Smartcat::Client::ApiClient' ) {
$api_client = $_[0];
}
else {
$api_client = Smartcat::Client::ApiClient->new(@_);
}
bless { api_client => $api_client }, $class;
}
=head1 get_api($which)
Returns an API object of the requested type.
$which is a nickname for the class:
FooBarClient::BazApi has nickname 'Baz'
=cut
sub get_api {
my ( $self, $which ) = @_;
croak "API not specified" unless $which;
my $api_class = $_apis{"${which}Api"} || croak "No known API for '$which'";
return $api_class->new( $self->api_client );
}
=head1 api_client()
Returns the api_client object, should you ever need it.
=cut
sub api_client { $_[0]->{api_client} }
=head1 apis_available()
=cut
sub apis_available {
return map { $_ =~ s/Api$//; $_ } sort keys %_apis;
}
=head1 classname_for()
=cut
sub classname_for {
my ( $self, $api_name ) = @_;
return $_apis{"${api_name}Api"};
}
1;
| 21.29771 | 104 | 0.674552 |
ed6e0a653e368a419d1730dadd28ef407328efb9 | 2,250 | t | Perl | t/04static.t | denormal/perl-Class-Declare-Attributes | 07ec56eefa794c3d8412362a965531b7b9e88875 | [
"Artistic-2.0"
] | null | null | null | t/04static.t | denormal/perl-Class-Declare-Attributes | 07ec56eefa794c3d8412362a965531b7b9e88875 | [
"Artistic-2.0"
] | null | null | null | t/04static.t | denormal/perl-Class-Declare-Attributes | 07ec56eefa794c3d8412362a965531b7b9e88875 | [
"Artistic-2.0"
] | null | null | null | #!/usr/bin/perl -Tw
# $Id: 04static.t 1515 2010-08-22 14:41:53Z ian $
# static.t
#
# Ensure static methods are handled correctly.
use strict;
use lib qw( t );
use Class::Declare::Attributes::Test qw( :constants );
# define the test type
my $type = 'static'; # testing static methods
# static methods should only be accessible from within the
# defining class and instances of that class, just as with private attributes
# and methods, but not confined to class instances.
#
# therefore, static methods of derived classes and instances
# should be accessible, provided the access is from within the defining or
# base class (the class to which the methods are static)
my @tests; undef @tests;
# first, define all the tests that will succeed: called from within the
# defining class and it's instances.
my @contexts = ( CTX_CLASS , CTX_INSTANCE ,
CTX_PARENT , CTX_SUPER );
my @targets = ( TGT_CLASS , TGT_DERIVED , TGT_INSTANCE , TGT_INHERITED );
# add the method tests
# - methods should be accessible and readable
foreach my $target ( @targets ) {
foreach my $context ( @contexts ) {
# add the attribute tests
push @tests , ( $context | $target | ATTRIBUTE | TST_ACCESS | LIVE ,
$context | $target | ATTRIBUTE | TST_READ | LIVE ,
$context | $target | ATTRIBUTE | TST_WRITE | DIE );
# add the method tests
push @tests , ( $context | $target | METHOD | TST_ACCESS | LIVE ,
$context | $target | METHOD | TST_READ | LIVE );
}
}
# all other access permutations should die
@contexts = ( CTX_DERIVED , CTX_UNRELATED ,
CTX_INHERITED , CTX_FOREIGN );
foreach my $target ( @targets ) {
foreach my $context ( @contexts ) {
# add the method tests
push @tests , ( $context | $target | ATTRIBUTE | TST_ALL | DIE ,
$context | $target | METHOD | TST_ALL | DIE );
}
}
# create the test object
my $test = Class::Declare::Attributes::Test->new( type => $type ,
tests => \@tests )
or die 'could not create test object';
# run the tests
$test->run;
| 35.714286 | 77 | 0.609333 |
ed7b640a149edc1bd371f2f1256b2186661b31e2 | 19,057 | pm | Perl | lib/Statocles/App/Blog.pm | manwar/Statocles | 5d631ccfefe6bb1ee192e70566c3b87fb8902311 | [
"Artistic-1.0"
] | 87 | 2015-01-25T07:37:33.000Z | 2022-01-12T16:33:44.000Z | lib/Statocles/App/Blog.pm | manwar/Statocles | 5d631ccfefe6bb1ee192e70566c3b87fb8902311 | [
"Artistic-1.0"
] | 473 | 2015-01-04T04:59:48.000Z | 2022-03-19T15:59:27.000Z | lib/Statocles/App/Blog.pm | manwar/Statocles | 5d631ccfefe6bb1ee192e70566c3b87fb8902311 | [
"Artistic-1.0"
] | 39 | 2015-02-05T13:22:29.000Z | 2022-02-12T02:52:34.000Z | package Statocles::App::Blog;
our $VERSION = '0.094';
# ABSTRACT: A blog application
use Text::Unidecode;
use Statocles::Base 'Class';
use Getopt::Long qw( GetOptionsFromArray );
use Statocles::Document;
use Statocles::Page::Document;
use Statocles::Page::List;
use Statocles::Util qw( run_editor read_stdin );
with 'Statocles::App';
=attr tag_text
# site.yml
blog:
class: Statocles::App::Blog
args:
tag_text:
software: Posts about software and development
travel: My travelogue around the world!
A hash of tag and introductory Markdown that will be shown on the tag's main
page. Having a description is optional.
Using L<Beam::Wire's $config directive|Beam::Wire/Config Services>, you can
put the tag text in an external file:
# site.yml
blog:
class: Statocles::App::Blog
args:
tag_text:
$config: tags.yml
# tags.yml
software: |-
# Software
Posts about software development, mostly in [Perl](http://perl.org)
travel: |-
# Travel
My travelogue around the world! [Also visit my Instagram!](http://example.com)
=cut
has tag_text => (
is => 'ro',
isa => HashRef,
default => sub { {} },
);
=attr page_size
# site.yml
blog:
class: Statocles::App::Blog
args:
page_size: 5
The number of posts to put in a page (the main page and the tag pages). Defaults
to 5.
=cut
has page_size => (
is => 'ro',
isa => Int,
default => sub { 5 },
);
=attr index_tags
# site.yml
blog:
class: Statocles::App::Blog
args:
index_tags: [ '-private', '+important' ]
Filter the tags shown in the index page. An array of tags prefixed with either
a + or a -. By prefixing the tag with a "-", it will be removed from the index,
unless a later tag prefixed with a "+" also matches.
By default, all tags are shown on the index page.
So, given a document with tags "foo", and "bar":
index_tags: [ ] # document will be included
index_tags: [ '-foo' ] # document will not be included
index_tags: [ '-foo', '+bar' ] # document will be included
=cut
has index_tags => (
is => 'ro',
isa => ArrayRef[Str],
default => sub { [] },
);
=attr template_dir
The directory (inside the theme directory) to use for this app's templates.
Defaults to C<blog>.
=cut
has '+template_dir' => (
default => 'blog',
);
# A cache of the last set of post pages we have
# XXX: We need to allow apps to have a "clear" the way that Store and Theme do
has _post_pages => (
is => 'rw',
isa => ArrayRef,
predicate => '_has_cached_post_pages',
);
# The default post information hash
has _default_post => (
is => 'rw',
isa => HashRef,
lazy => 1,
default => sub {
{
tags => undef,
content => "Markdown content goes here.\n",
}
},
);
=method command
my $exitval = $app->command( $app_name, @args );
Run a command on this app. The app name is used to build the help, so
users get exactly what they need to run.
=cut
my $USAGE_INFO = <<'ENDHELP';
Usage:
$name help -- This help file
$name post [--date YYYY-MM-DD] <title> -- Create a new blog post with the given title
ENDHELP
sub command {
my ( $self, $name, @argv ) = @_;
if ( !$argv[0] ) {
say STDERR "ERROR: Missing command";
say STDERR eval "qq{$USAGE_INFO}";
return 1;
}
if ( $argv[0] eq 'help' ) {
say eval "qq{$USAGE_INFO}";
}
elsif ( $argv[0] eq 'post' ) {
my %opt;
my @doc_opts = qw(author layout status tags template);
GetOptionsFromArray( \@argv, \%opt,
'date:s',
map { "$_:s" } @doc_opts,
);
my $doc;
# Read post content on STDIN
if ( my $content = read_stdin() ) {
$doc = Statocles::Document->parse_content(
(map { defined $opt{$_} ? ( $_, $opt{$_} ) : () } @doc_opts),
( @argv > 1 ? ( title => join( " ", @argv[1..$#argv] ) ) : () ),
content => $content,
);
}
else {
$doc = Statocles::Document->new(
%{ $self->_default_post },
(map { defined $opt{$_} ? ( $_, $opt{$_} ) : () } @doc_opts),
( @argv > 1 ? ( title => join( " ", @argv[1..$#argv] ) ) : () ),
);
}
if ( !$ENV{EDITOR} && !$doc->title ) {
say STDERR <<"ENDHELP";
Title is required when \$EDITOR is not set.
Usage: $name post <title>
ENDHELP
return 1;
}
my ( $year, $mon, $day );
if ( $opt{ date } ) {
( $year, $mon, $day ) = split /-/, $opt{date};
}
else {
( undef, undef, undef, $day, $mon, $year ) = localtime;
$year += 1900;
$mon += 1;
}
my @date_parts = (
sprintf( '%04i', $year ),
sprintf( '%02i', $mon ),
sprintf( '%02i', $day ),
);
my $slug = $self->make_slug( $doc->title || "new post" );
my $url_root = $self->url_root;
$url_root =~ s{^/}{}g;
my @partsdir = ($url_root, @date_parts, $slug);
my @partsfile = (@partsdir, "index.markdown");
my $path = Mojo::Path->new->parts(\@partsfile);
$self->site->store->write_file( $path => $doc );
my $full_path = $self->site->store->path->child( @partsfile );
if ( my $content = run_editor( $full_path ) ) {
my $old_title = $doc->title;
my $doc = Statocles::Document->parse_content(
path => $path.'',
store => $self->site->store,
content => $content,
);
if ( $doc->title ne $old_title ) {
$self->site->store->path->child( @partsdir )->remove_tree;
$slug = $self->make_slug( $doc->title || "new post" );
@partsdir = ($url_root, @date_parts, $slug);
@partsfile = (@partsdir, "index.markdown");
$path = Mojo::Path->new->parts(\@partsfile);
$self->site->store->write_file( $path => $doc );
$full_path = $self->site->store->path->child( @partsfile );
}
}
say "New post at: $full_path";
}
else {
say STDERR qq{ERROR: Unknown command "$argv[0]"};
say STDERR eval "qq{$USAGE_INFO}";
return 1;
}
return 0;
}
=method make_slug
my $slug = $app->make_slug( $title );
Given a post title, remove special characters to create a slug.
=cut
sub make_slug {
my ( $self, $slug ) = @_;
$slug = unidecode($slug);
$slug =~ s/'//g;
$slug =~ s/[\W]+/-/g;
$slug =~ s/^-|-$//g;
return lc $slug;
}
=method index
my @pages = $app->index( \@post_pages );
Build the index page (a L<list page|Statocles::Page::List>) and all related
feed pages out of the given array reference of post pages.
=cut
my %FEEDS = (
rss => {
text => 'RSS',
template => 'index.rss',
},
atom => {
text => 'Atom',
template => 'index.atom',
},
);
sub index {
my ( $self, $all_post_pages ) = @_;
my @index_tags;
my %tag_flag;
for my $tag_spec ( map lc, @{ $self->index_tags } ) {
my $tag = substr $tag_spec, 1;
push @index_tags, $tag;
$tag_flag{$tag} = substr $tag_spec, 0, 1;
}
my @index_post_pages;
PAGE: for my $page ( @$all_post_pages ) {
my $page_flag = '+';
my %page_tags;
@page_tags{ map lc, @{ $page->document->tags } } = 1; # we use exists(), so value doesn't matter
for my $tag ( map lc, @index_tags ) {
if ( exists $page_tags{ $tag } ) {
$page_flag = $tag_flag{ $tag };
}
}
push @index_post_pages, $page if $page_flag eq '+';
}
my @pages = Statocles::Page::List->paginate(
after => $self->page_size,
path => $self->url( 'page/%i/index.html', 1 ),
index => $self->url( 'index.html' ),
pages => [ _sort_page_list( @index_post_pages ) ],
app => $self,
template => $self->template( 'index.html' ),
layout => $self->template( 'layout.html' ),
);
return unless @pages; # Only build feeds if we have pages
my $index = $pages[0];
my @feed_pages;
my @feed_links;
for my $feed ( sort keys %FEEDS ) {
my $page = Statocles::Page::List->new(
app => $self,
site => $self->site,
pages => $index->pages,
path => $self->url( 'index.' . $feed ),
template => $self->template( $FEEDS{$feed}{template} ),
links => {
alternate => [
$self->link(
href => $index->path,
title => 'index',
type => $index->type,
),
],
},
);
push @feed_pages, $page;
push @feed_links, $self->link(
text => $FEEDS{ $feed }{ text },
href => $page->path.'',
type => $page->type,
);
}
# Add the feeds to all the pages
for my $page ( @pages ) {
$page->links( feed => @feed_links );
}
return ( @pages, @feed_pages );
}
=method tag_pages
my @pages = $app->tag_pages( \%tag_pages );
Get L<pages|Statocles::Page> for the tags in the given blog post documents
(build from L<the post_pages method|/post_pages>, including relevant feed
pages.
=cut
sub tag_pages {
my ( $self, $tagged_docs ) = @_;
my @pages;
for my $tag ( keys %$tagged_docs ) {
my $tagroot = $self->url( join "/", 'tag', $self->_tag_url( $tag ) );
my @tag_pages = Statocles::Page::List->paginate(
after => $self->page_size,
path => join( "/", $tagroot, 'page/%i/index.html' ),
index => join( "/", $tagroot, 'index.html' ),
pages => [ _sort_page_list( @{ $tagged_docs->{ $tag } } ) ],
app => $self,
template => $self->template( 'index.html' ),
layout => $self->template( 'layout.html' ),
data => {
tag => $tag,
tag_text => $self->tag_text->{ $tag },
},
);
my $index = $tag_pages[0];
my @feed_pages;
my @feed_links;
for my $feed ( sort keys %FEEDS ) {
my $tag_file = $self->_tag_url( $tag ) . '.' . $feed;
my $page = Statocles::Page::List->new(
app => $self,
site => $self->site,
pages => $index->pages,
path => $self->url( join( "/", 'tag', $tag_file ) ),
template => $self->template( $FEEDS{$feed}{template} ),
links => {
alternate => [
$self->link(
href => $index->path,
title => $tag,
type => $index->type,
),
],
},
);
push @feed_pages, $page;
push @feed_links, $self->link(
text => $FEEDS{ $feed }{ text },
href => $page->path.'',
type => $page->type,
);
}
# Add the feeds to all the pages
for my $page ( @tag_pages ) {
$page->links( feed => @feed_links );
}
push @pages, @tag_pages, @feed_pages;
}
return @pages;
}
=method pages
my @pages = $app->pages( %options );
Get all the L<pages|Statocles::Page> for this application. Available options
are:
=over 4
=item date
The date to build for. Only posts on or before this date will be built.
Defaults to the current date.
=back
=cut
sub pages {
my ( $self, $pages, %opt ) = @_;
$opt{date} ||= DateTime::Moonpig->now( time_zone => 'local' )->ymd;
my $root = $self->url_root;
$root =~ s{^/}{}g;
my $is_dated_path = qr{^/?$root/?(\d{4})/(\d{2})/(\d{2})/};
my @parent_pages = @$pages;
my @pages =
map { $_->[0] }
# Only pages today or before
grep { $_->[1] le $opt{date} }
# Create the page's date
map { [ $_, join "-", $_->path =~ $is_dated_path ] }
# Only dated pages
grep { $_->path =~ $is_dated_path }
@parent_pages;
@pages = _sort_page_list( @pages );
my @post_pages;
my %tag_pages;
#; say "Got pages: " . join ", ", map { $_->path } @pages;
for my $page ( @pages ) {
$page->app( $self );
if ( $page->isa( 'Statocles::Page::Document' ) ) {
if ( $page->path =~ m{$is_dated_path [^/]+ (?:/index)? [.]html$}x ) {
my ( $year, $month, $day ) = ( $1, $2, $3 );
push @post_pages, $page;
my $doc = $page->document;
$page->date( $doc->has_date ? $doc->date : DateTime::Moonpig->new( year => $year, month => $month, day => $day ) );
my @tags;
for my $tag ( @{ $doc->tags } ) {
push @{ $tag_pages{ lc $tag } }, $page;
push @tags, $self->link(
text => $tag,
href => join( "/", 'tag', $self->_tag_url( $tag ), '' ),
);
}
$page->tags( \@tags );
$page->template( $self->template( 'post.html' ) );
}
}
}
for ( my $i = 0; $i < @post_pages; $i++ ) {
my $page = $post_pages[$i];
my $prev_page = $i ? $post_pages[$i-1] : undef;
my $next_page = $post_pages[$i+1];
$page->prev_page( $prev_page ) if $prev_page;
$page->next_page( $next_page ) if $next_page;
}
# Cache the post pages for this build
# XXX: This needs to be handled more intelligently with proper dependencies
$self->_post_pages( \@post_pages );
my @all_pages = ( $self->index( \@post_pages ), $self->tag_pages( \%tag_pages ) );
return @all_pages;
}
=method tags
my @links = $app->tags;
Get a set of L<link objects|Statocles::Link> suitable for creating a list of
tag links. The common attributes are:
text => 'The tag text'
href => 'The URL to the tag page'
=cut
sub tags {
my ( $self ) = @_;
my %tags;
my @pages = @{ $self->_post_pages || [] };
for my $page ( @pages ) {
for my $tag ( @{ $page->document->tags } ) {
$tags{ lc $tag } ||= $tag;
}
}
return map {; $self->link( text => $_, href => join( "/", 'tag', $self->_tag_url( $_ ), '' ) ) }
map { $tags{ $_ } }
sort keys %tags;
}
sub _tag_url {
my ( $self, $tag ) = @_;
return lc $self->make_slug( $tag );
}
=method recent_posts
my @pages = $app->recent_posts( $count, %filter );
Get the last $count recent posts for this blog. Useful for templates and site
index pages.
%filter is an optional set of filters to apply to only show recent posts
matching the given criteria. The following filters are available:
=over 4
=item tags
(string) Only show posts with the given tag
=back
=cut
sub recent_posts {
my ( $self, $count, %filter ) = @_;
my $root = $self->url_root;
my @pages = $self->_has_cached_post_pages ? @{ $self->_post_pages } : $self->pages;
my @found_pages;
PAGE: for my $page ( @pages ) {
next PAGE unless $page->path =~ qr{^$root/?(\d{4})/(\d{2})/(\d{2})/[^/]+(?:/index)?[.]html$};
QUERY: for my $attr ( keys %filter ) {
my $value = $filter{ $attr };
if ( $attr eq 'tags' ) {
next PAGE unless grep { $_ eq $value } @{ $page->document->tags };
}
}
push @found_pages, $page;
last if @found_pages >= $count;
}
return @found_pages;
}
=method page_url
my $url = $app->page_url( $page )
Return the absolute URL to this L<page object|Statocles::Page>, removing the
"/index.html" if necessary.
=cut
# XXX This is TERRIBLE. We need to do this better. Perhaps a "url()" helper in the
# template? And a full_url() helper? Or perhaps the template knows whether it should
# use absolute (/whatever) or full (http://www.example.com/whatever) URLs?
sub page_url {
my ( $self, $page ) = @_;
my $url = "".$page->path;
$url =~ s{/index[.]html$}{/};
return $url;
}
#=sub _sort_list
#
# my @sorted_pages = _sort_page_list( @unsorted_pages );
#
# Sort a list of blog post pages into buckets according to the date
# component of their path, and then sort the buckets according to the
# date field in the document.
#
# This allows a user to order the posts in a single day themselves,
# predictably and consistently.
sub _sort_page_list {
return map { $_->[0] }
sort { $b->[1] cmp $a->[1] || $b->[2] cmp $a->[2] }
map { [ $_, $_->path =~ m{/(\d{4}/\d{2}/\d{2})}, $_->date ] }
@_;
}
1;
__END__
=head1 DESCRIPTION
This is a simple blog application for Statocles.
=head2 FEATURES
=over
=item *
Content dividers. By dividing your main content with "---", you create
sections. Only the first section will show up on the index page or in RSS
feeds.
=item *
RSS and Atom syndication feeds.
=item *
Tags to organize blog posts. Tags have their own custom feeds so users can
subscribe to only those posts they care about.
=item *
Cross-post links to redirect users to a syndicated blog. Useful when you
participate in many blogs and want to drive traffic to them.
=item *
Post-dated blog posts to appear automatically when the date is passed. If a
blog post is set in the future, it will not be added to the site when running
C<build> or C<deploy>.
In order to ensure that post-dated blogs get added, you may want to run
C<deploy> in a nightly cron job.
=back
=head1 COMMANDS
=head2 post
post [--date <date>] <title>
Create a new blog post, optionally setting an initial C<title>. The post will be
created in a directory according to the current date.
Initial post content can be read from C<STDIN>. This lets you write other programs
to generate content for blog posts (for example, to help automate release blog posts).
=head1 THEME
=over
=item index.html
The index page template. Gets the following template variables:
=over
=item site
The L<Statocles::Site> object.
=item pages
An array reference containing all the blog post pages. Each page is a hash reference with the following keys:
=over
=item content
The post content
=item title
The post title
=item author
The post author
=back
=item post.html
The main post page template. Gets the following template variables:
=over
=item site
The L<Statocles::Site> object
=item content
The post content
=item title
The post title
=item author
The post author
=back
=back
=back
=head1 SEE ALSO
=over 4
=item L<Statocles::App>
=back
| 25.207672 | 131 | 0.533662 |
ed8a272af694184a4281bceea3b34b3b49aa0740 | 2,804 | pm | Perl | auto-lib/Paws/Proton/UpdateService.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 164 | 2015-01-08T14:58:53.000Z | 2022-02-20T19:16:24.000Z | auto-lib/Paws/Proton/UpdateService.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 348 | 2015-01-07T22:08:38.000Z | 2022-01-27T14:34:44.000Z | auto-lib/Paws/Proton/UpdateService.pm | 0leksii/aws-sdk-perl | b2132fe3c79a06fd15b6137e8a0eb628de722e0f | [
"Apache-2.0"
] | 87 | 2015-04-22T06:29:47.000Z | 2021-09-29T14:45:55.000Z |
package Paws::Proton::UpdateService;
use Moose;
has Description => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'description' );
has Name => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'name' , required => 1);
has Spec => (is => 'ro', isa => 'Str', traits => ['NameInRequest'], request_name => 'spec' );
use MooseX::ClassAttribute;
class_has _api_call => (isa => 'Str', is => 'ro', default => 'UpdateService');
class_has _returns => (isa => 'Str', is => 'ro', default => 'Paws::Proton::UpdateServiceOutput');
class_has _result_key => (isa => 'Str', is => 'ro');
1;
### main pod documentation begin ###
=head1 NAME
Paws::Proton::UpdateService - Arguments for method UpdateService on L<Paws::Proton>
=head1 DESCRIPTION
This class represents the parameters used for calling the method UpdateService on the
L<AWS Proton|Paws::Proton> service. Use the attributes of this class
as arguments to method UpdateService.
You shouldn't make instances of this class. Each attribute should be used as a named argument in the call to UpdateService.
=head1 SYNOPSIS
my $proton = Paws->service('Proton');
my $UpdateServiceOutput = $proton->UpdateService(
Name => 'MyResourceName',
Description => 'MyDescription', # OPTIONAL
Spec => 'MySpecContents', # OPTIONAL
);
# Results:
my $Service = $UpdateServiceOutput->Service;
# Returns a L<Paws::Proton::UpdateServiceOutput> object.
Values for attributes that are native types (Int, String, Float, etc) can passed as-is (scalar values). Values for complex Types (objects) can be passed as a HashRef. The keys and values of the hashref will be used to instance the underlying object.
For the AWS API documentation, see L<https://docs.aws.amazon.com/goto/WebAPI/proton/UpdateService>
=head1 ATTRIBUTES
=head2 Description => Str
The edited service description.
=head2 B<REQUIRED> Name => Str
The name of the service to edit.
=head2 Spec => Str
Lists the service instances to add and the existing service instances
to remain. Omit the existing service instances to delete from the list.
I<Don't> include edits to the existing service instances or pipeline.
For more information, see I<Edit a service> in the AWS Proton
Administration Guide
(https://docs.aws.amazon.com/proton/latest/adminguide/ag-svc-update.html)
or the AWS Proton User Guide
(https://docs.aws.amazon.com/proton/latest/userguide/ug-svc-update.html).
=head1 SEE ALSO
This class forms part of L<Paws>, documenting arguments for method UpdateService in L<Paws::Proton>
=head1 BUGS and CONTRIBUTIONS
The source code is located here: L<https://github.com/pplu/aws-sdk-perl>
Please report bugs to: L<https://github.com/pplu/aws-sdk-perl/issues>
=cut
| 32.229885 | 249 | 0.712197 |
ed74879f975d402e0df33c70a309fae97dfe55b7 | 278 | pm | Perl | lib/Test2/Harness/UI/Schema/Result/EmailVerificationCode.pm | szabgab/Test2-Harness-UI | c2b659eafeb819f3886be1ec224c27a71b471469 | [
"Artistic-1.0",
"MIT"
] | null | null | null | lib/Test2/Harness/UI/Schema/Result/EmailVerificationCode.pm | szabgab/Test2-Harness-UI | c2b659eafeb819f3886be1ec224c27a71b471469 | [
"Artistic-1.0",
"MIT"
] | null | null | null | lib/Test2/Harness/UI/Schema/Result/EmailVerificationCode.pm | szabgab/Test2-Harness-UI | c2b659eafeb819f3886be1ec224c27a71b471469 | [
"Artistic-1.0",
"MIT"
] | null | null | null | package Test2::Harness::UI::Schema::Result::EmailVerificationCode;
use utf8;
use strict;
use warnings;
use Carp qw/confess/;
confess "You must first load a Test2::Harness::UI::Schema::NAME module"
unless $Test2::Harness::UI::Schema::LOADED;
our $VERSION = '0.000055';
1;
| 21.384615 | 71 | 0.723022 |
73fdbdd86c1e33ab20bad4d391842d5f0ad1d96f | 75 | t | Perl | wclarge/data.small.t | wkoszek/puzzles | 0cb721bb057abf9c8e595e0a5e5e6261498e5d40 | [
"BSD-2-Clause"
] | 1 | 2015-08-15T04:07:20.000Z | 2015-08-15T04:07:20.000Z | wclarge/data.small.t | wkoszek/puzzles | 0cb721bb057abf9c8e595e0a5e5e6261498e5d40 | [
"BSD-2-Clause"
] | null | null | null | wclarge/data.small.t | wkoszek/puzzles | 0cb721bb057abf9c8e595e0a5e5e6261498e5d40 | [
"BSD-2-Clause"
] | null | null | null | 1--
112
1a
1ansic
1awkawk
1c++
1else
1something
2awk
3adam
3koszek
3wojtek
| 5.769231 | 10 | 0.786667 |
ed87cdbfcbf7501888fdf3daa338ffe20989edbc | 5,645 | pm | Perl | lib/Perl/Critic/Policy/Variables/RequireLocalizedPunctuationVars.pm | utgwkk/Perl-Critic | e88e1bce7f24527cb484ff459e68c80cf411408f | [
"Artistic-1.0"
] | null | null | null | lib/Perl/Critic/Policy/Variables/RequireLocalizedPunctuationVars.pm | utgwkk/Perl-Critic | e88e1bce7f24527cb484ff459e68c80cf411408f | [
"Artistic-1.0"
] | null | null | null | lib/Perl/Critic/Policy/Variables/RequireLocalizedPunctuationVars.pm | utgwkk/Perl-Critic | e88e1bce7f24527cb484ff459e68c80cf411408f | [
"Artistic-1.0"
] | null | null | null | package Perl::Critic::Policy::Variables::RequireLocalizedPunctuationVars;
use 5.006001;
use strict;
use warnings;
use Readonly;
use Perl::Critic::Utils qw{ :severities :classification $EMPTY hashify};
use base 'Perl::Critic::Policy';
our $VERSION = '1.139_01';
#-----------------------------------------------------------------------------
Readonly::Scalar my $PACKAGE_RX => qr/::/xms;
Readonly::Hash my %EXCEPTIONS => hashify(qw(
$_
$ARG
@_
));
Readonly::Scalar my $DESC => q{Magic variable "%s" should be assigned as "local"};
Readonly::Scalar my $EXPL => [ 81, 82 ];
#-----------------------------------------------------------------------------
sub supported_parameters {
return (
{
name => 'allow',
description =>
q<Global variables to exclude from this policy.>,
default_string => $EMPTY,
behavior => 'string list',
list_always_present_values => [ qw< $_ $ARG @_ > ],
},
);
}
sub default_severity { return $SEVERITY_HIGH }
sub default_themes { return qw(core pbp bugs certrec ) }
sub applies_to { return 'PPI::Token::Operator' }
#-----------------------------------------------------------------------------
sub violates {
my ( $self, $elem, undef ) = @_;
return if $elem->content() ne q{=};
my $destination = $elem->sprevious_sibling;
return if !$destination; # huh? assignment in void context??
while ($destination->isa('PPI::Structure::Subscript')) {
$destination = $destination->sprevious_sibling()
or return;
}
if (my $var = $self->_is_non_local_magic_dest($destination)) {
return $self->violation( sprintf( $DESC, $var ), $EXPL, $elem );
}
return; # OK
}
sub _is_non_local_magic_dest {
my ($self, $elem) = @_;
# Quick exit if in good form
my $modifier = $elem->sprevious_sibling;
return
if
$modifier
&& $modifier->isa('PPI::Token::Word')
&& ($modifier->content() eq 'local'
|| $modifier->content() eq 'my');
# Implementation note: Can't rely on PPI::Token::Magic,
# unfortunately, because we need English too
if ($elem->isa('PPI::Token::Symbol')) {
return $self->_is_magic_var($elem) ? $elem : undef;
}
elsif (
$elem->isa('PPI::Structure::List')
or $elem->isa('PPI::Statement::Expression')
) {
for my $child ($elem->schildren) {
my $var = $self->_is_non_local_magic_dest($child);
return $var if $var;
}
}
return;
}
#-----------------------------------------------------------------------------
sub _is_magic_var {
my ($self, $elem) = @_;
my $variable_name = $elem->symbol();
return if $self->{_allow}{$variable_name};
return 1 if $elem->isa('PPI::Token::Magic'); # optimization(?), and
# helps with PPI 1.118 carat
# bug. This bug is gone as of
# 1.208, which is required for
# P::C 1.113. RT 65514
return if not is_perl_global( $elem );
return 1;
}
1;
__END__
#-----------------------------------------------------------------------------
=pod
=head1 NAME
Perl::Critic::Policy::Variables::RequireLocalizedPunctuationVars - Magic variables should be assigned as "local".
=head1 AFFILIATION
This Policy is part of the core L<Perl::Critic|Perl::Critic>
distribution.
=head1 DESCRIPTION
Punctuation variables (and their English.pm equivalents) are global
variables. Messing with globals is dangerous in a complex program as
it can lead to very subtle and hard to fix bugs. If you must change a
magic variable in a non-trivial program, do it in a local scope.
For example, to slurp a filehandle into a scalar, it's common to set
the record separator to undef instead of a newline. If you choose to
do this (instead of using L<Path::Tiny|Path::Tiny>!) then be sure to
localize the global and change it for as short a time as possible.
# BAD:
$/ = undef;
my $content = <$fh>;
# BETTER:
my $content;
{
local $/ = undef;
$content = <$fh>;
}
# A popular idiom:
my $content = do { local $/ = undef; <$fh> };
This policy also allows the use of C<my>. Perl prevents using C<my>
with "proper" punctuation variables, but allows C<$a>, C<@ARGV>, the
names declared by L<English|English>, etc. This is not a good coding
practice, however it is not the concern of this specific policy to
complain about that.
There are exemptions for C<$_> and C<@_>, and the English equivalent
C<$ARG>.
=head1 CONFIGURATION
You can configure your own exemptions using the C<allow> option:
[Variables::RequireLocalizedPunctuationVars]
allow = @ARGV $ARGV
These are added to the default exemptions.
=head1 CREDITS
Initial development of this policy was supported by a grant from the
Perl Foundation.
=head1 AUTHOR
Chris Dolan <cdolan@cpan.org>
=head1 COPYRIGHT
Copyright (c) 2007-2011 Chris Dolan. Many rights reserved.
This program is free software; you can redistribute it and/or modify
it under the same terms as Perl itself. The full text of this license
can be found in the LICENSE file included with this module.
=cut
# Local Variables:
# mode: cperl
# cperl-indent-level: 4
# fill-column: 78
# indent-tabs-mode: nil
# c-indentation-style: bsd
# End:
# ex: set ts=8 sts=4 sw=4 tw=78 ft=perl expandtab shiftround :
| 27.536585 | 113 | 0.575908 |
ed0d509dc327c37c5ab6d8a68662c720e210a303 | 2,448 | pl | Perl | lib/re2/re2/make_perl_groups.pl | baulk/btar | 417532674e466cbce0de21e7a40a1c6a887ae06f | [
"Apache-2.0"
] | 7,057 | 2015-01-02T23:02:47.000Z | 2022-03-30T17:17:13.000Z | lib/re2/re2/make_perl_groups.pl | baulk/btar | 417532674e466cbce0de21e7a40a1c6a887ae06f | [
"Apache-2.0"
] | 574 | 2016-03-23T15:35:56.000Z | 2022-03-31T07:11:03.000Z | lib/re2/re2/make_perl_groups.pl | baulk/uncia | 417532674e466cbce0de21e7a40a1c6a887ae06f | [
"Apache-2.0"
] | 1,144 | 2015-01-15T15:15:35.000Z | 2022-03-26T00:25:18.000Z | #!/usr/bin/perl
# Copyright 2008 The RE2 Authors. All Rights Reserved.
# Use of this source code is governed by a BSD-style
# license that can be found in the LICENSE file.
# Generate table entries giving character ranges
# for POSIX/Perl character classes. Rather than
# figure out what the definition is, it is easier to ask
# Perl about each letter from 0-128 and write down
# its answer.
@posixclasses = (
"[:alnum:]",
"[:alpha:]",
"[:ascii:]",
"[:blank:]",
"[:cntrl:]",
"[:digit:]",
"[:graph:]",
"[:lower:]",
"[:print:]",
"[:punct:]",
"[:space:]",
"[:upper:]",
"[:word:]",
"[:xdigit:]",
);
@perlclasses = (
"\\d",
"\\s",
"\\w",
);
%overrides = (
# Prior to Perl 5.18, \s did not match vertical tab.
# RE2 preserves that original behaviour.
"\\s:11" => 0,
);
sub ComputeClass($) {
my ($cname) = @_;
my @ranges;
my $regexp = qr/[$cname]/;
my $start = -1;
for (my $i=0; $i<=129; $i++) {
if ($i == 129) { $i = 256; }
if ($i <= 128 && ($overrides{"$cname:$i"} // chr($i) =~ $regexp)) {
if ($start < 0) {
$start = $i;
}
} else {
if ($start >= 0) {
push @ranges, [$start, $i-1];
}
$start = -1;
}
}
return @ranges;
}
sub PrintClass($$@) {
my ($cnum, $cname, @ranges) = @_;
print "static const URange16 code${cnum}[] = { /* $cname */\n";
for (my $i=0; $i<@ranges; $i++) {
my @a = @{$ranges[$i]};
printf "\t{ 0x%x, 0x%x },\n", $a[0], $a[1];
}
print "};\n";
my $n = @ranges;
my $escname = $cname;
$escname =~ s/\\/\\\\/g;
$negname = $escname;
if ($negname =~ /:/) {
$negname =~ s/:/:^/;
} else {
$negname =~ y/a-z/A-Z/;
}
return "{ \"$escname\", +1, code$cnum, $n, 0, 0 }", "{ \"$negname\", -1, code$cnum, $n, 0, 0 }";
}
my $cnum = 0;
sub PrintClasses($@) {
my ($pname, @classes) = @_;
my @entries;
foreach my $cname (@classes) {
my @ranges = ComputeClass($cname);
push @entries, PrintClass(++$cnum, $cname, @ranges);
}
print "const UGroup ${pname}_groups[] = {\n";
foreach my $e (@entries) {
print "\t$e,\n";
}
print "};\n";
my $count = @entries;
print "const int num_${pname}_groups = $count;\n";
}
print <<EOF;
// GENERATED BY make_perl_groups.pl; DO NOT EDIT.
// make_perl_groups.pl >perl_groups.cc
#include "re2/unicode_groups.h"
namespace re2 {
EOF
PrintClasses("perl", @perlclasses);
PrintClasses("posix", @posixclasses);
print <<EOF;
} // namespace re2
EOF
| 20.923077 | 98 | 0.539624 |
ed59a8178136f80bb6ebb136947130eaaa53685d | 3,025 | pm | Perl | lib/Fey/Meta/Attribute/FromSelect.pm | houseabsolute/Fey-ORM | af4bb010413ec46474da22d9e85938d46c94f462 | [
"Artistic-1.0"
] | null | null | null | lib/Fey/Meta/Attribute/FromSelect.pm | houseabsolute/Fey-ORM | af4bb010413ec46474da22d9e85938d46c94f462 | [
"Artistic-1.0"
] | null | null | null | lib/Fey/Meta/Attribute/FromSelect.pm | houseabsolute/Fey-ORM | af4bb010413ec46474da22d9e85938d46c94f462 | [
"Artistic-1.0"
] | null | null | null | package Fey::Meta::Attribute::FromSelect;
use strict;
use warnings;
use namespace::autoclean;
our $VERSION = '0.48';
use Moose;
extends 'Moose::Meta::Attribute';
with 'Fey::Meta::Role::FromSelect';
## no critic (Subroutines::ProhibitUnusedPrivateSubroutines)
sub _process_options {
my $class = shift;
my $name = shift;
my $options = shift;
$options->{lazy} = 1;
$options->{default} = $class->_make_sub_from_select(
$options->{select},
$options->{bind_params},
$options->{multi_column},
$options->{isa},
);
return $class->SUPER::_process_options( $name, $options );
}
sub _new {
my $class = shift;
my $options = @_ == 1 ? $_[0] : {@_};
my $self = $class->SUPER::_new($options);
$self->{select} = $options->{select};
$self->{bind_params} = $options->{bind_params};
$self->{is_multi_column} = $options->{multi_column};
return $self;
}
## use critic
# The parent class's constructor is not a Moose::Object-based
# constructor, so we don't want to inline one that is.
__PACKAGE__->meta()->make_immutable( inline_constructor => 0 );
## no critic (Modules::ProhibitMultiplePackages)
package # hide from PAUSE
Moose::Meta::Attribute::Custom::FromSelect;
sub register_implementation {'Fey::Meta::Attribute::FromSelect'}
1;
# ABSTRACT: An attribute metaclass for SELECT-based attributes
__END__
=pod
=head1 SYNOPSIS
package MyApp::Song;
has average_rating => (
metaclass => 'FromSelect',
is => 'ro',
isa => 'Float',
select => $select,
bind_params => sub { $_[0]->song_id() },
);
=head1 DESCRIPTION
This attribute metaclass allows you to set an attribute's default
based on a C<SELECT> query and optional bound parameters. This is a
fairly common need when writing ORM-based classes.
=head1 OPTIONS
This metaclass accepts two additional parameters in addition to the
normal Moose attribute options.
=over 4
=item * select
This must do the L<Fey::Role::SQL::ReturnsData> role. It is required.
=item * bind_params
This must be a subroutine reference, which when called will return an
array of bind parameters for the query. This subref will be called as
a method on the object which has the attribute. This is an optional
parameter.
=back
Note that this metaclass overrides any value you provide for "default"
with a subroutine that executes the query and gets the value it
returns.
=head1 METHODS
This class adds a few methods to those provided by
C<Moose::Meta::Attribute>:
=head2 $attr->select()
Returns the query object associated with this attribute.
=head2 $attr->bind_params()
Returns the bind_params subroutine reference associated with this
attribute, if any.
=head1 ArrayRef TYPES
By default, the C<SELECT> is expected to return just a single row with
one column. However, if you set the type of the attribute to ArrayRef
(or a subtype), then the select can return multiple rows, still with a
single column.
=cut
| 23.632813 | 70 | 0.694545 |
ed9d156b272c53a498a06ae163b36dcc36569011 | 2,282 | pm | Perl | local/lib/perl5/SQL/Translator/Producer/SQLServer.pm | ray66rus/vndrv | 196fd94a02dc2d41bd45a0cb22b53e00e6b23805 | [
"Apache-2.0"
] | null | null | null | local/lib/perl5/SQL/Translator/Producer/SQLServer.pm | ray66rus/vndrv | 196fd94a02dc2d41bd45a0cb22b53e00e6b23805 | [
"Apache-2.0"
] | null | null | null | local/lib/perl5/SQL/Translator/Producer/SQLServer.pm | ray66rus/vndrv | 196fd94a02dc2d41bd45a0cb22b53e00e6b23805 | [
"Apache-2.0"
] | null | null | null | package SQL::Translator::Producer::SQLServer;
use strict;
use warnings;
our ( $DEBUG, $WARN );
our $VERSION = '1.59';
$DEBUG = 1 unless defined $DEBUG;
use SQL::Translator::Schema::Constants;
use SQL::Translator::Utils qw(debug header_comment);
use SQL::Translator::Generator::DDL::SQLServer;
sub produce {
my $translator = shift;
SQL::Translator::Generator::DDL::SQLServer->new(
add_comments => !$translator->no_comments,
add_drop_table => $translator->add_drop_table,
)->schema($translator->schema)
}
1;
=head1 NAME
SQL::Translator::Producer::SQLServer - MS SQLServer producer for SQL::Translator
=head1 SYNOPSIS
use SQL::Translator;
my $t = SQL::Translator->new( parser => '...', producer => 'SQLServer' );
$t->translate;
=head1 DESCRIPTION
This is currently a thin wrapper around the nextgen
L<SQL::Translator::Generator::DDL::SQLServer> DDL maker.
=head1 Extra Attributes
=over 4
=item field.list
List of values for an enum field.
=back
=head1 TODO
* !! Write some tests !!
* Reserved words list needs updating to SQLServer.
* Triggers, Procedures and Views DO NOT WORK
# Text of view is already a 'create view' statement so no need to
# be fancy
foreach ( $schema->get_views ) {
my $name = $_->name();
$output .= "\n\n";
$output .= "--\n-- View: $name\n--\n\n" unless $no_comments;
my $text = $_->sql();
$text =~ s/\r//g;
$output .= "$text\nGO\n";
}
# Text of procedure already has the 'create procedure' stuff
# so there is no need to do anything fancy. However, we should
# think about doing fancy stuff with granting permissions and
# so on.
foreach ( $schema->get_procedures ) {
my $name = $_->name();
$output .= "\n\n";
$output .= "--\n-- Procedure: $name\n--\n\n" unless $no_comments;
my $text = $_->sql();
$text =~ s/\r//g;
$output .= "$text\nGO\n";
}
=head1 SEE ALSO
L<SQL::Translator>
=head1 AUTHORS
See the included AUTHORS file:
L<http://search.cpan.org/dist/SQL-Translator/AUTHORS>
=head1 COPYRIGHT
Copyright (c) 2012 the SQL::Translator L</AUTHORS> as listed above.
=head1 LICENSE
This code is free software and may be distributed under the same terms as Perl
itself.
=cut
| 23.050505 | 80 | 0.649869 |
ed5c1162e204ee44f57b505be79559ffe3ead6f4 | 893 | pl | Perl | Practical/tp8_PLR/prob5.pl | LockDownPT/MIEIC_plog | b1209caeff3cd33534c44ba0dc55387c959f4367 | [
"MIT"
] | null | null | null | Practical/tp8_PLR/prob5.pl | LockDownPT/MIEIC_plog | b1209caeff3cd33534c44ba0dc55387c959f4367 | [
"MIT"
] | null | null | null | Practical/tp8_PLR/prob5.pl | LockDownPT/MIEIC_plog | b1209caeff3cd33534c44ba0dc55387c959f4367 | [
"MIT"
] | null | null | null | :-use_module(library(clpfd)).
/*
FORT PLOG
| S4_corner | S5 | S6 | S7_corner |
| S3 | | S8 |
| S2 | | S9 |
| S1_corner | S12 | S11 | S10_corner |
*/
guards(Vars):-
Vars = [S1_corner, S2, S3, S4_corner, S5, S6, S7_corner, S8, S9, S10_corner, S11, S12],
% corner or side
domain(Vars, 0, 12),
% left side
S1_corner + S2 + S3 + S4_corner #= 5,
% up side
S4_corner + S5 + S6 + S7_corner #= 5,
% right side
S7_corner + S8 + S9 + S10_corner #= 5,
% down side
S10_corner + S11 + S12 + S1_corner #= 5,
% there are only 12 guards
S1_corner + S2 + S3 + S4_corner + S5 + S6 + S7_corner + S8 + S9 + S10_corner + S11 + S12 #= 12,
% find solutions
labeling([],Vars). | 33.074074 | 99 | 0.456887 |
73fb453c0f2436476181bd2e85bbef6c4f4b6b56 | 4,796 | pl | Perl | webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/rn-BI.pl | AK-10/AK-10-isucon8-preliminary-revenge | f390710721b2f2e3d9f60120394ec37c9c96b975 | [
"MIT"
] | 2 | 2019-04-15T04:28:23.000Z | 2019-04-16T12:45:51.000Z | webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/rn-BI.pl | AK-10/AK-10-isucon8-preliminary-revenge | f390710721b2f2e3d9f60120394ec37c9c96b975 | [
"MIT"
] | 16 | 2019-08-28T23:45:01.000Z | 2019-12-20T02:12:13.000Z | webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/rn-BI.pl | AK-10/AK-10-isucon8-preliminary-revenge | f390710721b2f2e3d9f60120394ec37c9c96b975 | [
"MIT"
] | 1 | 2019-04-14T01:11:20.000Z | 2019-04-14T01:11:20.000Z | {
am_pm_abbreviated => [
"Z.MU.",
"Z.MW.",
],
available_formats => {
Bh => "h B",
Bhm => "h:mm B",
Bhms => "h:mm:ss B",
E => "ccc",
EBhm => "E h:mm B",
EBhms => "E h:mm:ss B",
EHm => "E HH:mm",
EHms => "E HH:mm:ss",
Ed => "E d",
Ehm => "E h:mm a",
Ehms => "E h:mm:ss a",
Gy => "G y",
GyMMM => "G y MMM",
GyMMMEd => "G y MMM d, E",
GyMMMd => "G y MMM d",
H => "HH",
Hm => "HH:mm",
Hms => "HH:mm:ss",
Hmsv => "HH:mm:ss v",
Hmv => "HH:mm v",
M => "L",
MEd => "E d/M",
MMM => "LLL",
MMMEd => "E d MMM",
"MMMMW-count-other" => "'week' W 'of' MMMM",
MMMMd => "MMMM d",
MMMd => "d MMM",
Md => "d/M",
d => "d",
h => "h a",
hm => "h:mm a",
hms => "h:mm:ss a",
hmsv => "h:mm:ss a v",
hmv => "h:mm a v",
ms => "m:ss",
y => "y",
yM => "M/y",
yMEd => "E d/M/y",
yMMM => "MMM y",
yMMMEd => "E d MMM y",
yMMMM => "y MMMM",
yMMMd => "d MMM y",
yMd => "d/M/y",
yQQQ => "QQQ y",
yQQQQ => "QQQQ y",
"yw-count-other" => "'week' w 'of' Y",
},
code => "rn-BI",
date_format_full => "EEEE d MMMM y",
date_format_long => "d MMMM y",
date_format_medium => "d MMM y",
date_format_short => "d/M/y",
datetime_format_full => "{1} {0}",
datetime_format_long => "{1} {0}",
datetime_format_medium => "{1} {0}",
datetime_format_short => "{1} {0}",
day_format_abbreviated => [
"mbe.",
"kab.",
"gtu.",
"kan.",
"gnu.",
"gnd.",
"cu.",
],
day_format_narrow => [
"M",
"T",
"W",
"T",
"F",
"S",
"S",
],
day_format_wide => [
"Ku wa mbere",
"Ku wa kabiri",
"Ku wa gatatu",
"Ku wa kane",
"Ku wa gatanu",
"Ku wa gatandatu",
"Ku w\N{U+2019}indwi",
],
day_stand_alone_abbreviated => [
"mbe.",
"kab.",
"gtu.",
"kan.",
"gnu.",
"gnd.",
"cu.",
],
day_stand_alone_narrow => [
"M",
"T",
"W",
"T",
"F",
"S",
"S",
],
day_stand_alone_wide => [
"Ku wa mbere",
"Ku wa kabiri",
"Ku wa gatatu",
"Ku wa kane",
"Ku wa gatanu",
"Ku wa gatandatu",
"Ku w\N{U+2019}indwi",
],
era_abbreviated => [
"Mb.Y.",
"Ny.Y",
],
era_narrow => [
"Mb.Y.",
"Ny.Y",
],
era_wide => [
"Mbere ya Yezu",
"Nyuma ya Yezu",
],
first_day_of_week => 1,
glibc_date_1_format => "%a %b %e %H:%M:%S %Z %Y",
glibc_date_format => "%m/%d/%y",
glibc_datetime_format => "%a %b %e %H:%M:%S %Y",
glibc_time_12_format => "%I:%M:%S %p",
glibc_time_format => "%H:%M:%S",
language => "Rundi",
month_format_abbreviated => [
"Mut.",
"Gas.",
"Wer.",
"Mat.",
"Gic.",
"Kam.",
"Nya.",
"Kan.",
"Nze.",
"Ukw.",
"Ugu.",
"Uku.",
],
month_format_narrow => [
1,
2,
3,
4,
5,
6,
7,
8,
9,
10,
11,
12,
],
month_format_wide => [
"Nzero",
"Ruhuhuma",
"Ntwarante",
"Ndamukiza",
"Rusama",
"Ruheshi",
"Mukakaro",
"Nyandagaro",
"Nyakanga",
"Gitugutu",
"Munyonyo",
"Kigarama",
],
month_stand_alone_abbreviated => [
"Mut.",
"Gas.",
"Wer.",
"Mat.",
"Gic.",
"Kam.",
"Nya.",
"Kan.",
"Nze.",
"Ukw.",
"Ugu.",
"Uku.",
],
month_stand_alone_narrow => [
1,
2,
3,
4,
5,
6,
7,
8,
9,
10,
11,
12,
],
month_stand_alone_wide => [
"Nzero",
"Ruhuhuma",
"Ntwarante",
"Ndamukiza",
"Rusama",
"Ruheshi",
"Mukakaro",
"Nyandagaro",
"Nyakanga",
"Gitugutu",
"Munyonyo",
"Kigarama",
],
name => "Rundi Burundi",
native_language => "Ikirundi",
native_name => "Ikirundi Uburundi",
native_script => undef,
native_territory => "Uburundi",
native_variant => undef,
quarter_format_abbreviated => [
"I1",
"I2",
"I3",
"I4",
],
quarter_format_narrow => [
1,
2,
3,
4,
],
quarter_format_wide => [
"Igice ca mbere c\N{U+2019}umwaka",
"Igice ca kabiri c\N{U+2019}umwaka",
"Igice ca gatatu c\N{U+2019}umwaka",
"Igice ca kane c\N{U+2019}umwaka",
],
quarter_stand_alone_abbreviated => [
"I1",
"I2",
"I3",
"I4",
],
quarter_stand_alone_narrow => [
1,
2,
3,
4,
],
quarter_stand_alone_wide => [
"Igice ca mbere c\N{U+2019}umwaka",
"Igice ca kabiri c\N{U+2019}umwaka",
"Igice ca gatatu c\N{U+2019}umwaka",
"Igice ca kane c\N{U+2019}umwaka",
],
script => undef,
territory => "Burundi",
time_format_full => "HH:mm:ss zzzz",
time_format_long => "HH:mm:ss z",
time_format_medium => "HH:mm:ss",
time_format_short => "HH:mm",
variant => undef,
version => 33,
}
| 17.697417 | 51 | 0.462469 |
ed857e0899906e44d0f127c0aeddef89ca008e4e | 1,239 | pm | Perl | tests/wicked/basic/sut/t06_static_routes_legacy.pm | acerv/os-autoinst-distri-opensuse | 0e0cfca02f3a86323682c511a1efa926c7f0df3a | [
"FSFAP"
] | 84 | 2015-02-10T16:01:52.000Z | 2022-03-10T21:20:14.000Z | tests/wicked/basic/sut/t06_static_routes_legacy.pm | acerv/os-autoinst-distri-opensuse | 0e0cfca02f3a86323682c511a1efa926c7f0df3a | [
"FSFAP"
] | 8,065 | 2015-01-07T07:44:02.000Z | 2022-03-31T12:02:06.000Z | tests/wicked/basic/sut/t06_static_routes_legacy.pm | acerv/os-autoinst-distri-opensuse | 0e0cfca02f3a86323682c511a1efa926c7f0df3a | [
"FSFAP"
] | 404 | 2015-01-14T14:42:44.000Z | 2022-03-30T07:38:08.000Z | # SUSE's openQA tests
#
# Copyright 2018-2019 SUSE LLC
# SPDX-License-Identifier: FSFAP
# Package: wicked wicked-service iproute2
# Summary: Set up static routes from legacy ifcfg files
# Maintainer: Anton Smorodskyi <asmorodskyi@suse.com>
# Jose Lausuch <jalausuch@suse.com>
# Clemens Famulla-Conrad <cfamullaconrad@suse.de>
use base 'wickedbase';
use strict;
use warnings;
use testapi;
sub run {
my ($self, $ctx) = @_;
record_info('Info', 'Set up static routes from legacy ifcfg files');
$self->get_from_data('wicked/static_address/ifcfg-eth0', '/etc/sysconfig/network/ifcfg-' . $ctx->iface());
$self->get_from_data('wicked/static_address/ifroute-eth0', '/etc/sysconfig/network/ifroute-' . $ctx->iface());
$self->wicked_command('ifup', $ctx->iface());
$self->assert_wicked_state(ping_ip => $self->get_remote_ip(type => 'host'), iface => $ctx->iface());
validate_script_output("ip -4 route show", sub { m/default via 10\.0\.2\.2/ });
assert_script_run('ip -4 route show | grep "default" | grep -v "via' . $ctx->iface() . '"');
validate_script_output("ip -6 route show", sub { m/default via fd00:cafe:babe::1/ });
}
sub test_flags {
return {always_rollback => 1};
}
1;
| 35.4 | 114 | 0.672316 |
ed199c376a9bd455f6e88a21878db196c8f4968a | 3,632 | t | Perl | t/14.perl_version_parsing.t | calid/App-perlbrew | 7e9a68ded0b45ac8b77a6ecc39e6578316ff3ef8 | [
"MIT"
] | 1 | 2017-07-17T07:34:22.000Z | 2017-07-17T07:34:22.000Z | t/14.perl_version_parsing.t | calid/App-perlbrew | 7e9a68ded0b45ac8b77a6ecc39e6578316ff3ef8 | [
"MIT"
] | null | null | null | t/14.perl_version_parsing.t | calid/App-perlbrew | 7e9a68ded0b45ac8b77a6ecc39e6578316ff3ef8 | [
"MIT"
] | null | null | null | #!perl
use strict;
use App::perlbrew;
use File::Temp qw( tempdir );
$App::perlbrew::PERLBREW_ROOT = tempdir( CLEANUP => 1 );
$App::perlbrew::PERLBREW_HOME = tempdir( CLEANUP => 1 );
$ENV{PERLBREW_ROOT} = $App::perlbrew::PERLBREW_ROOT;
#
# This test checks if the sorting order of parsed version is the same as
# the order of @versions array defined below.
#
my @versions = qw(
5.003_07
5.004
5.004_01
5.004_02
5.004_03
5.004_04
5.004_05
5.005
5.005_01
5.005_02
5.005_03
5.005_04
5.6.0
5.6.1-TRIAL1
5.6.1-TRIAL2
5.6.1-TRIAL3
5.6.1
5.6.2
5.7.0
5.7.1
5.7.2
5.7.3
5.8.0
5.8.1
5.8.2
5.8.3
5.8.4
5.8.5
5.8.6
5.8.7
5.8.8
5.8.9
5.9.0
5.9.1
5.9.2
5.9.3
5.9.4
5.9.5
5.10.0-RC1
5.10.0-RC2
5.10.0
5.10.1
5.11.0
5.11.1
5.11.2
5.11.3
5.11.4
5.11.5
5.12.0
5.12.1-RC1
5.12.1-RC2
5.12.1
5.12.2-RC1
5.12.2
5.12.3
5.12.4-RC1
5.12.4-RC2
5.12.4
5.13.0
5.13.1
5.13.2
5.13.3
5.13.4
5.13.5
5.13.6
5.13.7
5.13.8
5.13.9
5.13.10
5.13.11
5.14.0-RC1
5.14.0-RC2
5.14.0-RC3
5.14.0
5.14.1-RC1
5.14.1
5.14.2-RC1
5.14.2
5.14.3-RC1
5.14.3-RC2
5.14.3
5.15.0
5.15.1
5.15.2
5.15.3
5.15.4
5.15.5
5.15.6
5.15.7
5.15.8
5.15.9
5.16.0-RC0
5.16.0-RC1
5.16.0-RC2
5.16.0
5.16.1-RC1
5.16.1
5.16.2-RC1
5.17.0
5.17.1
5.17.2
5.17.3
5.17.4
5.17.5
);
use Test::More;
plan tests => 0+@versions;
my @versions_i = sort { $a->[0] <=> $b->[0] } map { [App::perlbrew::perl_version_to_integer($_), $_] } @versions;
for my $i (0..$#versions) {
is $versions[$i], $versions_i[$i]->[1];
}
| 28.155039 | 113 | 0.247797 |
ed6acc7eff4201b47a5a7b37294ac88b5c69d6ba | 7,061 | t | Perl | t/controller/shared/release-info.t | zakame/metacpan-web | c23bc1cff46c057c7047d6c2ff520e942240b7ac | [
"Artistic-1.0"
] | null | null | null | t/controller/shared/release-info.t | zakame/metacpan-web | c23bc1cff46c057c7047d6c2ff520e942240b7ac | [
"Artistic-1.0"
] | null | null | null | t/controller/shared/release-info.t | zakame/metacpan-web | c23bc1cff46c057c7047d6c2ff520e942240b7ac | [
"Artistic-1.0"
] | null | null | null | use strict;
use warnings;
use Test::More 0.96;
use MetaCPAN::Web::Test;
use Module::Runtime qw( use_module );
my $model = use_module('MetaCPAN::Web::Model::ReleaseInfo');
my $rt_prefix = $model->rt_url_prefix;
# Test various aspects that should be similar
# among controllers that show release info (in the side bar).
# Currently this includes module and release controllers.
# Not all tests apply to all releases.
my @optional = qw(
favorited
home_page
repository
issues
);
# Use a counter to make sure we at least do each optional test once.
my %tested = map { ( $_ => 0 ) } @optional;
# global var (eww) used for test names
my $current;
sub optional_test; # predeclare for non-parenthetical usage below
test_psgi app, sub {
my $cb = shift;
# Tests default to true unless explicitly set to false.
# Setting to false does not test for failure, it simply skips the test.
my @tests = (
# has all optional tests
{
module => 'Dist::Zilla',
issues => 'https://github.com/rjbs/Dist-Zilla/issues'
},
# dist name that needs uri encoding
{
module => 'Text::Tabs',
release => 'Text-Tabs+Wrap',
qs_dist => 'Text-Tabs%2BWrap',
home_page => 0,
repository => 0,
reviews => 0,
},
# release name different than just s/::/-/g
{
module => 'LWP::UserAgent',
release => 'libwww-perl',
repository => 0,
home_page => 0,
issues => 'https://github.com/libwww-perl/libwww-perl/issues',
},
# no optional tests
{
module => 'CGI::Bus',
home_page => 0,
reviews => 0,
repository => 0,
favorited => 0
},
);
foreach my $test (@tests) {
( $test->{release} = $test->{module} ) =~ s/::/-/g
if !$test->{release};
my $qs_dist = $test->{qs_dist} || $test->{release};
my $qs_module = $test->{module};
# turn tests on by default
$test->{issues} //= $rt_prefix . $qs_dist;
exists( $test->{$_} ) or $test->{$_} = 1 for @optional;
# short cuts
my ( $module, $release ) = @{$test}{qw(module release)};
my $first_letter = uc( substr( $release, 0, 1 ) );
foreach my $type (qw(module release)) {
my $name = $test->{$type};
$current = { desc => "$type $name", test => $test };
my $req_uri = $type eq 'module' ? "/pod/$name" : "/release/$name";
ok( my $res = $cb->( GET $req_uri ), "GET $req_uri" );
is( $res->code, 200, 'code 200' );
my $tx = tx($res);
# these first tests are similar between the controllers only because of
# consistecy or coincidence and are not specifically related to release-info
$tx->like( '/html/head/title', qr/\Q$name\E/,
qq[title includes name "$name"] );
ok( $tx->find_value(qq<//a[\@href="$req_uri"]>),
'contains permalink to resource' );
ok(
my $this = $tx->find_value(
'//a[text()="This version"][starts-with(@href,"/")]/@href'
),
'contains link to "this" version'
);
# A fragile and unsure way to get the version, but at least an 80% solution.
# TODO: Set up a fake cpan; We'll know what version to expect; we can test that this matches
ok(
my $version = (
$this =~ m!(?:/pod)?/release/[^/]+/\Q$release\E-([^/"]+)!
)[0],
'got version from "this" link'
);
my $qs_version = $version;
# TODO: latest version (should be where we already are)
# TODO: author
# not in release-info.html but should be shown on both:
my $favs = '//*[contains(@class, "favorite")]';
$tx->like( $favs, qr/\+\+$/, 'tag for favorites (++)' );
optional_test favorited => sub {
ok(
$tx->find_value("$favs/span") > 0,
"$req_uri has been marked as favorite"
);
};
# Info about a release (either the one we're looking at or the one the module belongs to)
# TODO: Download
# TODO: Changes
optional_test home_page => sub {
ok( $tx->find_value('//a[text()="Homepage"]/@href'),
'link for resources.homepage' );
};
# test separate links for both web and url keys (if specified)
optional_test repository => sub {
ok( $tx->find_value('//a[text()="Repository"]/@href'),
'link for resources.repository.web' );
ok( $tx->find_value('//a[text()="git clone"]/@href'),
'link for resources.repository.url' );
};
optional_test issues => sub {
$tx->is( '//a[text()="Issues"]/@href', $test->{issues},
'link to bug tracker' );
};
# TODO: cpantesters
# TODO: release.tests.size
$tx->is(
'//a[@title="Matrix"]/@href',
"http://matrix.cpantesters.org/?dist=$qs_dist+$qs_version",
'link to test matrix'
);
# version select box
ok( $tx->find_value('//div[@class="breadcrumbs"]//select'),
'version select box' );
$tx->like(
# "go to" option has no value attr
'//select[@name="release"]/option[@value][1]',
qr/\([A-Z]{3,9} on \d{4}-\d{2}-\d{2}\)$/,
'version ends with pause id and date in common format'
);
# TODO: diff with version
# TODO: search
# TODO: toggle table of contents (module only)
my $revdep = $type eq 'module' ? 'module' : 'distribution';
ok(
$tx->find_value(
"//a[starts-with(\@href, \"/requires/$revdep/$name?\")]"),
"reverse deps link uses $revdep name"
);
$tx->like(
'//a[starts-with(@href, "https://explorer.metacpan.org/?url")]/@href',
$type eq 'module'
? qr!\?url=/module/\w+/${qs_dist}-${version}/.+!
: qr!\?url=/release/\w+/${qs_dist}-${version}\z!,
'explorer link points to module file or release',
);
# TODO: activity
}
}
ok( $tested{$_} > 0, "at least one module tested $_" )
for sort keys %tested;
};
done_testing;
sub optional_test {
my ( $name, $sub ) = @_;
subtest $name => sub {
plan skip_all => "$name test for $current->{desc}"
unless $current->{test}->{$name};
$sub->();
++$tested{$name};
};
}
| 31.663677 | 92 | 0.488316 |
ed74b07adedbb014bcfde84660ca0f6bc31eba99 | 2,632 | al | Perl | benchmark/benchmarks/FASP-benchmarks/data/small-world-2/smallworld2-0320-20-160-637.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/small-world-2/smallworld2-0320-20-160-637.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/small-world-2/smallworld2-0320-20-160-637.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | 1 91 103 121 150
2 55 66 111 137
3 38 79
4 68 87 127 147
5 11 36 83 87 120 147 157
6 52 58 89
7 81 92 125 126 137
8 36 64 153
9 41 159
10 51 117 129
11 23 43 53 67
12 70 124 157
13 32 58 64 116 156
14 3 20 43 57 92 129
15 59 80 112 135
16 11 34 40 41 67 129 158
17 80 97 99 156
18 16 29
19 42 92 126 145 155
20 18 48 68 120
21 2 28 68
22 14 69 89 131 141
23 35 97 149
24 79 89 153
25 57 59 132
26 6 52
27 12 45 77 78 81 121
28 141
29 42 68
30 23 59
31 10 71 72 86 93 102 129
32 148 156
33 30 82 84 106 107
34 43 49 75 141 148
35 23 30 33 40 74 130
36 5 27 107 111 157
37 26 50 114 130
38 6 14 57 140
39 17 99 111
40 55 91 108 143
41 43 56 84 124
42 5 16 68 108
43 49 71 93 112 141
44 7 9 32 54 86 94 104 143
45 41 78 81 119
46 97 98 113 123 125 134 151
47 73 145
48 12 68 100 113
49 39 43 55 93 113 119
50 25 103 134 139
51 10 47 86 94
52 26 37 39 73 75
53 11 87 122
54 41 100 107 112 117
55 15 76 77 96
56 2
57 3 25 52
58 2 4 35 74 76
59 60 80 85
60 18
61 34 65 113 148
62 8 38 60 70 144
63 47 77 95 110 138 143 145
64 135 136 156
65 2 21 27 66
66 13 61 148
67 18 53
68 24 43 83 115
69 18 33 48 65 139 158
70 12 26 60 62
71 74 129 145
72 1 45 104 159
73 56 145 159
74 33 35 147
75 56 73 101
76 26 75 119
77 5 27 91 121
78 11 12 70 84 157
79 3 11 81 128 141
80 15 135
81 65 90 105 110 111 140 144 150 153
82 33 59 74
83 29 68 78 137
84 33 41 106 108 109
85 1 27 77
86 24 102 149 156
87 23 56 67 116
88 10 20 25 27 57 83
89 48 57 102
90 27 39 44 77 108
91 85 92 114 117 127
92 68 125
93 12 49 119 146
94 25 51 114
96 62 119 138
97 11 27 46 111 130
98 46 103 113 137
99 31 49 82 119
100 2 118 133 134 149
101 63 67
102 11 31 57 70 93
103 46 51 53 114
104 44 72 110 142
105 136 155
106 117
107 33 80 82 131
108 32 40 76 124
109 12 116 149 160
110 25 37 50 114 126
111 19 24 41 61 65 95
112 15 58 64 82 136 155 156
113 123 149
114 37 57 81
115 26 26 70
116 18 40 50 56 63 73 87 95 107 109
117 19 92 127 140 150
118 94 100 101 130 144
119 12 59 80 93 99
120 83 83 100 104 118 152
121 6 45 93 150
122 16 21 75 95 111 128
123 59
124 18 88 90 141 143
125 7 71 92
126 19 117 127 158
127 91 126 147
128 3 13
129 14 31 57 88
130 23 35 58 98 137 137
131 14 22 43 141
132 2 24 29 54 107
133 34 39 148
134 7 46 105 123
135 15
136 13 30 64 105 112
137 49 89 96 105 155
138 6 54 93 96 147
139 7 33 84 109
140 3 6 8 31 63 103 115 159
141 9 26 30 57 61 76 79 114
142 149
143 40 47 73 138
144 7 78
145 47 87 115
146 44 102 119 142
147 87 91 106
148 32 76
149 48 118
150 1 70 117
151 19 27 82 97
152 5 37 45 82 118 120 144
153 1 8 60 128 157
154 55 96 159
155 58 77 130 136
156 133 135 148
157 51 60 78 152
158 30 33 69 97 128
159 21 86 100 104
160 116 | 16.553459 | 36 | 0.697948 |
eda5d9a1697d81732040931cbb8d161219161af4 | 473 | t | Perl | tests/key-right.t | nereusx/npick | bba54007afabb396bb25873bc115533742ba16bc | [
"MIT"
] | 1 | 2015-05-03T20:40:38.000Z | 2015-05-03T20:40:38.000Z | tests/key-right.t | nereusx/npick | bba54007afabb396bb25873bc115533742ba16bc | [
"MIT"
] | null | null | null | tests/key-right.t | nereusx/npick | bba54007afabb396bb25873bc115533742ba16bc | [
"MIT"
] | 1 | 2018-02-12T08:04:10.000Z | 2018-02-12T08:04:10.000Z | description: right moves the cursor to the right
keys: a \002 b \006 b \n # LEFT RIGHT ENTER
stdin:
bab
stdout:
bab
description: right moves the cursor to the right and handles UTF-8
keys: åaå \001 \006 \006 \006 ö \n # CTRL_A RIGHT RIGHT RIGHT ENTER
stdin:
åaåö
stdout:
åaåö
description: right arrow is an alias for right
keys: a \002 b \033OC b \n # LEFT RIGHT ENTER
stdin:
bab
stdout:
bab
description: right end of line
keys: \006 \n # RIGHT ENTER
stdin:
a
stdout:
a
| 16.892857 | 67 | 0.731501 |
eda98e77e4614b21310ba39ad97b4f9edd86403c | 7,067 | t | Perl | t/450-find.t | bbkr/mongo-perl6-driver | 821597ed79e43f40d421bb4caa45fe2dc62644c5 | [
"Artistic-2.0"
] | 15 | 2015-01-29T17:46:17.000Z | 2020-05-05T09:44:07.000Z | t/450-find.t | MARTIMM/raku-mongodb-driver | 821597ed79e43f40d421bb4caa45fe2dc62644c5 | [
"Artistic-2.0"
] | 26 | 2015-01-12T14:21:52.000Z | 2021-01-10T12:57:54.000Z | t/450-find.t | MARTIMM/raku-mongodb-driver | 821597ed79e43f40d421bb4caa45fe2dc62644c5 | [
"Artistic-2.0"
] | 8 | 2015-05-22T15:11:29.000Z | 2019-11-14T19:28:33.000Z | use v6;
use lib 't';
use Test;
use Test-support;
use MongoDB;
use MongoDB::Client;
use MongoDB::Cursor;
use MongoDB::Collection;
use BSON::ObjectId;
use BSON::Document;
#-------------------------------------------------------------------------------
drop-send-to('mongodb');
drop-send-to('screen');
#modify-send-to( 'screen', :level(MongoDB::MdbLoglevels::Trace));
info-message("Test $?FILE start");
my MongoDB::Test-support $ts .= new;
my Hash $clients = $ts.create-clients;
my MongoDB::Client $client = $clients{$clients.keys[0]};
my MongoDB::Database $database = $client.database('test');
my MongoDB::Collection $collection = $database.collection('testf');
my BSON::Document $req;
my BSON::Document $doc;
my MongoDB::Cursor $cursor;
# get version to skip certain tests
my Str $version = $ts.server-version($database);
#note $version;
#-------------------------------------------------------------------------------
subtest 'setup database', {
$database.run-command: (dropDatabase => 1,);
# Insert many documents to see proper working of get-more docs request
# using wireshark
#
my Array $docs = [];
for ^200 -> $i {
$docs.push: (
code => 'd1',
name => 'name and lastname',
address => 'address',
city => 'new york',
test_record => "tr$i"
);
}
$req .= new: (
insert => $collection.name,
documents => $docs
);
$doc = $database.run-command($req);
is $doc<ok>, 1, 'insert ok';
is $doc<n>, 200, 'inserted 200 docs';
# Request to get all documents listed to generate a get-more request
$cursor = $collection.find(
:criteria(test_record => 'tr100',),
:projection(_id => 0,)
);
$doc = $cursor.fetch;
is $doc.elems, 5, '5 fields in record, _id not returned';
is $doc<test_record>, 'tr100', 'test record 100 found';
}
#-------------------------------------------------------------------------------
subtest "Find tests", {
check-document(
( code => 'd1', test_record => 'tr3'),
( _id => 1, code => 1, name => 1, 'some-name' => 0)
);
check-document(
( code => 'd1', test_record => 'tr4'),
( _id => 1, code => 1, name => 0, address => 0, city => 0),
( code => 1,)
);
check-document(
( code => 'd1', test_record => 'tr5'),
( _id => 0, code => 0, name => 1, address => 1, city => 1),
( _id => 0, code => 0)
);
}
#-------------------------------------------------------------------------------
subtest "Count tests", {
$req .= new: ( count => $collection.name);
$doc = $database.run-command($req);
is $doc<n>, 200, '200 records';
$req<query> = ( code => 'd1', test_record => 'tr3');
$doc = $database.run-command($req);
is $doc<n>, 1, '1 record';
$req<query> = ();
$req<limit> = 3;
$doc = $database.run-command($req);
is $doc<n>, 3, '3 records with limit';
$req<query> = ();
$req<limit> = 3;
$req<skip> = 198;
$doc = $database.run-command($req);
is $doc<n>, 2, '2 records using skip and limit';
}
#-------------------------------------------------------------------------------
if $version ~~ / '2.6.' \d+ / {
skip "2.6.* server doesn't know about command 'explain'", 1;
}
else {
subtest "Testing explain and performance using cursor", {
# The server needs to scan through all documents to see if the query matches
# when there is no index set.
$req .= new: (
explain => (
find => 'testf',
filter => (test_record => 'tr38'),
options => ()
),
verbosity => 'executionStats'
);
$doc = $database.run-command($req);
# diag $doc;
my $s = $doc<executionStats>;
is $s<nReturned>, 1, 'One doc found';
is $s<totalDocsExamined>, 200, 'Scanned 200 docs, bad searching';
# Now set an index on the field and the scan goes only through one document
$doc = $database.run-command: (
createIndexes => $collection.name,
indexes => [ (
key => (test_record => 1,),
name => 'tf_idx',
),
]
);
is $doc<createdCollectionAutomatically>, False, 'Not created automatically';
is $doc<numIndexesBefore>, 1, 'Only 1 index before call';
is $doc<numIndexesAfter>, 2, 'Now there are 2';
$doc = $database.run-command($req);
$s = $doc<executionStats>;
is $s<nReturned>, 1, 'One doc found';
is $s<totalDocsExamined>, 1, 'Scanned 1 doc, great searching';
}
#-----------------------------------------------------------------------------
subtest "Testing explain and performance using hint", {
# Give a bad hint and get explaination(another possibility from above
# explain using find in stead of run-command)
$cursor = $collection.find(
:criteria(
'$query' => (test_record => 'tr38',),
'$hint' => (_id => 1,),
'$explain' => 1
),
:number-to-return(1)
);
$doc = $cursor.fetch;
my $s = $doc<executionStats>;
is $s<nReturned>, 1, 'One doc found, explain via bad hint';
ok $s<totalDocsExamined> > 1, 'Scanned 200 docs, bad searching, explain via bad hint';
# Give a good hint and get explaination(another possibility from above
# explain using find in stead of run-command)
$cursor = $collection.find(
:criteria(
'$query' => (test_record => 'tr38',),
'$hint' => (test_record => 1,),
'$explain' => 1
),
:number-to-return(1)
);
$doc = $cursor.fetch;
$s = $doc<executionStats>;
is $s<nReturned>, 1, 'One doc found, explain via a good hint';
is $s<totalDocsExamined>, 1, 'Scanned 1 doc, great indexing, explain via good hint';
}
}
#-------------------------------------------------------------------------------
subtest "Error testing", {
$cursor.kill;
$doc = $database.run-command: (getLastError => 1,);
ok $doc<ok>.Bool, 'No error after kill cursor';
# Is this ok (No fifty because of test with explain on cursor????
$doc = $database.run-command(
BSON::Document.new: (
:count($collection.name),
:query(:test_record<tr38>,),
:hint(:1test_record,),
)
);
is $doc<n>, 1, 'Counting 1 document on search';
}
#-------------------------------------------------------------------------------
# Cleanup and close
info-message("Test $?FILE stop");
done-testing();
#-------------------------------------------------------------------------------
# Check one document for its fields. Something like {code => 1, nofield => 0}
# use find()
sub check-document ( $criteria, $field-list, $projection = ())
{
# $cursor = $collection.find( :$criteria, :$projection);
# while $cursor.fetch() -> BSON::Document $document {
for $collection.find( :$criteria, :$projection) -> BSON::Document $document {
for @$field-list -> $pair {
if $pair.value == 1 {
is( $document{$pair.key}:exists, True, "Key '{$pair.key}' exists");
}
else {
is( $document{$pair.key}:exists,
False, "Key '{$pair.key}' does not exist"
);
}
}
last;
}
}
| 27.822835 | 90 | 0.52257 |
ed8f2c5190b19db634effdb87d61617243ec1729 | 6,939 | t | Perl | t/50connect-deadlock.t | GerHobbelt/h2o | a429117babff09542d3517c4fa36c1ef769889c1 | [
"MIT"
] | null | null | null | t/50connect-deadlock.t | GerHobbelt/h2o | a429117babff09542d3517c4fa36c1ef769889c1 | [
"MIT"
] | null | null | null | t/50connect-deadlock.t | GerHobbelt/h2o | a429117babff09542d3517c4fa36c1ef769889c1 | [
"MIT"
] | null | null | null | # This test makes sure that there is limit in the amount of buffer used by a CONNECT tunnel, by running a server that echoes the
# input using 1KB buffer, and by running a client that sends data through the tunnel without reading the response.
use strict;
use warnings;
use Errno qw(EAGAIN EINTR EWOULDBLOCK);
use Fcntl qw(F_GETFL F_SETFL O_NONBLOCK);
use IO::Select;
use IO::Socket::INET;
use IPC::Open3;
use Scope::Guard;
use Socket qw(IPPROTO_TCP TCP_NODELAY);
use Symbol qw(gensym);
use Time::HiRes qw(sleep);
use Test::More;
use Net::EmptyPort qw(check_port empty_port);
use t::Util;
local $SIG{PIPE} = sub {};
my $origin_port = empty_port();
my $quic_port = empty_port({
host => "127.0.0.1",
proto => "udp",
});
my $server = spawn_h2o(<< "EOT");
listen:
type: quic
port: $quic_port
ssl:
key-file: examples/h2o/server.key
certificate-file: examples/h2o/server.crt
hosts:
default:
paths:
"/":
proxy.connect:
- "+127.0.0.1:$origin_port"
proxy.timeout.io: 10000
EOT
# setup a server that echoes the input using buffer size of 1KB
my $origin_guard = do {
my $listener = IO::Socket::INET->new(
Listen => 5,
LocalAddr => "127.0.0.1:$origin_port",
Proto => "tcp",
) or die "failed to open listener:$!";
my $pid = fork;
die "fork failed:$!"
unless defined $pid;
if ($pid == 0) {
# child process
while (1) {
if (my $sock = $listener->accept) {
if (!defined setsockopt($sock, IPPROTO_TCP, TCP_NODELAY, 1)) {
die "setsockopt(TCP_NODELAY) failed:$!";
}
while (sysread($sock, my $buf, 1024) > 0) {
while (length $buf != 0) {
my $ret = syswrite($sock, $buf, length $buf);
last unless $ret > 0;
substr $buf, 0, $ret, "";
}
}
}
}
die "unreachable";
}
# parent process
undef $listener;
Scope::Guard->new(sub {
kill 'KILL', $pid;
while (waitpid($pid, 0) != $pid) {}
});
};
subtest "handwritten-h1-client" => sub {
my $sock = IO::Socket::INET->new(
PeerAddr => "127.0.0.1:$server->{port}",
Proto => "tcp",
) or die "failed to connect to server:$!";
my $req = "CONNECT 127.0.0.1:$origin_port HTTP/1.1\r\n\r\n";
subtest "establish-tunnel" => sub {
is syswrite($sock, $req), length $req, "send request";
sysread $sock, my $resp, 1024;
like $resp, qr{HTTP/1\.1 200 .*\r\n\r\n$}s, "got 200 response";
};
test_tunnel($sock, $sock, undef);
};
subtest "h2o-httpclient" => sub {
my $client_prog = bindir() . "/h2o-httpclient";
plan skip_all => "$client_prog not found"
unless -e $client_prog;
for (['h1', 'http', $server->{port}, ''], ['h1s', 'https', $server->{tls_port}, ''], ['h3', 'https', $quic_port, '-3 100']) {
my ($name, $scheme, $port, $opts) = @$_;
subtest $name => sub {
# open client
my ($writefh, $readfh, $errfh);
$errfh = gensym;
my $guard = do {
my $pid = open3($writefh, $readfh, $errfh, "exec $client_prog -k $opts -m CONNECT -x $scheme://127.0.0.1:$port 127.0.0.1:$origin_port");
die unless $pid > 0;
sub {
kill 'KILL', $pid;
while (waitpid($pid, 0) != $pid) {}
};
};
# check if tunnel is established
my $resp = read_until_blocked($errfh);
like $resp, qr{HTTP/\S+ 200.*\n\n$}s, "got 200 response";
test_tunnel($writefh, $readfh, $errfh);
};
}
};
done_testing;
sub test_tunnel {
my ($writefh, $readfh, $errfh) = @_;
subtest "test-echo" => sub {
is syswrite($writefh, "hello\n"), 6;
my $resp = read_until_blocked($readfh);
is $resp, "hello\n";
};
my $all_read = '';
my @all_lengths_written;
for my $ch (1..5) {
subtest "run $ch" => sub {
my $bytes_written;
subtest "write-much-as-possible" => sub {
$bytes_written = write_until_blocked($writefh, $ch);
die "unexpected close during write:" . ($errfh ? read_until_blocked($errfh) : "")
unless defined $bytes_written;
diag "stall after $bytes_written bytes";
pass "stalled";
push @all_lengths_written, $bytes_written;
};
subtest "read-all" => sub {
my $buf = read_until_blocked($readfh);
is length $buf, $bytes_written;
$all_read .= $buf;
};
};
}
my @all_lengths_read;
for my $ch (1..5) {
if ($all_read =~ /^($ch*)/s) {
push @all_lengths_read, length $1;
$all_read = $';
} else {
push @all_lengths_read, 0;
}
}
subtest "byte pattern" => sub {
is_deeply \@all_lengths_read, \@all_lengths_written, "lengths of each block";
is $all_read, '', "nothing excess";
};
}
sub write_until_blocked {
my ($sock, $ch) = @_;
my $bytes_written = 0;
fcntl $sock, F_SETFL, O_NONBLOCK
or die "failed to set O_NONBLOCK:$!";
while (1) {
my $ret = syswrite $sock, $ch x 65536;
if (defined $ret) {
return undef if $ret == 0;
# continue writing
$bytes_written += $ret;
} else {
if ($! == EAGAIN || $! == EWOULDBLOCK) {
# wait for max 0.5 seconds
last if !IO::Select->new([ $sock ])->can_write(1);
} elsif ($! == EINTR) {
# retry
} else {
return undef;
}
}
}
fcntl $sock, F_SETFL, 0
or die "failed to clear O_NONBLOCK:$!";
return $bytes_written;
}
sub read_until_blocked {
my $sock = shift;
fcntl $sock, F_SETFL, O_NONBLOCK
or die "failed to set O_NONBLOCK:$!";
my $buf = '';
while (1) {
my $ret = sysread $sock, $buf, 65536, length $buf;
if (defined $ret) {
if ($ret > 0) {
# continue reading
} else {
# EOF
last;
}
} else {
if ($! == EAGAIN || $! == EWOULDBLOCK) {
# wait for max. 0.5 seconds for additional data
$! = 0;
if (!IO::Select->new([ $sock ])->can_read(1)) {
last unless $!; # timeout
}
} elsif ($! == EINTR) {
# retry
} else {
# error
last;
}
}
}
fcntl $sock, F_SETFL, 0
or die "failed to clear O_NONBLOCK:$!";
$buf;
}
| 30.038961 | 152 | 0.49546 |
eda501dd70c1a9003d533bd6518783c4f57b458b | 2,466 | pm | Perl | lib/Catmandu/FedoraCommons/Model/findObjects.pm | LibreCat/Catmandu-FedoraCommons | cca9ef5582f2d1fc1395acebfd2dab239e557cba | [
"Artistic-1.0"
] | 2 | 2018-03-05T19:39:33.000Z | 2018-03-05T19:39:37.000Z | lib/Catmandu/FedoraCommons/Model/findObjects.pm | LibreCat/Catmandu-FedoraCommons | cca9ef5582f2d1fc1395acebfd2dab239e557cba | [
"Artistic-1.0"
] | 2 | 2015-11-25T12:48:46.000Z | 2018-11-21T13:56:37.000Z | lib/Catmandu/FedoraCommons/Model/findObjects.pm | LibreCat/Catmandu-FedoraCommons | cca9ef5582f2d1fc1395acebfd2dab239e557cba | [
"Artistic-1.0"
] | null | null | null | =head1 NAME
Catmandu::FedoraCommons::Model::findObjects - Perl model for the Fedora 'findObjects' and 'resumeFindObjects' REST call
=head1 SYNOPSIS
use Catmandu::FedoraCommons;
my $fedora = Catmandu::FedoraCommons->new('http://localhost:8080/fedora','fedoraAdmin','fedoraAdmin');
my $obj = $fedora->findObjects(terms=>'*')->parse_content;
{
'token' => '92b0ae4028f9459ce7cd0600f562adb2' ,
'cursor' => 0,
'expirationDate' => '2013-02-08T09:37:55.860Z',
'results' => [
{
'pid' => 'demo:29' ,
'label' => 'Data Object for Image Manipulation Demo' ,
'state' => 'I' ,
'ownerId' => 'fedoraAdmin' ,
'cDate' => '2008-07-02T05:09:42.015Z' ,
'mDate' => '2013-02-07T19:57:27.140Z' ,
'dcmDate' => '2008-07-02T05:09:43.234Z' ,
'title' => [ 'Coliseum in Rome' ] ,
'creator' => [ 'Thornton Staples' ] ,
'subject' => [ 'Architecture, Roman' ] ,
'description' => [ 'Image of Coliseum in Rome' ] ,
'publisher' => [ 'University of Virginia Library' ] ,
'format' => [ 'image/jpeg' ] ,
'identifier' => [ 'demo:29' ],
},
] ,
}
=head1 SEE ALSO
L<Catmandu::FedoraCommons>
=cut
package Catmandu::FedoraCommons::Model::findObjects;
use XML::LibXML;
our %SCALAR_TYPES = (pid => 1 , label => 1 , state => 1 , ownerId => 1 , cDate => 1 , mDate => 1 , dcmDate => 1);
sub parse {
my ($class,$xml) = @_;
my $dom = XML::LibXML->load_xml(string => $xml);
$dom->getDocumentElement()->setNamespace('http://www.fedora.info/definitions/1/0/types/','t');
my $result = { results => [] };
my @nodes;
@nodes = $dom->findnodes("/t:result/t:listSession/*");
for my $node (@nodes) {
my $name = $node->nodeName;
my $value = $node->textContent;
$result->{$name} = $value;
}
@nodes = $dom->findnodes("/t:result/t:resultList/t:objectFields");
for my $node (@nodes) {
my @vals = $node->findnodes("./*");
my $rec = {};
foreach my $val (@vals) {
my $name = $val->nodeName;
my $value = $val->textContent;
if (exists $SCALAR_TYPES{$name}) {
$rec->{$name} = $value;
}
else {
push @{ $rec->{$name} } , $value;
}
}
push @{$result->{results}}, $rec;
}
return $result;
}
1;
| 27.707865 | 119 | 0.519465 |
73edb1e310b58bb650800e25277d8a5e6d7a059e | 1,336 | pm | Perl | auto-lib/Paws/EMR/PlacementType.pm | agimenez/aws-sdk-perl | 9c4dff7d1af2ff0210c28ca44fb9e92bc625712b | [
"Apache-2.0"
] | 2 | 2016-09-22T09:18:33.000Z | 2017-06-20T01:36:58.000Z | auto-lib/Paws/EMR/PlacementType.pm | cah-rfelsburg/paws | de9ffb8d49627635a2da588066df26f852af37e4 | [
"Apache-2.0"
] | null | null | null | auto-lib/Paws/EMR/PlacementType.pm | cah-rfelsburg/paws | de9ffb8d49627635a2da588066df26f852af37e4 | [
"Apache-2.0"
] | null | null | null | package Paws::EMR::PlacementType;
use Moose;
has AvailabilityZone => (is => 'ro', isa => 'Str', required => 1);
1;
### main pod documentation begin ###
=head1 NAME
Paws::EMR::PlacementType
=head1 USAGE
This class represents one of two things:
=head3 Arguments in a call to a service
Use the attributes of this class as arguments to methods. You shouldn't make instances of this class.
Each attribute should be used as a named argument in the calls that expect this type of object.
As an example, if Att1 is expected to be a Paws::EMR::PlacementType object:
$service_obj->Method(Att1 => { AvailabilityZone => $value, ..., AvailabilityZone => $value });
=head3 Results returned from an API call
Use accessors for each attribute. If Att1 is expected to be an Paws::EMR::PlacementType object:
$result = $service_obj->Method(...);
$result->Att1->AvailabilityZone
=head1 DESCRIPTION
The Amazon EC2 location for the job flow.
=head1 ATTRIBUTES
=head2 B<REQUIRED> AvailabilityZone => Str
The Amazon EC2 Availability Zone for the job flow.
=head1 SEE ALSO
This class forms part of L<Paws>, describing an object used in L<Paws::EMR>
=head1 BUGS and CONTRIBUTIONS
The source code is located here: https://github.com/pplu/aws-sdk-perl
Please report bugs to: https://github.com/pplu/aws-sdk-perl/issues
=cut
| 23.438596 | 102 | 0.734281 |
ed69ea25b4f10c7fcd4a0e89e4608f7f7c36e053 | 2,592 | pl | Perl | data/threesame/data/train/4.pl | logic-and-learning-lab/aaai22-dcc | e2176545f222fd0fe4788297f5448f278c46e440 | [
"MIT"
] | null | null | null | data/threesame/data/train/4.pl | logic-and-learning-lab/aaai22-dcc | e2176545f222fd0fe4788297f5448f278c46e440 | [
"MIT"
] | null | null | null | data/threesame/data/train/4.pl | logic-and-learning-lab/aaai22-dcc | e2176545f222fd0fe4788297f5448f278c46e440 | [
"MIT"
] | null | null | null | pos(f([10, 10, 10, 93, 7, 53, 15, 93, 67, 101, 85, 25, 44, 66, 93, 63, 62, 27, 17, 74, 90, 53, 87, 24, 29, 74, 96, 73, 99, 84, 20, 96, 5, 48, 70, 2, 27, 86, 52, 16])).
pos(f([56, 56, 56, 39, 77, 71, 88, 32, 39, 14, 31, 91, 2, 34, 38, 60, 47, 89, 55, 35, 51, 18, 73, 85, 36, 34, 52, 73, 8, 10, 98, 57, 17, 51, 77, 22, 7, 51, 42, 82, 51, 24, 43, 86, 49, 86, 7, 78, 41, 22, 57, 71])).
pos(f([22, 22, 22, 58, 24, 93, 32, 83, 65, 9, 72, 28, 64, 59, 22, 4, 88, 26, 13, 14, 101, 90, 59, 96, 31, 26, 38, 25, 92, 49, 50, 66, 75, 59, 12, 53, 36, 15, 6, 9, 53, 41, 22, 42, 42, 56, 24, 22, 44, 48])).
pos(f([40, 40, 40, 93, 38, 97, 44, 94, 21, 8, 31, 86, 97, 6, 24, 29, 77, 66, 101, 83, 40, 40, 28])).
pos(f([74, 74, 74, 52, 77, 36, 42, 44, 56, 24, 77, 40, 101, 99, 68, 49, 27, 87, 95, 73, 74, 43, 10, 10, 44, 81, 55, 59, 91, 96, 19, 95, 90, 75, 39, 27, 62, 10, 8, 53, 48, 84, 50, 78, 45, 3, 17, 48, 77, 4])).
pos(f([14, 14, 14, 35, 65, 94, 17, 11, 81, 14, 74, 66, 12, 48, 99, 19, 59, 83, 40, 56, 36, 83, 98, 16, 9, 86, 42, 39, 12, 1, 69, 73, 26, 30, 97, 11, 32, 36, 46, 54, 63, 59, 94, 26, 36, 73, 61, 95, 6, 71, 87, 75, 80, 96])).
pos(f([64, 64, 64, 39, 100, 4, 60, 49, 94, 71, 86, 75, 11, 26, 47, 23, 1, 32, 58, 63, 58, 59, 95, 8, 1, 22])).
pos(f([89, 89, 89, 56, 38, 97, 15, 100, 66, 78])).
pos(f([82, 82, 82, 84, 26])).
pos(f([22, 22, 22, 67, 52, 17, 20, 43, 26, 1, 70, 45, 89, 10, 27, 93, 7, 74, 22, 28])).
neg(f([87, 30, 33, 30, 5, 38, 36, 10, 17, 33, 52, 5, 10, 44, 34, 77, 91, 85, 14, 60, 31, 1, 4, 29, 45, 97, 68, 60, 23, 1, 44, 7, 89, 66, 67, 16, 21, 98, 18, 67, 15, 68, 54, 84, 36, 50, 58, 81, 14, 49])).
neg(f([78, 44, 14, 27, 78, 7, 1, 11, 24, 9, 76, 65, 83, 49, 47, 7, 100, 62, 8, 83, 75, 32, 47, 73, 61, 12, 35, 77, 1, 22])).
neg(f([6, 12, 49, 19, 39, 10, 81, 34, 72, 64, 69, 83, 95, 71, 24, 46, 46, 30, 90, 53, 12, 21, 95, 80, 90, 84, 21, 2])).
neg(f([74, 14, 76, 36, 12, 19, 20, 10, 57, 100, 57, 35, 65, 81, 48, 3, 35, 83])).
neg(f([98, 30, 5, 78, 76, 39, 63, 63, 69, 99, 22, 82, 46, 35, 48, 22, 5, 50, 47, 91, 51, 38, 69, 36, 21, 95, 33, 87, 68, 3, 81, 45, 30, 71, 22, 61, 12, 101, 93, 69, 69, 10, 58, 14, 58, 83, 84, 53])).
neg(f([43, 93, 90, 40, 45, 26, 86, 25, 44, 4, 46])).
neg(f([33, 93, 97, 65, 60, 11, 71, 53, 100, 88, 61, 8, 17, 91, 3, 15, 55, 49, 78, 96, 101, 96, 13, 18, 66, 76, 9, 14, 7, 48, 15, 74, 42, 61, 98, 62])).
neg(f([34, 58, 37, 65, 14, 57, 2, 41, 73, 76, 39, 19, 77, 5])).
neg(f([81, 38, 10, 75, 90, 94, 56, 60])).
neg(f([81, 16, 60, 48, 17, 54, 23, 50, 53, 83, 49, 1, 87, 74, 25, 35, 40, 33, 92, 70, 67, 14, 53, 94, 96, 89, 98, 60, 19, 24, 88, 28, 58, 91, 16])).
| 123.428571 | 222 | 0.484568 |
ed86e2b9942b46315197189deb56fa433e823b10 | 133 | psgi | Perl | bin/app.psgi | Hegz/ANTournament | f67e7c9449f1c10b9cb6d3eb91e45ea619d709e4 | [
"Artistic-2.0"
] | null | null | null | bin/app.psgi | Hegz/ANTournament | f67e7c9449f1c10b9cb6d3eb91e45ea619d709e4 | [
"Artistic-2.0"
] | null | null | null | bin/app.psgi | Hegz/ANTournament | f67e7c9449f1c10b9cb6d3eb91e45ea619d709e4 | [
"Artistic-2.0"
] | null | null | null | #!/usr/bin/env perl
use strict;
use warnings;
use FindBin;
use lib "$FindBin::Bin/../lib";
use ANTournament;
ANTournament->to_app;
| 13.3 | 31 | 0.714286 |
ed9252b6639e74c1bc9c78ef4c35c9d07e5920df | 3,393 | al | Perl | benchmark/benchmarks/FASP-benchmarks/data/random-oriented/randomoriented-1624-450-450.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/random-oriented/randomoriented-1624-450-450.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | benchmark/benchmarks/FASP-benchmarks/data/random-oriented/randomoriented-1624-450-450.al | krzysg/FaspHeuristic | 1929c40e3fbc49e68b04acfc5522539a18758031 | [
"MIT"
] | null | null | null | 1 166 169 370
2
3
4
5
6 154
7
8 89 255 336 348
9 273 419
10
11
12
13 24
14 240
15 168 230
16 115 400
17
18
19
20 73 240
21
22 86 172
23 70
24 73 222
25
26
27 152
28
29 99 259
30
31 65 89
32 21
33 368
34 410
35
36
37
38
39 77
40 210
41
42 404
43
44
45 88
46 353
47 395
48 388
49 150
50 92 203 312 335 344
51
52
53
54 384 385
55 71 222 246
56
57 2 392
58 449
59
60 217 323
61
62 103
63 115
64 131 368
65 195
66 84 222 397
67 159
68
69
70 190 294
71
72 383
73
74 248
75 3 159 389
76 107 272
77
78
79
80
81 45
82
83 113
84 391
85 18 405
86
87
88 158 270
89 23 105 234
90 441
91 45
92
93
94 248 405
95
96
97
98 178 237
99
100 165 392
101
102 178 246
103
104 41 175 337 357 438
105 103
106 328 389
107 186 270 305 443
108 415
109 164
110 177 247 329
111
112 164
113 31 79 286
114 98 117
115 80 344
116
117 255
118 63 399 403
119 214 228 354
120 1 413
121
122 110 427
123
124
125
126
127
128
129 236 392
130 152 436
131 344
132 280
133
134
135 244 392
136
137 269
138 340
139
140 143
141 302
142
143
144
145 88 244
146
147 2
148 128
149 154 366 392
150 40
151 271
152 206
153 55 239
154
155
156 375
157
158 318
159 73
160 100
161
162
163 433
164 195
165 367
166 372
167
168
169
170 140
171 325
172 330 360
173
174
175 261 376 411 426
176
177
178
179 209
180 44 295
181 363 412
182 130
183 333 349
184 111
185
186 223
187
188 356
189 167 422
190 278
191 417
192 354 398
193
194 42
195 303
196
197 19 383
198
199
200
201 38
202 24 74 257
203 230 330
204
205 50 185 255 277
206 184 299
207 362
208 412
209 33 406
210
211 346
212 127
213 13 145
214
215 241 288
216 294 356
217 410
218 375
219
220
221
222 352 396
223
224
225
226
227 276
228 143 424
229 15
230 209 282 419 434
231 283 346
232 11
233
234
235 5 311 391
236
237
238
239
240
241 444
242
243
244 19 65 219
245 93
246 30
247
248 308 346
249 121 435
250
251 95 187
252 306 392 421
253
254
255 373 434
256
257 22 75 182 344
258 246
259 157 323
260
261 264
262
263 202
264
265 92
266
267
268 217
269 348
270
271
272 351
273
274 335
275 425
276 120 347
277
278
279 376
280
281 133
282
283 110
284 69
285 99 200 267 284
286
287
288 20
289 42
290 389 419
291 336
292 231 423
293
294 51 173
295 108
296 402
297 273
298
299
300 169
301 114 292
302 343 346
303 76 170 429
304 273
305
306 361
307 84 298
308
309 106 111 448
310 173
311
312 366 369
313
314 361
315
316 382
317 345
318
319
320
321 275 308
322 112 209 444
323 168
324 178 235
325 35 342 395
326
327 240 296 305
328
329
330 435
331 31 51
332 25 226
333 236
334 308
335
336 199 415
337 91
338
339 220
340 17 222
341 57
342 189
343 10
344 298
345 219
346 198 411
347 234
348 355
349
350 46 398
351
352 68
353
354
355
356 427
357
358 152
359 97
360 35 48 155 405
361 73 284
362 59 411
363 438
364 16 174 269
365 37 112 304
366 393
367 166 192 397
368 181 387
369
370
371
372 180 249 382 391
373 240
374
375 103 233 304 321
376
377
378 365
379 85
380 107 190
381 310
382
383
384 20 157 355
385 377
386 231
387
388 353
389 359
390 339
391 181
392
393
394
395 297
396 220 322 392
397 206
398
399
400 342
401
402 107 283
403 20 267 276 400
404 128 193
405 239
406 88 146
407 294
408 37 110
409
410
411 419
412 47
413 143
414 302 340
415 33 54 168
416
417 201
418
419 382
420 326 439
421 148
422 212
423 134 310
424 303
425 101
426 27 379
427
428 32
429
430 88 237 256
431
432 111 341
433
434 385
435 75 122
436
437 2
438 154 163
439
440 298
441
442 243
443
444 365
445 81 99
446 138
447
448
449
450 | 7.54 | 22 | 0.735043 |
ed909949e7aa1ccc58e423b86d7b010a2c383cd6 | 767 | t | Perl | t/CommonGetAutocompleteV1ResponseTest.t | ezmaxinc/eZmax-SDK-perl | 3de20235136371b946247d2aed9e5e5704a4051c | [
"MIT"
] | null | null | null | t/CommonGetAutocompleteV1ResponseTest.t | ezmaxinc/eZmax-SDK-perl | 3de20235136371b946247d2aed9e5e5704a4051c | [
"MIT"
] | null | null | null | t/CommonGetAutocompleteV1ResponseTest.t | ezmaxinc/eZmax-SDK-perl | 3de20235136371b946247d2aed9e5e5704a4051c | [
"MIT"
] | null | null | null | =begin comment
eZmax API Definition (Full)
This API expose all the functionnalities for the eZmax and eZsign applications.
The version of the OpenAPI document: 1.1.7
Contact: support-api@ezmax.ca
Generated by: https://openapi-generator.tech
=end comment
=cut
#
# NOTE: This class is auto generated by the OpenAPI Generator
# Please update the test cases below to test the model.
# Ref: https://openapi-generator.tech
#
use Test::More tests => 2;
use Test::Exception;
use lib 'lib';
use strict;
use warnings;
use_ok('EzmaxApi::Object::CommonGetAutocompleteV1Response');
# uncomment below and update the test
#my $instance = EzmaxApi::Object::CommonGetAutocompleteV1Response->new();
#
#isa_ok($instance, 'EzmaxApi::Object::CommonGetAutocompleteV1Response');
| 21.914286 | 79 | 0.765319 |
ed965e2cb026b0b51183867034ac870fd64ab63f | 251 | t | Perl | S02-types/stash.t | dumarchie/roast | dbf9aa7209593f21f806a478a7f3d172649569ae | [
"Artistic-2.0"
] | 99 | 2015-03-03T13:01:44.000Z | 2020-03-05T15:21:43.000Z | S02-types/stash.t | dumarchie/roast | dbf9aa7209593f21f806a478a7f3d172649569ae | [
"Artistic-2.0"
] | 331 | 2015-02-17T15:26:22.000Z | 2020-03-16T18:29:49.000Z | S02-types/stash.t | dumarchie/roast | dbf9aa7209593f21f806a478a7f3d172649569ae | [
"Artistic-2.0"
] | 136 | 2015-02-02T13:34:10.000Z | 2020-02-18T02:26:59.000Z | use v6;
use Test;
plan 1;
#L<S02/Mutable Types>
# https://github.com/Raku/old-issue-tracker/issues/3137
{
sub S (Stash $s) { $s.WHAT.raku };
is S(Stash.new), 'Stash', 'Stash.new creates Stash, not a Hash';
}
# vim: expandtab shiftwidth=4
| 15.6875 | 68 | 0.645418 |
ed6e5c6f411b88b8145aab022d3138850aa7de3f | 439 | pl | Perl | ARTe/work/tools/cygwin/lib/perl5/5.14/unicore/lib/Blk/KayahLi.pl | melvin-mancini/Multitasking-RealTime-Arduino-System | 6999beaf28f69b4c4a8f8badcc60f66e6e118477 | [
"MIT"
] | 5 | 2018-12-18T20:19:43.000Z | 2022-02-21T21:53:09.000Z | Slic3r/Linux/lib/std/unicore/lib/Blk/KayahLi.pl | thomaspreece10/STLExtract | 2bea6d38135ebfda2558a33cc93565211e30a2bb | [
"MIT"
] | null | null | null | Slic3r/Linux/lib/std/unicore/lib/Blk/KayahLi.pl | thomaspreece10/STLExtract | 2bea6d38135ebfda2558a33cc93565211e30a2bb | [
"MIT"
] | 6 | 2016-09-23T02:54:47.000Z | 2022-03-10T22:04:19.000Z | # !!!!!!! DO NOT EDIT THIS FILE !!!!!!!
# This file is machine-generated by lib/unicore/mktables from the Unicode
# database, Version 6.0.0. Any changes made here will be lost!
# !!!!!!! INTERNAL PERL USE ONLY !!!!!!!
# This file is for internal use by the Perl program only. The format and even
# the name or existence of this file are subject to change without notice.
# Don't use it directly.
return <<'END';
A900 A92F
END
| 31.357143 | 78 | 0.678815 |
73e64ef0c141ca2855c83b651b0179e8913fb06e | 6,960 | pm | Perl | lib/XML/Loy/ActivityStreams.pm | Akron/XML-Loy | e44e03b1a18e74b018afb4574ce13aa091154728 | [
"Artistic-2.0"
] | 1 | 2015-03-20T08:17:59.000Z | 2015-03-20T08:17:59.000Z | lib/XML/Loy/ActivityStreams.pm | Akron/XML-Loy | e44e03b1a18e74b018afb4574ce13aa091154728 | [
"Artistic-2.0"
] | 4 | 2015-02-04T12:08:12.000Z | 2016-04-01T09:55:51.000Z | lib/XML/Loy/ActivityStreams.pm | Akron/XML-Loy | e44e03b1a18e74b018afb4574ce13aa091154728 | [
"Artistic-2.0"
] | 3 | 2015-02-11T15:40:54.000Z | 2016-03-22T14:11:46.000Z | package XML::Loy::ActivityStreams;
use strict;
use warnings;
use XML::Loy with => (
prefix => 'activity',
namespace => 'http://activitystrea.ms/schema/1.0/'
);
# Todo: support to_json
# Todo: verbs and object-types may need namespaces
# Todo: Support ActivityStreams 2 as a anamespace
use Carp qw/carp/;
# No constructor
sub new {
carp 'Only use ' . __PACKAGE__ . ' as an extension to Atom';
return;
};
# Add or get ActivityStreams actor
sub actor {
my $self = shift;
# Set actor
if ($_[0]) {
my $actor = $self->author( @_ );
$actor->set('object-type', _check_prefix('person'));
return $actor;
}
# Get actor
else {
my $actor = $self->author->[0];
if ($actor) {
my $object_type = $actor->children('object-type');
return unless $object_type = $object_type->[0];
# Prepend namespace if not defined
if (index($object_type->text, '/') == -1) {
$object_type->content(
__PACKAGE__->_namespace . lc $object_type->text
);
};
return $actor;
};
};
return;
};
# Add or get ActivityStreams verb
sub verb {
my $self = shift;
# Set verb
if ($_[0]) {
return $self->set(verb => _check_prefix($_[0]));
}
# Get verb
else {
my $verb = $self->children('verb');
return unless $verb = $verb->[0];
# Prepend namespace if not defined
if (index($verb->text, '/') == -1) {
my $nverb = __PACKAGE__->_namespace . lc $verb->text;
$verb->content($nverb);
return $nverb;
};
return $verb->text;
}
};
# Add or get ActivityStreams object
sub object {
shift->_target_object(object => @_ );
};
# Add or get ActivityStreams target
sub target {
shift->_target_object(target => @_ );
};
sub _target_object {
my $self = shift;
my $type = shift;
# Add target or object
if ($_[0]) {
my %params = @_;
my $obj = $self->set($type);
$obj->id( delete $params{id} ) if exists $params{id};
if (exists $params{'object-type'}) {
my $type = delete $params{'object-type'};
$obj->set('object-type', _check_prefix($type));
};
foreach (keys %params) {
$obj->add('-' . $_ => $params{$_});
};
return $obj;
}
# Get target or object
else {
my $obj = $self->at($type);
return unless $obj->[0];
my $object_type = $obj->children('object-type')->[0];
# Prepend namespace if not defined
if (index($object_type->text, '/') == -1) {
$object_type->content(
__PACKAGE__->_namespace . lc($object_type->text)
);
};
return $obj;
};
};
# Prefix relative object types and verbs with
# ActivityStreams namespace
sub _check_prefix {
if (index($_[0], '/') == -1) {
return __PACKAGE__->_namespace . lc $_[0];
};
return $_[0];
};
1;
__END__
=pod
=head1 NAME
XML::Loy::ActivityStreams - ActivityStreams Extension for Atom
=head1 SYNOPSIS
# Create new Atom object
my $atom = XML::Loy::Atom->new('feed');
# Extend with ActivityStreams
$atom->extension(-ActivityStreams);
# New atom entry
my $entry = $atom->entry(id => 'first_post');
for ($entry) {
# Define activity actor
$_->actor(name => 'Fry');
# Define activity verb
$_->verb('loves');
# Define activity object
$_->object(
'object-type' => 'person',
'name' => 'Leela'
)->title('Captain');
# Set related Atom information
$_->title(xhtml => 'Fry loves Leela');
$_->summary("Now it's official!");
$_->published(time);
};
# Retrive verb
print $entry->verb;
# Print ActivityStream as XML
print $atom->to_pretty_xml;
# <?xml version="1.0" encoding="UTF-8" standalone="yes"?>
# <feed xmlns="http://www.w3.org/2005/Atom"
# xmlns:activity="http://activitystrea.ms/schema/1.0/">
# <entry xml:id="first_post">
# <id>first_post</id>
# <author>
# <name>Fry</name>
# <activity:object-type>http://activitystrea.ms/schema/1.0/person</activity:object-type>
# </author>
# <activity:verb>http://activitystrea.ms/schema/1.0/loves</activity:verb>
# <activity:object>
# <activity:object-type>http://activitystrea.ms/schema/1.0/person</activity:object-type>
# <name>Leela</name>
# <title xml:space="preserve"
# xmlns="http://www.w3.org/2005/Atom">Captain</title>
# </activity:object>
# <title type="xhtml">
# <div xmlns="http://www.w3.org/1999/xhtml">Fry loves Leela</div>
# </title>
# <summary xml:space="preserve">Now it's official!</summary>
# <published>2013-03-08T14:01:14Z</published>
# </entry>
# </feed>
=head1 DESCRIPTION
L<XML::Loy::ActivityStreams> is an extension
to L<XML::Loy::Atom> and provides additional functionality
for the work with L<Atom ActivityStreams|http://activitystrea.ms/>.
B<This module is an early release! There may be significant changes in the future.>
=head1 METHODS
L<XML::Loy::ActivityStreams> inherits all methods
from L<XML::Loy> and implements the following new ones.
=head2 actor
my $person = $atom->new_person(
name => 'Bender',
uri => 'acct:bender@example.org'
);
my $actor = $atom->actor($person);
print $atom->actor->at('name')->text;
Sets the actor of the ActivityStreams object or returns it.
Accepts a person construct
(see L<new_person|XML::Loy::Atom/new_person>) or the
parameters accepted by
L<new_person|XML::Loy::Atom/new_person>.
=head2 verb
$atom->verb('follow');
print $atom->verb;
Sets the verb of the ActivityStreams object or returns it.
Accepts a verb string.
Relative verbs will be prefixed with the ActivityStreams
namespace.
=head2 object
$atom->object(
'object-type' => 'person',
'displayName' => 'Leela'
);
print $atom->object->at('object-type')->text;
Sets object information to the ActivityStreams object
or returns it.
Accepts a hash with various parameters
depending on the object's type. The object's type is
given by the C<object-type> parameter.
Relative object types will be prefixed with the ActivityStreams
namespace.
=head2 target
$atom->target(
'object-type' => 'robot',
'displayName' => 'Bender'
);
print $atom->target->at('object-type')->text;
Sets target information to the ActivityStreams object
or returns it.
Accepts a hash with various parameters
depending on the target's type. The target's type is
given by the C<object-type> parameter.
Relative object types will be prefixed with the ActivityStreams
namespace.
=head1 DEPENDENCIES
L<Mojolicious>.
=head1 LIMITATIONS
L<XML::Loy::ActivityStreams> has currently no support for
JSON serialization, neither on reading nor writing.
=head1 AVAILABILITY
https://github.com/Akron/XML-Loy
=head1 COPYRIGHT AND LICENSE
Copyright (C) 2011-2021, L<Nils Diewald|https://www.nils-diewald.de/>.
This program is free software, you can redistribute it
and/or modify it under the same terms as Perl.
=cut
| 21.284404 | 96 | 0.636351 |
ed5b2624f4e6d4413a2094a97cadb9a3f6558531 | 4,749 | pl | Perl | Lab_Code/Perl/cels2tab.pl | alexgraehl/timeforscience | 09609cd99c10f85165f12fc89ffd7e39288b9e8e | [
"MIT"
] | 6 | 2015-11-24T17:35:05.000Z | 2018-09-08T04:29:20.000Z | Lab_Code/Perl/cels2tab.pl | alexgraehl/timeforscience | 09609cd99c10f85165f12fc89ffd7e39288b9e8e | [
"MIT"
] | null | null | null | Lab_Code/Perl/cels2tab.pl | alexgraehl/timeforscience | 09609cd99c10f85165f12fc89ffd7e39288b9e8e | [
"MIT"
] | 1 | 2015-11-11T09:13:44.000Z | 2015-11-11T09:13:44.000Z | #!/usr/bin/env perl
##############################################################################
##############################################################################
##
## cels2tab.pl
##
##############################################################################
##############################################################################
##
## Written by Josh Stuart.
##
## Email address: jstuart@ucsc.edu
## Phone: (831) 459-1344
##
## Postal address: Department of Biomolecular Engineering
## Baskin Engineering 129
## University of California, Santa Cruz
## Santa Cruz, CA 95064
##
##############################################################################
use lib "$ENV{MYPERLDIR}/lib"; use lib "$ENV{TIME_FOR_SCIENCE_DIR}/Lab_Code/Perl"; require "libfile.pl";
use strict;
use warnings;
# Flush output to STDOUT immediately.
$| = 1;
my @flags = (
[ '-q', 'scalar', 0, 1]
, [ '-c', 'scalar', 0.5, undef]
, [ '-f', 'scalar', undef, undef]
, [ '-s', 'scalar', '', undef]
, [ '-p', 'scalar', '', undef]
, ['--file', 'list', [], undef]
);
my %args = %{&parseArgs(\@ARGV, \@flags)};
if(exists($args{'--help'}))
{
print STDOUT <DATA>;
exit(0);
}
my $verbose = not($args{'-q'});
my $coefvar_cutoff = $args{'-c'};
my $file_list = $args{'-f'};
my $suffix = $args{'-s'};
my $prefix = $args{'-p'};
my @files = @{$args{'--file'}};
my @names = ();
if(defined($file_list) and open(LIST, $file_list))
{
print STDERR "Reading list of files from '$file_list'.\n";
while(<LIST>)
{
chomp;
my ($file, $name) = split("\t");
push(@files, $file);
push(@names, $name);
}
close(LIST);
print STDERR "Done reading the list of files.\n";
}
for(my $i = 0; $i < scalar(@files); $i++)
{
if(not(defined($names[$i])))
{
$names[$i] = $files[$i];
}
}
my %spots;
my @matrix;
my @xys;
my $r = -1;
my @header = ('Spot');
for(my $i = 0; $i < scalar(@files); $i++)
{
my $file = $prefix . $files[$i] . $suffix;
if(open(FILE, $file))
{
push(@header, $names[$i]);
my $saw_header = 0;
my $done = 0;
print STDERR "Reading data from file '$file'.\n";
my $total_spots = 0;
my $good_spots = 0;
while(not($done))
{
my $line = <FILE>;
if($line =~ /^CellHeader=X/)
{
$saw_header = 1;
}
elsif($saw_header and $line =~ /^\s*$/)
{
$done = 1;
}
elsif($saw_header)
{
chomp($line);
$line =~ s/[ ]+//g;
my ($x,$y,$mu,$stdev,$pixels) = split("\t", $line);
my $spot = "$x,$y";
if(not(exists($spots{$spot})))
{
$r++;
$spots{$spot} = $r;
push(@xys, $spot);
}
my $row = $spots{$spot};
# If the coefficient of variation is too high,
# then mark the data as missing. If it's bigger
# than half of the mean, let's toss it.
my $coefvar = $stdev / $mu;
my $mu_print = '';
if($coefvar < $coefvar_cutoff)
{
$good_spots++;
$mu_print = "$mu";
}
push(@{$matrix[$row]}, $mu_print);
$total_spots++;
}
}
print STDERR "Done. $good_spots out of $total_spots good spots found.\n";
close(FILE);
}
else
{
print STDERR "Could not open file '$file', skipping.";
}
}
print STDERR "Printing out the data matrix.\n";
print join("\t", @header), "\n";
my $passify = 1000;
my $num_rows = scalar(@matrix);
for(my $i = 0; $i < $num_rows; $i++)
{
my $xy = $xys[$i];
my $tuple = $matrix[$i];
print STDOUT $xy, "\t", join("\t", @{$tuple}), "\n";
if($verbose and (($i+1) % $passify == 0))
{
my $perc_done = int(($i + 1) / $num_rows * 100.0);
print STDERR "$perc_done% done.\n";
}
}
exit(0);
__DATA__
syntax: cels2tab.pl [OPTIONS] FILE1 [FILE2 ...]
OPTIONS are:
-q: Quiet mode (default is verbose)
-c CUTOFF: Set the cutoff for the coefficient of variation.
Any spot with a variation greater than CUTOFF will
be set to missing (default is 0.5).
-f FILELIST: Contains a list of file names as the first column.
The script will then read the data from the files
specified in this file. The header used can come
from an optional second column otherwise the filename
itself is used as the header for the column.
-p PREFIX: Add a prefix to the file names listed (default is blank)
For example you can specify a directory like -p '../'.
-s SUFFIX: Add a suffix to the file names listed (default is blank)
| 22.295775 | 104 | 0.479259 |
ed335beb1b4bcbf8af0f779e1e75898c82c62069 | 10,225 | pl | Perl | src/perl/tag_data.pl | jonathancrabtree/ergatis | a587bfa0d30c58dec8855ba5ed45274e4f206ad7 | [
"Artistic-1.0"
] | null | null | null | src/perl/tag_data.pl | jonathancrabtree/ergatis | a587bfa0d30c58dec8855ba5ed45274e4f206ad7 | [
"Artistic-1.0"
] | null | null | null | src/perl/tag_data.pl | jonathancrabtree/ergatis | a587bfa0d30c58dec8855ba5ed45274e4f206ad7 | [
"Artistic-1.0"
] | null | null | null | #!/usr/bin/perl
=head1 NAME
transform_WWARN_input.pl - Transforms input data to WWARN to a common format.
=head1 SYNOPSIS
./tag_data.pl
--map_file=/path/to/map/file
--repository_root=/path/to/ergatis/repository/root
--pipeline_id=<ergatis pipeline ID>
--pipeline_name=<clovr pipeline name>
[--log=/path/to/log/file
--debug=<debug level>
--help]
=head1 PARAMETERS
B<--map_file, -i>
A tab delimited file containing the files to be tagged as well as the desired tag-name
for these set of files.
B<--repository_root, -r>
The repository where output files to be tagged reside. This value is replaced in the mapping
file when present
B<--pipeline_id, -p>
The pipeline ID whose files should be downloaded. This value is replaced in the mapping file
when present
B<--pipeline_name, -n>
The pipeline name (provided in the clovr wrapper config) that will be used to create a unique
tag name for output.
B<--log, -l>
Optional. Log file.
B<--debug, -d>
Optional. Debug level.
B<--help>
Prints this documentaiton.
=head1 DESCRIPTION
A wrapper script that facilitates the execution of the CloVR tagData.py script through ergatis.
This wrapper script is meant to allow for custom tagging of output data from a pipeline.
=head1 INPUT
Input is a tab delimited file containing all files to be tagged and the associated tag-name for
the files. Files can be a single file, directories, a list containing multiple files or a list of comma-separated
files.
#TAG_NAME\tFILE
test_tag\tfile1.txt,file2.txt,files.list,/usr/local/test_data/
=head OUTPUT
A file containing all tag names will be written for use by the accompanying download_tag component
=head1 CONTACT
Cesar Arze
carze@som.umaryland.edu
=cut
use strict;
#use warnings;
use Pod::Usage;
use Ergatis::Logger;
use File::OpenFile qw(open_file);
use File::Basename;
use Getopt::Long qw(:config no_ignore_case no_auto_abbrev pass_through);
## Need to setup the PYTHONPATH env variable here...
$ENV{'PYTHONPATH'} = "/opt/vappio-twisted:/opt/vappio-py:/opt/vappio-py:/opt/opt-packages/bioinf-v1r4b1//Denoiser/" .
":/opt/opt-packages/bioinf-v1r4b1//PyNAST/lib/:/opt/opt-packages/bioinf-v1r4b1//qiime/lib/" ;
#----------------------------------------------------------
# GLOBALS/COMMAND-LINE OPTIONS
#----------------------------------------------------------
my $logger;
my $TAG_DATA_EXEC = "/opt/vappio-py/vappio/cli/tagData.py";
my %options = parse_options();
my $input = $options{'map_file'};
my $repo_root = $options{'repository_root'};
my $pipeline_id = $options{'pipeline_id'};
my $pipeline_name = $options{'pipeline_name'};
my $flatten = $options{'flatten'};
my ($files_to_tag,$meta_data) = parse_mapping_file($input);
## Now that we have our files to tag we can go ahead with the tagging
foreach my $tag_name (keys %$files_to_tag) {
my @files = @{ $files_to_tag->{$tag_name} };
my $tag_base_dir = "$repo_root/output_repository/";
if($flatten) {
my $flat_files = &flatten_files($tag_name,\@files);
@files = @$flat_files;
$tag_base_dir = "/mnt/flat_tags/";
}
open FILE,"+>/tmp/tag$$.filelist";
print FILE join("\n", @files);
close FILE;
my $cmd = $TAG_DATA_EXEC;
$cmd .= " --stdin --tag-base-dir $tag_base_dir -o --recursive --tag-name " . $tag_name;
if($$meta_data{$tag_name}{'key_vals_exist'}) {
$cmd .= " -m " . join(" -m ", @{$$meta_data{$tag_name}{'key_vals'}});
}
$cmd = "cat /tmp/tag$$.filelist | $cmd";
run_system_cmd($cmd);
}
###############################################################################
##### SUBROUTINES #####
###############################################################################
#----------------------------------------------------------
# parse input mapping file and return an array
# containing hash containing all files and the associated
# tag-name.
#----------------------------------------------------------
sub parse_mapping_file {
my $map_file = shift;
my $tag_files = ();
my $meta_data; # a ref to hash; key => tag_name
# value is an array of key:val pairs for that tag
my $map_fh = open_file($map_file, "in");
while (my $line = <$map_fh>) {
next if ($line =~ /^#/);
chomp($line);
next if($line =~ /^$/);
my @files = ();
my ($tag_name, $files_list, $key_vals) = split(/\t/, $line);
print "DEBUG: $tag_name\t$files_list". ($key_vals ? "\t$key_vals\n" : "\n");
## Currently tagData will break if any spaces are in the tag name
## so we need to replace spaces with underscores.
$tag_name =~ s/\s+/_/;
## Pipeline name will also be attached to the tag name to ensure
## our tag names are unique
$tag_name = $pipeline_name . "_" . $tag_name;
my @file_tokens = split(/[,\s]+/, $files_list);
foreach my $file_token (@file_tokens) {
_verify_file($file_token, \@files);
}
push ( @{ $tag_files->{$tag_name} }, @files);
## push key vals into array and hold the ref of that array as a value of key tag_name
if($key_vals) {
$$meta_data{$tag_name}{'key_vals_exist'} = 1;
push @{$$meta_data{$tag_name}{'key_vals'}}, split(/[,\s]+/, $key_vals);
} else {
$$meta_data{$tag_name}{'key_vals_exist'} = 0;
}
}
return ($tag_files, $meta_data);
}
sub flatten_files {
my ($tag_name,$files) = @_;
&run_system_cmd("mkdir -p /mnt/flat_tags/$tag_name");
my $file_counter = {};
my $new_files = [];
map {
# Make sure there are no duplicate files.
my($file) = fileparse($_);
if(-e "/mnt/flat_tags/$tag_name/$file") {
$file_counter->{$file}++;
$file = "$file_counter->{$file}_$file";
}
&run_system_cmd("ln -f -s $_ /mnt/flat_tags/$tag_name/$file");
print STDERR "Adding /mnt/flat_tags/$tag_name/$file to tag $tag_name\n";
push(@$new_files,"/mnt/flat_tags/$tag_name/$file");
}@$files;
return $new_files;
}
#----------------------------------------------------------
# verify whether a file exists, is readable and if it is a
# directory; if the file is a list then the list of files
# will be iterated over and verified as well
#----------------------------------------------------------
sub _verify_file {
my ($file, $files_ref) = @_;
my $ret_file;
## If this is being run in conjunction with an ergatis pipeline
## we need to account for files having $;REPOSITORY_ROOT$; and
## $;PIPELINEID$; in them.
$file =~ s/\$\;REPO_ROOT\$\;/$repo_root/;
$file =~ s/\$\;PIPELINE_ID\$\;/$pipeline_id/;
############## MAHESH VANGALA ###########
# For some pipelines the files are writtend and then gzipped
######################################################
if(-e $file.'.gz') {
$file .= '.gz';
}
## First check if our file is a directory
if ( -e $file) {
## We are dealing with either a single file or a list if
## the "file" is not a directory
unless (-d $file) {
my $fh = open_file($file, "in");
chomp( my $line_peek = <$fh> );
## Now check if our first line of this file exists, if it does most
## likely we have a list of files here
if (file_exists($line_peek)) {
seek ($fh, 0, 0);
chomp( my @files = <$fh> );
foreach my $list_file (@files) {
_verify_file($list_file, $files_ref);
}
} else {
push(@$files_ref, $file);
}
close ($fh);
} else {
push(@$files_ref, $file);
}
} else {
$logger->logdie("File $file does not exist.");
}
}
#----------------------------------------------------------
# function for robust examination of file existence
# return 1 if exists, 0 if not.
#----------------------------------------------------------
sub file_exists
{
my ($lp) = @_;
my $ck = 0;
if (-e $lp){
$ck = 1; # make sure it can be opened
open LP, "$lp" or return 0;
close LP;
}
return $ck;
}
#----------------------------------------------------------
# run unix system command and determine whether or not
# the command executed successfully
#----------------------------------------------------------
sub run_system_cmd {
my $cmd = shift;
system($cmd);
my $success = $? >> 8;
unless ($success == 0) {
$logger->logdie("Command \"$cmd\" failed.");
}
}
#----------------------------------------------------------
# parse command-line options
#----------------------------------------------------------
sub parse_options {
my %opts = ();
GetOptions(\%opts,
'map_file|i=s',
'repository_root|r=s',
'pipeline_id|p=s',
'pipeline_name|n=s',
'log|l:s',
'debug|d:s',
'flatten|f:s',
'help') || pod2usage();
&pod2usage( {-exitval => 1, -verbose => 1, -output => \*STDOUT}) if ($opts{'help'} );
## Configure logger
my $logfile = $opts{'log'} || Ergatis::Logger::get_default_logfilename();
$logger = new Ergatis::Logger( 'LOG_FILE' => $opts{'log'},
'LOG_LEVEL' => $opts{'debug'} );
$logger = Ergatis::Logger::get_logger();
## Make sure our parameter are declared correctly
defined ($opts{'map_file'}) || $logger->logdie('Please specify a valid input map file');
defined ($opts{'repository_root'}) || $logger->logdie('Path to the repository root must be specified');
defined ($opts{'pipeline_id'}) || $logger->logdie('A valid ergatis pipeline ID must be specified');
defined ($opts{'pipeline_name'}) || $logger->logdie('Please provide a valid clovr pipeline name');
return %opts;
}
| 33.745875 | 117 | 0.537311 |
ed984d10f3f2474764166aeb6ee42a69874fe269 | 1,552 | t | Perl | t/controller/changes.t | mephinet/metacpan-web | 348c9f3804370e30f4f997351353fed93c378435 | [
"Artistic-1.0"
] | null | null | null | t/controller/changes.t | mephinet/metacpan-web | 348c9f3804370e30f4f997351353fed93c378435 | [
"Artistic-1.0"
] | null | null | null | t/controller/changes.t | mephinet/metacpan-web | 348c9f3804370e30f4f997351353fed93c378435 | [
"Artistic-1.0"
] | null | null | null | use strict;
use warnings;
use Test::More;
use MetaCPAN::Web::Test;
test_psgi app, sub {
my $cb = shift;
{
ok(
my $res = $cb->(
GET '/changes/release/RWSTAUNER/File-Spec-Native-1.003'
),
'GET /changes/release/...'
);
is( $res->code, 200, 'code 200' );
my $tx = tx( $res, { css => 1 } );
$tx->like(
'div.content pre#source',
qr/^Revision history for File-Spec-Native/,
'source view for plain text change log'
);
}
{
ok( my $res = $cb->( GET '/changes/distribution/perl' ),
'GET /changes/distribution/perl' );
is( $res->code, 200, 'code 200' );
my $tx = tx($res);
$tx->like(
'//title',
qr/^perldelta - /,
'got perldelta for perl release'
);
}
{
my $missing = 'test-dist-name-that-does-not-exist-i-hope';
ok( my $res = $cb->( GET "/changes/distribution/$missing" ),
"GET /changes/$missing" );
is( $res->code, 404, 'code 404' );
my $tx = tx($res);
$tx->like(
'//div[@id="not-found"]',
qr/Change log not found for release.+Try the release info page:/,
'Suggest release info page for not-found dist.'
);
$tx->like(
qq{//div[\@id="not-found"]//p[\@class="suggestion"]//a[text()="$missing"]//\@href},
qr{/$missing$}, 'link to suggested release',
);
}
};
done_testing;
| 27.714286 | 95 | 0.469716 |
eda259f6bd8329e9c1cce4c1889262a2dfe35640 | 38,286 | pm | Perl | java_class/src/perl/JavaClass.pm | kaitai-io/formats-kaitai-io.github.io | 2700514a2a8f67c5351fe93962c70abea02fd3d3 | [
"0BSD"
] | 4 | 2018-12-10T09:21:19.000Z | 2021-11-03T16:43:22.000Z | java_class/src/perl/JavaClass.pm | kaitai-io/formats-kaitai-io.github.io | 2700514a2a8f67c5351fe93962c70abea02fd3d3 | [
"0BSD"
] | null | null | null | java_class/src/perl/JavaClass.pm | kaitai-io/formats-kaitai-io.github.io | 2700514a2a8f67c5351fe93962c70abea02fd3d3 | [
"0BSD"
] | 3 | 2019-04-08T08:22:22.000Z | 2021-10-10T19:11:51.000Z | # This is a generated file! Please edit source .ksy file and use kaitai-struct-compiler to rebuild
use strict;
use warnings;
use IO::KaitaiStruct 0.009_000;
use Encode;
########################################################################
package JavaClass;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{magic} = $self->{_io}->read_bytes(4);
$self->{version_minor} = $self->{_io}->read_u2be();
$self->{version_major} = $self->{_io}->read_u2be();
$self->{constant_pool_count} = $self->{_io}->read_u2be();
$self->{constant_pool} = ();
my $n_constant_pool = ($self->constant_pool_count() - 1);
for (my $i = 0; $i < $n_constant_pool; $i++) {
$self->{constant_pool}[$i] = JavaClass::ConstantPoolEntry->new($self->{_io}, $self, $self->{_root});
}
$self->{access_flags} = $self->{_io}->read_u2be();
$self->{this_class} = $self->{_io}->read_u2be();
$self->{super_class} = $self->{_io}->read_u2be();
$self->{interfaces_count} = $self->{_io}->read_u2be();
$self->{interfaces} = ();
my $n_interfaces = $self->interfaces_count();
for (my $i = 0; $i < $n_interfaces; $i++) {
$self->{interfaces}[$i] = $self->{_io}->read_u2be();
}
$self->{fields_count} = $self->{_io}->read_u2be();
$self->{fields} = ();
my $n_fields = $self->fields_count();
for (my $i = 0; $i < $n_fields; $i++) {
$self->{fields}[$i] = JavaClass::FieldInfo->new($self->{_io}, $self, $self->{_root});
}
$self->{methods_count} = $self->{_io}->read_u2be();
$self->{methods} = ();
my $n_methods = $self->methods_count();
for (my $i = 0; $i < $n_methods; $i++) {
$self->{methods}[$i] = JavaClass::MethodInfo->new($self->{_io}, $self, $self->{_root});
}
$self->{attributes_count} = $self->{_io}->read_u2be();
$self->{attributes} = ();
my $n_attributes = $self->attributes_count();
for (my $i = 0; $i < $n_attributes; $i++) {
$self->{attributes}[$i] = JavaClass::AttributeInfo->new($self->{_io}, $self, $self->{_root});
}
}
sub magic {
my ($self) = @_;
return $self->{magic};
}
sub version_minor {
my ($self) = @_;
return $self->{version_minor};
}
sub version_major {
my ($self) = @_;
return $self->{version_major};
}
sub constant_pool_count {
my ($self) = @_;
return $self->{constant_pool_count};
}
sub constant_pool {
my ($self) = @_;
return $self->{constant_pool};
}
sub access_flags {
my ($self) = @_;
return $self->{access_flags};
}
sub this_class {
my ($self) = @_;
return $self->{this_class};
}
sub super_class {
my ($self) = @_;
return $self->{super_class};
}
sub interfaces_count {
my ($self) = @_;
return $self->{interfaces_count};
}
sub interfaces {
my ($self) = @_;
return $self->{interfaces};
}
sub fields_count {
my ($self) = @_;
return $self->{fields_count};
}
sub fields {
my ($self) = @_;
return $self->{fields};
}
sub methods_count {
my ($self) = @_;
return $self->{methods_count};
}
sub methods {
my ($self) = @_;
return $self->{methods};
}
sub attributes_count {
my ($self) = @_;
return $self->{attributes_count};
}
sub attributes {
my ($self) = @_;
return $self->{attributes};
}
########################################################################
package JavaClass::FloatCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{value} = $self->{_io}->read_f4be();
}
sub value {
my ($self) = @_;
return $self->{value};
}
########################################################################
package JavaClass::AttributeInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{name_index} = $self->{_io}->read_u2be();
$self->{attribute_length} = $self->{_io}->read_u4be();
my $_on = $self->name_as_str();
if ($_on eq "SourceFile") {
$self->{_raw_info} = $self->{_io}->read_bytes($self->attribute_length());
my $io__raw_info = IO::KaitaiStruct::Stream->new($self->{_raw_info});
$self->{info} = JavaClass::AttributeInfo::AttrBodySourceFile->new($io__raw_info, $self, $self->{_root});
}
elsif ($_on eq "LineNumberTable") {
$self->{_raw_info} = $self->{_io}->read_bytes($self->attribute_length());
my $io__raw_info = IO::KaitaiStruct::Stream->new($self->{_raw_info});
$self->{info} = JavaClass::AttributeInfo::AttrBodyLineNumberTable->new($io__raw_info, $self, $self->{_root});
}
elsif ($_on eq "Exceptions") {
$self->{_raw_info} = $self->{_io}->read_bytes($self->attribute_length());
my $io__raw_info = IO::KaitaiStruct::Stream->new($self->{_raw_info});
$self->{info} = JavaClass::AttributeInfo::AttrBodyExceptions->new($io__raw_info, $self, $self->{_root});
}
elsif ($_on eq "Code") {
$self->{_raw_info} = $self->{_io}->read_bytes($self->attribute_length());
my $io__raw_info = IO::KaitaiStruct::Stream->new($self->{_raw_info});
$self->{info} = JavaClass::AttributeInfo::AttrBodyCode->new($io__raw_info, $self, $self->{_root});
}
else {
$self->{info} = $self->{_io}->read_bytes($self->attribute_length());
}
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = @{$self->_root()->constant_pool()}[($self->name_index() - 1)]->cp_info()->value();
return $self->{name_as_str};
}
sub name_index {
my ($self) = @_;
return $self->{name_index};
}
sub attribute_length {
my ($self) = @_;
return $self->{attribute_length};
}
sub info {
my ($self) = @_;
return $self->{info};
}
sub _raw_info {
my ($self) = @_;
return $self->{_raw_info};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyCode;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{max_stack} = $self->{_io}->read_u2be();
$self->{max_locals} = $self->{_io}->read_u2be();
$self->{code_length} = $self->{_io}->read_u4be();
$self->{code} = $self->{_io}->read_bytes($self->code_length());
$self->{exception_table_length} = $self->{_io}->read_u2be();
$self->{exception_table} = ();
my $n_exception_table = $self->exception_table_length();
for (my $i = 0; $i < $n_exception_table; $i++) {
$self->{exception_table}[$i] = JavaClass::AttributeInfo::AttrBodyCode::ExceptionEntry->new($self->{_io}, $self, $self->{_root});
}
$self->{attributes_count} = $self->{_io}->read_u2be();
$self->{attributes} = ();
my $n_attributes = $self->attributes_count();
for (my $i = 0; $i < $n_attributes; $i++) {
$self->{attributes}[$i] = JavaClass::AttributeInfo->new($self->{_io}, $self, $self->{_root});
}
}
sub max_stack {
my ($self) = @_;
return $self->{max_stack};
}
sub max_locals {
my ($self) = @_;
return $self->{max_locals};
}
sub code_length {
my ($self) = @_;
return $self->{code_length};
}
sub code {
my ($self) = @_;
return $self->{code};
}
sub exception_table_length {
my ($self) = @_;
return $self->{exception_table_length};
}
sub exception_table {
my ($self) = @_;
return $self->{exception_table};
}
sub attributes_count {
my ($self) = @_;
return $self->{attributes_count};
}
sub attributes {
my ($self) = @_;
return $self->{attributes};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyCode::ExceptionEntry;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{start_pc} = $self->{_io}->read_u2be();
$self->{end_pc} = $self->{_io}->read_u2be();
$self->{handler_pc} = $self->{_io}->read_u2be();
$self->{catch_type} = $self->{_io}->read_u2be();
}
sub catch_exception {
my ($self) = @_;
return $self->{catch_exception} if ($self->{catch_exception});
if ($self->catch_type() != 0) {
$self->{catch_exception} = @{$self->_root()->constant_pool()}[($self->catch_type() - 1)];
}
return $self->{catch_exception};
}
sub start_pc {
my ($self) = @_;
return $self->{start_pc};
}
sub end_pc {
my ($self) = @_;
return $self->{end_pc};
}
sub handler_pc {
my ($self) = @_;
return $self->{handler_pc};
}
sub catch_type {
my ($self) = @_;
return $self->{catch_type};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyExceptions;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{number_of_exceptions} = $self->{_io}->read_u2be();
$self->{exceptions} = ();
my $n_exceptions = $self->number_of_exceptions();
for (my $i = 0; $i < $n_exceptions; $i++) {
$self->{exceptions}[$i] = JavaClass::AttributeInfo::AttrBodyExceptions::ExceptionTableEntry->new($self->{_io}, $self, $self->{_root});
}
}
sub number_of_exceptions {
my ($self) = @_;
return $self->{number_of_exceptions};
}
sub exceptions {
my ($self) = @_;
return $self->{exceptions};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyExceptions::ExceptionTableEntry;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{index} = $self->{_io}->read_u2be();
}
sub as_info {
my ($self) = @_;
return $self->{as_info} if ($self->{as_info});
$self->{as_info} = @{$self->_root()->constant_pool()}[($self->index() - 1)]->cp_info();
return $self->{as_info};
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = $self->as_info()->name_as_str();
return $self->{name_as_str};
}
sub index {
my ($self) = @_;
return $self->{index};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodySourceFile;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{sourcefile_index} = $self->{_io}->read_u2be();
}
sub sourcefile_as_str {
my ($self) = @_;
return $self->{sourcefile_as_str} if ($self->{sourcefile_as_str});
$self->{sourcefile_as_str} = @{$self->_root()->constant_pool()}[($self->sourcefile_index() - 1)]->cp_info()->value();
return $self->{sourcefile_as_str};
}
sub sourcefile_index {
my ($self) = @_;
return $self->{sourcefile_index};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyLineNumberTable;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{line_number_table_length} = $self->{_io}->read_u2be();
$self->{line_number_table} = ();
my $n_line_number_table = $self->line_number_table_length();
for (my $i = 0; $i < $n_line_number_table; $i++) {
$self->{line_number_table}[$i] = JavaClass::AttributeInfo::AttrBodyLineNumberTable::LineNumberTableEntry->new($self->{_io}, $self, $self->{_root});
}
}
sub line_number_table_length {
my ($self) = @_;
return $self->{line_number_table_length};
}
sub line_number_table {
my ($self) = @_;
return $self->{line_number_table};
}
########################################################################
package JavaClass::AttributeInfo::AttrBodyLineNumberTable::LineNumberTableEntry;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{start_pc} = $self->{_io}->read_u2be();
$self->{line_number} = $self->{_io}->read_u2be();
}
sub start_pc {
my ($self) = @_;
return $self->{start_pc};
}
sub line_number {
my ($self) = @_;
return $self->{line_number};
}
########################################################################
package JavaClass::MethodRefCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{class_index} = $self->{_io}->read_u2be();
$self->{name_and_type_index} = $self->{_io}->read_u2be();
}
sub class_as_info {
my ($self) = @_;
return $self->{class_as_info} if ($self->{class_as_info});
$self->{class_as_info} = @{$self->_root()->constant_pool()}[($self->class_index() - 1)]->cp_info();
return $self->{class_as_info};
}
sub name_and_type_as_info {
my ($self) = @_;
return $self->{name_and_type_as_info} if ($self->{name_and_type_as_info});
$self->{name_and_type_as_info} = @{$self->_root()->constant_pool()}[($self->name_and_type_index() - 1)]->cp_info();
return $self->{name_and_type_as_info};
}
sub class_index {
my ($self) = @_;
return $self->{class_index};
}
sub name_and_type_index {
my ($self) = @_;
return $self->{name_and_type_index};
}
########################################################################
package JavaClass::FieldInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{access_flags} = $self->{_io}->read_u2be();
$self->{name_index} = $self->{_io}->read_u2be();
$self->{descriptor_index} = $self->{_io}->read_u2be();
$self->{attributes_count} = $self->{_io}->read_u2be();
$self->{attributes} = ();
my $n_attributes = $self->attributes_count();
for (my $i = 0; $i < $n_attributes; $i++) {
$self->{attributes}[$i] = JavaClass::AttributeInfo->new($self->{_io}, $self, $self->{_root});
}
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = @{$self->_root()->constant_pool()}[($self->name_index() - 1)]->cp_info()->value();
return $self->{name_as_str};
}
sub access_flags {
my ($self) = @_;
return $self->{access_flags};
}
sub name_index {
my ($self) = @_;
return $self->{name_index};
}
sub descriptor_index {
my ($self) = @_;
return $self->{descriptor_index};
}
sub attributes_count {
my ($self) = @_;
return $self->{attributes_count};
}
sub attributes {
my ($self) = @_;
return $self->{attributes};
}
########################################################################
package JavaClass::DoubleCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{value} = $self->{_io}->read_f8be();
}
sub value {
my ($self) = @_;
return $self->{value};
}
########################################################################
package JavaClass::LongCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{value} = $self->{_io}->read_u8be();
}
sub value {
my ($self) = @_;
return $self->{value};
}
########################################################################
package JavaClass::InvokeDynamicCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{bootstrap_method_attr_index} = $self->{_io}->read_u2be();
$self->{name_and_type_index} = $self->{_io}->read_u2be();
}
sub bootstrap_method_attr_index {
my ($self) = @_;
return $self->{bootstrap_method_attr_index};
}
sub name_and_type_index {
my ($self) = @_;
return $self->{name_and_type_index};
}
########################################################################
package JavaClass::MethodHandleCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
our $REFERENCE_KIND_ENUM_GET_FIELD = 1;
our $REFERENCE_KIND_ENUM_GET_STATIC = 2;
our $REFERENCE_KIND_ENUM_PUT_FIELD = 3;
our $REFERENCE_KIND_ENUM_PUT_STATIC = 4;
our $REFERENCE_KIND_ENUM_INVOKE_VIRTUAL = 5;
our $REFERENCE_KIND_ENUM_INVOKE_STATIC = 6;
our $REFERENCE_KIND_ENUM_INVOKE_SPECIAL = 7;
our $REFERENCE_KIND_ENUM_NEW_INVOKE_SPECIAL = 8;
our $REFERENCE_KIND_ENUM_INVOKE_INTERFACE = 9;
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{reference_kind} = $self->{_io}->read_u1();
$self->{reference_index} = $self->{_io}->read_u2be();
}
sub reference_kind {
my ($self) = @_;
return $self->{reference_kind};
}
sub reference_index {
my ($self) = @_;
return $self->{reference_index};
}
########################################################################
package JavaClass::NameAndTypeCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{name_index} = $self->{_io}->read_u2be();
$self->{descriptor_index} = $self->{_io}->read_u2be();
}
sub name_as_info {
my ($self) = @_;
return $self->{name_as_info} if ($self->{name_as_info});
$self->{name_as_info} = @{$self->_root()->constant_pool()}[($self->name_index() - 1)]->cp_info();
return $self->{name_as_info};
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = $self->name_as_info()->value();
return $self->{name_as_str};
}
sub descriptor_as_info {
my ($self) = @_;
return $self->{descriptor_as_info} if ($self->{descriptor_as_info});
$self->{descriptor_as_info} = @{$self->_root()->constant_pool()}[($self->descriptor_index() - 1)]->cp_info();
return $self->{descriptor_as_info};
}
sub descriptor_as_str {
my ($self) = @_;
return $self->{descriptor_as_str} if ($self->{descriptor_as_str});
$self->{descriptor_as_str} = $self->descriptor_as_info()->value();
return $self->{descriptor_as_str};
}
sub name_index {
my ($self) = @_;
return $self->{name_index};
}
sub descriptor_index {
my ($self) = @_;
return $self->{descriptor_index};
}
########################################################################
package JavaClass::Utf8CpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{str_len} = $self->{_io}->read_u2be();
$self->{value} = Encode::decode("UTF-8", $self->{_io}->read_bytes($self->str_len()));
}
sub str_len {
my ($self) = @_;
return $self->{str_len};
}
sub value {
my ($self) = @_;
return $self->{value};
}
########################################################################
package JavaClass::StringCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{string_index} = $self->{_io}->read_u2be();
}
sub string_index {
my ($self) = @_;
return $self->{string_index};
}
########################################################################
package JavaClass::MethodTypeCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{descriptor_index} = $self->{_io}->read_u2be();
}
sub descriptor_index {
my ($self) = @_;
return $self->{descriptor_index};
}
########################################################################
package JavaClass::InterfaceMethodRefCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{class_index} = $self->{_io}->read_u2be();
$self->{name_and_type_index} = $self->{_io}->read_u2be();
}
sub class_as_info {
my ($self) = @_;
return $self->{class_as_info} if ($self->{class_as_info});
$self->{class_as_info} = @{$self->_root()->constant_pool()}[($self->class_index() - 1)]->cp_info();
return $self->{class_as_info};
}
sub name_and_type_as_info {
my ($self) = @_;
return $self->{name_and_type_as_info} if ($self->{name_and_type_as_info});
$self->{name_and_type_as_info} = @{$self->_root()->constant_pool()}[($self->name_and_type_index() - 1)]->cp_info();
return $self->{name_and_type_as_info};
}
sub class_index {
my ($self) = @_;
return $self->{class_index};
}
sub name_and_type_index {
my ($self) = @_;
return $self->{name_and_type_index};
}
########################################################################
package JavaClass::ClassCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{name_index} = $self->{_io}->read_u2be();
}
sub name_as_info {
my ($self) = @_;
return $self->{name_as_info} if ($self->{name_as_info});
$self->{name_as_info} = @{$self->_root()->constant_pool()}[($self->name_index() - 1)]->cp_info();
return $self->{name_as_info};
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = $self->name_as_info()->value();
return $self->{name_as_str};
}
sub name_index {
my ($self) = @_;
return $self->{name_index};
}
########################################################################
package JavaClass::ConstantPoolEntry;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
our $TAG_ENUM_UTF8 = 1;
our $TAG_ENUM_INTEGER = 3;
our $TAG_ENUM_FLOAT = 4;
our $TAG_ENUM_LONG = 5;
our $TAG_ENUM_DOUBLE = 6;
our $TAG_ENUM_CLASS_TYPE = 7;
our $TAG_ENUM_STRING = 8;
our $TAG_ENUM_FIELD_REF = 9;
our $TAG_ENUM_METHOD_REF = 10;
our $TAG_ENUM_INTERFACE_METHOD_REF = 11;
our $TAG_ENUM_NAME_AND_TYPE = 12;
our $TAG_ENUM_METHOD_HANDLE = 15;
our $TAG_ENUM_METHOD_TYPE = 16;
our $TAG_ENUM_INVOKE_DYNAMIC = 18;
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
if (!($self->is_prev_two_entries())) {
$self->{tag} = $self->{_io}->read_u1();
}
if (!($self->is_prev_two_entries())) {
my $_on = $self->tag();
if ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_INTERFACE_METHOD_REF) {
$self->{cp_info} = JavaClass::InterfaceMethodRefCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_CLASS_TYPE) {
$self->{cp_info} = JavaClass::ClassCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_UTF8) {
$self->{cp_info} = JavaClass::Utf8CpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_METHOD_TYPE) {
$self->{cp_info} = JavaClass::MethodTypeCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_INTEGER) {
$self->{cp_info} = JavaClass::IntegerCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_STRING) {
$self->{cp_info} = JavaClass::StringCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_FLOAT) {
$self->{cp_info} = JavaClass::FloatCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_LONG) {
$self->{cp_info} = JavaClass::LongCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_METHOD_REF) {
$self->{cp_info} = JavaClass::MethodRefCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_DOUBLE) {
$self->{cp_info} = JavaClass::DoubleCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_INVOKE_DYNAMIC) {
$self->{cp_info} = JavaClass::InvokeDynamicCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_FIELD_REF) {
$self->{cp_info} = JavaClass::FieldRefCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_METHOD_HANDLE) {
$self->{cp_info} = JavaClass::MethodHandleCpInfo->new($self->{_io}, $self, $self->{_root});
}
elsif ($_on == $JavaClass::ConstantPoolEntry::TAG_ENUM_NAME_AND_TYPE) {
$self->{cp_info} = JavaClass::NameAndTypeCpInfo->new($self->{_io}, $self, $self->{_root});
}
}
}
sub is_two_entries {
my ($self) = @_;
return $self->{is_two_entries} if ($self->{is_two_entries});
$self->{is_two_entries} = (($self->tag() == $JavaClass::ConstantPoolEntry::TAG_ENUM_LONG) || ($self->tag() == $JavaClass::ConstantPoolEntry::TAG_ENUM_DOUBLE)) ;
return $self->{is_two_entries};
}
sub tag {
my ($self) = @_;
return $self->{tag};
}
sub cp_info {
my ($self) = @_;
return $self->{cp_info};
}
sub is_prev_two_entries {
my ($self) = @_;
return $self->{is_prev_two_entries};
}
########################################################################
package JavaClass::MethodInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{access_flags} = $self->{_io}->read_u2be();
$self->{name_index} = $self->{_io}->read_u2be();
$self->{descriptor_index} = $self->{_io}->read_u2be();
$self->{attributes_count} = $self->{_io}->read_u2be();
$self->{attributes} = ();
my $n_attributes = $self->attributes_count();
for (my $i = 0; $i < $n_attributes; $i++) {
$self->{attributes}[$i] = JavaClass::AttributeInfo->new($self->{_io}, $self, $self->{_root});
}
}
sub name_as_str {
my ($self) = @_;
return $self->{name_as_str} if ($self->{name_as_str});
$self->{name_as_str} = @{$self->_root()->constant_pool()}[($self->name_index() - 1)]->cp_info()->value();
return $self->{name_as_str};
}
sub access_flags {
my ($self) = @_;
return $self->{access_flags};
}
sub name_index {
my ($self) = @_;
return $self->{name_index};
}
sub descriptor_index {
my ($self) = @_;
return $self->{descriptor_index};
}
sub attributes_count {
my ($self) = @_;
return $self->{attributes_count};
}
sub attributes {
my ($self) = @_;
return $self->{attributes};
}
########################################################################
package JavaClass::IntegerCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{value} = $self->{_io}->read_u4be();
}
sub value {
my ($self) = @_;
return $self->{value};
}
########################################################################
package JavaClass::FieldRefCpInfo;
our @ISA = 'IO::KaitaiStruct::Struct';
sub from_file {
my ($class, $filename) = @_;
my $fd;
open($fd, '<', $filename) or return undef;
binmode($fd);
return new($class, IO::KaitaiStruct::Stream->new($fd));
}
sub new {
my ($class, $_io, $_parent, $_root) = @_;
my $self = IO::KaitaiStruct::Struct->new($_io);
bless $self, $class;
$self->{_parent} = $_parent;
$self->{_root} = $_root || $self;;
$self->_read();
return $self;
}
sub _read {
my ($self) = @_;
$self->{class_index} = $self->{_io}->read_u2be();
$self->{name_and_type_index} = $self->{_io}->read_u2be();
}
sub class_as_info {
my ($self) = @_;
return $self->{class_as_info} if ($self->{class_as_info});
$self->{class_as_info} = @{$self->_root()->constant_pool()}[($self->class_index() - 1)]->cp_info();
return $self->{class_as_info};
}
sub name_and_type_as_info {
my ($self) = @_;
return $self->{name_and_type_as_info} if ($self->{name_and_type_as_info});
$self->{name_and_type_as_info} = @{$self->_root()->constant_pool()}[($self->name_and_type_index() - 1)]->cp_info();
return $self->{name_and_type_as_info};
}
sub class_index {
my ($self) = @_;
return $self->{class_index};
}
sub name_and_type_index {
my ($self) = @_;
return $self->{name_and_type_index};
}
1;
| 24.495202 | 165 | 0.554824 |
ed91576e711c35eb4e99047a702b1d8cfc09880c | 2,579 | pm | Perl | auto-lib/Paws/ApiGateway/DeleteMethodResponse.pm | agimenez/aws-sdk-perl | 9c4dff7d1af2ff0210c28ca44fb9e92bc625712b | [
"Apache-2.0"
] | null | null | null | auto-lib/Paws/ApiGateway/DeleteMethodResponse.pm | agimenez/aws-sdk-perl | 9c4dff7d1af2ff0210c28ca44fb9e92bc625712b | [
"Apache-2.0"
] | null | null | null | auto-lib/Paws/ApiGateway/DeleteMethodResponse.pm | agimenez/aws-sdk-perl | 9c4dff7d1af2ff0210c28ca44fb9e92bc625712b | [
"Apache-2.0"
] | null | null | null |
package Paws::ApiGateway::DeleteMethodResponse;
use Moose;
has HttpMethod => (is => 'ro', isa => 'Str', traits => ['ParamInURI'], uri_name => 'httpMethod' , required => 1);
has ResourceId => (is => 'ro', isa => 'Str', traits => ['ParamInURI'], uri_name => 'resourceId' , required => 1);
has RestApiId => (is => 'ro', isa => 'Str', traits => ['ParamInURI'], uri_name => 'restApiId' , required => 1);
has StatusCode => (is => 'ro', isa => 'Str', traits => ['ParamInURI'], uri_name => 'statusCode' , required => 1);
use MooseX::ClassAttribute;
class_has _api_call => (isa => 'Str', is => 'ro', default => 'DeleteMethodResponse');
class_has _api_uri => (isa => 'Str', is => 'ro', default => '/restapis/{restapi_id}/resources/{resource_id}/methods/{http_method}/responses/{status_code}');
class_has _api_method => (isa => 'Str', is => 'ro', default => 'DELETE');
class_has _returns => (isa => 'Str', is => 'ro', default => 'Paws::API::Response');
class_has _result_key => (isa => 'Str', is => 'ro');
1;
### main pod documentation begin ###
=head1 NAME
Paws::ApiGateway::DeleteMethodResponse - Arguments for method DeleteMethodResponse on Paws::ApiGateway
=head1 DESCRIPTION
This class represents the parameters used for calling the method DeleteMethodResponse on the
Amazon API Gateway service. Use the attributes of this class
as arguments to method DeleteMethodResponse.
You shouldn't make instances of this class. Each attribute should be used as a named argument in the call to DeleteMethodResponse.
As an example:
$service_obj->DeleteMethodResponse(Att1 => $value1, Att2 => $value2, ...);
Values for attributes that are native types (Int, String, Float, etc) can passed as-is (scalar values). Values for complex Types (objects) can be passed as a HashRef. The keys and values of the hashref will be used to instance the underlying object.
=head1 ATTRIBUTES
=head2 B<REQUIRED> HttpMethod => Str
The HTTP verb of the Method resource.
=head2 B<REQUIRED> ResourceId => Str
The Resource identifier for the MethodResponse resource.
=head2 B<REQUIRED> RestApiId => Str
The RestApi identifier for the MethodResponse resource.
=head2 B<REQUIRED> StatusCode => Str
The status code identifier for the MethodResponse resource.
=head1 SEE ALSO
This class forms part of L<Paws>, documenting arguments for method DeleteMethodResponse in L<Paws::ApiGateway>
=head1 BUGS and CONTRIBUTIONS
The source code is located here: https://github.com/pplu/aws-sdk-perl
Please report bugs to: https://github.com/pplu/aws-sdk-perl/issues
=cut
| 33.064103 | 249 | 0.709577 |
eda2e0b70b75cef87845b595dee579700c66aa4c | 4,575 | pm | Perl | centreon/common/powershell/exchange/2010/imapmailbox.pm | garnier-quentin/centreon-plugins | 51c16b4419d640709d3352a260e4cd63cd96db14 | [
"Apache-2.0"
] | null | null | null | centreon/common/powershell/exchange/2010/imapmailbox.pm | garnier-quentin/centreon-plugins | 51c16b4419d640709d3352a260e4cd63cd96db14 | [
"Apache-2.0"
] | null | null | null | centreon/common/powershell/exchange/2010/imapmailbox.pm | garnier-quentin/centreon-plugins | 51c16b4419d640709d3352a260e4cd63cd96db14 | [
"Apache-2.0"
] | null | null | null | #
# Copyright 2018 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package centreon::common::powershell::exchange::2010::imapmailbox;
use strict;
use warnings;
use centreon::plugins::misc;
use centreon::common::powershell::exchange::2010::powershell;
sub get_powershell {
my (%options) = @_;
# options: no_ps
my $no_ps = (defined($options{no_ps})) ? 1 : 0;
return '' if ($no_ps == 1);
my $ps = centreon::common::powershell::exchange::2010::powershell::powershell_init(%options);
$ps .= '
try {
$ErrorActionPreference = "Stop"
$username = "' . $options{mailbox} . '"
$password = "' . $options{password} . '"
$secstr = New-Object -TypeName System.Security.SecureString
$password.ToCharArray() | ForEach-Object {$secstr.AppendChar($_)}
$cred = new-object -typename System.Management.Automation.PSCredential -argumentlist $username, $secstr
$results = Test-ImapConnectivity -MailboxCredential $cred
} catch {
Write-Host $Error[0].Exception
exit 1
}
Foreach ($result in $results) {
Write-Host "[scenario=" $result.Scenario "][result=" $result.Result "][latency=" $result.Latency.TotalMilliseconds "][[error=" $Result.Error "]]"
}
exit 0
';
return centreon::plugins::misc::powershell_encoded($ps);
}
sub check {
my ($self, %options) = @_;
# options: stdout
# Following output:
#[scenario= Options ][result= Failure ][latency= 52,00 ][[error=...]]
$self->{output}->output_add(severity => 'OK',
short_msg => "Imap to '" . $options{mailbox} . "' is ok.");
my $checked = 0;
$self->{output}->output_add(long_msg => $options{stdout});
while ($options{stdout} =~ /\[scenario=(.*?)\]\[result=(.*?)\]\[latency=(.*?)\]\[\[error=(.*?)\]\]/msg) {
$self->{data} = {};
($self->{data}->{scenario}, $self->{data}->{result}, $self->{data}->{latency}, $self->{data}->{error}) =
($self->{output}->to_utf8($1), centreon::plugins::misc::trim($2),
centreon::plugins::misc::trim($3), centreon::plugins::misc::trim($4));
$checked++;
my ($status, $message) = ('ok');
eval {
local $SIG{__WARN__} = sub { $message = $_[0]; };
local $SIG{__DIE__} = sub { $message = $_[0]; };
if (defined($self->{option_results}->{critical}) && $self->{option_results}->{critical} ne '' &&
eval "$self->{option_results}->{critical}") {
$status = 'critical';
} elsif (defined($self->{option_results}->{warning}) && $self->{option_results}->{warning} ne '' &&
eval "$self->{option_results}->{warning}") {
$status = 'warning';
}
};
if (defined($message)) {
$self->{output}->output_add(long_msg => 'filter status issue: ' . $message);
}
if (!$self->{output}->is_status(value => $status, compare => 'ok', litteral => 1)) {
$self->{output}->output_add(severity => $status,
short_msg => sprintf("Imap scenario '%s' to '%s' is '%s'",
$self->{data}->{scenario}, $options{mailbox}, $self->{data}->{result}));
}
if ($self->{data}->{latency} =~ /^(\d+)/) {
$self->{output}->perfdata_add(label => $self->{data}->{scenario}, unit => 's',
value => sprintf("%.3f", $1 / 1000),
min => 0);
}
}
if ($checked == 0) {
$self->{output}->output_add(severity => 'UNKNOWN',
short_msg => 'Cannot find informations');
}
}
1;
__END__
=head1 DESCRIPTION
Method to check Exchange 2010 imap on a specific mailbox.
=cut | 37.195122 | 149 | 0.561749 |
ed86c75f889c61fd84a81e9a5b35da55761f1605 | 1,797 | t | Perl | t/tapper-mcp-local.t | tapper/Tapper-MCP | d3c65d339ac607a983986eb838cee8cb6932299f | [
"BSD-2-Clause"
] | null | null | null | t/tapper-mcp-local.t | tapper/Tapper-MCP | d3c65d339ac607a983986eb838cee8cb6932299f | [
"BSD-2-Clause"
] | null | null | null | t/tapper-mcp-local.t | tapper/Tapper-MCP | d3c65d339ac607a983986eb838cee8cb6932299f | [
"BSD-2-Clause"
] | null | null | null | #! /usr/bin/env perl
use strict;
use warnings;
use Test::Fixture::DBIC::Schema;
use YAML::Syck;
use Tapper::Schema::TestTools;
use Tapper::MCP::Child;
use Tapper::Config;
use Test::More;
use Test::Deep;
use Test::MockModule;
# (XXX) need to find a way to include log4perl into tests to make sure no
# errors reported through this framework are missed
my $string = "
log4perl.rootLogger = INFO, root
log4perl.appender.root = Log::Log4perl::Appender::Screen
log4perl.appender.root.stderr = 1
log4perl.appender.root.layout = SimpleLayout";
Log::Log4perl->init(\$string);
# -----------------------------------------------------------------------------------------------------------------
construct_fixture( schema => testrundb_schema, fixture => 't/fixtures/testrundb/testrun_local.yml' );
# -----------------------------------------------------------------------------------------------------------------
my @errors;
my $mock_child = Test::MockModule->new('Tapper::MCP::Child');
$mock_child->mock('wait_for_testrun', sub { 0 });
$mock_child->mock('report_mcp_results', sub { 0 });
$mock_child->mock('handle_error', sub { my ($self, $error_msg, $error_comment) = @_;
push @errors, {msg => $error_msg,
comment => $error_comment}
});
my $child = Tapper::MCP::Child->new(13);
my $error = $child->runtest_handling();
is($error, 0, 'runtest_handling without error');
eval {
is($child->state->state_details->state_details->{current_state}, 'reboot_test','local test with skipped installation');
};
is_deeply(\@errors, [], 'No errors during testing');
if (@errors) {
use Data::Dumper;
diag Dumper \@errors;
}
done_testing();
| 32.672727 | 127 | 0.556483 |
ed8cc2967f42b697c26388e54f0426805718a53c | 2,532 | pl | Perl | randname.pl | naughtont3/randname | 0cbe4a1af23e9eb8df0934ebc8de06c60b066ef7 | [
"BSD-3-Clause"
] | null | null | null | randname.pl | naughtont3/randname | 0cbe4a1af23e9eb8df0934ebc8de06c60b066ef7 | [
"BSD-3-Clause"
] | null | null | null | randname.pl | naughtont3/randname | 0cbe4a1af23e9eb8df0934ebc8de06c60b066ef7 | [
"BSD-3-Clause"
] | null | null | null | #!/usr/bin/env perl
#
# Quick hack at a Perl version for generating random (repo) names.
#
# Added support for "short" names.
#
use Getopt::Long;
my $TOPDIR=".";
my $adjectives_file = "$TOPDIR/data/adjectives.txt";
my $animals_file = "$TOPDIR/data/animals.txt";
my $opt_help = 0;
my $opt_upper = 0;
my $opt_short = 0;
my $SHORT_LIMIT = 3; # Max length for "short" string option
sub usage
{
print <<EOF;
Usage: $0 [OPTIONS]
-u|--upper Show name as UPPERCASE.
-s|--short Show a short name
-h|--help Print this help message
EOF
return;
}
#
# Best effort to find a random item in input list that is
# less-than-equal to $SHORT_LIMIT length. We have a crude
# max try method of only trying N times, where N=num items in list.
# In that case, you could return value greater than $SHORT_LIMIT, but
# will always return some value.
#
sub get_short_value(@)
{
my @input = @_;
my $done = 0;
my $value;
my $num_input = scalar(@input);
my $count = $num_input; # Fail-safe, add try counter to avoid infinite loop
do {
$count--;
my $rand = int( rand($num_input) );
$value = $input[ $rand ];
my $len = length( $value );
if ( ($len <= $SHORT_LIMIT) || ($count < 0) ) {
$done = 1;
}
#print "DONE=$done, COUNT=$count, LEN=$len, VALUE=$value, RAND=$rand\n";
} while (!$done);
return $value;
}
sub get_value(@)
{
my @input = @_;
my $value;
my $rand;
my $num_input = scalar(@input);
$rand = int( rand($num_input) );
$value = $input[ $rand ];
return $value;
}
########
# MAIN
########
my $rc = GetOptions(
"help" => \$opt_help,
"upper" => \$opt_upper,
"short" => \$opt_short,
);
if ($opt_help) {
usage();
exit(0);
}
# Open data files
open (FILE1, $adjectives_file) || die "Error: $! '$adjectives_file'";
open (FILE2, $animals_file) || die "Error: $! '$animals_file'";
# Read data into array
my @list1 = <FILE1>;
chomp(@list1);
# Read data into array
my @list2 = <FILE2>;
chomp(@list2);
# Close data files
close (FILE1);
close (FILE2);
my $w1, $w2;
if ($opt_short) {
$w1 = get_short_value(@list1);
$w2 = get_short_value(@list2);
} else {
$w1 = get_value(@list1);
$w2 = get_value(@list2);
}
if ($opt_upper) {
# Print codename in UPPERCASE
print uc "$w1-$w2\n";
} else {
# Print codename in lowercase
print lc "$w1-$w2\n";
}
exit (0);
| 19.181818 | 80 | 0.568325 |
eda080b59530458841a7101d966d70490b12733b | 4,656 | pl | Perl | log_transform/make_prop_rank.pl | flaithbheartaigh/jaikuengine-mobile-client | c47100ec009d47a4045b3d98addc9b8ad887b132 | [
"MIT"
] | null | null | null | log_transform/make_prop_rank.pl | flaithbheartaigh/jaikuengine-mobile-client | c47100ec009d47a4045b3d98addc9b8ad887b132 | [
"MIT"
] | null | null | null | log_transform/make_prop_rank.pl | flaithbheartaigh/jaikuengine-mobile-client | c47100ec009d47a4045b3d98addc9b8ad887b132 | [
"MIT"
] | null | null | null | # Copyright (c) 2007-2009 Google Inc.
# Copyright (c) 2006-2007 Jaiku Ltd.
# Copyright (c) 2002-2006 Mika Raento and Renaud Petit
#
# This software is licensed at your choice under either 1 or 2 below.
#
# 1. MIT License
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to deal
# in the Software without restriction, including without limitation the rights
# to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
# copies of the Software, and to permit persons to whom the Software is
# furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included in
# all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
# THE SOFTWARE.
#
# 2. Gnu General Public license 2.0
#
# This program is free software; you can redistribute it and/or
# modify it under the terms of the GNU General Public License
# as published by the Free Software Foundation; either version 2
# of the License, or (at your option) any later version.
#
# This program is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
#
# You should have received a copy of the GNU General Public License
# along with this program; if not, write to the Free Software
# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
#
#
# This file is part of the JaikuEngine mobile client.
use lib '/home/group/context/perl';
use lib '/home/group/context/perl/i386-linux-thread-multi';
$ENV{'NLS_LANG'} = "american_america.we8iso8859p1";
my $DBNAME="context.cs.helsinki.fi";
my $DBUSER="context";
my $DBPASS="nSrXt8p";
use DBD::Oracle;
my $dbh=DBI->connect("dbi:Oracle:$DBNAME", $DBUSER, $DBPASS);
$dbh->{RaiseError} = 1;
my $sql=
"select rowid,
(select count(*) from contact_rank c2 where c.person=c2.person) total,
(select count(*) from contact_rank c2 where c2.rank_count<=c.rank_count and
c.person=c2.person) lesst_count,
(select count(*) from contact_rank c2 where c2.rank_count_in<=c.rank_count_in and
c.person=c2.person) lesst_count_in,
(select count(*) from contact_rank c2 where c2.rank_count_out<=c.rank_count_out and
c.person=c2.person) lesst_count_out,
(select count(*) from contact_rank c2 where c2.rank_duration<=c.rank_duration and
c.person=c2.person) lesst_duration,
(select count(*) from contact_rank c2 where c2.rank_duration_in<=c.rank_duration_in and
c.person=c2.person) lesst_duration_in,
(select count(*) from contact_rank c2 where c2.rank_duration_out<=c.rank_duration_out and
c.person=c2.person) lesst_duration_out
from contact_rank c";
$vals=$dbh->selectall_arrayref($sql);
$j=0;
my (@rowids,
@call_count_prop, @call_duration_prop,
@call_count_prop_in, @call_duration_prop_in,
@call_count_prop_out, @call_duration_prop_out);
while (my $r=$vals->[$j++]) {
my $rowid=$r->[0];
my $total=$r->[1];
my $lesst_count=$r->[2];
my $lesst_count_in=$r->[3];
my $lesst_count_out=$r->[4];
my $lesst_duration=$r->[2];
my $lesst_duration_in=$r->[3];
my $lesst_duration_out=$r->[4];
push(@rowids, $rowid);
push(@call_count_prop, $lesst_count/$total);
push(@call_count_prop_in, $lesst_count_in/$total);
push(@call_count_prop_out, $lesst_count_out/$total);
push(@call_duration_prop, $lesst_duration/$total);
push(@call_duration_prop_in, $lesst_duration_in/$total);
push(@call_duration_prop_out, $lesst_duration_out/$total);
}
$st=$dbh->prepare("update contact_rank set
call_count_prop=?,
call_count_prop_in=?,
call_count_prop_out=?,
duration_prop=?,
duration_prop_in=?,
duration_prop_out=?
where rowid=?");
$st->bind_param_array(1, \@call_count_prop);
$st->bind_param_array(2, \@call_count_prop_in);
$st->bind_param_array(3, \@call_count_prop_out);
$st->bind_param_array(4, \@call_duration_prop);
$st->bind_param_array(5, \@call_duration_prop_in);
$st->bind_param_array(6, \@call_duration_prop_out);
$st->bind_param_array(7, \@rowids);
my @tuple_status;
$st->execute_array({ ArrayTupleStatus => \@tuple_status });
| 37.548387 | 90 | 0.756229 |
ed8d547365fc5777d93462a44afd7dfa53ea3f93 | 2,079 | t | Perl | t/regression/chart_data_labels44.t | ft-lie/excel-writer-xlsx | 074eac935b0bde0091e4c54b15aac1d7ebec55c0 | [
"Artistic-1.0-Perl"
] | null | null | null | t/regression/chart_data_labels44.t | ft-lie/excel-writer-xlsx | 074eac935b0bde0091e4c54b15aac1d7ebec55c0 | [
"Artistic-1.0-Perl"
] | null | null | null | t/regression/chart_data_labels44.t | ft-lie/excel-writer-xlsx | 074eac935b0bde0091e4c54b15aac1d7ebec55c0 | [
"Artistic-1.0-Perl"
] | null | null | null | ###############################################################################
#
# Tests the output of Excel::Writer::XLSX against Excel generated files.
#
# Copyright 2000-2020, John McNamara, jmcnamara@cpan.org
#
use lib 't/lib';
use TestFunctions qw(_compare_xlsx_files _is_deep_diff);
use strict;
use warnings;
use Test::More tests => 1;
###############################################################################
#
# Tests setup.
#
my $filename = 'chart_data_labels44.xlsx';
my $dir = 't/regression/';
my $got_filename = $dir . "ewx_$filename";
my $exp_filename = $dir . 'xlsx_files/' . $filename;
my $ignore_members = [];
my $ignore_elements = {};
###############################################################################
#
# Test the creation of a simple Excel::Writer::XLSX file.
#
use Excel::Writer::XLSX;
my $workbook = Excel::Writer::XLSX->new( $got_filename );
my $worksheet = $workbook->add_worksheet();
my $chart = $workbook->add_chart( type => 'column', embedded => 1 );
# For testing, copy the randomly generated axis ids in the target xlsx file.
$chart->{_axis_ids} = [ 56179712, 56185600 ];
my $data = [
[ 1, 2, 3, 4, 5 ],
[ 2, 4, 6, 8, 10 ],
[ 3, 6, 9, 12, 15 ],
];
$worksheet->write( 'A1', $data );
$chart->add_series(
values => '=Sheet1!$A$1:$A$5',
data_labels => {value => 1, custom => [{value => 33, border => { color => 'red'}, fill => { color => '#00B050' }}]}
);
$chart->add_series( values => '=Sheet1!$B$1:$B$5');
$chart->add_series( values => '=Sheet1!$C$1:$C$5' );
$worksheet->insert_chart( 'E9', $chart );
$workbook->close();
###############################################################################
#
# Compare the generated and existing Excel files.
#
my ( $got, $expected, $caption ) = _compare_xlsx_files(
$got_filename,
$exp_filename,
$ignore_members,
$ignore_elements,
);
_is_deep_diff( $got, $expected, $caption );
###############################################################################
#
# Cleanup.
#
unlink $got_filename;
__END__
| 24.174419 | 119 | 0.506494 |
ed9208c57f8fc90fb197c8a7c3d6d6f48ffc3b98 | 2,596 | pm | Perl | perl/vendor/lib/SOAP/Transport/MAILTO.pm | DDMoReFoundation/PortableNonmem | 7e40b30887537f24fed12421935b58325ba2e5c3 | [
"BSD-3-Clause-Clear"
] | null | null | null | perl/vendor/lib/SOAP/Transport/MAILTO.pm | DDMoReFoundation/PortableNonmem | 7e40b30887537f24fed12421935b58325ba2e5c3 | [
"BSD-3-Clause-Clear"
] | null | null | null | perl/vendor/lib/SOAP/Transport/MAILTO.pm | DDMoReFoundation/PortableNonmem | 7e40b30887537f24fed12421935b58325ba2e5c3 | [
"BSD-3-Clause-Clear"
] | null | null | null | # ======================================================================
#
# Copyright (C) 2000-2001 Paul Kulchenko (paulclinger@yahoo.com)
# SOAP::Lite is free software; you can redistribute it
# and/or modify it under the same terms as Perl itself.
#
# ======================================================================
package SOAP::Transport::MAILTO;
use strict;
our $VERSION = 1.11;
use MIME::Lite;
use URI;
# ======================================================================
package SOAP::Transport::MAILTO::Client;
use SOAP::Lite;
use vars qw(@ISA);
@ISA = qw(SOAP::Client);
sub DESTROY { SOAP::Trace::objects('()') }
sub new {
my $class = shift;
return $class if ref $class;
my(@params, @methods);
while (@_) { $class->can($_[0]) ? push(@methods, shift() => shift) : push(@params, shift) }
my $self = bless {@params} => $class;
while (@methods) { my($method, $params) = splice(@methods,0,2);
$self->$method(ref $params eq 'ARRAY' ? @$params : $params)
}
SOAP::Trace::objects('()');
return $self;
}
sub send_receive {
my($self, %parameters) = @_;
my($envelope, $endpoint, $action) =
@parameters{qw(envelope endpoint action)};
$endpoint ||= $self->endpoint;
my $uri = URI->new($endpoint);
%parameters = (%$self,
map {URI::Escape::uri_unescape($_)}
map {split/=/,$_,2}
split /[&;]/, $uri->query || '');
my $msg = MIME::Lite->new(
To => $uri->to,
Type => 'text/xml',
Encoding => $parameters{Encoding} || 'base64',
Data => $envelope,
$parameters{From}
? (From => $parameters{From})
: (),
$parameters{'Reply-To'}
? ('Reply-To' => $parameters{'Reply-To'})
: (),
$parameters{Subject}
? (Subject => $parameters{Subject})
: (),
);
$msg->replace('X-Mailer' => join '/', 'SOAP::Lite', 'Perl', SOAP::Transport::MAILTO->VERSION);
$msg->add(SOAPAction => $action);
SOAP::Trace::transport($msg);
SOAP::Trace::debug($msg->as_string);
MIME::Lite->send(map {exists $parameters{$_}
? ($_ => $parameters{$_})
: ()} 'smtp', 'sendmail');
eval { local $SIG{__DIE__}; $MIME::Lite::AUTO_CC = 0; $msg->send };
(my $code = $@) =~ s/ at .*\n//;
$self->code($code);
$self->message($code);
$self->is_success(!defined $code || $code eq '');
$self->status($code);
return;
}
# ======================================================================
1;
__END__
| 27.326316 | 98 | 0.474961 |
73fc80e7a265afaa55c5d4936cda3436b9c067a4 | 4,897 | t | Perl | t/concurrency/01-thread.t | mryan/perl6-nqp | 687e2f12c866ee1498229ac1ac234ff56b7d02b8 | [
"MIT"
] | null | null | null | t/concurrency/01-thread.t | mryan/perl6-nqp | 687e2f12c866ee1498229ac1ac234ff56b7d02b8 | [
"MIT"
] | null | null | null | t/concurrency/01-thread.t | mryan/perl6-nqp | 687e2f12c866ee1498229ac1ac234ff56b7d02b8 | [
"MIT"
] | null | null | null | #! nqp
plan(24);
# 2 tests
{
my $ran := 0;
my $t := nqp::newthread({ $ran := 1 }, 0);
ok(nqp::defined($t), 'Can create a new non-app-lifetime thread');
nqp::threadrun($t);
nqp::threadjoin($t);
ok($ran, 'Can run and join the new thread');
}
# 2 tests
{
my $start := nqp::time_n();
my $t := nqp::newthread({ nqp::sleep(10.0) }, 1);
ok(nqp::defined($t), 'Can create a new app-lifetime thread');
nqp::threadrun($t);
ok(nqp::time_n() - $start < 10.0,
'Sleeping app-lifetime thread does not block main thread');
}
# 4 tests
{
my int $done := 0;
my $t := nqp::newthread({
1 until $done;
ok(1, 'Can write to STDOUT in child thread');
}, 0);
ok(1, 'Can write to STDOUT in parent thread before threadrun');
nqp::threadrun($t);
ok(1, 'Can write to STDOUT in parent thread after threadrun');
$done := 1;
nqp::threadjoin($t);
ok(1, 'Can write to STDOUT in parent thread after threadjoin');
}
# 9 tests
{
my $c := nqp::currentthread();
my $pid := nqp::threadid($c);
ok($pid, 'Parent thread has a non-zero ID');
my $tid := 0;
my $cid := 0;
my $t := nqp::newthread({
$cid := nqp::threadid(nqp::currentthread());
}, 0);
ok(nqp::defined($t), 'Can create another new thread after previous joins');
$tid := nqp::threadid($t);
ok($tid, 'New thread has a non-zero ID');
ok($tid != $pid, 'Parent and new thread have different IDs');
nqp::threadrun($t);
ok($tid == nqp::threadid($t), 'Thread keeps same ID after threadrun()');
nqp::threadjoin($t);
ok($tid == nqp::threadid($t), 'Thread keeps same ID after threadjoin()');
ok($cid, 'Child thread knew its own thread ID');
ok($cid == $tid, 'Parent saw same ID for child as child did');
ok($pid == nqp::threadid(nqp::currentthread()),
'Parent thread still has the same ID');
}
# 3 tests
{
my $a := 0;
my $b := 0;
my $t1 := nqp::newthread({ $a := 21 }, 0);
my $t2 := nqp::newthread({ $b := 42 }, 0);
nqp::threadrun($t1);
nqp::threadrun($t2);
ok(nqp::threadid($t1) != nqp::threadid($t2),
'Two new child threads have different IDs');
nqp::threadjoin($t1);
nqp::threadjoin($t2);
ok($a == 21, 'First child thread actually ran');
ok($b == 42, 'Second child thread also ran');
}
# 2 tests
# Parent-child case for threadyield()
# This test intentionally does not use proper synchronization primitives,
# so that threadyield can be tested independently of locks/condvars/etc.
{
my @a;
my $t := nqp::newthread({
nqp::threadyield() until nqp::elems(@a) == 1 && @a[0] eq 'a';
nqp::push(@a, '1');
nqp::threadyield() until nqp::elems(@a) == 3 && @a[2] eq 'b';
nqp::push(@a, '2');
}, 0);
# Make sure child thread is at least *runnable* (if not actually running)
# before running parent thread's code.
nqp::threadrun($t);
{
nqp::push(@a, 'a');
nqp::threadyield() until nqp::elems(@a) == 2 && @a[1] eq '1';
nqp::push(@a, 'b');
nqp::threadyield() until nqp::elems(@a) == 4 && @a[3] eq '2';
nqp::push(@a, 'c');
}
nqp::threadjoin($t);
ok(@a[0] eq 'a',
'Looped threadyield() can force parent thread to act first');
my $order := nqp::join(',', @a);
my $ok := $order eq 'a,1,b,2,c';
ok($ok, 'threadyield() properly interleaved parent and child threads');
say("# execution order = $order (expected a,1,b,2,c)") if !$ok;
}
# 2 tests
# Sibling child threads case for threadyield()
# This test intentionally does not use proper synchronization primitives,
# so that threadyield can be tested independently of locks/condvars/etc.
{
my @a;
my $t1 := nqp::newthread({
nqp::push(@a, 'a');
nqp::threadyield() until nqp::elems(@a) == 2 && @a[1] eq '1';
nqp::push(@a, 'b');
nqp::threadyield() until nqp::elems(@a) == 4 && @a[3] eq '2';
nqp::push(@a, 'c');
}, 0);
my $t2 := nqp::newthread({
nqp::threadyield() until nqp::elems(@a) == 1 && @a[0] eq 'a';
nqp::push(@a, '1');
nqp::threadyield() until nqp::elems(@a) == 3 && @a[2] eq 'b';
nqp::push(@a, '2');
}, 0);
# Make sure $t2 is at least *runnable* (if not actually running)
# before $t1 becomes runnable.
nqp::threadrun($t2);
nqp::threadrun($t1);
# Join in either order should work here.
nqp::threadjoin($t1);
nqp::threadjoin($t2);
ok(@a[0] eq 'a',
'Looped threadyield() can force other thread to act first');
my $order := nqp::join(',', @a);
my $ok := $order eq 'a,1,b,2,c';
ok($ok, 'threadyield() properly interleaved two child threads');
say("# execution order = $order (expected a,1,b,2,c)") if !$ok;
}
# XXXX: Stress tests -- Perl 6 spectests starting at S17-lowlevel/thread.t:100
| 29.5 | 79 | 0.561568 |
ed68fbef882f65ade2c76d1842150e51ffffb71e | 231 | t | Perl | t/00-load.t | git-the-cpan/Catalyst-Authentication-Store-FromSub | a820506757022be41e7b72e8fd43578470231857 | [
"Artistic-1.0"
] | null | null | null | t/00-load.t | git-the-cpan/Catalyst-Authentication-Store-FromSub | a820506757022be41e7b72e8fd43578470231857 | [
"Artistic-1.0"
] | null | null | null | t/00-load.t | git-the-cpan/Catalyst-Authentication-Store-FromSub | a820506757022be41e7b72e8fd43578470231857 | [
"Artistic-1.0"
] | null | null | null | #!perl -T
use Test::More tests => 1;
BEGIN {
use_ok('Catalyst::Authentication::Store::FromSub');
}
diag(
"Testing Catalyst::Authentication::Store::FromSub $Catalyst::Authentication::Store::FromSub::VERSION, Perl $], $^X"
);
| 19.25 | 115 | 0.683983 |
73eb62320f3ebf9b92033bd512f4485bf7bc9f01 | 17,341 | pm | Perl | centreon/plugins/backend/http/curl.pm | alenorcy/centreon-plugins | d7603030c24766935ed07e6ebe1082e16d6fdb4a | [
"Apache-2.0"
] | null | null | null | centreon/plugins/backend/http/curl.pm | alenorcy/centreon-plugins | d7603030c24766935ed07e6ebe1082e16d6fdb4a | [
"Apache-2.0"
] | null | null | null | centreon/plugins/backend/http/curl.pm | alenorcy/centreon-plugins | d7603030c24766935ed07e6ebe1082e16d6fdb4a | [
"Apache-2.0"
] | null | null | null | #
# Copyright 2019 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package centreon::plugins::backend::http::curl;
use strict;
use warnings;
use URI;
use centreon::plugins::misc;
sub new {
my ($class, %options) = @_;
my $self = {};
bless $self, $class;
if (!defined($options{noptions}) || $options{noptions} != 1) {
$options{options}->add_options(arguments => {
"curl-opt:s@" => { name => 'curl_opt' },
});
$options{options}->add_help(package => __PACKAGE__, sections => 'BACKEND CURL OPTIONS', once => 1);
}
$self->{output} = $options{output};
return $self;
}
sub check_options {
my ($self, %options) = @_;
centreon::plugins::misc::mymodule_load(output => $self->{output}, module => 'Net::Curl::Easy',
error_msg => "Cannot load module 'Net::Curl::Easy'.");
centreon::plugins::misc::mymodule_load(output => $self->{output}, module => 'centreon::plugins::backend::http::curlconstants',
error_msg => "Cannot load module 'centreon::plugins::backend::http::curlconstants'.");
$self->{constant_cb} = \¢reon::plugins::backend::http::curlconstants::get_constant_value;
foreach (('unknown_status', 'warning_status', 'critical_status')) {
if (defined($options{request}->{$_})) {
$options{request}->{$_} =~ s/%\{http_code\}/\$self->{response_code}/g;
}
}
if (!defined($options{request}->{curl_opt})) {
$options{request}->{curl_opt} = [];
}
}
my $http_code_explained = {
100 => 'Continue',
101 => 'Switching Protocols',
200 => 'OK',
201 => 'Created',
202 => 'Accepted',
203 => 'Non-Authoritative Information',
204 => 'No Content',
205 => 'Reset Content',
206 => 'Partial Content',
300 => 'Multiple Choices',
301 => 'Moved Permanently',
302 => 'Found',
303 => 'See Other',
304 => 'Not Modified',
305 => 'Use Proxy',
306 => '(Unused)',
307 => 'Temporary Redirect',
400 => 'Bad Request',
401 => 'Unauthorized',
402 => 'Payment Required',
403 => 'Forbidden',
404 => 'Not Found',
405 => 'Method Not Allowed',
406 => 'Not Acceptable',
407 => 'Proxy Authentication Required',
408 => 'Request Timeout',
409 => 'Conflict',
410 => 'Gone',
411 => 'Length Required',
412 => 'Precondition Failed',
413 => 'Request Entity Too Large',
414 => 'Request-URI Too Long',
415 => 'Unsupported Media Type',
416 => 'Requested Range Not Satisfiable',
417 => 'Expectation Failed',
500 => 'Internal Server Error',
501 => 'Not Implemented',
502 => 'Bad Gateway',
503 => 'Service Unavailable',
504 => 'Gateway Timeout',
505 => 'HTTP Version Not Supported',
};
sub cb_debug {
my ($easy, $type, $data, $uservar) = @_;
my $msg = '';
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_TEXT')) {
$msg = sprintf("== Info: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_HEADER_OUT')) {
$msg = sprintf("=> Send header: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_DATA_OUT')) {
$msg = sprintf("=> Send data: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_SSL_DATA_OUT')) {
$msg = sprintf("=> Send SSL data: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_HEADER_IN')) {
$msg = sprintf("=> Recv header: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_DATA_IN')) {
$msg = sprintf("=> Recv data: %s", $data);
}
if ($type == $uservar->{constant_cb}->(name => 'CURLINFO_SSL_DATA_IN')) {
$msg = sprintf("=> Recv SSL data: %s", $data);
}
$uservar->{output}->output_add(long_msg => $msg, debug => 1);
return 0;
}
sub curl_setopt {
my ($self, %options) = @_;
eval {
$self->{curl_easy}->setopt($options{option}, $options{parameter});
};
if ($@) {
$self->{output}->add_option_msg(short_msg => "curl setopt error: '" . $@ . "'.");
$self->{output}->option_exit();
}
}
sub set_method {
my ($self, %options) = @_;
if ($options{request}->{method} eq 'GET') {
return ;
}
if ($options{content_type_forced} == 1) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_POSTFIELDS'), parameter => $options{request}->{query_form_post})
if (defined($options{request}->{query_form_post}) && $options{request}->{query_form_post} ne '');
} elsif (defined($options{request}->{post_params})) {
my $uri_post = URI->new();
$uri_post->query_form($options{request}->{post_params});
push @{$options{headers}}, 'Content-Type: application/x-www-form-urlencoded';
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_POSTFIELDS'), parameter => $uri_post->query);
}
if ($options{request}->{method} eq 'POST') {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_POST'), parameter => 1);
}
if ($options{request}->{method} eq 'PUT') {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_CUSTOMREQUEST'), parameter => $options{request}->{method});
}
if ($options{request}->{method} eq 'DELETE') {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_CUSTOMREQUEST'), parameter => $options{request}->{method});
}
}
sub set_auth {
my ($self, %options) = @_;
if (defined($options{request}->{credentials})) {
if (defined($options{request}->{basic})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_HTTPAUTH'), parameter => $self->{constant_cb}->(name => 'CURLAUTH_BASIC'));
} elsif (defined($options{request}->{ntlmv2})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_HTTPAUTH'), parameter => $self->{constant_cb}->(name => 'CURLAUTH_NTLM'));
} else {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_HTTPAUTH'), parameter => $self->{constant_cb}->(name => 'CURLAUTH_ANY'));
}
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_USERPWD'), parameter => $options{request}->{username} . ':' . $options{request}->{password});
}
if (defined($options{request}->{cert_file}) && $options{request}->{cert_file} ne '') {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_SSLCERT'), parameter => $options{request}->{cert_file});
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_SSLKEY'), parameter => $options{request}->{key_file});
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_KEYPASSWD'), parameter => $options{request}->{cert_pwd});
}
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_SSLCERTTYPE'), parameter => "PEM");
if (defined($options{request}->{cert_pkcs12})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_SSLCERTTYPE'), parameter => "P12");
}
}
sub set_proxy {
my ($self, %options) = @_;
if (defined($options{request}->{proxyurl}) && $options{request}->{proxyurl} ne '') {
if ($options{request}->{proxyurl} =~ /^(?:http|https):\/\/(.*?):(.*?)@/) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_PROXYUSERNAME'), parameter => $1);
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_PROXYPASSWORD'), parameter => $2);
$options{request}->{proxyurl} =~ s/\/\/$1:$2@//;
}
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_PROXY'), parameter => $options{request}->{proxyurl});
}
if (defined($options{request}->{proxypac}) && $options{request}->{proxypac} ne '') {
$self->{output}->add_option_msg(short_msg => 'Unsupported proxypac option');
$self->{output}->option_exit();
}
}
sub set_extra_curl_opt {
my ($self, %options) = @_;
my $fields = { key => '', value => '' };
foreach (@{$options{request}->{curl_opt}}) {
($fields->{key}, $fields->{value}) = split /=>/;
foreach my $label ('key', 'value') {
$fields->{$label} = centreon::plugins::misc::trim($fields->{$label});
if ($fields->{$label} =~ /^CURLOPT|CURL/) {
$fields->{$label} = $self->{constant_cb}->(name => $fields->{$label});
}
}
$self->curl_setopt(option => $fields->{key}, parameter => $fields->{value});
}
}
sub cb_get_header {
my ($easy, $header, $uservar) = @_;
$header =~ s/[\r\n]//g;
if ($header =~ /^[\r\n]*$/) {
$uservar->{nheaders}++;
} else {
$uservar->{response_headers}->[$uservar->{nheaders}] = {}
if (!defined($uservar->{response_headers}->[$uservar->{nheaders}]));
if ($header =~ /^(\S(?:.*?))\s*:\s*(.*)/) {
my $header_name = lc($1);
$uservar->{response_headers}->[$uservar->{nheaders}]->{$header_name} = []
if (!defined($uservar->{response_headers}->[$uservar->{nheaders}]->{$header_name}));
push @{$uservar->{response_headers}->[$uservar->{nheaders}]->{$header_name}}, $2;
} else {
$uservar->{response_headers}->[$uservar->{nheaders}]->{response_line} = $header;
}
}
return length($_[1]);
}
sub request {
my ($self, %options) = @_;
$self->{curl_easy} = Net::Curl::Easy->new();
if ($self->{output}->is_debug()) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_DEBUGFUNCTION'), parameter => \&cb_debug);
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_DEBUGDATA'), parameter => $self);
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_VERBOSE'), parameter => 1);
}
if (defined($options{request}->{timeout})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_TIMEOUT'), parameter => $options{request}->{timeout});
}
if (defined($options{request}->{cookies_file})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_COOKIEFILE'), parameter => $options{request}->{cookies_file});
}
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_FOLLOWLOCATION'), parameter => 1);
if (defined($options{request}->{no_follow})) {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_FOLLOWLOCATION'), parameter => 0);
}
my $url;
if (defined($options{request}->{full_url})) {
$url = $options{request}->{full_url};
} elsif (defined($options{request}->{port}) && $options{request}->{port} =~ /^[0-9]+$/) {
$url = $options{request}->{proto}. "://" . $options{request}->{hostname} . ':' . $options{request}->{port} . $options{request}->{url_path};
} else {
$url = $options{request}->{proto}. "://" . $options{request}->{hostname} . $options{request}->{url_path};
}
if (defined($options{request}->{http_peer_addr}) && $options{request}->{http_peer_addr} ne '') {
$url =~ /^(?:http|https):\/\/(.*?)(\/|\:|$)/;
$self->{curl_easy}->pushopt($self->{constant_cb}->(name => 'CURLOPT_RESOLVE'),
[$1 . ':' . $options{request}->{port_force} . ':' . $options{request}->{http_peer_addr}]);
}
my $uri = URI->new($url);
if (defined($options{request}->{get_params})) {
$uri->query_form($options{request}->{get_params});
}
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_URL'), parameter => $uri);
my $headers = [];
my $content_type_forced = 0;
foreach my $key (keys %{$options{request}->{headers}}) {
push @$headers, $key . ':' . $options{request}->{headers}->{$key};
if ($key =~ /content-type/i) {
$content_type_forced = 1;
}
}
$self->set_method(%options, content_type_forced => $content_type_forced, headers => $headers);
if (scalar(@$headers) > 0) {
$self->{curl_easy}->pushopt($self->{constant_cb}->(name => 'CURLOPT_HTTPHEADER'), $headers);
}
if (defined($options{request}->{cacert_file}) && $options{request}->{cacert_file} ne '') {
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_CAINFO'), parameter => $options{request}->{cacert_file});
}
$self->set_auth(%options);
$self->set_proxy(%options);
$self->set_extra_curl_opt(%options);
$self->{response_body} = '';
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_FILE'), parameter => \$self->{response_body});
$self->{nheaders} = 0;
$self->{response_headers} = [{}];
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_HEADERDATA'), parameter => $self);
$self->curl_setopt(option => $self->{constant_cb}->(name => 'CURLOPT_HEADERFUNCTION'), parameter => \&cb_get_header);
eval {
$self->{curl_easy}->perform();
};
if ($@) {
$self->{output}->add_option_msg(short_msg => 'curl perform error : ' . $@);
$self->{output}->option_exit();
}
$self->{response_code} = $self->{curl_easy}->getinfo($self->{constant_cb}->(name => 'CURLINFO_RESPONSE_CODE'));
# Check response
my $status = 'ok';
my $message;
eval {
local $SIG{__WARN__} = sub { $message = $_[0]; };
local $SIG{__DIE__} = sub { $message = $_[0]; };
if (defined($options{request}->{critical_status}) && $options{request}->{critical_status} ne '' &&
eval "$options{request}->{critical_status}") {
$status = 'critical';
} elsif (defined($options{request}->{warning_status}) && $options{request}->{warning_status} ne '' &&
eval "$options{request}->{warning_status}") {
$status = 'warning';
} elsif (defined($options{request}->{unknown_status}) && $options{request}->{unknown_status} ne '' &&
eval "$options{request}->{unknown_status}") {
$status = 'unknown';
}
};
if (defined($message)) {
$self->{output}->add_option_msg(short_msg => 'filter status issue: ' . $message);
$self->{output}->option_exit();
}
if (!$self->{output}->is_status(value => $status, compare => 'ok', litteral => 1)) {
my $short_msg = $self->{response_code} . ' ' .
(defined($http_code_explained->{$self->{response_code}}) ? $http_code_explained->{$self->{response_code}} : 'unknown');
$self->{output}->output_add(severity => $status,
short_msg => $short_msg);
$self->{output}->display();
$self->{output}->exit();
}
return $self->{response_body};
}
sub get_headers {
my ($self, %options) = @_;
my $headers = '';
foreach (keys %{$self->{response_headers}->[$options{nheader}]}) {
next if (/response_line/);
foreach my $value (@{$self->{response_headers}->[$options{nheader}]->{$_}}) {
$headers .= "$_: " . $value . "\n";
}
}
return $headers;
}
sub get_first_header {
my ($self, %options) = @_;
if (!defined($options{name})) {
return $self->get_headers(nheader => 0);
}
return undef
if (!defined($self->{response_headers}->[0]->{ lc($options{name}) }));
return wantarray ? @{$self->{response_headers}->[0]->{ lc($options{name}) }} : $self->{response_headers}->[0]->{ lc($options{name}) }->[0];
}
sub get_header {
my ($self, %options) = @_;
if (!defined($options{name})) {
return $self->get_headers(nheader => -1);
}
return undef
if (!defined($self->{response_headers}->[-1]->{ lc($options{name}) }));
return wantarray ? @{$self->{response_headers}->[-1]->{ lc($options{name}) }} : $self->{response_headers}->[-1]->{ lc($options{name}) }->[0];
}
sub get_code {
my ($self, %options) = @_;
return $self->{response_code};
}
sub get_message {
my ($self, %options) = @_;
return $http_code_explained->{$self->{response_code}};
}
1;
__END__
=head1 NAME
HTTP Curl backend layer.
=head1 SYNOPSIS
HTTP Curl backend layer.
=head1 BACKEND CURL OPTIONS
=over 8
=item B<--curl-opt>
Set CURL Options (--curl-opt="CURLOPT_SSL_VERIFYPEER => 0" --curl-opt="CURLOPT_SSLVERSION => CURL_SSLVERSION_TLSv1_1" ).
=back
=head1 DESCRIPTION
B<http>.
=cut
| 37.534632 | 171 | 0.572747 |
73e45195243389273301515aee880dc81471bac7 | 3,258 | t | Perl | t/05-messages/10-warnings.t | coke/rakudo | 8c3f013dd1356f0815bc54eae1c2ca85447c647c | [
"Artistic-2.0"
] | null | null | null | t/05-messages/10-warnings.t | coke/rakudo | 8c3f013dd1356f0815bc54eae1c2ca85447c647c | [
"Artistic-2.0"
] | null | null | null | t/05-messages/10-warnings.t | coke/rakudo | 8c3f013dd1356f0815bc54eae1c2ca85447c647c | [
"Artistic-2.0"
] | null | null | null | use lib <t/packages/>;
use Test;
use Test::Helpers;
plan 9;
subtest 'Supply.interval with negative value warns' => {
plan 2;
CONTROL { when CX::Warn {
like .message, /'Minimum timer resolution is 1ms'/, 'useful warning';
.resume;
}}
react whenever Supply.interval(-100) {
pass "intervaled code ran";
done;
}
}
if $*DISTRO.is-win {
# https://github.com/Raku/old-issue-tracker/issues/6591
skip 'is-run code is too complex to run on Windows';
}
else {
subtest 'no useless-use warning on return when KEEP/UNDO phasers used' => {
plan 3;
is-run ｢
if 1 { LEAVE 42.uc; Any }; if 1 { LEAVE 42.uc; 42 };
for 1 { LEAVE 42.uc; Any }; for 1 { LEAVE 42.uc; 42 };
｣, :err{ 2 == .comb: 'Useless use' },
'we get warnings with phasers that do not care about return value';
is-run ｢
if 1 { KEEP 42.uc; Any }; if 1 { KEEP 42.uc; 42 };
for 1 { KEEP 42.uc; Any }; for 1 { KEEP 42.uc; 42 };
｣, :err(''), 'no warnings with KEEP phaser';
is-run ｢
if 1 { UNDO 42.uc; Any }; if 1 { UNDO 42.uc; 42 };
for 1 { UNDO 42.uc; Any }; for 1 { UNDO 42.uc; 42 };
｣, :err(''), 'no warnings with UNDO phaser';
}
}
if $*DISTRO.is-win {
# https://github.com/Raku/old-issue-tracker/issues/6591
skip 'is-run code is too complex to run on Windows';
}
else {
subtest 'no useless-use warning in andthen/notandthen/orelse/ chains' => {
plan 2;
is-run ｢
1 notandthen 2 notandthen 3 notandthen 4;
5 andthen 6 andthen 7 andthen 8;
9 orelse 10 orelse 11 orelse 12;
｣, :err{ 3 == .comb: 'Useless use' },
'we get warnings when last value is useless';
is-run ｢
2 notandthen 2 notandthen 2 notandthen 2.uc;
2 andthen 2 andthen 2 andthen 2.uc;
2 orelse 2 orelse 2 orelse 2.uc;
｣, 'no warnings when last value is useful';
}
}
# https://github.com/Raku/old-issue-tracker/issues/6244
is-run ｢
sub prefix:<ᔑ> (Pair $p --> Pair) is tighter(&postcircumfix:<[ ]>) {};
print postcircumfix:<[ ]>(<foo bar ber>, 1)
｣, :out<bar>, 'no spurious warnings when invoking colonpaired routine';
# https://github.com/Raku/old-issue-tracker/issues/6221
is-run ｢my $a; $a [R~]= "b"; $a [Z~]= "b"; $a [X~]= "b"｣,
'metaops + metaassign op do not produce spurious warnings';
# https://github.com/Raku/old-issue-tracker/issues/6253
# https://github.com/Raku/old-issue-tracker/issues/6185
is-run ｢my $ = ^2 .grep: {try 1 after 0}; my $ = {try 5 == 5}()｣,
'no spurious warnings with `try` thunks in blocks';
is-run ｢my @a; sink @a; my $b := gather { print 'meow' }; sink $b｣,
:out<meow>, 'no warnings when sinking variables';
is-run ｢use experimental :macros; macro z($) { quasi {} };
z $; z <x>; print "pass"｣, :out<pass>,
'args to macros do not cause useless use warnings';
# https://github.com/rakudo/rakudo/issues/2554
is-run ｢my @a[Int] = 1,2,3; dd @a｣,
'ignored shape specification issues a warning',
:err(/'Ignoring [Int] as shape specification'/);
# vim: ft=perl6 expandtab sw=4
| 34.659574 | 79 | 0.572744 |
eda54048192e5648c5ab0ff138737059f711bd54 | 7,498 | pm | Perl | modules/Bio/EnsEMBL/Analysis/Runnable/BlastTranscriptPep.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Analysis/Runnable/BlastTranscriptPep.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | modules/Bio/EnsEMBL/Analysis/Runnable/BlastTranscriptPep.pm | ens-bwalts/ensembl-analysis | 0ce32243f3ce17aad133ee1f5016e20ddff545bd | [
"Apache-2.0"
] | null | null | null | =head1 LICENSE
# Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
=head1 CONTACT
Please email comments or questions to the public Ensembl
developers list at <http://lists.ensembl.org/mailman/listinfo/dev>.
Questions may also be sent to the Ensembl help desk at
<http://www.ensembl.org/Help/Contact>.
=cut
=head1 NAME
Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep -
=head1 SYNOPSIS
my $blast = Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep->
new(
-transcript => $transcript,
-program => 'wublastn',
-database => 'embl_vertrna',
-options => 'hitdist=40 -cpus=1',
-parser => $bplitewrapper,
-filter => $featurefilter,
);
$blast->run;
my @output =@{$blast->output};
=head1 DESCRIPTION
This module acts as an intermediate between blast and transcripts. It
is primarily used by the runnabledb BlastGenscanPep to blast
the protein sequence of a genscan or any other ab initio prediction
againsts a protein database. It instantiates a blast runnable passing it
the Bio::Seq of the transcript translation as the query sequence. This
module expects all the same arguments as a standard blast with the
exception or a query sequence as these must be passed into the blast
runnable it instantiates
=cut
package Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep;
use strict;
use warnings;
use Bio::EnsEMBL::Utils::Exception qw(throw warning);
use Bio::EnsEMBL::Utils::Argument qw( rearrange );
use Bio::EnsEMBL::Analysis::Runnable::Blast;
use vars qw(@ISA);
@ISA = qw(Bio::EnsEMBL::Analysis::Runnable::Blast);
=head2 new
Arg [1] : Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep
Arg [Transcript]: Bio::EnsEMBL::Transcript
Function : create a BlastTranscriptPep runnable
Returntype : Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep
Exceptions : none
Example :
=cut
sub new {
my ($class,@args) = @_;
my $self = $class->SUPER::new(@args);
my ($pt) = rearrange(['TRANSCRIPT'], @args);
$self->transcript($pt);
return $self;
}
=head2 transcript
Arg [1] : Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep
Arg [2] : Bio::EnsEMBL::Transcript
Function : container for transcript
Returntype: Bio::EnsEMBL::Transcript
Exceptions: throws if not passed a Bio::EnsEMBL::Transcript
Example :
=cut
sub transcript{
my ($self, $pt) = @_;
if($pt){
throw("BlastGenscanPep:transcript must be a ".
"Bio::EnsEMBL::Transcript ")
unless($pt->isa("Bio::EnsEMBL::Transcript"));
$self->{'prediction_transcript'} = $pt;
}
return $self->{'prediction_transcript'};
}
=head2 output
Function : override the output method to allow its
resetting to empty
=cut
sub output {
my ($self, $arr_ref, $reset) = @_;
if(!$self->{'output'}){
$self->{'output'} = [];
}
if($arr_ref){
throw("Must pass Runnable:output an arrayref not a ".$arr_ref)
unless(ref($arr_ref) eq 'ARRAY');
if ($reset) {
$self->{'output'} = $arr_ref;
} else {
push(@{$self->{'output'}}, @$arr_ref);
}
}
return $self->{'output'};
}
=head2 run
Arg [1] : Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep
Arg [2] : string, working directory
Function : instantiations Blast runnable and runs it then converts
blast hits back into genomic coords
Returntype: none
Exceptions: none
Example :
=cut
sub run{
my ($self, $dir) = @_;
my $pep = $self->transcript->translate;
$pep->id($self->transcript->dbID);
if($pep->length <= 3){
#transcripts this length cause problems for blast
return;
}
my $query = $self->query;
$self->query($pep);
$self->SUPER::run($dir);
$self->query($query);
my $out = $self->output;
$self->output([], 1);
$self->align_hits_to_query($out);
}
=head2 align_hits_to_query
Arg [1] : Bio::EnsEMBL::Analysis::Runnable::BlastTranscriptPep
Arg [2] : arrayref of Bio::EnsEMBL::BaseAlignFeatures
Function : convert the features from blast from peptide coodinates
to genomic coordinates
Returntype: none
Exceptions:
Example :
=cut
sub align_hits_to_query {
my ($self, $features) = @_;
my $ff = $self->feature_factory();
my @output;
for my $feature ( @$features ) {
my %exon_hash = ();
# for each ungapped piece in it
foreach my $ugFeature ( $feature->ungapped_features() ) {
my $cdna_total = 1;
#convert peptide coords to genomic coords
my @split = $self->transcript->pep2genomic($ugFeature->start(),
$ugFeature->end());
foreach my $gcoord ( @split ) {
if($gcoord->isa('Bio::EnsEMBL::Mapper::Gap')) {
$cdna_total += $gcoord->end - $gcoord->start + 1;
next;
}
my $gstart = $gcoord->start;
my $gend = $gcoord->end;
my $gstrand = $gcoord->strand;
my $cdna_start = $cdna_total;
my $cdna_end = $cdna_start + $gend - $gstart;
$cdna_total += $gend - $gstart + 1;
#determine which exon this genomic coordinate overlaps
my $exon;
foreach my $e (@{$self->transcript->get_all_Exons}) {
if($gstart >= $e->start && $gend <= $e->end) {
$exon = $e;
last;
}
}
# first, eat away non complete codons from start
while(( $cdna_start - 1 ) % 3 != 0 ) {
$cdna_start++;
if( $gstrand == 1 ) {
$gstart++;
} else {
$gend--;
}
}
# and from end
while( $cdna_end % 3 != 0 ) {
$cdna_end--;
if( $gstrand == 1 ) {
$gend--;
} else {
$gstart++;
}
}
if( $cdna_end <= $cdna_start ) {
next;
}
my $hstart = (($cdna_start+2)/3) + $ugFeature->hstart() - 1;
my $hend = ($cdna_end / 3) + $ugFeature->hstart() - 1;
my $fp = $ff->create_feature_pair($gstart, $gend, $gstrand,
$feature->score, $hstart,
$hend, 1,
$feature->hseqname,
$feature->percent_id,
$feature->p_value,
undef,
$self->query,
$feature->analysis);
push( @{$exon_hash{$exon}}, $fp );
}
}
# Take the pieces for each exon and make gapped feature
foreach my $ex ( keys %exon_hash ) {
my $dna_align_feature = Bio::EnsEMBL::DnaPepAlignFeature->new
(-features => $exon_hash{$ex});
push(@output, $dna_align_feature);
}
}
$self->output(\@output);
}
| 27.667897 | 102 | 0.589757 |
edae421379ee7df3abf8d1d498589cf4545c4bbd | 1,502 | pm | Perl | lib/App/Yath/Command/collector.pm | ppisar/Test2-Harness | 7d1ccac6a43464ff2f2c2acd18cd8accded0c397 | [
"Artistic-1.0"
] | 20 | 2016-05-25T20:46:11.000Z | 2021-12-16T18:59:09.000Z | lib/App/Yath/Command/collector.pm | ppisar/Test2-Harness | 7d1ccac6a43464ff2f2c2acd18cd8accded0c397 | [
"Artistic-1.0"
] | 185 | 2016-05-25T04:06:37.000Z | 2022-03-24T11:57:58.000Z | lib/App/Yath/Command/collector.pm | ppisar/Test2-Harness | 7d1ccac6a43464ff2f2c2acd18cd8accded0c397 | [
"Artistic-1.0"
] | 31 | 2016-05-25T03:46:56.000Z | 2021-04-21T21:31:30.000Z | package App::Yath::Command::collector;
use strict;
use warnings;
our $VERSION = '1.000077';
use File::Spec;
use App::Yath::Util qw/isolate_stdout/;
use Test2::Harness::Util::JSON qw/decode_json/;
use Test2::Harness::Util qw/mod2file/;
use Test2::Harness::Run;
use parent 'App::Yath::Command';
use Test2::Harness::Util::HashBase;
sub internal_only { 1 }
sub summary { "For internal use only" }
sub name { 'collector' }
sub run {
my $self = shift;
my ($collector_class, $dir, $run_id, $runner_pid, %args) = @{$self->{+ARGS}};
$0 = 'yath-collector';
my $fh = isolate_stdout();
my $settings = Test2::Harness::Settings->new(File::Spec->catfile($dir, 'settings.json'));
require(mod2file($collector_class));
my $run = Test2::Harness::Run->new(%{decode_json(<STDIN>)});
my $collector = $collector_class->new(
%args,
settings => $settings,
workdir => $dir,
run_id => $run_id,
runner_pid => $runner_pid,
run => $run,
# as_json may already have the json form of the event cached, if so
# we can avoid doing an extra call to encode_json
action => sub { print $fh defined($_[0]) ? $_[0]->as_json . "\n" : "null\n"; },
);
local $SIG{PIPE} = 'IGNORE';
my $ok = eval { $collector->process(); 1 };
my $err = $@;
eval { print $fh "null\n"; 1 } or warn $@;
die $err unless $ok;
return 0;
}
1;
__END__
=head1 POD IS AUTO-GENERATED
| 22.757576 | 93 | 0.587217 |
eda67557057aff980ae4a414b30428db4b2b7253 | 395,527 | pl | Perl | ndk/prebuilt/linux-x86_64/lib/perl5/5.16.2/unicore/To/NFKCCF.pl | efortuna/AndroidSDKClone | 240e73b763c159af6bbcd111f2705b549e85295a | [
"Apache-2.0"
] | 1 | 2019-07-10T15:21:02.000Z | 2019-07-10T15:21:02.000Z | ndk/prebuilt/linux-x86_64/lib/perl5/5.16.2/unicore/To/NFKCCF.pl | efortuna/AndroidSDKClone | 240e73b763c159af6bbcd111f2705b549e85295a | [
"Apache-2.0"
] | null | null | null | ndk/prebuilt/linux-x86_64/lib/perl5/5.16.2/unicore/To/NFKCCF.pl | efortuna/AndroidSDKClone | 240e73b763c159af6bbcd111f2705b549e85295a | [
"Apache-2.0"
] | 1 | 2019-02-25T11:55:44.000Z | 2019-02-25T11:55:44.000Z | # !!!!!!! DO NOT EDIT THIS FILE !!!!!!!
# This file is machine-generated by lib/unicore/mktables from the Unicode
# database, Version 6.1.0. Any changes made here will be lost!
# !!!!!!! IT IS DEPRECATED TO USE THIS FILE !!!!!!!
# This file is for internal use by core Perl only. It is retained for
# backwards compatibility with applications that may have come to rely on it,
# but its format and even its name or existence are subject to change without
# notice in a future Perl version. Don't use it directly. Instead, its
# contents are now retrievable through a stable API in the Unicode::UCD
# module: Unicode::UCD::prop_invmap('NFKC_Casefold').
# The name this swash is to be known by, with the format of the mappings in
# the main body of the table, and what all code points missing from this file
# map to.
$utf8::SwashInfo{'ToNFKCCF'}{'format'} = 'x'; # non-negative hex whole number; a code point
$utf8::SwashInfo{'ToNFKCCF'}{'specials_name'} = 'utf8::ToSpecNFKCCF'; # Name of hash of special mappings
$utf8::SwashInfo{'ToNFKCCF'}{'missing'} = '<code point>'; # code point maps to itself
# Some code points require special handling because their mappings are each to
# multiple code points. These do not appear in the main body, but are defined
# in the hash below.
# Each key is the string of N bytes that together make up the UTF-8 encoding
# for the code point. (i.e. the same as looking at the code point's UTF-8
# under "use bytes"). Each value is the UTF-8 of the translation, for speed.
%utf8::ToSpecNFKCCF = (
"\xC2\xA8" => "\x{0020}\x{0308}", # U+00A8 => 0020 0308
"\xC2\xAD" => "", # U+00AD =>
"\xC2\xAF" => "\x{0020}\x{0304}", # U+00AF => 0020 0304
"\xC2\xB4" => "\x{0020}\x{0301}", # U+00B4 => 0020 0301
"\xC2\xB8" => "\x{0020}\x{0327}", # U+00B8 => 0020 0327
"\xC2\xBC" => "\x{0031}\x{2044}\x{0034}", # U+00BC => 0031 2044 0034
"\xC2\xBD" => "\x{0031}\x{2044}\x{0032}", # U+00BD => 0031 2044 0032
"\xC2\xBE" => "\x{0033}\x{2044}\x{0034}", # U+00BE => 0033 2044 0034
"\xC3\x9F" => "\x{0073}\x{0073}", # U+00DF => 0073 0073
"\xC4\xB0" => "\x{0069}\x{0307}", # U+0130 => 0069 0307
"\xC4\xB2" => "\x{0069}\x{006A}", # U+0132 => 0069 006A
"\xC4\xB3" => "\x{0069}\x{006A}", # U+0133 => 0069 006A
"\xC4\xBF" => "\x{006C}\x{00B7}", # U+013F => 006C 00B7
"\xC5\x80" => "\x{006C}\x{00B7}", # U+0140 => 006C 00B7
"\xC5\x89" => "\x{02BC}\x{006E}", # U+0149 => 02BC 006E
"\xC7\x84" => "\x{0064}\x{017E}", # U+01C4 => 0064 017E
"\xC7\x85" => "\x{0064}\x{017E}", # U+01C5 => 0064 017E
"\xC7\x86" => "\x{0064}\x{017E}", # U+01C6 => 0064 017E
"\xC7\x87" => "\x{006C}\x{006A}", # U+01C7 => 006C 006A
"\xC7\x88" => "\x{006C}\x{006A}", # U+01C8 => 006C 006A
"\xC7\x89" => "\x{006C}\x{006A}", # U+01C9 => 006C 006A
"\xC7\x8A" => "\x{006E}\x{006A}", # U+01CA => 006E 006A
"\xC7\x8B" => "\x{006E}\x{006A}", # U+01CB => 006E 006A
"\xC7\x8C" => "\x{006E}\x{006A}", # U+01CC => 006E 006A
"\xC7\xB1" => "\x{0064}\x{007A}", # U+01F1 => 0064 007A
"\xC7\xB2" => "\x{0064}\x{007A}", # U+01F2 => 0064 007A
"\xC7\xB3" => "\x{0064}\x{007A}", # U+01F3 => 0064 007A
"\xCB\x98" => "\x{0020}\x{0306}", # U+02D8 => 0020 0306
"\xCB\x99" => "\x{0020}\x{0307}", # U+02D9 => 0020 0307
"\xCB\x9A" => "\x{0020}\x{030A}", # U+02DA => 0020 030A
"\xCB\x9B" => "\x{0020}\x{0328}", # U+02DB => 0020 0328
"\xCB\x9C" => "\x{0020}\x{0303}", # U+02DC => 0020 0303
"\xCB\x9D" => "\x{0020}\x{030B}", # U+02DD => 0020 030B
"\xCD\x84" => "\x{0308}\x{0301}", # U+0344 => 0308 0301
"\xCD\x8F" => "", # U+034F =>
"\xCD\xBA" => "\x{0020}\x{03B9}", # U+037A => 0020 03B9
"\xCE\x84" => "\x{0020}\x{0301}", # U+0384 => 0020 0301
"\xCE\x85" => "\x{0020}\x{0308}\x{0301}", # U+0385 => 0020 0308 0301
"\xD6\x87" => "\x{0565}\x{0582}", # U+0587 => 0565 0582
"\xD9\xB5" => "\x{0627}\x{0674}", # U+0675 => 0627 0674
"\xD9\xB6" => "\x{0648}\x{0674}", # U+0676 => 0648 0674
"\xD9\xB7" => "\x{06C7}\x{0674}", # U+0677 => 06C7 0674
"\xD9\xB8" => "\x{064A}\x{0674}", # U+0678 => 064A 0674
"\xE0\xA5\x98" => "\x{0915}\x{093C}", # U+0958 => 0915 093C
"\xE0\xA5\x99" => "\x{0916}\x{093C}", # U+0959 => 0916 093C
"\xE0\xA5\x9A" => "\x{0917}\x{093C}", # U+095A => 0917 093C
"\xE0\xA5\x9B" => "\x{091C}\x{093C}", # U+095B => 091C 093C
"\xE0\xA5\x9C" => "\x{0921}\x{093C}", # U+095C => 0921 093C
"\xE0\xA5\x9D" => "\x{0922}\x{093C}", # U+095D => 0922 093C
"\xE0\xA5\x9E" => "\x{092B}\x{093C}", # U+095E => 092B 093C
"\xE0\xA5\x9F" => "\x{092F}\x{093C}", # U+095F => 092F 093C
"\xE0\xA7\x9C" => "\x{09A1}\x{09BC}", # U+09DC => 09A1 09BC
"\xE0\xA7\x9D" => "\x{09A2}\x{09BC}", # U+09DD => 09A2 09BC
"\xE0\xA7\x9F" => "\x{09AF}\x{09BC}", # U+09DF => 09AF 09BC
"\xE0\xA8\xB3" => "\x{0A32}\x{0A3C}", # U+0A33 => 0A32 0A3C
"\xE0\xA8\xB6" => "\x{0A38}\x{0A3C}", # U+0A36 => 0A38 0A3C
"\xE0\xA9\x99" => "\x{0A16}\x{0A3C}", # U+0A59 => 0A16 0A3C
"\xE0\xA9\x9A" => "\x{0A17}\x{0A3C}", # U+0A5A => 0A17 0A3C
"\xE0\xA9\x9B" => "\x{0A1C}\x{0A3C}", # U+0A5B => 0A1C 0A3C
"\xE0\xA9\x9E" => "\x{0A2B}\x{0A3C}", # U+0A5E => 0A2B 0A3C
"\xE0\xAD\x9C" => "\x{0B21}\x{0B3C}", # U+0B5C => 0B21 0B3C
"\xE0\xAD\x9D" => "\x{0B22}\x{0B3C}", # U+0B5D => 0B22 0B3C
"\xE0\xB8\xB3" => "\x{0E4D}\x{0E32}", # U+0E33 => 0E4D 0E32
"\xE0\xBA\xB3" => "\x{0ECD}\x{0EB2}", # U+0EB3 => 0ECD 0EB2
"\xE0\xBB\x9C" => "\x{0EAB}\x{0E99}", # U+0EDC => 0EAB 0E99
"\xE0\xBB\x9D" => "\x{0EAB}\x{0EA1}", # U+0EDD => 0EAB 0EA1
"\xE0\xBD\x83" => "\x{0F42}\x{0FB7}", # U+0F43 => 0F42 0FB7
"\xE0\xBD\x8D" => "\x{0F4C}\x{0FB7}", # U+0F4D => 0F4C 0FB7
"\xE0\xBD\x92" => "\x{0F51}\x{0FB7}", # U+0F52 => 0F51 0FB7
"\xE0\xBD\x97" => "\x{0F56}\x{0FB7}", # U+0F57 => 0F56 0FB7
"\xE0\xBD\x9C" => "\x{0F5B}\x{0FB7}", # U+0F5C => 0F5B 0FB7
"\xE0\xBD\xA9" => "\x{0F40}\x{0FB5}", # U+0F69 => 0F40 0FB5
"\xE0\xBD\xB3" => "\x{0F71}\x{0F72}", # U+0F73 => 0F71 0F72
"\xE0\xBD\xB5" => "\x{0F71}\x{0F74}", # U+0F75 => 0F71 0F74
"\xE0\xBD\xB6" => "\x{0FB2}\x{0F80}", # U+0F76 => 0FB2 0F80
"\xE0\xBD\xB7" => "\x{0FB2}\x{0F71}\x{0F80}", # U+0F77 => 0FB2 0F71 0F80
"\xE0\xBD\xB8" => "\x{0FB3}\x{0F80}", # U+0F78 => 0FB3 0F80
"\xE0\xBD\xB9" => "\x{0FB3}\x{0F71}\x{0F80}", # U+0F79 => 0FB3 0F71 0F80
"\xE0\xBE\x81" => "\x{0F71}\x{0F80}", # U+0F81 => 0F71 0F80
"\xE0\xBE\x93" => "\x{0F92}\x{0FB7}", # U+0F93 => 0F92 0FB7
"\xE0\xBE\x9D" => "\x{0F9C}\x{0FB7}", # U+0F9D => 0F9C 0FB7
"\xE0\xBE\xA2" => "\x{0FA1}\x{0FB7}", # U+0FA2 => 0FA1 0FB7
"\xE0\xBE\xA7" => "\x{0FA6}\x{0FB7}", # U+0FA7 => 0FA6 0FB7
"\xE0\xBE\xAC" => "\x{0FAB}\x{0FB7}", # U+0FAC => 0FAB 0FB7
"\xE0\xBE\xB9" => "\x{0F90}\x{0FB5}", # U+0FB9 => 0F90 0FB5
"\xE1\x85\x9F" => "", # U+115F =>
"\xE1\x85\xA0" => "", # U+1160 =>
"\xE1\x9E\xB4" => "", # U+17B4 =>
"\xE1\x9E\xB5" => "", # U+17B5 =>
"\xE1\xA0\x8B" => "", # U+180B =>
"\xE1\xA0\x8C" => "", # U+180C =>
"\xE1\xA0\x8D" => "", # U+180D =>
"\xE1\xBA\x9A" => "\x{0061}\x{02BE}", # U+1E9A => 0061 02BE
"\xE1\xBA\x9E" => "\x{0073}\x{0073}", # U+1E9E => 0073 0073
"\xE1\xBE\x80" => "\x{1F00}\x{03B9}", # U+1F80 => 1F00 03B9
"\xE1\xBE\x81" => "\x{1F01}\x{03B9}", # U+1F81 => 1F01 03B9
"\xE1\xBE\x82" => "\x{1F02}\x{03B9}", # U+1F82 => 1F02 03B9
"\xE1\xBE\x83" => "\x{1F03}\x{03B9}", # U+1F83 => 1F03 03B9
"\xE1\xBE\x84" => "\x{1F04}\x{03B9}", # U+1F84 => 1F04 03B9
"\xE1\xBE\x85" => "\x{1F05}\x{03B9}", # U+1F85 => 1F05 03B9
"\xE1\xBE\x86" => "\x{1F06}\x{03B9}", # U+1F86 => 1F06 03B9
"\xE1\xBE\x87" => "\x{1F07}\x{03B9}", # U+1F87 => 1F07 03B9
"\xE1\xBE\x88" => "\x{1F00}\x{03B9}", # U+1F88 => 1F00 03B9
"\xE1\xBE\x89" => "\x{1F01}\x{03B9}", # U+1F89 => 1F01 03B9
"\xE1\xBE\x8A" => "\x{1F02}\x{03B9}", # U+1F8A => 1F02 03B9
"\xE1\xBE\x8B" => "\x{1F03}\x{03B9}", # U+1F8B => 1F03 03B9
"\xE1\xBE\x8C" => "\x{1F04}\x{03B9}", # U+1F8C => 1F04 03B9
"\xE1\xBE\x8D" => "\x{1F05}\x{03B9}", # U+1F8D => 1F05 03B9
"\xE1\xBE\x8E" => "\x{1F06}\x{03B9}", # U+1F8E => 1F06 03B9
"\xE1\xBE\x8F" => "\x{1F07}\x{03B9}", # U+1F8F => 1F07 03B9
"\xE1\xBE\x90" => "\x{1F20}\x{03B9}", # U+1F90 => 1F20 03B9
"\xE1\xBE\x91" => "\x{1F21}\x{03B9}", # U+1F91 => 1F21 03B9
"\xE1\xBE\x92" => "\x{1F22}\x{03B9}", # U+1F92 => 1F22 03B9
"\xE1\xBE\x93" => "\x{1F23}\x{03B9}", # U+1F93 => 1F23 03B9
"\xE1\xBE\x94" => "\x{1F24}\x{03B9}", # U+1F94 => 1F24 03B9
"\xE1\xBE\x95" => "\x{1F25}\x{03B9}", # U+1F95 => 1F25 03B9
"\xE1\xBE\x96" => "\x{1F26}\x{03B9}", # U+1F96 => 1F26 03B9
"\xE1\xBE\x97" => "\x{1F27}\x{03B9}", # U+1F97 => 1F27 03B9
"\xE1\xBE\x98" => "\x{1F20}\x{03B9}", # U+1F98 => 1F20 03B9
"\xE1\xBE\x99" => "\x{1F21}\x{03B9}", # U+1F99 => 1F21 03B9
"\xE1\xBE\x9A" => "\x{1F22}\x{03B9}", # U+1F9A => 1F22 03B9
"\xE1\xBE\x9B" => "\x{1F23}\x{03B9}", # U+1F9B => 1F23 03B9
"\xE1\xBE\x9C" => "\x{1F24}\x{03B9}", # U+1F9C => 1F24 03B9
"\xE1\xBE\x9D" => "\x{1F25}\x{03B9}", # U+1F9D => 1F25 03B9
"\xE1\xBE\x9E" => "\x{1F26}\x{03B9}", # U+1F9E => 1F26 03B9
"\xE1\xBE\x9F" => "\x{1F27}\x{03B9}", # U+1F9F => 1F27 03B9
"\xE1\xBE\xA0" => "\x{1F60}\x{03B9}", # U+1FA0 => 1F60 03B9
"\xE1\xBE\xA1" => "\x{1F61}\x{03B9}", # U+1FA1 => 1F61 03B9
"\xE1\xBE\xA2" => "\x{1F62}\x{03B9}", # U+1FA2 => 1F62 03B9
"\xE1\xBE\xA3" => "\x{1F63}\x{03B9}", # U+1FA3 => 1F63 03B9
"\xE1\xBE\xA4" => "\x{1F64}\x{03B9}", # U+1FA4 => 1F64 03B9
"\xE1\xBE\xA5" => "\x{1F65}\x{03B9}", # U+1FA5 => 1F65 03B9
"\xE1\xBE\xA6" => "\x{1F66}\x{03B9}", # U+1FA6 => 1F66 03B9
"\xE1\xBE\xA7" => "\x{1F67}\x{03B9}", # U+1FA7 => 1F67 03B9
"\xE1\xBE\xA8" => "\x{1F60}\x{03B9}", # U+1FA8 => 1F60 03B9
"\xE1\xBE\xA9" => "\x{1F61}\x{03B9}", # U+1FA9 => 1F61 03B9
"\xE1\xBE\xAA" => "\x{1F62}\x{03B9}", # U+1FAA => 1F62 03B9
"\xE1\xBE\xAB" => "\x{1F63}\x{03B9}", # U+1FAB => 1F63 03B9
"\xE1\xBE\xAC" => "\x{1F64}\x{03B9}", # U+1FAC => 1F64 03B9
"\xE1\xBE\xAD" => "\x{1F65}\x{03B9}", # U+1FAD => 1F65 03B9
"\xE1\xBE\xAE" => "\x{1F66}\x{03B9}", # U+1FAE => 1F66 03B9
"\xE1\xBE\xAF" => "\x{1F67}\x{03B9}", # U+1FAF => 1F67 03B9
"\xE1\xBE\xB2" => "\x{1F70}\x{03B9}", # U+1FB2 => 1F70 03B9
"\xE1\xBE\xB3" => "\x{03B1}\x{03B9}", # U+1FB3 => 03B1 03B9
"\xE1\xBE\xB4" => "\x{03AC}\x{03B9}", # U+1FB4 => 03AC 03B9
"\xE1\xBE\xB7" => "\x{1FB6}\x{03B9}", # U+1FB7 => 1FB6 03B9
"\xE1\xBE\xBC" => "\x{03B1}\x{03B9}", # U+1FBC => 03B1 03B9
"\xE1\xBE\xBD" => "\x{0020}\x{0313}", # U+1FBD => 0020 0313
"\xE1\xBE\xBF" => "\x{0020}\x{0313}", # U+1FBF => 0020 0313
"\xE1\xBF\x80" => "\x{0020}\x{0342}", # U+1FC0 => 0020 0342
"\xE1\xBF\x81" => "\x{0020}\x{0308}\x{0342}", # U+1FC1 => 0020 0308 0342
"\xE1\xBF\x82" => "\x{1F74}\x{03B9}", # U+1FC2 => 1F74 03B9
"\xE1\xBF\x83" => "\x{03B7}\x{03B9}", # U+1FC3 => 03B7 03B9
"\xE1\xBF\x84" => "\x{03AE}\x{03B9}", # U+1FC4 => 03AE 03B9
"\xE1\xBF\x87" => "\x{1FC6}\x{03B9}", # U+1FC7 => 1FC6 03B9
"\xE1\xBF\x8C" => "\x{03B7}\x{03B9}", # U+1FCC => 03B7 03B9
"\xE1\xBF\x8D" => "\x{0020}\x{0313}\x{0300}", # U+1FCD => 0020 0313 0300
"\xE1\xBF\x8E" => "\x{0020}\x{0313}\x{0301}", # U+1FCE => 0020 0313 0301
"\xE1\xBF\x8F" => "\x{0020}\x{0313}\x{0342}", # U+1FCF => 0020 0313 0342
"\xE1\xBF\x9D" => "\x{0020}\x{0314}\x{0300}", # U+1FDD => 0020 0314 0300
"\xE1\xBF\x9E" => "\x{0020}\x{0314}\x{0301}", # U+1FDE => 0020 0314 0301
"\xE1\xBF\x9F" => "\x{0020}\x{0314}\x{0342}", # U+1FDF => 0020 0314 0342
"\xE1\xBF\xAD" => "\x{0020}\x{0308}\x{0300}", # U+1FED => 0020 0308 0300
"\xE1\xBF\xAE" => "\x{0020}\x{0308}\x{0301}", # U+1FEE => 0020 0308 0301
"\xE1\xBF\xB2" => "\x{1F7C}\x{03B9}", # U+1FF2 => 1F7C 03B9
"\xE1\xBF\xB3" => "\x{03C9}\x{03B9}", # U+1FF3 => 03C9 03B9
"\xE1\xBF\xB4" => "\x{03CE}\x{03B9}", # U+1FF4 => 03CE 03B9
"\xE1\xBF\xB7" => "\x{1FF6}\x{03B9}", # U+1FF7 => 1FF6 03B9
"\xE1\xBF\xBC" => "\x{03C9}\x{03B9}", # U+1FFC => 03C9 03B9
"\xE1\xBF\xBD" => "\x{0020}\x{0301}", # U+1FFD => 0020 0301
"\xE1\xBF\xBE" => "\x{0020}\x{0314}", # U+1FFE => 0020 0314
"\xE2\x80\x8B" => "", # U+200B =>
"\xE2\x80\x8C" => "", # U+200C =>
"\xE2\x80\x8D" => "", # U+200D =>
"\xE2\x80\x8E" => "", # U+200E =>
"\xE2\x80\x8F" => "", # U+200F =>
"\xE2\x80\x97" => "\x{0020}\x{0333}", # U+2017 => 0020 0333
"\xE2\x80\xA5" => "\x{002E}\x{002E}", # U+2025 => 002E 002E
"\xE2\x80\xA6" => "\x{002E}\x{002E}\x{002E}", # U+2026 => 002E 002E 002E
"\xE2\x80\xAA" => "", # U+202A =>
"\xE2\x80\xAB" => "", # U+202B =>
"\xE2\x80\xAC" => "", # U+202C =>
"\xE2\x80\xAD" => "", # U+202D =>
"\xE2\x80\xAE" => "", # U+202E =>
"\xE2\x80\xB3" => "\x{2032}\x{2032}", # U+2033 => 2032 2032
"\xE2\x80\xB4" => "\x{2032}\x{2032}\x{2032}", # U+2034 => 2032 2032 2032
"\xE2\x80\xB6" => "\x{2035}\x{2035}", # U+2036 => 2035 2035
"\xE2\x80\xB7" => "\x{2035}\x{2035}\x{2035}", # U+2037 => 2035 2035 2035
"\xE2\x80\xBC" => "\x{0021}\x{0021}", # U+203C => 0021 0021
"\xE2\x80\xBE" => "\x{0020}\x{0305}", # U+203E => 0020 0305
"\xE2\x81\x87" => "\x{003F}\x{003F}", # U+2047 => 003F 003F
"\xE2\x81\x88" => "\x{003F}\x{0021}", # U+2048 => 003F 0021
"\xE2\x81\x89" => "\x{0021}\x{003F}", # U+2049 => 0021 003F
"\xE2\x81\x97" => "\x{2032}\x{2032}\x{2032}\x{2032}", # U+2057 => 2032 2032 2032 2032
"\xE2\x81\xA0" => "", # U+2060 =>
"\xE2\x81\xA1" => "", # U+2061 =>
"\xE2\x81\xA2" => "", # U+2062 =>
"\xE2\x81\xA3" => "", # U+2063 =>
"\xE2\x81\xA4" => "", # U+2064 =>
"\xE2\x81\xA5" => "", # U+2065 =>
"\xE2\x81\xA6" => "", # U+2066 =>
"\xE2\x81\xA7" => "", # U+2067 =>
"\xE2\x81\xA8" => "", # U+2068 =>
"\xE2\x81\xA9" => "", # U+2069 =>
"\xE2\x81\xAA" => "", # U+206A =>
"\xE2\x81\xAB" => "", # U+206B =>
"\xE2\x81\xAC" => "", # U+206C =>
"\xE2\x81\xAD" => "", # U+206D =>
"\xE2\x81\xAE" => "", # U+206E =>
"\xE2\x81\xAF" => "", # U+206F =>
"\xE2\x82\xA8" => "\x{0072}\x{0073}", # U+20A8 => 0072 0073
"\xE2\x84\x80" => "\x{0061}\x{002F}\x{0063}", # U+2100 => 0061 002F 0063
"\xE2\x84\x81" => "\x{0061}\x{002F}\x{0073}", # U+2101 => 0061 002F 0073
"\xE2\x84\x83" => "\x{00B0}\x{0063}", # U+2103 => 00B0 0063
"\xE2\x84\x85" => "\x{0063}\x{002F}\x{006F}", # U+2105 => 0063 002F 006F
"\xE2\x84\x86" => "\x{0063}\x{002F}\x{0075}", # U+2106 => 0063 002F 0075
"\xE2\x84\x89" => "\x{00B0}\x{0066}", # U+2109 => 00B0 0066
"\xE2\x84\x96" => "\x{006E}\x{006F}", # U+2116 => 006E 006F
"\xE2\x84\xA0" => "\x{0073}\x{006D}", # U+2120 => 0073 006D
"\xE2\x84\xA1" => "\x{0074}\x{0065}\x{006C}", # U+2121 => 0074 0065 006C
"\xE2\x84\xA2" => "\x{0074}\x{006D}", # U+2122 => 0074 006D
"\xE2\x84\xBB" => "\x{0066}\x{0061}\x{0078}", # U+213B => 0066 0061 0078
"\xE2\x85\x90" => "\x{0031}\x{2044}\x{0037}", # U+2150 => 0031 2044 0037
"\xE2\x85\x91" => "\x{0031}\x{2044}\x{0039}", # U+2151 => 0031 2044 0039
"\xE2\x85\x92" => "\x{0031}\x{2044}\x{0031}\x{0030}", # U+2152 => 0031 2044 0031 0030
"\xE2\x85\x93" => "\x{0031}\x{2044}\x{0033}", # U+2153 => 0031 2044 0033
"\xE2\x85\x94" => "\x{0032}\x{2044}\x{0033}", # U+2154 => 0032 2044 0033
"\xE2\x85\x95" => "\x{0031}\x{2044}\x{0035}", # U+2155 => 0031 2044 0035
"\xE2\x85\x96" => "\x{0032}\x{2044}\x{0035}", # U+2156 => 0032 2044 0035
"\xE2\x85\x97" => "\x{0033}\x{2044}\x{0035}", # U+2157 => 0033 2044 0035
"\xE2\x85\x98" => "\x{0034}\x{2044}\x{0035}", # U+2158 => 0034 2044 0035
"\xE2\x85\x99" => "\x{0031}\x{2044}\x{0036}", # U+2159 => 0031 2044 0036
"\xE2\x85\x9A" => "\x{0035}\x{2044}\x{0036}", # U+215A => 0035 2044 0036
"\xE2\x85\x9B" => "\x{0031}\x{2044}\x{0038}", # U+215B => 0031 2044 0038
"\xE2\x85\x9C" => "\x{0033}\x{2044}\x{0038}", # U+215C => 0033 2044 0038
"\xE2\x85\x9D" => "\x{0035}\x{2044}\x{0038}", # U+215D => 0035 2044 0038
"\xE2\x85\x9E" => "\x{0037}\x{2044}\x{0038}", # U+215E => 0037 2044 0038
"\xE2\x85\x9F" => "\x{0031}\x{2044}", # U+215F => 0031 2044
"\xE2\x85\xA1" => "\x{0069}\x{0069}", # U+2161 => 0069 0069
"\xE2\x85\xA2" => "\x{0069}\x{0069}\x{0069}", # U+2162 => 0069 0069 0069
"\xE2\x85\xA3" => "\x{0069}\x{0076}", # U+2163 => 0069 0076
"\xE2\x85\xA5" => "\x{0076}\x{0069}", # U+2165 => 0076 0069
"\xE2\x85\xA6" => "\x{0076}\x{0069}\x{0069}", # U+2166 => 0076 0069 0069
"\xE2\x85\xA7" => "\x{0076}\x{0069}\x{0069}\x{0069}", # U+2167 => 0076 0069 0069 0069
"\xE2\x85\xA8" => "\x{0069}\x{0078}", # U+2168 => 0069 0078
"\xE2\x85\xAA" => "\x{0078}\x{0069}", # U+216A => 0078 0069
"\xE2\x85\xAB" => "\x{0078}\x{0069}\x{0069}", # U+216B => 0078 0069 0069
"\xE2\x85\xB1" => "\x{0069}\x{0069}", # U+2171 => 0069 0069
"\xE2\x85\xB2" => "\x{0069}\x{0069}\x{0069}", # U+2172 => 0069 0069 0069
"\xE2\x85\xB3" => "\x{0069}\x{0076}", # U+2173 => 0069 0076
"\xE2\x85\xB5" => "\x{0076}\x{0069}", # U+2175 => 0076 0069
"\xE2\x85\xB6" => "\x{0076}\x{0069}\x{0069}", # U+2176 => 0076 0069 0069
"\xE2\x85\xB7" => "\x{0076}\x{0069}\x{0069}\x{0069}", # U+2177 => 0076 0069 0069 0069
"\xE2\x85\xB8" => "\x{0069}\x{0078}", # U+2178 => 0069 0078
"\xE2\x85\xBA" => "\x{0078}\x{0069}", # U+217A => 0078 0069
"\xE2\x85\xBB" => "\x{0078}\x{0069}\x{0069}", # U+217B => 0078 0069 0069
"\xE2\x86\x89" => "\x{0030}\x{2044}\x{0033}", # U+2189 => 0030 2044 0033
"\xE2\x88\xAC" => "\x{222B}\x{222B}", # U+222C => 222B 222B
"\xE2\x88\xAD" => "\x{222B}\x{222B}\x{222B}", # U+222D => 222B 222B 222B
"\xE2\x88\xAF" => "\x{222E}\x{222E}", # U+222F => 222E 222E
"\xE2\x88\xB0" => "\x{222E}\x{222E}\x{222E}", # U+2230 => 222E 222E 222E
"\xE2\x91\xA9" => "\x{0031}\x{0030}", # U+2469 => 0031 0030
"\xE2\x91\xAA" => "\x{0031}\x{0031}", # U+246A => 0031 0031
"\xE2\x91\xAB" => "\x{0031}\x{0032}", # U+246B => 0031 0032
"\xE2\x91\xAC" => "\x{0031}\x{0033}", # U+246C => 0031 0033
"\xE2\x91\xAD" => "\x{0031}\x{0034}", # U+246D => 0031 0034
"\xE2\x91\xAE" => "\x{0031}\x{0035}", # U+246E => 0031 0035
"\xE2\x91\xAF" => "\x{0031}\x{0036}", # U+246F => 0031 0036
"\xE2\x91\xB0" => "\x{0031}\x{0037}", # U+2470 => 0031 0037
"\xE2\x91\xB1" => "\x{0031}\x{0038}", # U+2471 => 0031 0038
"\xE2\x91\xB2" => "\x{0031}\x{0039}", # U+2472 => 0031 0039
"\xE2\x91\xB3" => "\x{0032}\x{0030}", # U+2473 => 0032 0030
"\xE2\x91\xB4" => "\x{0028}\x{0031}\x{0029}", # U+2474 => 0028 0031 0029
"\xE2\x91\xB5" => "\x{0028}\x{0032}\x{0029}", # U+2475 => 0028 0032 0029
"\xE2\x91\xB6" => "\x{0028}\x{0033}\x{0029}", # U+2476 => 0028 0033 0029
"\xE2\x91\xB7" => "\x{0028}\x{0034}\x{0029}", # U+2477 => 0028 0034 0029
"\xE2\x91\xB8" => "\x{0028}\x{0035}\x{0029}", # U+2478 => 0028 0035 0029
"\xE2\x91\xB9" => "\x{0028}\x{0036}\x{0029}", # U+2479 => 0028 0036 0029
"\xE2\x91\xBA" => "\x{0028}\x{0037}\x{0029}", # U+247A => 0028 0037 0029
"\xE2\x91\xBB" => "\x{0028}\x{0038}\x{0029}", # U+247B => 0028 0038 0029
"\xE2\x91\xBC" => "\x{0028}\x{0039}\x{0029}", # U+247C => 0028 0039 0029
"\xE2\x91\xBD" => "\x{0028}\x{0031}\x{0030}\x{0029}", # U+247D => 0028 0031 0030 0029
"\xE2\x91\xBE" => "\x{0028}\x{0031}\x{0031}\x{0029}", # U+247E => 0028 0031 0031 0029
"\xE2\x91\xBF" => "\x{0028}\x{0031}\x{0032}\x{0029}", # U+247F => 0028 0031 0032 0029
"\xE2\x92\x80" => "\x{0028}\x{0031}\x{0033}\x{0029}", # U+2480 => 0028 0031 0033 0029
"\xE2\x92\x81" => "\x{0028}\x{0031}\x{0034}\x{0029}", # U+2481 => 0028 0031 0034 0029
"\xE2\x92\x82" => "\x{0028}\x{0031}\x{0035}\x{0029}", # U+2482 => 0028 0031 0035 0029
"\xE2\x92\x83" => "\x{0028}\x{0031}\x{0036}\x{0029}", # U+2483 => 0028 0031 0036 0029
"\xE2\x92\x84" => "\x{0028}\x{0031}\x{0037}\x{0029}", # U+2484 => 0028 0031 0037 0029
"\xE2\x92\x85" => "\x{0028}\x{0031}\x{0038}\x{0029}", # U+2485 => 0028 0031 0038 0029
"\xE2\x92\x86" => "\x{0028}\x{0031}\x{0039}\x{0029}", # U+2486 => 0028 0031 0039 0029
"\xE2\x92\x87" => "\x{0028}\x{0032}\x{0030}\x{0029}", # U+2487 => 0028 0032 0030 0029
"\xE2\x92\x88" => "\x{0031}\x{002E}", # U+2488 => 0031 002E
"\xE2\x92\x89" => "\x{0032}\x{002E}", # U+2489 => 0032 002E
"\xE2\x92\x8A" => "\x{0033}\x{002E}", # U+248A => 0033 002E
"\xE2\x92\x8B" => "\x{0034}\x{002E}", # U+248B => 0034 002E
"\xE2\x92\x8C" => "\x{0035}\x{002E}", # U+248C => 0035 002E
"\xE2\x92\x8D" => "\x{0036}\x{002E}", # U+248D => 0036 002E
"\xE2\x92\x8E" => "\x{0037}\x{002E}", # U+248E => 0037 002E
"\xE2\x92\x8F" => "\x{0038}\x{002E}", # U+248F => 0038 002E
"\xE2\x92\x90" => "\x{0039}\x{002E}", # U+2490 => 0039 002E
"\xE2\x92\x91" => "\x{0031}\x{0030}\x{002E}", # U+2491 => 0031 0030 002E
"\xE2\x92\x92" => "\x{0031}\x{0031}\x{002E}", # U+2492 => 0031 0031 002E
"\xE2\x92\x93" => "\x{0031}\x{0032}\x{002E}", # U+2493 => 0031 0032 002E
"\xE2\x92\x94" => "\x{0031}\x{0033}\x{002E}", # U+2494 => 0031 0033 002E
"\xE2\x92\x95" => "\x{0031}\x{0034}\x{002E}", # U+2495 => 0031 0034 002E
"\xE2\x92\x96" => "\x{0031}\x{0035}\x{002E}", # U+2496 => 0031 0035 002E
"\xE2\x92\x97" => "\x{0031}\x{0036}\x{002E}", # U+2497 => 0031 0036 002E
"\xE2\x92\x98" => "\x{0031}\x{0037}\x{002E}", # U+2498 => 0031 0037 002E
"\xE2\x92\x99" => "\x{0031}\x{0038}\x{002E}", # U+2499 => 0031 0038 002E
"\xE2\x92\x9A" => "\x{0031}\x{0039}\x{002E}", # U+249A => 0031 0039 002E
"\xE2\x92\x9B" => "\x{0032}\x{0030}\x{002E}", # U+249B => 0032 0030 002E
"\xE2\x92\x9C" => "\x{0028}\x{0061}\x{0029}", # U+249C => 0028 0061 0029
"\xE2\x92\x9D" => "\x{0028}\x{0062}\x{0029}", # U+249D => 0028 0062 0029
"\xE2\x92\x9E" => "\x{0028}\x{0063}\x{0029}", # U+249E => 0028 0063 0029
"\xE2\x92\x9F" => "\x{0028}\x{0064}\x{0029}", # U+249F => 0028 0064 0029
"\xE2\x92\xA0" => "\x{0028}\x{0065}\x{0029}", # U+24A0 => 0028 0065 0029
"\xE2\x92\xA1" => "\x{0028}\x{0066}\x{0029}", # U+24A1 => 0028 0066 0029
"\xE2\x92\xA2" => "\x{0028}\x{0067}\x{0029}", # U+24A2 => 0028 0067 0029
"\xE2\x92\xA3" => "\x{0028}\x{0068}\x{0029}", # U+24A3 => 0028 0068 0029
"\xE2\x92\xA4" => "\x{0028}\x{0069}\x{0029}", # U+24A4 => 0028 0069 0029
"\xE2\x92\xA5" => "\x{0028}\x{006A}\x{0029}", # U+24A5 => 0028 006A 0029
"\xE2\x92\xA6" => "\x{0028}\x{006B}\x{0029}", # U+24A6 => 0028 006B 0029
"\xE2\x92\xA7" => "\x{0028}\x{006C}\x{0029}", # U+24A7 => 0028 006C 0029
"\xE2\x92\xA8" => "\x{0028}\x{006D}\x{0029}", # U+24A8 => 0028 006D 0029
"\xE2\x92\xA9" => "\x{0028}\x{006E}\x{0029}", # U+24A9 => 0028 006E 0029
"\xE2\x92\xAA" => "\x{0028}\x{006F}\x{0029}", # U+24AA => 0028 006F 0029
"\xE2\x92\xAB" => "\x{0028}\x{0070}\x{0029}", # U+24AB => 0028 0070 0029
"\xE2\x92\xAC" => "\x{0028}\x{0071}\x{0029}", # U+24AC => 0028 0071 0029
"\xE2\x92\xAD" => "\x{0028}\x{0072}\x{0029}", # U+24AD => 0028 0072 0029
"\xE2\x92\xAE" => "\x{0028}\x{0073}\x{0029}", # U+24AE => 0028 0073 0029
"\xE2\x92\xAF" => "\x{0028}\x{0074}\x{0029}", # U+24AF => 0028 0074 0029
"\xE2\x92\xB0" => "\x{0028}\x{0075}\x{0029}", # U+24B0 => 0028 0075 0029
"\xE2\x92\xB1" => "\x{0028}\x{0076}\x{0029}", # U+24B1 => 0028 0076 0029
"\xE2\x92\xB2" => "\x{0028}\x{0077}\x{0029}", # U+24B2 => 0028 0077 0029
"\xE2\x92\xB3" => "\x{0028}\x{0078}\x{0029}", # U+24B3 => 0028 0078 0029
"\xE2\x92\xB4" => "\x{0028}\x{0079}\x{0029}", # U+24B4 => 0028 0079 0029
"\xE2\x92\xB5" => "\x{0028}\x{007A}\x{0029}", # U+24B5 => 0028 007A 0029
"\xE2\xA8\x8C" => "\x{222B}\x{222B}\x{222B}\x{222B}", # U+2A0C => 222B 222B 222B 222B
"\xE2\xA9\xB4" => "\x{003A}\x{003A}\x{003D}", # U+2A74 => 003A 003A 003D
"\xE2\xA9\xB5" => "\x{003D}\x{003D}", # U+2A75 => 003D 003D
"\xE2\xA9\xB6" => "\x{003D}\x{003D}\x{003D}", # U+2A76 => 003D 003D 003D
"\xE2\xAB\x9C" => "\x{2ADD}\x{0338}", # U+2ADC => 2ADD 0338
"\xE3\x82\x9B" => "\x{0020}\x{3099}", # U+309B => 0020 3099
"\xE3\x82\x9C" => "\x{0020}\x{309A}", # U+309C => 0020 309A
"\xE3\x82\x9F" => "\x{3088}\x{308A}", # U+309F => 3088 308A
"\xE3\x83\xBF" => "\x{30B3}\x{30C8}", # U+30FF => 30B3 30C8
"\xE3\x85\xA4" => "", # U+3164 =>
"\xE3\x88\x80" => "\x{0028}\x{1100}\x{0029}", # U+3200 => 0028 1100 0029
"\xE3\x88\x81" => "\x{0028}\x{1102}\x{0029}", # U+3201 => 0028 1102 0029
"\xE3\x88\x82" => "\x{0028}\x{1103}\x{0029}", # U+3202 => 0028 1103 0029
"\xE3\x88\x83" => "\x{0028}\x{1105}\x{0029}", # U+3203 => 0028 1105 0029
"\xE3\x88\x84" => "\x{0028}\x{1106}\x{0029}", # U+3204 => 0028 1106 0029
"\xE3\x88\x85" => "\x{0028}\x{1107}\x{0029}", # U+3205 => 0028 1107 0029
"\xE3\x88\x86" => "\x{0028}\x{1109}\x{0029}", # U+3206 => 0028 1109 0029
"\xE3\x88\x87" => "\x{0028}\x{110B}\x{0029}", # U+3207 => 0028 110B 0029
"\xE3\x88\x88" => "\x{0028}\x{110C}\x{0029}", # U+3208 => 0028 110C 0029
"\xE3\x88\x89" => "\x{0028}\x{110E}\x{0029}", # U+3209 => 0028 110E 0029
"\xE3\x88\x8A" => "\x{0028}\x{110F}\x{0029}", # U+320A => 0028 110F 0029
"\xE3\x88\x8B" => "\x{0028}\x{1110}\x{0029}", # U+320B => 0028 1110 0029
"\xE3\x88\x8C" => "\x{0028}\x{1111}\x{0029}", # U+320C => 0028 1111 0029
"\xE3\x88\x8D" => "\x{0028}\x{1112}\x{0029}", # U+320D => 0028 1112 0029
"\xE3\x88\x8E" => "\x{0028}\x{AC00}\x{0029}", # U+320E => 0028 AC00 0029
"\xE3\x88\x8F" => "\x{0028}\x{B098}\x{0029}", # U+320F => 0028 B098 0029
"\xE3\x88\x90" => "\x{0028}\x{B2E4}\x{0029}", # U+3210 => 0028 B2E4 0029
"\xE3\x88\x91" => "\x{0028}\x{B77C}\x{0029}", # U+3211 => 0028 B77C 0029
"\xE3\x88\x92" => "\x{0028}\x{B9C8}\x{0029}", # U+3212 => 0028 B9C8 0029
"\xE3\x88\x93" => "\x{0028}\x{BC14}\x{0029}", # U+3213 => 0028 BC14 0029
"\xE3\x88\x94" => "\x{0028}\x{C0AC}\x{0029}", # U+3214 => 0028 C0AC 0029
"\xE3\x88\x95" => "\x{0028}\x{C544}\x{0029}", # U+3215 => 0028 C544 0029
"\xE3\x88\x96" => "\x{0028}\x{C790}\x{0029}", # U+3216 => 0028 C790 0029
"\xE3\x88\x97" => "\x{0028}\x{CC28}\x{0029}", # U+3217 => 0028 CC28 0029
"\xE3\x88\x98" => "\x{0028}\x{CE74}\x{0029}", # U+3218 => 0028 CE74 0029
"\xE3\x88\x99" => "\x{0028}\x{D0C0}\x{0029}", # U+3219 => 0028 D0C0 0029
"\xE3\x88\x9A" => "\x{0028}\x{D30C}\x{0029}", # U+321A => 0028 D30C 0029
"\xE3\x88\x9B" => "\x{0028}\x{D558}\x{0029}", # U+321B => 0028 D558 0029
"\xE3\x88\x9C" => "\x{0028}\x{C8FC}\x{0029}", # U+321C => 0028 C8FC 0029
"\xE3\x88\x9D" => "\x{0028}\x{C624}\x{C804}\x{0029}", # U+321D => 0028 C624 C804 0029
"\xE3\x88\x9E" => "\x{0028}\x{C624}\x{D6C4}\x{0029}", # U+321E => 0028 C624 D6C4 0029
"\xE3\x88\xA0" => "\x{0028}\x{4E00}\x{0029}", # U+3220 => 0028 4E00 0029
"\xE3\x88\xA1" => "\x{0028}\x{4E8C}\x{0029}", # U+3221 => 0028 4E8C 0029
"\xE3\x88\xA2" => "\x{0028}\x{4E09}\x{0029}", # U+3222 => 0028 4E09 0029
"\xE3\x88\xA3" => "\x{0028}\x{56DB}\x{0029}", # U+3223 => 0028 56DB 0029
"\xE3\x88\xA4" => "\x{0028}\x{4E94}\x{0029}", # U+3224 => 0028 4E94 0029
"\xE3\x88\xA5" => "\x{0028}\x{516D}\x{0029}", # U+3225 => 0028 516D 0029
"\xE3\x88\xA6" => "\x{0028}\x{4E03}\x{0029}", # U+3226 => 0028 4E03 0029
"\xE3\x88\xA7" => "\x{0028}\x{516B}\x{0029}", # U+3227 => 0028 516B 0029
"\xE3\x88\xA8" => "\x{0028}\x{4E5D}\x{0029}", # U+3228 => 0028 4E5D 0029
"\xE3\x88\xA9" => "\x{0028}\x{5341}\x{0029}", # U+3229 => 0028 5341 0029
"\xE3\x88\xAA" => "\x{0028}\x{6708}\x{0029}", # U+322A => 0028 6708 0029
"\xE3\x88\xAB" => "\x{0028}\x{706B}\x{0029}", # U+322B => 0028 706B 0029
"\xE3\x88\xAC" => "\x{0028}\x{6C34}\x{0029}", # U+322C => 0028 6C34 0029
"\xE3\x88\xAD" => "\x{0028}\x{6728}\x{0029}", # U+322D => 0028 6728 0029
"\xE3\x88\xAE" => "\x{0028}\x{91D1}\x{0029}", # U+322E => 0028 91D1 0029
"\xE3\x88\xAF" => "\x{0028}\x{571F}\x{0029}", # U+322F => 0028 571F 0029
"\xE3\x88\xB0" => "\x{0028}\x{65E5}\x{0029}", # U+3230 => 0028 65E5 0029
"\xE3\x88\xB1" => "\x{0028}\x{682A}\x{0029}", # U+3231 => 0028 682A 0029
"\xE3\x88\xB2" => "\x{0028}\x{6709}\x{0029}", # U+3232 => 0028 6709 0029
"\xE3\x88\xB3" => "\x{0028}\x{793E}\x{0029}", # U+3233 => 0028 793E 0029
"\xE3\x88\xB4" => "\x{0028}\x{540D}\x{0029}", # U+3234 => 0028 540D 0029
"\xE3\x88\xB5" => "\x{0028}\x{7279}\x{0029}", # U+3235 => 0028 7279 0029
"\xE3\x88\xB6" => "\x{0028}\x{8CA1}\x{0029}", # U+3236 => 0028 8CA1 0029
"\xE3\x88\xB7" => "\x{0028}\x{795D}\x{0029}", # U+3237 => 0028 795D 0029
"\xE3\x88\xB8" => "\x{0028}\x{52B4}\x{0029}", # U+3238 => 0028 52B4 0029
"\xE3\x88\xB9" => "\x{0028}\x{4EE3}\x{0029}", # U+3239 => 0028 4EE3 0029
"\xE3\x88\xBA" => "\x{0028}\x{547C}\x{0029}", # U+323A => 0028 547C 0029
"\xE3\x88\xBB" => "\x{0028}\x{5B66}\x{0029}", # U+323B => 0028 5B66 0029
"\xE3\x88\xBC" => "\x{0028}\x{76E3}\x{0029}", # U+323C => 0028 76E3 0029
"\xE3\x88\xBD" => "\x{0028}\x{4F01}\x{0029}", # U+323D => 0028 4F01 0029
"\xE3\x88\xBE" => "\x{0028}\x{8CC7}\x{0029}", # U+323E => 0028 8CC7 0029
"\xE3\x88\xBF" => "\x{0028}\x{5354}\x{0029}", # U+323F => 0028 5354 0029
"\xE3\x89\x80" => "\x{0028}\x{796D}\x{0029}", # U+3240 => 0028 796D 0029
"\xE3\x89\x81" => "\x{0028}\x{4F11}\x{0029}", # U+3241 => 0028 4F11 0029
"\xE3\x89\x82" => "\x{0028}\x{81EA}\x{0029}", # U+3242 => 0028 81EA 0029
"\xE3\x89\x83" => "\x{0028}\x{81F3}\x{0029}", # U+3243 => 0028 81F3 0029
"\xE3\x89\x90" => "\x{0070}\x{0074}\x{0065}", # U+3250 => 0070 0074 0065
"\xE3\x89\x91" => "\x{0032}\x{0031}", # U+3251 => 0032 0031
"\xE3\x89\x92" => "\x{0032}\x{0032}", # U+3252 => 0032 0032
"\xE3\x89\x93" => "\x{0032}\x{0033}", # U+3253 => 0032 0033
"\xE3\x89\x94" => "\x{0032}\x{0034}", # U+3254 => 0032 0034
"\xE3\x89\x95" => "\x{0032}\x{0035}", # U+3255 => 0032 0035
"\xE3\x89\x96" => "\x{0032}\x{0036}", # U+3256 => 0032 0036
"\xE3\x89\x97" => "\x{0032}\x{0037}", # U+3257 => 0032 0037
"\xE3\x89\x98" => "\x{0032}\x{0038}", # U+3258 => 0032 0038
"\xE3\x89\x99" => "\x{0032}\x{0039}", # U+3259 => 0032 0039
"\xE3\x89\x9A" => "\x{0033}\x{0030}", # U+325A => 0033 0030
"\xE3\x89\x9B" => "\x{0033}\x{0031}", # U+325B => 0033 0031
"\xE3\x89\x9C" => "\x{0033}\x{0032}", # U+325C => 0033 0032
"\xE3\x89\x9D" => "\x{0033}\x{0033}", # U+325D => 0033 0033
"\xE3\x89\x9E" => "\x{0033}\x{0034}", # U+325E => 0033 0034
"\xE3\x89\x9F" => "\x{0033}\x{0035}", # U+325F => 0033 0035
"\xE3\x89\xBC" => "\x{CC38}\x{ACE0}", # U+327C => CC38 ACE0
"\xE3\x89\xBD" => "\x{C8FC}\x{C758}", # U+327D => C8FC C758
"\xE3\x8A\xB1" => "\x{0033}\x{0036}", # U+32B1 => 0033 0036
"\xE3\x8A\xB2" => "\x{0033}\x{0037}", # U+32B2 => 0033 0037
"\xE3\x8A\xB3" => "\x{0033}\x{0038}", # U+32B3 => 0033 0038
"\xE3\x8A\xB4" => "\x{0033}\x{0039}", # U+32B4 => 0033 0039
"\xE3\x8A\xB5" => "\x{0034}\x{0030}", # U+32B5 => 0034 0030
"\xE3\x8A\xB6" => "\x{0034}\x{0031}", # U+32B6 => 0034 0031
"\xE3\x8A\xB7" => "\x{0034}\x{0032}", # U+32B7 => 0034 0032
"\xE3\x8A\xB8" => "\x{0034}\x{0033}", # U+32B8 => 0034 0033
"\xE3\x8A\xB9" => "\x{0034}\x{0034}", # U+32B9 => 0034 0034
"\xE3\x8A\xBA" => "\x{0034}\x{0035}", # U+32BA => 0034 0035
"\xE3\x8A\xBB" => "\x{0034}\x{0036}", # U+32BB => 0034 0036
"\xE3\x8A\xBC" => "\x{0034}\x{0037}", # U+32BC => 0034 0037
"\xE3\x8A\xBD" => "\x{0034}\x{0038}", # U+32BD => 0034 0038
"\xE3\x8A\xBE" => "\x{0034}\x{0039}", # U+32BE => 0034 0039
"\xE3\x8A\xBF" => "\x{0035}\x{0030}", # U+32BF => 0035 0030
"\xE3\x8B\x80" => "\x{0031}\x{6708}", # U+32C0 => 0031 6708
"\xE3\x8B\x81" => "\x{0032}\x{6708}", # U+32C1 => 0032 6708
"\xE3\x8B\x82" => "\x{0033}\x{6708}", # U+32C2 => 0033 6708
"\xE3\x8B\x83" => "\x{0034}\x{6708}", # U+32C3 => 0034 6708
"\xE3\x8B\x84" => "\x{0035}\x{6708}", # U+32C4 => 0035 6708
"\xE3\x8B\x85" => "\x{0036}\x{6708}", # U+32C5 => 0036 6708
"\xE3\x8B\x86" => "\x{0037}\x{6708}", # U+32C6 => 0037 6708
"\xE3\x8B\x87" => "\x{0038}\x{6708}", # U+32C7 => 0038 6708
"\xE3\x8B\x88" => "\x{0039}\x{6708}", # U+32C8 => 0039 6708
"\xE3\x8B\x89" => "\x{0031}\x{0030}\x{6708}", # U+32C9 => 0031 0030 6708
"\xE3\x8B\x8A" => "\x{0031}\x{0031}\x{6708}", # U+32CA => 0031 0031 6708
"\xE3\x8B\x8B" => "\x{0031}\x{0032}\x{6708}", # U+32CB => 0031 0032 6708
"\xE3\x8B\x8C" => "\x{0068}\x{0067}", # U+32CC => 0068 0067
"\xE3\x8B\x8D" => "\x{0065}\x{0072}\x{0067}", # U+32CD => 0065 0072 0067
"\xE3\x8B\x8E" => "\x{0065}\x{0076}", # U+32CE => 0065 0076
"\xE3\x8B\x8F" => "\x{006C}\x{0074}\x{0064}", # U+32CF => 006C 0074 0064
"\xE3\x8C\x80" => "\x{30A2}\x{30D1}\x{30FC}\x{30C8}", # U+3300 => 30A2 30D1 30FC 30C8
"\xE3\x8C\x81" => "\x{30A2}\x{30EB}\x{30D5}\x{30A1}", # U+3301 => 30A2 30EB 30D5 30A1
"\xE3\x8C\x82" => "\x{30A2}\x{30F3}\x{30DA}\x{30A2}", # U+3302 => 30A2 30F3 30DA 30A2
"\xE3\x8C\x83" => "\x{30A2}\x{30FC}\x{30EB}", # U+3303 => 30A2 30FC 30EB
"\xE3\x8C\x84" => "\x{30A4}\x{30CB}\x{30F3}\x{30B0}", # U+3304 => 30A4 30CB 30F3 30B0
"\xE3\x8C\x85" => "\x{30A4}\x{30F3}\x{30C1}", # U+3305 => 30A4 30F3 30C1
"\xE3\x8C\x86" => "\x{30A6}\x{30A9}\x{30F3}", # U+3306 => 30A6 30A9 30F3
"\xE3\x8C\x87" => "\x{30A8}\x{30B9}\x{30AF}\x{30FC}\x{30C9}", # U+3307 => 30A8 30B9 30AF 30FC 30C9
"\xE3\x8C\x88" => "\x{30A8}\x{30FC}\x{30AB}\x{30FC}", # U+3308 => 30A8 30FC 30AB 30FC
"\xE3\x8C\x89" => "\x{30AA}\x{30F3}\x{30B9}", # U+3309 => 30AA 30F3 30B9
"\xE3\x8C\x8A" => "\x{30AA}\x{30FC}\x{30E0}", # U+330A => 30AA 30FC 30E0
"\xE3\x8C\x8B" => "\x{30AB}\x{30A4}\x{30EA}", # U+330B => 30AB 30A4 30EA
"\xE3\x8C\x8C" => "\x{30AB}\x{30E9}\x{30C3}\x{30C8}", # U+330C => 30AB 30E9 30C3 30C8
"\xE3\x8C\x8D" => "\x{30AB}\x{30ED}\x{30EA}\x{30FC}", # U+330D => 30AB 30ED 30EA 30FC
"\xE3\x8C\x8E" => "\x{30AC}\x{30ED}\x{30F3}", # U+330E => 30AC 30ED 30F3
"\xE3\x8C\x8F" => "\x{30AC}\x{30F3}\x{30DE}", # U+330F => 30AC 30F3 30DE
"\xE3\x8C\x90" => "\x{30AE}\x{30AC}", # U+3310 => 30AE 30AC
"\xE3\x8C\x91" => "\x{30AE}\x{30CB}\x{30FC}", # U+3311 => 30AE 30CB 30FC
"\xE3\x8C\x92" => "\x{30AD}\x{30E5}\x{30EA}\x{30FC}", # U+3312 => 30AD 30E5 30EA 30FC
"\xE3\x8C\x93" => "\x{30AE}\x{30EB}\x{30C0}\x{30FC}", # U+3313 => 30AE 30EB 30C0 30FC
"\xE3\x8C\x94" => "\x{30AD}\x{30ED}", # U+3314 => 30AD 30ED
"\xE3\x8C\x95" => "\x{30AD}\x{30ED}\x{30B0}\x{30E9}\x{30E0}", # U+3315 => 30AD 30ED 30B0 30E9 30E0
"\xE3\x8C\x96" => "\x{30AD}\x{30ED}\x{30E1}\x{30FC}\x{30C8}\x{30EB}", # U+3316 => 30AD 30ED 30E1 30FC 30C8 30EB
"\xE3\x8C\x97" => "\x{30AD}\x{30ED}\x{30EF}\x{30C3}\x{30C8}", # U+3317 => 30AD 30ED 30EF 30C3 30C8
"\xE3\x8C\x98" => "\x{30B0}\x{30E9}\x{30E0}", # U+3318 => 30B0 30E9 30E0
"\xE3\x8C\x99" => "\x{30B0}\x{30E9}\x{30E0}\x{30C8}\x{30F3}", # U+3319 => 30B0 30E9 30E0 30C8 30F3
"\xE3\x8C\x9A" => "\x{30AF}\x{30EB}\x{30BC}\x{30A4}\x{30ED}", # U+331A => 30AF 30EB 30BC 30A4 30ED
"\xE3\x8C\x9B" => "\x{30AF}\x{30ED}\x{30FC}\x{30CD}", # U+331B => 30AF 30ED 30FC 30CD
"\xE3\x8C\x9C" => "\x{30B1}\x{30FC}\x{30B9}", # U+331C => 30B1 30FC 30B9
"\xE3\x8C\x9D" => "\x{30B3}\x{30EB}\x{30CA}", # U+331D => 30B3 30EB 30CA
"\xE3\x8C\x9E" => "\x{30B3}\x{30FC}\x{30DD}", # U+331E => 30B3 30FC 30DD
"\xE3\x8C\x9F" => "\x{30B5}\x{30A4}\x{30AF}\x{30EB}", # U+331F => 30B5 30A4 30AF 30EB
"\xE3\x8C\xA0" => "\x{30B5}\x{30F3}\x{30C1}\x{30FC}\x{30E0}", # U+3320 => 30B5 30F3 30C1 30FC 30E0
"\xE3\x8C\xA1" => "\x{30B7}\x{30EA}\x{30F3}\x{30B0}", # U+3321 => 30B7 30EA 30F3 30B0
"\xE3\x8C\xA2" => "\x{30BB}\x{30F3}\x{30C1}", # U+3322 => 30BB 30F3 30C1
"\xE3\x8C\xA3" => "\x{30BB}\x{30F3}\x{30C8}", # U+3323 => 30BB 30F3 30C8
"\xE3\x8C\xA4" => "\x{30C0}\x{30FC}\x{30B9}", # U+3324 => 30C0 30FC 30B9
"\xE3\x8C\xA5" => "\x{30C7}\x{30B7}", # U+3325 => 30C7 30B7
"\xE3\x8C\xA6" => "\x{30C9}\x{30EB}", # U+3326 => 30C9 30EB
"\xE3\x8C\xA7" => "\x{30C8}\x{30F3}", # U+3327 => 30C8 30F3
"\xE3\x8C\xA8" => "\x{30CA}\x{30CE}", # U+3328 => 30CA 30CE
"\xE3\x8C\xA9" => "\x{30CE}\x{30C3}\x{30C8}", # U+3329 => 30CE 30C3 30C8
"\xE3\x8C\xAA" => "\x{30CF}\x{30A4}\x{30C4}", # U+332A => 30CF 30A4 30C4
"\xE3\x8C\xAB" => "\x{30D1}\x{30FC}\x{30BB}\x{30F3}\x{30C8}", # U+332B => 30D1 30FC 30BB 30F3 30C8
"\xE3\x8C\xAC" => "\x{30D1}\x{30FC}\x{30C4}", # U+332C => 30D1 30FC 30C4
"\xE3\x8C\xAD" => "\x{30D0}\x{30FC}\x{30EC}\x{30EB}", # U+332D => 30D0 30FC 30EC 30EB
"\xE3\x8C\xAE" => "\x{30D4}\x{30A2}\x{30B9}\x{30C8}\x{30EB}", # U+332E => 30D4 30A2 30B9 30C8 30EB
"\xE3\x8C\xAF" => "\x{30D4}\x{30AF}\x{30EB}", # U+332F => 30D4 30AF 30EB
"\xE3\x8C\xB0" => "\x{30D4}\x{30B3}", # U+3330 => 30D4 30B3
"\xE3\x8C\xB1" => "\x{30D3}\x{30EB}", # U+3331 => 30D3 30EB
"\xE3\x8C\xB2" => "\x{30D5}\x{30A1}\x{30E9}\x{30C3}\x{30C9}", # U+3332 => 30D5 30A1 30E9 30C3 30C9
"\xE3\x8C\xB3" => "\x{30D5}\x{30A3}\x{30FC}\x{30C8}", # U+3333 => 30D5 30A3 30FC 30C8
"\xE3\x8C\xB4" => "\x{30D6}\x{30C3}\x{30B7}\x{30A7}\x{30EB}", # U+3334 => 30D6 30C3 30B7 30A7 30EB
"\xE3\x8C\xB5" => "\x{30D5}\x{30E9}\x{30F3}", # U+3335 => 30D5 30E9 30F3
"\xE3\x8C\xB6" => "\x{30D8}\x{30AF}\x{30BF}\x{30FC}\x{30EB}", # U+3336 => 30D8 30AF 30BF 30FC 30EB
"\xE3\x8C\xB7" => "\x{30DA}\x{30BD}", # U+3337 => 30DA 30BD
"\xE3\x8C\xB8" => "\x{30DA}\x{30CB}\x{30D2}", # U+3338 => 30DA 30CB 30D2
"\xE3\x8C\xB9" => "\x{30D8}\x{30EB}\x{30C4}", # U+3339 => 30D8 30EB 30C4
"\xE3\x8C\xBA" => "\x{30DA}\x{30F3}\x{30B9}", # U+333A => 30DA 30F3 30B9
"\xE3\x8C\xBB" => "\x{30DA}\x{30FC}\x{30B8}", # U+333B => 30DA 30FC 30B8
"\xE3\x8C\xBC" => "\x{30D9}\x{30FC}\x{30BF}", # U+333C => 30D9 30FC 30BF
"\xE3\x8C\xBD" => "\x{30DD}\x{30A4}\x{30F3}\x{30C8}", # U+333D => 30DD 30A4 30F3 30C8
"\xE3\x8C\xBE" => "\x{30DC}\x{30EB}\x{30C8}", # U+333E => 30DC 30EB 30C8
"\xE3\x8C\xBF" => "\x{30DB}\x{30F3}", # U+333F => 30DB 30F3
"\xE3\x8D\x80" => "\x{30DD}\x{30F3}\x{30C9}", # U+3340 => 30DD 30F3 30C9
"\xE3\x8D\x81" => "\x{30DB}\x{30FC}\x{30EB}", # U+3341 => 30DB 30FC 30EB
"\xE3\x8D\x82" => "\x{30DB}\x{30FC}\x{30F3}", # U+3342 => 30DB 30FC 30F3
"\xE3\x8D\x83" => "\x{30DE}\x{30A4}\x{30AF}\x{30ED}", # U+3343 => 30DE 30A4 30AF 30ED
"\xE3\x8D\x84" => "\x{30DE}\x{30A4}\x{30EB}", # U+3344 => 30DE 30A4 30EB
"\xE3\x8D\x85" => "\x{30DE}\x{30C3}\x{30CF}", # U+3345 => 30DE 30C3 30CF
"\xE3\x8D\x86" => "\x{30DE}\x{30EB}\x{30AF}", # U+3346 => 30DE 30EB 30AF
"\xE3\x8D\x87" => "\x{30DE}\x{30F3}\x{30B7}\x{30E7}\x{30F3}", # U+3347 => 30DE 30F3 30B7 30E7 30F3
"\xE3\x8D\x88" => "\x{30DF}\x{30AF}\x{30ED}\x{30F3}", # U+3348 => 30DF 30AF 30ED 30F3
"\xE3\x8D\x89" => "\x{30DF}\x{30EA}", # U+3349 => 30DF 30EA
"\xE3\x8D\x8A" => "\x{30DF}\x{30EA}\x{30D0}\x{30FC}\x{30EB}", # U+334A => 30DF 30EA 30D0 30FC 30EB
"\xE3\x8D\x8B" => "\x{30E1}\x{30AC}", # U+334B => 30E1 30AC
"\xE3\x8D\x8C" => "\x{30E1}\x{30AC}\x{30C8}\x{30F3}", # U+334C => 30E1 30AC 30C8 30F3
"\xE3\x8D\x8D" => "\x{30E1}\x{30FC}\x{30C8}\x{30EB}", # U+334D => 30E1 30FC 30C8 30EB
"\xE3\x8D\x8E" => "\x{30E4}\x{30FC}\x{30C9}", # U+334E => 30E4 30FC 30C9
"\xE3\x8D\x8F" => "\x{30E4}\x{30FC}\x{30EB}", # U+334F => 30E4 30FC 30EB
"\xE3\x8D\x90" => "\x{30E6}\x{30A2}\x{30F3}", # U+3350 => 30E6 30A2 30F3
"\xE3\x8D\x91" => "\x{30EA}\x{30C3}\x{30C8}\x{30EB}", # U+3351 => 30EA 30C3 30C8 30EB
"\xE3\x8D\x92" => "\x{30EA}\x{30E9}", # U+3352 => 30EA 30E9
"\xE3\x8D\x93" => "\x{30EB}\x{30D4}\x{30FC}", # U+3353 => 30EB 30D4 30FC
"\xE3\x8D\x94" => "\x{30EB}\x{30FC}\x{30D6}\x{30EB}", # U+3354 => 30EB 30FC 30D6 30EB
"\xE3\x8D\x95" => "\x{30EC}\x{30E0}", # U+3355 => 30EC 30E0
"\xE3\x8D\x96" => "\x{30EC}\x{30F3}\x{30C8}\x{30B2}\x{30F3}", # U+3356 => 30EC 30F3 30C8 30B2 30F3
"\xE3\x8D\x97" => "\x{30EF}\x{30C3}\x{30C8}", # U+3357 => 30EF 30C3 30C8
"\xE3\x8D\x98" => "\x{0030}\x{70B9}", # U+3358 => 0030 70B9
"\xE3\x8D\x99" => "\x{0031}\x{70B9}", # U+3359 => 0031 70B9
"\xE3\x8D\x9A" => "\x{0032}\x{70B9}", # U+335A => 0032 70B9
"\xE3\x8D\x9B" => "\x{0033}\x{70B9}", # U+335B => 0033 70B9
"\xE3\x8D\x9C" => "\x{0034}\x{70B9}", # U+335C => 0034 70B9
"\xE3\x8D\x9D" => "\x{0035}\x{70B9}", # U+335D => 0035 70B9
"\xE3\x8D\x9E" => "\x{0036}\x{70B9}", # U+335E => 0036 70B9
"\xE3\x8D\x9F" => "\x{0037}\x{70B9}", # U+335F => 0037 70B9
"\xE3\x8D\xA0" => "\x{0038}\x{70B9}", # U+3360 => 0038 70B9
"\xE3\x8D\xA1" => "\x{0039}\x{70B9}", # U+3361 => 0039 70B9
"\xE3\x8D\xA2" => "\x{0031}\x{0030}\x{70B9}", # U+3362 => 0031 0030 70B9
"\xE3\x8D\xA3" => "\x{0031}\x{0031}\x{70B9}", # U+3363 => 0031 0031 70B9
"\xE3\x8D\xA4" => "\x{0031}\x{0032}\x{70B9}", # U+3364 => 0031 0032 70B9
"\xE3\x8D\xA5" => "\x{0031}\x{0033}\x{70B9}", # U+3365 => 0031 0033 70B9
"\xE3\x8D\xA6" => "\x{0031}\x{0034}\x{70B9}", # U+3366 => 0031 0034 70B9
"\xE3\x8D\xA7" => "\x{0031}\x{0035}\x{70B9}", # U+3367 => 0031 0035 70B9
"\xE3\x8D\xA8" => "\x{0031}\x{0036}\x{70B9}", # U+3368 => 0031 0036 70B9
"\xE3\x8D\xA9" => "\x{0031}\x{0037}\x{70B9}", # U+3369 => 0031 0037 70B9
"\xE3\x8D\xAA" => "\x{0031}\x{0038}\x{70B9}", # U+336A => 0031 0038 70B9
"\xE3\x8D\xAB" => "\x{0031}\x{0039}\x{70B9}", # U+336B => 0031 0039 70B9
"\xE3\x8D\xAC" => "\x{0032}\x{0030}\x{70B9}", # U+336C => 0032 0030 70B9
"\xE3\x8D\xAD" => "\x{0032}\x{0031}\x{70B9}", # U+336D => 0032 0031 70B9
"\xE3\x8D\xAE" => "\x{0032}\x{0032}\x{70B9}", # U+336E => 0032 0032 70B9
"\xE3\x8D\xAF" => "\x{0032}\x{0033}\x{70B9}", # U+336F => 0032 0033 70B9
"\xE3\x8D\xB0" => "\x{0032}\x{0034}\x{70B9}", # U+3370 => 0032 0034 70B9
"\xE3\x8D\xB1" => "\x{0068}\x{0070}\x{0061}", # U+3371 => 0068 0070 0061
"\xE3\x8D\xB2" => "\x{0064}\x{0061}", # U+3372 => 0064 0061
"\xE3\x8D\xB3" => "\x{0061}\x{0075}", # U+3373 => 0061 0075
"\xE3\x8D\xB4" => "\x{0062}\x{0061}\x{0072}", # U+3374 => 0062 0061 0072
"\xE3\x8D\xB5" => "\x{006F}\x{0076}", # U+3375 => 006F 0076
"\xE3\x8D\xB6" => "\x{0070}\x{0063}", # U+3376 => 0070 0063
"\xE3\x8D\xB7" => "\x{0064}\x{006D}", # U+3377 => 0064 006D
"\xE3\x8D\xB8" => "\x{0064}\x{006D}\x{0032}", # U+3378 => 0064 006D 0032
"\xE3\x8D\xB9" => "\x{0064}\x{006D}\x{0033}", # U+3379 => 0064 006D 0033
"\xE3\x8D\xBA" => "\x{0069}\x{0075}", # U+337A => 0069 0075
"\xE3\x8D\xBB" => "\x{5E73}\x{6210}", # U+337B => 5E73 6210
"\xE3\x8D\xBC" => "\x{662D}\x{548C}", # U+337C => 662D 548C
"\xE3\x8D\xBD" => "\x{5927}\x{6B63}", # U+337D => 5927 6B63
"\xE3\x8D\xBE" => "\x{660E}\x{6CBB}", # U+337E => 660E 6CBB
"\xE3\x8D\xBF" => "\x{682A}\x{5F0F}\x{4F1A}\x{793E}", # U+337F => 682A 5F0F 4F1A 793E
"\xE3\x8E\x80" => "\x{0070}\x{0061}", # U+3380 => 0070 0061
"\xE3\x8E\x81" => "\x{006E}\x{0061}", # U+3381 => 006E 0061
"\xE3\x8E\x82" => "\x{03BC}\x{0061}", # U+3382 => 03BC 0061
"\xE3\x8E\x83" => "\x{006D}\x{0061}", # U+3383 => 006D 0061
"\xE3\x8E\x84" => "\x{006B}\x{0061}", # U+3384 => 006B 0061
"\xE3\x8E\x85" => "\x{006B}\x{0062}", # U+3385 => 006B 0062
"\xE3\x8E\x86" => "\x{006D}\x{0062}", # U+3386 => 006D 0062
"\xE3\x8E\x87" => "\x{0067}\x{0062}", # U+3387 => 0067 0062
"\xE3\x8E\x88" => "\x{0063}\x{0061}\x{006C}", # U+3388 => 0063 0061 006C
"\xE3\x8E\x89" => "\x{006B}\x{0063}\x{0061}\x{006C}", # U+3389 => 006B 0063 0061 006C
"\xE3\x8E\x8A" => "\x{0070}\x{0066}", # U+338A => 0070 0066
"\xE3\x8E\x8B" => "\x{006E}\x{0066}", # U+338B => 006E 0066
"\xE3\x8E\x8C" => "\x{03BC}\x{0066}", # U+338C => 03BC 0066
"\xE3\x8E\x8D" => "\x{03BC}\x{0067}", # U+338D => 03BC 0067
"\xE3\x8E\x8E" => "\x{006D}\x{0067}", # U+338E => 006D 0067
"\xE3\x8E\x8F" => "\x{006B}\x{0067}", # U+338F => 006B 0067
"\xE3\x8E\x90" => "\x{0068}\x{007A}", # U+3390 => 0068 007A
"\xE3\x8E\x91" => "\x{006B}\x{0068}\x{007A}", # U+3391 => 006B 0068 007A
"\xE3\x8E\x92" => "\x{006D}\x{0068}\x{007A}", # U+3392 => 006D 0068 007A
"\xE3\x8E\x93" => "\x{0067}\x{0068}\x{007A}", # U+3393 => 0067 0068 007A
"\xE3\x8E\x94" => "\x{0074}\x{0068}\x{007A}", # U+3394 => 0074 0068 007A
"\xE3\x8E\x95" => "\x{03BC}\x{006C}", # U+3395 => 03BC 006C
"\xE3\x8E\x96" => "\x{006D}\x{006C}", # U+3396 => 006D 006C
"\xE3\x8E\x97" => "\x{0064}\x{006C}", # U+3397 => 0064 006C
"\xE3\x8E\x98" => "\x{006B}\x{006C}", # U+3398 => 006B 006C
"\xE3\x8E\x99" => "\x{0066}\x{006D}", # U+3399 => 0066 006D
"\xE3\x8E\x9A" => "\x{006E}\x{006D}", # U+339A => 006E 006D
"\xE3\x8E\x9B" => "\x{03BC}\x{006D}", # U+339B => 03BC 006D
"\xE3\x8E\x9C" => "\x{006D}\x{006D}", # U+339C => 006D 006D
"\xE3\x8E\x9D" => "\x{0063}\x{006D}", # U+339D => 0063 006D
"\xE3\x8E\x9E" => "\x{006B}\x{006D}", # U+339E => 006B 006D
"\xE3\x8E\x9F" => "\x{006D}\x{006D}\x{0032}", # U+339F => 006D 006D 0032
"\xE3\x8E\xA0" => "\x{0063}\x{006D}\x{0032}", # U+33A0 => 0063 006D 0032
"\xE3\x8E\xA1" => "\x{006D}\x{0032}", # U+33A1 => 006D 0032
"\xE3\x8E\xA2" => "\x{006B}\x{006D}\x{0032}", # U+33A2 => 006B 006D 0032
"\xE3\x8E\xA3" => "\x{006D}\x{006D}\x{0033}", # U+33A3 => 006D 006D 0033
"\xE3\x8E\xA4" => "\x{0063}\x{006D}\x{0033}", # U+33A4 => 0063 006D 0033
"\xE3\x8E\xA5" => "\x{006D}\x{0033}", # U+33A5 => 006D 0033
"\xE3\x8E\xA6" => "\x{006B}\x{006D}\x{0033}", # U+33A6 => 006B 006D 0033
"\xE3\x8E\xA7" => "\x{006D}\x{2215}\x{0073}", # U+33A7 => 006D 2215 0073
"\xE3\x8E\xA8" => "\x{006D}\x{2215}\x{0073}\x{0032}", # U+33A8 => 006D 2215 0073 0032
"\xE3\x8E\xA9" => "\x{0070}\x{0061}", # U+33A9 => 0070 0061
"\xE3\x8E\xAA" => "\x{006B}\x{0070}\x{0061}", # U+33AA => 006B 0070 0061
"\xE3\x8E\xAB" => "\x{006D}\x{0070}\x{0061}", # U+33AB => 006D 0070 0061
"\xE3\x8E\xAC" => "\x{0067}\x{0070}\x{0061}", # U+33AC => 0067 0070 0061
"\xE3\x8E\xAD" => "\x{0072}\x{0061}\x{0064}", # U+33AD => 0072 0061 0064
"\xE3\x8E\xAE" => "\x{0072}\x{0061}\x{0064}\x{2215}\x{0073}", # U+33AE => 0072 0061 0064 2215 0073
"\xE3\x8E\xAF" => "\x{0072}\x{0061}\x{0064}\x{2215}\x{0073}\x{0032}", # U+33AF => 0072 0061 0064 2215 0073 0032
"\xE3\x8E\xB0" => "\x{0070}\x{0073}", # U+33B0 => 0070 0073
"\xE3\x8E\xB1" => "\x{006E}\x{0073}", # U+33B1 => 006E 0073
"\xE3\x8E\xB2" => "\x{03BC}\x{0073}", # U+33B2 => 03BC 0073
"\xE3\x8E\xB3" => "\x{006D}\x{0073}", # U+33B3 => 006D 0073
"\xE3\x8E\xB4" => "\x{0070}\x{0076}", # U+33B4 => 0070 0076
"\xE3\x8E\xB5" => "\x{006E}\x{0076}", # U+33B5 => 006E 0076
"\xE3\x8E\xB6" => "\x{03BC}\x{0076}", # U+33B6 => 03BC 0076
"\xE3\x8E\xB7" => "\x{006D}\x{0076}", # U+33B7 => 006D 0076
"\xE3\x8E\xB8" => "\x{006B}\x{0076}", # U+33B8 => 006B 0076
"\xE3\x8E\xB9" => "\x{006D}\x{0076}", # U+33B9 => 006D 0076
"\xE3\x8E\xBA" => "\x{0070}\x{0077}", # U+33BA => 0070 0077
"\xE3\x8E\xBB" => "\x{006E}\x{0077}", # U+33BB => 006E 0077
"\xE3\x8E\xBC" => "\x{03BC}\x{0077}", # U+33BC => 03BC 0077
"\xE3\x8E\xBD" => "\x{006D}\x{0077}", # U+33BD => 006D 0077
"\xE3\x8E\xBE" => "\x{006B}\x{0077}", # U+33BE => 006B 0077
"\xE3\x8E\xBF" => "\x{006D}\x{0077}", # U+33BF => 006D 0077
"\xE3\x8F\x80" => "\x{006B}\x{03C9}", # U+33C0 => 006B 03C9
"\xE3\x8F\x81" => "\x{006D}\x{03C9}", # U+33C1 => 006D 03C9
"\xE3\x8F\x82" => "\x{0061}\x{002E}\x{006D}\x{002E}", # U+33C2 => 0061 002E 006D 002E
"\xE3\x8F\x83" => "\x{0062}\x{0071}", # U+33C3 => 0062 0071
"\xE3\x8F\x84" => "\x{0063}\x{0063}", # U+33C4 => 0063 0063
"\xE3\x8F\x85" => "\x{0063}\x{0064}", # U+33C5 => 0063 0064
"\xE3\x8F\x86" => "\x{0063}\x{2215}\x{006B}\x{0067}", # U+33C6 => 0063 2215 006B 0067
"\xE3\x8F\x87" => "\x{0063}\x{006F}\x{002E}", # U+33C7 => 0063 006F 002E
"\xE3\x8F\x88" => "\x{0064}\x{0062}", # U+33C8 => 0064 0062
"\xE3\x8F\x89" => "\x{0067}\x{0079}", # U+33C9 => 0067 0079
"\xE3\x8F\x8A" => "\x{0068}\x{0061}", # U+33CA => 0068 0061
"\xE3\x8F\x8B" => "\x{0068}\x{0070}", # U+33CB => 0068 0070
"\xE3\x8F\x8C" => "\x{0069}\x{006E}", # U+33CC => 0069 006E
"\xE3\x8F\x8D" => "\x{006B}\x{006B}", # U+33CD => 006B 006B
"\xE3\x8F\x8E" => "\x{006B}\x{006D}", # U+33CE => 006B 006D
"\xE3\x8F\x8F" => "\x{006B}\x{0074}", # U+33CF => 006B 0074
"\xE3\x8F\x90" => "\x{006C}\x{006D}", # U+33D0 => 006C 006D
"\xE3\x8F\x91" => "\x{006C}\x{006E}", # U+33D1 => 006C 006E
"\xE3\x8F\x92" => "\x{006C}\x{006F}\x{0067}", # U+33D2 => 006C 006F 0067
"\xE3\x8F\x93" => "\x{006C}\x{0078}", # U+33D3 => 006C 0078
"\xE3\x8F\x94" => "\x{006D}\x{0062}", # U+33D4 => 006D 0062
"\xE3\x8F\x95" => "\x{006D}\x{0069}\x{006C}", # U+33D5 => 006D 0069 006C
"\xE3\x8F\x96" => "\x{006D}\x{006F}\x{006C}", # U+33D6 => 006D 006F 006C
"\xE3\x8F\x97" => "\x{0070}\x{0068}", # U+33D7 => 0070 0068
"\xE3\x8F\x98" => "\x{0070}\x{002E}\x{006D}\x{002E}", # U+33D8 => 0070 002E 006D 002E
"\xE3\x8F\x99" => "\x{0070}\x{0070}\x{006D}", # U+33D9 => 0070 0070 006D
"\xE3\x8F\x9A" => "\x{0070}\x{0072}", # U+33DA => 0070 0072
"\xE3\x8F\x9B" => "\x{0073}\x{0072}", # U+33DB => 0073 0072
"\xE3\x8F\x9C" => "\x{0073}\x{0076}", # U+33DC => 0073 0076
"\xE3\x8F\x9D" => "\x{0077}\x{0062}", # U+33DD => 0077 0062
"\xE3\x8F\x9E" => "\x{0076}\x{2215}\x{006D}", # U+33DE => 0076 2215 006D
"\xE3\x8F\x9F" => "\x{0061}\x{2215}\x{006D}", # U+33DF => 0061 2215 006D
"\xE3\x8F\xA0" => "\x{0031}\x{65E5}", # U+33E0 => 0031 65E5
"\xE3\x8F\xA1" => "\x{0032}\x{65E5}", # U+33E1 => 0032 65E5
"\xE3\x8F\xA2" => "\x{0033}\x{65E5}", # U+33E2 => 0033 65E5
"\xE3\x8F\xA3" => "\x{0034}\x{65E5}", # U+33E3 => 0034 65E5
"\xE3\x8F\xA4" => "\x{0035}\x{65E5}", # U+33E4 => 0035 65E5
"\xE3\x8F\xA5" => "\x{0036}\x{65E5}", # U+33E5 => 0036 65E5
"\xE3\x8F\xA6" => "\x{0037}\x{65E5}", # U+33E6 => 0037 65E5
"\xE3\x8F\xA7" => "\x{0038}\x{65E5}", # U+33E7 => 0038 65E5
"\xE3\x8F\xA8" => "\x{0039}\x{65E5}", # U+33E8 => 0039 65E5
"\xE3\x8F\xA9" => "\x{0031}\x{0030}\x{65E5}", # U+33E9 => 0031 0030 65E5
"\xE3\x8F\xAA" => "\x{0031}\x{0031}\x{65E5}", # U+33EA => 0031 0031 65E5
"\xE3\x8F\xAB" => "\x{0031}\x{0032}\x{65E5}", # U+33EB => 0031 0032 65E5
"\xE3\x8F\xAC" => "\x{0031}\x{0033}\x{65E5}", # U+33EC => 0031 0033 65E5
"\xE3\x8F\xAD" => "\x{0031}\x{0034}\x{65E5}", # U+33ED => 0031 0034 65E5
"\xE3\x8F\xAE" => "\x{0031}\x{0035}\x{65E5}", # U+33EE => 0031 0035 65E5
"\xE3\x8F\xAF" => "\x{0031}\x{0036}\x{65E5}", # U+33EF => 0031 0036 65E5
"\xE3\x8F\xB0" => "\x{0031}\x{0037}\x{65E5}", # U+33F0 => 0031 0037 65E5
"\xE3\x8F\xB1" => "\x{0031}\x{0038}\x{65E5}", # U+33F1 => 0031 0038 65E5
"\xE3\x8F\xB2" => "\x{0031}\x{0039}\x{65E5}", # U+33F2 => 0031 0039 65E5
"\xE3\x8F\xB3" => "\x{0032}\x{0030}\x{65E5}", # U+33F3 => 0032 0030 65E5
"\xE3\x8F\xB4" => "\x{0032}\x{0031}\x{65E5}", # U+33F4 => 0032 0031 65E5
"\xE3\x8F\xB5" => "\x{0032}\x{0032}\x{65E5}", # U+33F5 => 0032 0032 65E5
"\xE3\x8F\xB6" => "\x{0032}\x{0033}\x{65E5}", # U+33F6 => 0032 0033 65E5
"\xE3\x8F\xB7" => "\x{0032}\x{0034}\x{65E5}", # U+33F7 => 0032 0034 65E5
"\xE3\x8F\xB8" => "\x{0032}\x{0035}\x{65E5}", # U+33F8 => 0032 0035 65E5
"\xE3\x8F\xB9" => "\x{0032}\x{0036}\x{65E5}", # U+33F9 => 0032 0036 65E5
"\xE3\x8F\xBA" => "\x{0032}\x{0037}\x{65E5}", # U+33FA => 0032 0037 65E5
"\xE3\x8F\xBB" => "\x{0032}\x{0038}\x{65E5}", # U+33FB => 0032 0038 65E5
"\xE3\x8F\xBC" => "\x{0032}\x{0039}\x{65E5}", # U+33FC => 0032 0039 65E5
"\xE3\x8F\xBD" => "\x{0033}\x{0030}\x{65E5}", # U+33FD => 0033 0030 65E5
"\xE3\x8F\xBE" => "\x{0033}\x{0031}\x{65E5}", # U+33FE => 0033 0031 65E5
"\xE3\x8F\xBF" => "\x{0067}\x{0061}\x{006C}", # U+33FF => 0067 0061 006C
"\xEF\xAC\x80" => "\x{0066}\x{0066}", # U+FB00 => 0066 0066
"\xEF\xAC\x81" => "\x{0066}\x{0069}", # U+FB01 => 0066 0069
"\xEF\xAC\x82" => "\x{0066}\x{006C}", # U+FB02 => 0066 006C
"\xEF\xAC\x83" => "\x{0066}\x{0066}\x{0069}", # U+FB03 => 0066 0066 0069
"\xEF\xAC\x84" => "\x{0066}\x{0066}\x{006C}", # U+FB04 => 0066 0066 006C
"\xEF\xAC\x85" => "\x{0073}\x{0074}", # U+FB05 => 0073 0074
"\xEF\xAC\x86" => "\x{0073}\x{0074}", # U+FB06 => 0073 0074
"\xEF\xAC\x93" => "\x{0574}\x{0576}", # U+FB13 => 0574 0576
"\xEF\xAC\x94" => "\x{0574}\x{0565}", # U+FB14 => 0574 0565
"\xEF\xAC\x95" => "\x{0574}\x{056B}", # U+FB15 => 0574 056B
"\xEF\xAC\x96" => "\x{057E}\x{0576}", # U+FB16 => 057E 0576
"\xEF\xAC\x97" => "\x{0574}\x{056D}", # U+FB17 => 0574 056D
"\xEF\xAC\x9D" => "\x{05D9}\x{05B4}", # U+FB1D => 05D9 05B4
"\xEF\xAC\x9F" => "\x{05F2}\x{05B7}", # U+FB1F => 05F2 05B7
"\xEF\xAC\xAA" => "\x{05E9}\x{05C1}", # U+FB2A => 05E9 05C1
"\xEF\xAC\xAB" => "\x{05E9}\x{05C2}", # U+FB2B => 05E9 05C2
"\xEF\xAC\xAC" => "\x{05E9}\x{05BC}\x{05C1}", # U+FB2C => 05E9 05BC 05C1
"\xEF\xAC\xAD" => "\x{05E9}\x{05BC}\x{05C2}", # U+FB2D => 05E9 05BC 05C2
"\xEF\xAC\xAE" => "\x{05D0}\x{05B7}", # U+FB2E => 05D0 05B7
"\xEF\xAC\xAF" => "\x{05D0}\x{05B8}", # U+FB2F => 05D0 05B8
"\xEF\xAC\xB0" => "\x{05D0}\x{05BC}", # U+FB30 => 05D0 05BC
"\xEF\xAC\xB1" => "\x{05D1}\x{05BC}", # U+FB31 => 05D1 05BC
"\xEF\xAC\xB2" => "\x{05D2}\x{05BC}", # U+FB32 => 05D2 05BC
"\xEF\xAC\xB3" => "\x{05D3}\x{05BC}", # U+FB33 => 05D3 05BC
"\xEF\xAC\xB4" => "\x{05D4}\x{05BC}", # U+FB34 => 05D4 05BC
"\xEF\xAC\xB5" => "\x{05D5}\x{05BC}", # U+FB35 => 05D5 05BC
"\xEF\xAC\xB6" => "\x{05D6}\x{05BC}", # U+FB36 => 05D6 05BC
"\xEF\xAC\xB8" => "\x{05D8}\x{05BC}", # U+FB38 => 05D8 05BC
"\xEF\xAC\xB9" => "\x{05D9}\x{05BC}", # U+FB39 => 05D9 05BC
"\xEF\xAC\xBA" => "\x{05DA}\x{05BC}", # U+FB3A => 05DA 05BC
"\xEF\xAC\xBB" => "\x{05DB}\x{05BC}", # U+FB3B => 05DB 05BC
"\xEF\xAC\xBC" => "\x{05DC}\x{05BC}", # U+FB3C => 05DC 05BC
"\xEF\xAC\xBE" => "\x{05DE}\x{05BC}", # U+FB3E => 05DE 05BC
"\xEF\xAD\x80" => "\x{05E0}\x{05BC}", # U+FB40 => 05E0 05BC
"\xEF\xAD\x81" => "\x{05E1}\x{05BC}", # U+FB41 => 05E1 05BC
"\xEF\xAD\x83" => "\x{05E3}\x{05BC}", # U+FB43 => 05E3 05BC
"\xEF\xAD\x84" => "\x{05E4}\x{05BC}", # U+FB44 => 05E4 05BC
"\xEF\xAD\x86" => "\x{05E6}\x{05BC}", # U+FB46 => 05E6 05BC
"\xEF\xAD\x87" => "\x{05E7}\x{05BC}", # U+FB47 => 05E7 05BC
"\xEF\xAD\x88" => "\x{05E8}\x{05BC}", # U+FB48 => 05E8 05BC
"\xEF\xAD\x89" => "\x{05E9}\x{05BC}", # U+FB49 => 05E9 05BC
"\xEF\xAD\x8A" => "\x{05EA}\x{05BC}", # U+FB4A => 05EA 05BC
"\xEF\xAD\x8B" => "\x{05D5}\x{05B9}", # U+FB4B => 05D5 05B9
"\xEF\xAD\x8C" => "\x{05D1}\x{05BF}", # U+FB4C => 05D1 05BF
"\xEF\xAD\x8D" => "\x{05DB}\x{05BF}", # U+FB4D => 05DB 05BF
"\xEF\xAD\x8E" => "\x{05E4}\x{05BF}", # U+FB4E => 05E4 05BF
"\xEF\xAD\x8F" => "\x{05D0}\x{05DC}", # U+FB4F => 05D0 05DC
"\xEF\xAF\x9D" => "\x{06C7}\x{0674}", # U+FBDD => 06C7 0674
"\xEF\xAF\xAA" => "\x{0626}\x{0627}", # U+FBEA => 0626 0627
"\xEF\xAF\xAB" => "\x{0626}\x{0627}", # U+FBEB => 0626 0627
"\xEF\xAF\xAC" => "\x{0626}\x{06D5}", # U+FBEC => 0626 06D5
"\xEF\xAF\xAD" => "\x{0626}\x{06D5}", # U+FBED => 0626 06D5
"\xEF\xAF\xAE" => "\x{0626}\x{0648}", # U+FBEE => 0626 0648
"\xEF\xAF\xAF" => "\x{0626}\x{0648}", # U+FBEF => 0626 0648
"\xEF\xAF\xB0" => "\x{0626}\x{06C7}", # U+FBF0 => 0626 06C7
"\xEF\xAF\xB1" => "\x{0626}\x{06C7}", # U+FBF1 => 0626 06C7
"\xEF\xAF\xB2" => "\x{0626}\x{06C6}", # U+FBF2 => 0626 06C6
"\xEF\xAF\xB3" => "\x{0626}\x{06C6}", # U+FBF3 => 0626 06C6
"\xEF\xAF\xB4" => "\x{0626}\x{06C8}", # U+FBF4 => 0626 06C8
"\xEF\xAF\xB5" => "\x{0626}\x{06C8}", # U+FBF5 => 0626 06C8
"\xEF\xAF\xB6" => "\x{0626}\x{06D0}", # U+FBF6 => 0626 06D0
"\xEF\xAF\xB7" => "\x{0626}\x{06D0}", # U+FBF7 => 0626 06D0
"\xEF\xAF\xB8" => "\x{0626}\x{06D0}", # U+FBF8 => 0626 06D0
"\xEF\xAF\xB9" => "\x{0626}\x{0649}", # U+FBF9 => 0626 0649
"\xEF\xAF\xBA" => "\x{0626}\x{0649}", # U+FBFA => 0626 0649
"\xEF\xAF\xBB" => "\x{0626}\x{0649}", # U+FBFB => 0626 0649
"\xEF\xB0\x80" => "\x{0626}\x{062C}", # U+FC00 => 0626 062C
"\xEF\xB0\x81" => "\x{0626}\x{062D}", # U+FC01 => 0626 062D
"\xEF\xB0\x82" => "\x{0626}\x{0645}", # U+FC02 => 0626 0645
"\xEF\xB0\x83" => "\x{0626}\x{0649}", # U+FC03 => 0626 0649
"\xEF\xB0\x84" => "\x{0626}\x{064A}", # U+FC04 => 0626 064A
"\xEF\xB0\x85" => "\x{0628}\x{062C}", # U+FC05 => 0628 062C
"\xEF\xB0\x86" => "\x{0628}\x{062D}", # U+FC06 => 0628 062D
"\xEF\xB0\x87" => "\x{0628}\x{062E}", # U+FC07 => 0628 062E
"\xEF\xB0\x88" => "\x{0628}\x{0645}", # U+FC08 => 0628 0645
"\xEF\xB0\x89" => "\x{0628}\x{0649}", # U+FC09 => 0628 0649
"\xEF\xB0\x8A" => "\x{0628}\x{064A}", # U+FC0A => 0628 064A
"\xEF\xB0\x8B" => "\x{062A}\x{062C}", # U+FC0B => 062A 062C
"\xEF\xB0\x8C" => "\x{062A}\x{062D}", # U+FC0C => 062A 062D
"\xEF\xB0\x8D" => "\x{062A}\x{062E}", # U+FC0D => 062A 062E
"\xEF\xB0\x8E" => "\x{062A}\x{0645}", # U+FC0E => 062A 0645
"\xEF\xB0\x8F" => "\x{062A}\x{0649}", # U+FC0F => 062A 0649
"\xEF\xB0\x90" => "\x{062A}\x{064A}", # U+FC10 => 062A 064A
"\xEF\xB0\x91" => "\x{062B}\x{062C}", # U+FC11 => 062B 062C
"\xEF\xB0\x92" => "\x{062B}\x{0645}", # U+FC12 => 062B 0645
"\xEF\xB0\x93" => "\x{062B}\x{0649}", # U+FC13 => 062B 0649
"\xEF\xB0\x94" => "\x{062B}\x{064A}", # U+FC14 => 062B 064A
"\xEF\xB0\x95" => "\x{062C}\x{062D}", # U+FC15 => 062C 062D
"\xEF\xB0\x96" => "\x{062C}\x{0645}", # U+FC16 => 062C 0645
"\xEF\xB0\x97" => "\x{062D}\x{062C}", # U+FC17 => 062D 062C
"\xEF\xB0\x98" => "\x{062D}\x{0645}", # U+FC18 => 062D 0645
"\xEF\xB0\x99" => "\x{062E}\x{062C}", # U+FC19 => 062E 062C
"\xEF\xB0\x9A" => "\x{062E}\x{062D}", # U+FC1A => 062E 062D
"\xEF\xB0\x9B" => "\x{062E}\x{0645}", # U+FC1B => 062E 0645
"\xEF\xB0\x9C" => "\x{0633}\x{062C}", # U+FC1C => 0633 062C
"\xEF\xB0\x9D" => "\x{0633}\x{062D}", # U+FC1D => 0633 062D
"\xEF\xB0\x9E" => "\x{0633}\x{062E}", # U+FC1E => 0633 062E
"\xEF\xB0\x9F" => "\x{0633}\x{0645}", # U+FC1F => 0633 0645
"\xEF\xB0\xA0" => "\x{0635}\x{062D}", # U+FC20 => 0635 062D
"\xEF\xB0\xA1" => "\x{0635}\x{0645}", # U+FC21 => 0635 0645
"\xEF\xB0\xA2" => "\x{0636}\x{062C}", # U+FC22 => 0636 062C
"\xEF\xB0\xA3" => "\x{0636}\x{062D}", # U+FC23 => 0636 062D
"\xEF\xB0\xA4" => "\x{0636}\x{062E}", # U+FC24 => 0636 062E
"\xEF\xB0\xA5" => "\x{0636}\x{0645}", # U+FC25 => 0636 0645
"\xEF\xB0\xA6" => "\x{0637}\x{062D}", # U+FC26 => 0637 062D
"\xEF\xB0\xA7" => "\x{0637}\x{0645}", # U+FC27 => 0637 0645
"\xEF\xB0\xA8" => "\x{0638}\x{0645}", # U+FC28 => 0638 0645
"\xEF\xB0\xA9" => "\x{0639}\x{062C}", # U+FC29 => 0639 062C
"\xEF\xB0\xAA" => "\x{0639}\x{0645}", # U+FC2A => 0639 0645
"\xEF\xB0\xAB" => "\x{063A}\x{062C}", # U+FC2B => 063A 062C
"\xEF\xB0\xAC" => "\x{063A}\x{0645}", # U+FC2C => 063A 0645
"\xEF\xB0\xAD" => "\x{0641}\x{062C}", # U+FC2D => 0641 062C
"\xEF\xB0\xAE" => "\x{0641}\x{062D}", # U+FC2E => 0641 062D
"\xEF\xB0\xAF" => "\x{0641}\x{062E}", # U+FC2F => 0641 062E
"\xEF\xB0\xB0" => "\x{0641}\x{0645}", # U+FC30 => 0641 0645
"\xEF\xB0\xB1" => "\x{0641}\x{0649}", # U+FC31 => 0641 0649
"\xEF\xB0\xB2" => "\x{0641}\x{064A}", # U+FC32 => 0641 064A
"\xEF\xB0\xB3" => "\x{0642}\x{062D}", # U+FC33 => 0642 062D
"\xEF\xB0\xB4" => "\x{0642}\x{0645}", # U+FC34 => 0642 0645
"\xEF\xB0\xB5" => "\x{0642}\x{0649}", # U+FC35 => 0642 0649
"\xEF\xB0\xB6" => "\x{0642}\x{064A}", # U+FC36 => 0642 064A
"\xEF\xB0\xB7" => "\x{0643}\x{0627}", # U+FC37 => 0643 0627
"\xEF\xB0\xB8" => "\x{0643}\x{062C}", # U+FC38 => 0643 062C
"\xEF\xB0\xB9" => "\x{0643}\x{062D}", # U+FC39 => 0643 062D
"\xEF\xB0\xBA" => "\x{0643}\x{062E}", # U+FC3A => 0643 062E
"\xEF\xB0\xBB" => "\x{0643}\x{0644}", # U+FC3B => 0643 0644
"\xEF\xB0\xBC" => "\x{0643}\x{0645}", # U+FC3C => 0643 0645
"\xEF\xB0\xBD" => "\x{0643}\x{0649}", # U+FC3D => 0643 0649
"\xEF\xB0\xBE" => "\x{0643}\x{064A}", # U+FC3E => 0643 064A
"\xEF\xB0\xBF" => "\x{0644}\x{062C}", # U+FC3F => 0644 062C
"\xEF\xB1\x80" => "\x{0644}\x{062D}", # U+FC40 => 0644 062D
"\xEF\xB1\x81" => "\x{0644}\x{062E}", # U+FC41 => 0644 062E
"\xEF\xB1\x82" => "\x{0644}\x{0645}", # U+FC42 => 0644 0645
"\xEF\xB1\x83" => "\x{0644}\x{0649}", # U+FC43 => 0644 0649
"\xEF\xB1\x84" => "\x{0644}\x{064A}", # U+FC44 => 0644 064A
"\xEF\xB1\x85" => "\x{0645}\x{062C}", # U+FC45 => 0645 062C
"\xEF\xB1\x86" => "\x{0645}\x{062D}", # U+FC46 => 0645 062D
"\xEF\xB1\x87" => "\x{0645}\x{062E}", # U+FC47 => 0645 062E
"\xEF\xB1\x88" => "\x{0645}\x{0645}", # U+FC48 => 0645 0645
"\xEF\xB1\x89" => "\x{0645}\x{0649}", # U+FC49 => 0645 0649
"\xEF\xB1\x8A" => "\x{0645}\x{064A}", # U+FC4A => 0645 064A
"\xEF\xB1\x8B" => "\x{0646}\x{062C}", # U+FC4B => 0646 062C
"\xEF\xB1\x8C" => "\x{0646}\x{062D}", # U+FC4C => 0646 062D
"\xEF\xB1\x8D" => "\x{0646}\x{062E}", # U+FC4D => 0646 062E
"\xEF\xB1\x8E" => "\x{0646}\x{0645}", # U+FC4E => 0646 0645
"\xEF\xB1\x8F" => "\x{0646}\x{0649}", # U+FC4F => 0646 0649
"\xEF\xB1\x90" => "\x{0646}\x{064A}", # U+FC50 => 0646 064A
"\xEF\xB1\x91" => "\x{0647}\x{062C}", # U+FC51 => 0647 062C
"\xEF\xB1\x92" => "\x{0647}\x{0645}", # U+FC52 => 0647 0645
"\xEF\xB1\x93" => "\x{0647}\x{0649}", # U+FC53 => 0647 0649
"\xEF\xB1\x94" => "\x{0647}\x{064A}", # U+FC54 => 0647 064A
"\xEF\xB1\x95" => "\x{064A}\x{062C}", # U+FC55 => 064A 062C
"\xEF\xB1\x96" => "\x{064A}\x{062D}", # U+FC56 => 064A 062D
"\xEF\xB1\x97" => "\x{064A}\x{062E}", # U+FC57 => 064A 062E
"\xEF\xB1\x98" => "\x{064A}\x{0645}", # U+FC58 => 064A 0645
"\xEF\xB1\x99" => "\x{064A}\x{0649}", # U+FC59 => 064A 0649
"\xEF\xB1\x9A" => "\x{064A}\x{064A}", # U+FC5A => 064A 064A
"\xEF\xB1\x9B" => "\x{0630}\x{0670}", # U+FC5B => 0630 0670
"\xEF\xB1\x9C" => "\x{0631}\x{0670}", # U+FC5C => 0631 0670
"\xEF\xB1\x9D" => "\x{0649}\x{0670}", # U+FC5D => 0649 0670
"\xEF\xB1\x9E" => "\x{0020}\x{064C}\x{0651}", # U+FC5E => 0020 064C 0651
"\xEF\xB1\x9F" => "\x{0020}\x{064D}\x{0651}", # U+FC5F => 0020 064D 0651
"\xEF\xB1\xA0" => "\x{0020}\x{064E}\x{0651}", # U+FC60 => 0020 064E 0651
"\xEF\xB1\xA1" => "\x{0020}\x{064F}\x{0651}", # U+FC61 => 0020 064F 0651
"\xEF\xB1\xA2" => "\x{0020}\x{0650}\x{0651}", # U+FC62 => 0020 0650 0651
"\xEF\xB1\xA3" => "\x{0020}\x{0651}\x{0670}", # U+FC63 => 0020 0651 0670
"\xEF\xB1\xA4" => "\x{0626}\x{0631}", # U+FC64 => 0626 0631
"\xEF\xB1\xA5" => "\x{0626}\x{0632}", # U+FC65 => 0626 0632
"\xEF\xB1\xA6" => "\x{0626}\x{0645}", # U+FC66 => 0626 0645
"\xEF\xB1\xA7" => "\x{0626}\x{0646}", # U+FC67 => 0626 0646
"\xEF\xB1\xA8" => "\x{0626}\x{0649}", # U+FC68 => 0626 0649
"\xEF\xB1\xA9" => "\x{0626}\x{064A}", # U+FC69 => 0626 064A
"\xEF\xB1\xAA" => "\x{0628}\x{0631}", # U+FC6A => 0628 0631
"\xEF\xB1\xAB" => "\x{0628}\x{0632}", # U+FC6B => 0628 0632
"\xEF\xB1\xAC" => "\x{0628}\x{0645}", # U+FC6C => 0628 0645
"\xEF\xB1\xAD" => "\x{0628}\x{0646}", # U+FC6D => 0628 0646
"\xEF\xB1\xAE" => "\x{0628}\x{0649}", # U+FC6E => 0628 0649
"\xEF\xB1\xAF" => "\x{0628}\x{064A}", # U+FC6F => 0628 064A
"\xEF\xB1\xB0" => "\x{062A}\x{0631}", # U+FC70 => 062A 0631
"\xEF\xB1\xB1" => "\x{062A}\x{0632}", # U+FC71 => 062A 0632
"\xEF\xB1\xB2" => "\x{062A}\x{0645}", # U+FC72 => 062A 0645
"\xEF\xB1\xB3" => "\x{062A}\x{0646}", # U+FC73 => 062A 0646
"\xEF\xB1\xB4" => "\x{062A}\x{0649}", # U+FC74 => 062A 0649
"\xEF\xB1\xB5" => "\x{062A}\x{064A}", # U+FC75 => 062A 064A
"\xEF\xB1\xB6" => "\x{062B}\x{0631}", # U+FC76 => 062B 0631
"\xEF\xB1\xB7" => "\x{062B}\x{0632}", # U+FC77 => 062B 0632
"\xEF\xB1\xB8" => "\x{062B}\x{0645}", # U+FC78 => 062B 0645
"\xEF\xB1\xB9" => "\x{062B}\x{0646}", # U+FC79 => 062B 0646
"\xEF\xB1\xBA" => "\x{062B}\x{0649}", # U+FC7A => 062B 0649
"\xEF\xB1\xBB" => "\x{062B}\x{064A}", # U+FC7B => 062B 064A
"\xEF\xB1\xBC" => "\x{0641}\x{0649}", # U+FC7C => 0641 0649
"\xEF\xB1\xBD" => "\x{0641}\x{064A}", # U+FC7D => 0641 064A
"\xEF\xB1\xBE" => "\x{0642}\x{0649}", # U+FC7E => 0642 0649
"\xEF\xB1\xBF" => "\x{0642}\x{064A}", # U+FC7F => 0642 064A
"\xEF\xB2\x80" => "\x{0643}\x{0627}", # U+FC80 => 0643 0627
"\xEF\xB2\x81" => "\x{0643}\x{0644}", # U+FC81 => 0643 0644
"\xEF\xB2\x82" => "\x{0643}\x{0645}", # U+FC82 => 0643 0645
"\xEF\xB2\x83" => "\x{0643}\x{0649}", # U+FC83 => 0643 0649
"\xEF\xB2\x84" => "\x{0643}\x{064A}", # U+FC84 => 0643 064A
"\xEF\xB2\x85" => "\x{0644}\x{0645}", # U+FC85 => 0644 0645
"\xEF\xB2\x86" => "\x{0644}\x{0649}", # U+FC86 => 0644 0649
"\xEF\xB2\x87" => "\x{0644}\x{064A}", # U+FC87 => 0644 064A
"\xEF\xB2\x88" => "\x{0645}\x{0627}", # U+FC88 => 0645 0627
"\xEF\xB2\x89" => "\x{0645}\x{0645}", # U+FC89 => 0645 0645
"\xEF\xB2\x8A" => "\x{0646}\x{0631}", # U+FC8A => 0646 0631
"\xEF\xB2\x8B" => "\x{0646}\x{0632}", # U+FC8B => 0646 0632
"\xEF\xB2\x8C" => "\x{0646}\x{0645}", # U+FC8C => 0646 0645
"\xEF\xB2\x8D" => "\x{0646}\x{0646}", # U+FC8D => 0646 0646
"\xEF\xB2\x8E" => "\x{0646}\x{0649}", # U+FC8E => 0646 0649
"\xEF\xB2\x8F" => "\x{0646}\x{064A}", # U+FC8F => 0646 064A
"\xEF\xB2\x90" => "\x{0649}\x{0670}", # U+FC90 => 0649 0670
"\xEF\xB2\x91" => "\x{064A}\x{0631}", # U+FC91 => 064A 0631
"\xEF\xB2\x92" => "\x{064A}\x{0632}", # U+FC92 => 064A 0632
"\xEF\xB2\x93" => "\x{064A}\x{0645}", # U+FC93 => 064A 0645
"\xEF\xB2\x94" => "\x{064A}\x{0646}", # U+FC94 => 064A 0646
"\xEF\xB2\x95" => "\x{064A}\x{0649}", # U+FC95 => 064A 0649
"\xEF\xB2\x96" => "\x{064A}\x{064A}", # U+FC96 => 064A 064A
"\xEF\xB2\x97" => "\x{0626}\x{062C}", # U+FC97 => 0626 062C
"\xEF\xB2\x98" => "\x{0626}\x{062D}", # U+FC98 => 0626 062D
"\xEF\xB2\x99" => "\x{0626}\x{062E}", # U+FC99 => 0626 062E
"\xEF\xB2\x9A" => "\x{0626}\x{0645}", # U+FC9A => 0626 0645
"\xEF\xB2\x9B" => "\x{0626}\x{0647}", # U+FC9B => 0626 0647
"\xEF\xB2\x9C" => "\x{0628}\x{062C}", # U+FC9C => 0628 062C
"\xEF\xB2\x9D" => "\x{0628}\x{062D}", # U+FC9D => 0628 062D
"\xEF\xB2\x9E" => "\x{0628}\x{062E}", # U+FC9E => 0628 062E
"\xEF\xB2\x9F" => "\x{0628}\x{0645}", # U+FC9F => 0628 0645
"\xEF\xB2\xA0" => "\x{0628}\x{0647}", # U+FCA0 => 0628 0647
"\xEF\xB2\xA1" => "\x{062A}\x{062C}", # U+FCA1 => 062A 062C
"\xEF\xB2\xA2" => "\x{062A}\x{062D}", # U+FCA2 => 062A 062D
"\xEF\xB2\xA3" => "\x{062A}\x{062E}", # U+FCA3 => 062A 062E
"\xEF\xB2\xA4" => "\x{062A}\x{0645}", # U+FCA4 => 062A 0645
"\xEF\xB2\xA5" => "\x{062A}\x{0647}", # U+FCA5 => 062A 0647
"\xEF\xB2\xA6" => "\x{062B}\x{0645}", # U+FCA6 => 062B 0645
"\xEF\xB2\xA7" => "\x{062C}\x{062D}", # U+FCA7 => 062C 062D
"\xEF\xB2\xA8" => "\x{062C}\x{0645}", # U+FCA8 => 062C 0645
"\xEF\xB2\xA9" => "\x{062D}\x{062C}", # U+FCA9 => 062D 062C
"\xEF\xB2\xAA" => "\x{062D}\x{0645}", # U+FCAA => 062D 0645
"\xEF\xB2\xAB" => "\x{062E}\x{062C}", # U+FCAB => 062E 062C
"\xEF\xB2\xAC" => "\x{062E}\x{0645}", # U+FCAC => 062E 0645
"\xEF\xB2\xAD" => "\x{0633}\x{062C}", # U+FCAD => 0633 062C
"\xEF\xB2\xAE" => "\x{0633}\x{062D}", # U+FCAE => 0633 062D
"\xEF\xB2\xAF" => "\x{0633}\x{062E}", # U+FCAF => 0633 062E
"\xEF\xB2\xB0" => "\x{0633}\x{0645}", # U+FCB0 => 0633 0645
"\xEF\xB2\xB1" => "\x{0635}\x{062D}", # U+FCB1 => 0635 062D
"\xEF\xB2\xB2" => "\x{0635}\x{062E}", # U+FCB2 => 0635 062E
"\xEF\xB2\xB3" => "\x{0635}\x{0645}", # U+FCB3 => 0635 0645
"\xEF\xB2\xB4" => "\x{0636}\x{062C}", # U+FCB4 => 0636 062C
"\xEF\xB2\xB5" => "\x{0636}\x{062D}", # U+FCB5 => 0636 062D
"\xEF\xB2\xB6" => "\x{0636}\x{062E}", # U+FCB6 => 0636 062E
"\xEF\xB2\xB7" => "\x{0636}\x{0645}", # U+FCB7 => 0636 0645
"\xEF\xB2\xB8" => "\x{0637}\x{062D}", # U+FCB8 => 0637 062D
"\xEF\xB2\xB9" => "\x{0638}\x{0645}", # U+FCB9 => 0638 0645
"\xEF\xB2\xBA" => "\x{0639}\x{062C}", # U+FCBA => 0639 062C
"\xEF\xB2\xBB" => "\x{0639}\x{0645}", # U+FCBB => 0639 0645
"\xEF\xB2\xBC" => "\x{063A}\x{062C}", # U+FCBC => 063A 062C
"\xEF\xB2\xBD" => "\x{063A}\x{0645}", # U+FCBD => 063A 0645
"\xEF\xB2\xBE" => "\x{0641}\x{062C}", # U+FCBE => 0641 062C
"\xEF\xB2\xBF" => "\x{0641}\x{062D}", # U+FCBF => 0641 062D
"\xEF\xB3\x80" => "\x{0641}\x{062E}", # U+FCC0 => 0641 062E
"\xEF\xB3\x81" => "\x{0641}\x{0645}", # U+FCC1 => 0641 0645
"\xEF\xB3\x82" => "\x{0642}\x{062D}", # U+FCC2 => 0642 062D
"\xEF\xB3\x83" => "\x{0642}\x{0645}", # U+FCC3 => 0642 0645
"\xEF\xB3\x84" => "\x{0643}\x{062C}", # U+FCC4 => 0643 062C
"\xEF\xB3\x85" => "\x{0643}\x{062D}", # U+FCC5 => 0643 062D
"\xEF\xB3\x86" => "\x{0643}\x{062E}", # U+FCC6 => 0643 062E
"\xEF\xB3\x87" => "\x{0643}\x{0644}", # U+FCC7 => 0643 0644
"\xEF\xB3\x88" => "\x{0643}\x{0645}", # U+FCC8 => 0643 0645
"\xEF\xB3\x89" => "\x{0644}\x{062C}", # U+FCC9 => 0644 062C
"\xEF\xB3\x8A" => "\x{0644}\x{062D}", # U+FCCA => 0644 062D
"\xEF\xB3\x8B" => "\x{0644}\x{062E}", # U+FCCB => 0644 062E
"\xEF\xB3\x8C" => "\x{0644}\x{0645}", # U+FCCC => 0644 0645
"\xEF\xB3\x8D" => "\x{0644}\x{0647}", # U+FCCD => 0644 0647
"\xEF\xB3\x8E" => "\x{0645}\x{062C}", # U+FCCE => 0645 062C
"\xEF\xB3\x8F" => "\x{0645}\x{062D}", # U+FCCF => 0645 062D
"\xEF\xB3\x90" => "\x{0645}\x{062E}", # U+FCD0 => 0645 062E
"\xEF\xB3\x91" => "\x{0645}\x{0645}", # U+FCD1 => 0645 0645
"\xEF\xB3\x92" => "\x{0646}\x{062C}", # U+FCD2 => 0646 062C
"\xEF\xB3\x93" => "\x{0646}\x{062D}", # U+FCD3 => 0646 062D
"\xEF\xB3\x94" => "\x{0646}\x{062E}", # U+FCD4 => 0646 062E
"\xEF\xB3\x95" => "\x{0646}\x{0645}", # U+FCD5 => 0646 0645
"\xEF\xB3\x96" => "\x{0646}\x{0647}", # U+FCD6 => 0646 0647
"\xEF\xB3\x97" => "\x{0647}\x{062C}", # U+FCD7 => 0647 062C
"\xEF\xB3\x98" => "\x{0647}\x{0645}", # U+FCD8 => 0647 0645
"\xEF\xB3\x99" => "\x{0647}\x{0670}", # U+FCD9 => 0647 0670
"\xEF\xB3\x9A" => "\x{064A}\x{062C}", # U+FCDA => 064A 062C
"\xEF\xB3\x9B" => "\x{064A}\x{062D}", # U+FCDB => 064A 062D
"\xEF\xB3\x9C" => "\x{064A}\x{062E}", # U+FCDC => 064A 062E
"\xEF\xB3\x9D" => "\x{064A}\x{0645}", # U+FCDD => 064A 0645
"\xEF\xB3\x9E" => "\x{064A}\x{0647}", # U+FCDE => 064A 0647
"\xEF\xB3\x9F" => "\x{0626}\x{0645}", # U+FCDF => 0626 0645
"\xEF\xB3\xA0" => "\x{0626}\x{0647}", # U+FCE0 => 0626 0647
"\xEF\xB3\xA1" => "\x{0628}\x{0645}", # U+FCE1 => 0628 0645
"\xEF\xB3\xA2" => "\x{0628}\x{0647}", # U+FCE2 => 0628 0647
"\xEF\xB3\xA3" => "\x{062A}\x{0645}", # U+FCE3 => 062A 0645
"\xEF\xB3\xA4" => "\x{062A}\x{0647}", # U+FCE4 => 062A 0647
"\xEF\xB3\xA5" => "\x{062B}\x{0645}", # U+FCE5 => 062B 0645
"\xEF\xB3\xA6" => "\x{062B}\x{0647}", # U+FCE6 => 062B 0647
"\xEF\xB3\xA7" => "\x{0633}\x{0645}", # U+FCE7 => 0633 0645
"\xEF\xB3\xA8" => "\x{0633}\x{0647}", # U+FCE8 => 0633 0647
"\xEF\xB3\xA9" => "\x{0634}\x{0645}", # U+FCE9 => 0634 0645
"\xEF\xB3\xAA" => "\x{0634}\x{0647}", # U+FCEA => 0634 0647
"\xEF\xB3\xAB" => "\x{0643}\x{0644}", # U+FCEB => 0643 0644
"\xEF\xB3\xAC" => "\x{0643}\x{0645}", # U+FCEC => 0643 0645
"\xEF\xB3\xAD" => "\x{0644}\x{0645}", # U+FCED => 0644 0645
"\xEF\xB3\xAE" => "\x{0646}\x{0645}", # U+FCEE => 0646 0645
"\xEF\xB3\xAF" => "\x{0646}\x{0647}", # U+FCEF => 0646 0647
"\xEF\xB3\xB0" => "\x{064A}\x{0645}", # U+FCF0 => 064A 0645
"\xEF\xB3\xB1" => "\x{064A}\x{0647}", # U+FCF1 => 064A 0647
"\xEF\xB3\xB2" => "\x{0640}\x{064E}\x{0651}", # U+FCF2 => 0640 064E 0651
"\xEF\xB3\xB3" => "\x{0640}\x{064F}\x{0651}", # U+FCF3 => 0640 064F 0651
"\xEF\xB3\xB4" => "\x{0640}\x{0650}\x{0651}", # U+FCF4 => 0640 0650 0651
"\xEF\xB3\xB5" => "\x{0637}\x{0649}", # U+FCF5 => 0637 0649
"\xEF\xB3\xB6" => "\x{0637}\x{064A}", # U+FCF6 => 0637 064A
"\xEF\xB3\xB7" => "\x{0639}\x{0649}", # U+FCF7 => 0639 0649
"\xEF\xB3\xB8" => "\x{0639}\x{064A}", # U+FCF8 => 0639 064A
"\xEF\xB3\xB9" => "\x{063A}\x{0649}", # U+FCF9 => 063A 0649
"\xEF\xB3\xBA" => "\x{063A}\x{064A}", # U+FCFA => 063A 064A
"\xEF\xB3\xBB" => "\x{0633}\x{0649}", # U+FCFB => 0633 0649
"\xEF\xB3\xBC" => "\x{0633}\x{064A}", # U+FCFC => 0633 064A
"\xEF\xB3\xBD" => "\x{0634}\x{0649}", # U+FCFD => 0634 0649
"\xEF\xB3\xBE" => "\x{0634}\x{064A}", # U+FCFE => 0634 064A
"\xEF\xB3\xBF" => "\x{062D}\x{0649}", # U+FCFF => 062D 0649
"\xEF\xB4\x80" => "\x{062D}\x{064A}", # U+FD00 => 062D 064A
"\xEF\xB4\x81" => "\x{062C}\x{0649}", # U+FD01 => 062C 0649
"\xEF\xB4\x82" => "\x{062C}\x{064A}", # U+FD02 => 062C 064A
"\xEF\xB4\x83" => "\x{062E}\x{0649}", # U+FD03 => 062E 0649
"\xEF\xB4\x84" => "\x{062E}\x{064A}", # U+FD04 => 062E 064A
"\xEF\xB4\x85" => "\x{0635}\x{0649}", # U+FD05 => 0635 0649
"\xEF\xB4\x86" => "\x{0635}\x{064A}", # U+FD06 => 0635 064A
"\xEF\xB4\x87" => "\x{0636}\x{0649}", # U+FD07 => 0636 0649
"\xEF\xB4\x88" => "\x{0636}\x{064A}", # U+FD08 => 0636 064A
"\xEF\xB4\x89" => "\x{0634}\x{062C}", # U+FD09 => 0634 062C
"\xEF\xB4\x8A" => "\x{0634}\x{062D}", # U+FD0A => 0634 062D
"\xEF\xB4\x8B" => "\x{0634}\x{062E}", # U+FD0B => 0634 062E
"\xEF\xB4\x8C" => "\x{0634}\x{0645}", # U+FD0C => 0634 0645
"\xEF\xB4\x8D" => "\x{0634}\x{0631}", # U+FD0D => 0634 0631
"\xEF\xB4\x8E" => "\x{0633}\x{0631}", # U+FD0E => 0633 0631
"\xEF\xB4\x8F" => "\x{0635}\x{0631}", # U+FD0F => 0635 0631
"\xEF\xB4\x90" => "\x{0636}\x{0631}", # U+FD10 => 0636 0631
"\xEF\xB4\x91" => "\x{0637}\x{0649}", # U+FD11 => 0637 0649
"\xEF\xB4\x92" => "\x{0637}\x{064A}", # U+FD12 => 0637 064A
"\xEF\xB4\x93" => "\x{0639}\x{0649}", # U+FD13 => 0639 0649
"\xEF\xB4\x94" => "\x{0639}\x{064A}", # U+FD14 => 0639 064A
"\xEF\xB4\x95" => "\x{063A}\x{0649}", # U+FD15 => 063A 0649
"\xEF\xB4\x96" => "\x{063A}\x{064A}", # U+FD16 => 063A 064A
"\xEF\xB4\x97" => "\x{0633}\x{0649}", # U+FD17 => 0633 0649
"\xEF\xB4\x98" => "\x{0633}\x{064A}", # U+FD18 => 0633 064A
"\xEF\xB4\x99" => "\x{0634}\x{0649}", # U+FD19 => 0634 0649
"\xEF\xB4\x9A" => "\x{0634}\x{064A}", # U+FD1A => 0634 064A
"\xEF\xB4\x9B" => "\x{062D}\x{0649}", # U+FD1B => 062D 0649
"\xEF\xB4\x9C" => "\x{062D}\x{064A}", # U+FD1C => 062D 064A
"\xEF\xB4\x9D" => "\x{062C}\x{0649}", # U+FD1D => 062C 0649
"\xEF\xB4\x9E" => "\x{062C}\x{064A}", # U+FD1E => 062C 064A
"\xEF\xB4\x9F" => "\x{062E}\x{0649}", # U+FD1F => 062E 0649
"\xEF\xB4\xA0" => "\x{062E}\x{064A}", # U+FD20 => 062E 064A
"\xEF\xB4\xA1" => "\x{0635}\x{0649}", # U+FD21 => 0635 0649
"\xEF\xB4\xA2" => "\x{0635}\x{064A}", # U+FD22 => 0635 064A
"\xEF\xB4\xA3" => "\x{0636}\x{0649}", # U+FD23 => 0636 0649
"\xEF\xB4\xA4" => "\x{0636}\x{064A}", # U+FD24 => 0636 064A
"\xEF\xB4\xA5" => "\x{0634}\x{062C}", # U+FD25 => 0634 062C
"\xEF\xB4\xA6" => "\x{0634}\x{062D}", # U+FD26 => 0634 062D
"\xEF\xB4\xA7" => "\x{0634}\x{062E}", # U+FD27 => 0634 062E
"\xEF\xB4\xA8" => "\x{0634}\x{0645}", # U+FD28 => 0634 0645
"\xEF\xB4\xA9" => "\x{0634}\x{0631}", # U+FD29 => 0634 0631
"\xEF\xB4\xAA" => "\x{0633}\x{0631}", # U+FD2A => 0633 0631
"\xEF\xB4\xAB" => "\x{0635}\x{0631}", # U+FD2B => 0635 0631
"\xEF\xB4\xAC" => "\x{0636}\x{0631}", # U+FD2C => 0636 0631
"\xEF\xB4\xAD" => "\x{0634}\x{062C}", # U+FD2D => 0634 062C
"\xEF\xB4\xAE" => "\x{0634}\x{062D}", # U+FD2E => 0634 062D
"\xEF\xB4\xAF" => "\x{0634}\x{062E}", # U+FD2F => 0634 062E
"\xEF\xB4\xB0" => "\x{0634}\x{0645}", # U+FD30 => 0634 0645
"\xEF\xB4\xB1" => "\x{0633}\x{0647}", # U+FD31 => 0633 0647
"\xEF\xB4\xB2" => "\x{0634}\x{0647}", # U+FD32 => 0634 0647
"\xEF\xB4\xB3" => "\x{0637}\x{0645}", # U+FD33 => 0637 0645
"\xEF\xB4\xB4" => "\x{0633}\x{062C}", # U+FD34 => 0633 062C
"\xEF\xB4\xB5" => "\x{0633}\x{062D}", # U+FD35 => 0633 062D
"\xEF\xB4\xB6" => "\x{0633}\x{062E}", # U+FD36 => 0633 062E
"\xEF\xB4\xB7" => "\x{0634}\x{062C}", # U+FD37 => 0634 062C
"\xEF\xB4\xB8" => "\x{0634}\x{062D}", # U+FD38 => 0634 062D
"\xEF\xB4\xB9" => "\x{0634}\x{062E}", # U+FD39 => 0634 062E
"\xEF\xB4\xBA" => "\x{0637}\x{0645}", # U+FD3A => 0637 0645
"\xEF\xB4\xBB" => "\x{0638}\x{0645}", # U+FD3B => 0638 0645
"\xEF\xB4\xBC" => "\x{0627}\x{064B}", # U+FD3C => 0627 064B
"\xEF\xB4\xBD" => "\x{0627}\x{064B}", # U+FD3D => 0627 064B
"\xEF\xB5\x90" => "\x{062A}\x{062C}\x{0645}", # U+FD50 => 062A 062C 0645
"\xEF\xB5\x91" => "\x{062A}\x{062D}\x{062C}", # U+FD51 => 062A 062D 062C
"\xEF\xB5\x92" => "\x{062A}\x{062D}\x{062C}", # U+FD52 => 062A 062D 062C
"\xEF\xB5\x93" => "\x{062A}\x{062D}\x{0645}", # U+FD53 => 062A 062D 0645
"\xEF\xB5\x94" => "\x{062A}\x{062E}\x{0645}", # U+FD54 => 062A 062E 0645
"\xEF\xB5\x95" => "\x{062A}\x{0645}\x{062C}", # U+FD55 => 062A 0645 062C
"\xEF\xB5\x96" => "\x{062A}\x{0645}\x{062D}", # U+FD56 => 062A 0645 062D
"\xEF\xB5\x97" => "\x{062A}\x{0645}\x{062E}", # U+FD57 => 062A 0645 062E
"\xEF\xB5\x98" => "\x{062C}\x{0645}\x{062D}", # U+FD58 => 062C 0645 062D
"\xEF\xB5\x99" => "\x{062C}\x{0645}\x{062D}", # U+FD59 => 062C 0645 062D
"\xEF\xB5\x9A" => "\x{062D}\x{0645}\x{064A}", # U+FD5A => 062D 0645 064A
"\xEF\xB5\x9B" => "\x{062D}\x{0645}\x{0649}", # U+FD5B => 062D 0645 0649
"\xEF\xB5\x9C" => "\x{0633}\x{062D}\x{062C}", # U+FD5C => 0633 062D 062C
"\xEF\xB5\x9D" => "\x{0633}\x{062C}\x{062D}", # U+FD5D => 0633 062C 062D
"\xEF\xB5\x9E" => "\x{0633}\x{062C}\x{0649}", # U+FD5E => 0633 062C 0649
"\xEF\xB5\x9F" => "\x{0633}\x{0645}\x{062D}", # U+FD5F => 0633 0645 062D
"\xEF\xB5\xA0" => "\x{0633}\x{0645}\x{062D}", # U+FD60 => 0633 0645 062D
"\xEF\xB5\xA1" => "\x{0633}\x{0645}\x{062C}", # U+FD61 => 0633 0645 062C
"\xEF\xB5\xA2" => "\x{0633}\x{0645}\x{0645}", # U+FD62 => 0633 0645 0645
"\xEF\xB5\xA3" => "\x{0633}\x{0645}\x{0645}", # U+FD63 => 0633 0645 0645
"\xEF\xB5\xA4" => "\x{0635}\x{062D}\x{062D}", # U+FD64 => 0635 062D 062D
"\xEF\xB5\xA5" => "\x{0635}\x{062D}\x{062D}", # U+FD65 => 0635 062D 062D
"\xEF\xB5\xA6" => "\x{0635}\x{0645}\x{0645}", # U+FD66 => 0635 0645 0645
"\xEF\xB5\xA7" => "\x{0634}\x{062D}\x{0645}", # U+FD67 => 0634 062D 0645
"\xEF\xB5\xA8" => "\x{0634}\x{062D}\x{0645}", # U+FD68 => 0634 062D 0645
"\xEF\xB5\xA9" => "\x{0634}\x{062C}\x{064A}", # U+FD69 => 0634 062C 064A
"\xEF\xB5\xAA" => "\x{0634}\x{0645}\x{062E}", # U+FD6A => 0634 0645 062E
"\xEF\xB5\xAB" => "\x{0634}\x{0645}\x{062E}", # U+FD6B => 0634 0645 062E
"\xEF\xB5\xAC" => "\x{0634}\x{0645}\x{0645}", # U+FD6C => 0634 0645 0645
"\xEF\xB5\xAD" => "\x{0634}\x{0645}\x{0645}", # U+FD6D => 0634 0645 0645
"\xEF\xB5\xAE" => "\x{0636}\x{062D}\x{0649}", # U+FD6E => 0636 062D 0649
"\xEF\xB5\xAF" => "\x{0636}\x{062E}\x{0645}", # U+FD6F => 0636 062E 0645
"\xEF\xB5\xB0" => "\x{0636}\x{062E}\x{0645}", # U+FD70 => 0636 062E 0645
"\xEF\xB5\xB1" => "\x{0637}\x{0645}\x{062D}", # U+FD71 => 0637 0645 062D
"\xEF\xB5\xB2" => "\x{0637}\x{0645}\x{062D}", # U+FD72 => 0637 0645 062D
"\xEF\xB5\xB3" => "\x{0637}\x{0645}\x{0645}", # U+FD73 => 0637 0645 0645
"\xEF\xB5\xB4" => "\x{0637}\x{0645}\x{064A}", # U+FD74 => 0637 0645 064A
"\xEF\xB5\xB5" => "\x{0639}\x{062C}\x{0645}", # U+FD75 => 0639 062C 0645
"\xEF\xB5\xB6" => "\x{0639}\x{0645}\x{0645}", # U+FD76 => 0639 0645 0645
"\xEF\xB5\xB7" => "\x{0639}\x{0645}\x{0645}", # U+FD77 => 0639 0645 0645
"\xEF\xB5\xB8" => "\x{0639}\x{0645}\x{0649}", # U+FD78 => 0639 0645 0649
"\xEF\xB5\xB9" => "\x{063A}\x{0645}\x{0645}", # U+FD79 => 063A 0645 0645
"\xEF\xB5\xBA" => "\x{063A}\x{0645}\x{064A}", # U+FD7A => 063A 0645 064A
"\xEF\xB5\xBB" => "\x{063A}\x{0645}\x{0649}", # U+FD7B => 063A 0645 0649
"\xEF\xB5\xBC" => "\x{0641}\x{062E}\x{0645}", # U+FD7C => 0641 062E 0645
"\xEF\xB5\xBD" => "\x{0641}\x{062E}\x{0645}", # U+FD7D => 0641 062E 0645
"\xEF\xB5\xBE" => "\x{0642}\x{0645}\x{062D}", # U+FD7E => 0642 0645 062D
"\xEF\xB5\xBF" => "\x{0642}\x{0645}\x{0645}", # U+FD7F => 0642 0645 0645
"\xEF\xB6\x80" => "\x{0644}\x{062D}\x{0645}", # U+FD80 => 0644 062D 0645
"\xEF\xB6\x81" => "\x{0644}\x{062D}\x{064A}", # U+FD81 => 0644 062D 064A
"\xEF\xB6\x82" => "\x{0644}\x{062D}\x{0649}", # U+FD82 => 0644 062D 0649
"\xEF\xB6\x83" => "\x{0644}\x{062C}\x{062C}", # U+FD83 => 0644 062C 062C
"\xEF\xB6\x84" => "\x{0644}\x{062C}\x{062C}", # U+FD84 => 0644 062C 062C
"\xEF\xB6\x85" => "\x{0644}\x{062E}\x{0645}", # U+FD85 => 0644 062E 0645
"\xEF\xB6\x86" => "\x{0644}\x{062E}\x{0645}", # U+FD86 => 0644 062E 0645
"\xEF\xB6\x87" => "\x{0644}\x{0645}\x{062D}", # U+FD87 => 0644 0645 062D
"\xEF\xB6\x88" => "\x{0644}\x{0645}\x{062D}", # U+FD88 => 0644 0645 062D
"\xEF\xB6\x89" => "\x{0645}\x{062D}\x{062C}", # U+FD89 => 0645 062D 062C
"\xEF\xB6\x8A" => "\x{0645}\x{062D}\x{0645}", # U+FD8A => 0645 062D 0645
"\xEF\xB6\x8B" => "\x{0645}\x{062D}\x{064A}", # U+FD8B => 0645 062D 064A
"\xEF\xB6\x8C" => "\x{0645}\x{062C}\x{062D}", # U+FD8C => 0645 062C 062D
"\xEF\xB6\x8D" => "\x{0645}\x{062C}\x{0645}", # U+FD8D => 0645 062C 0645
"\xEF\xB6\x8E" => "\x{0645}\x{062E}\x{062C}", # U+FD8E => 0645 062E 062C
"\xEF\xB6\x8F" => "\x{0645}\x{062E}\x{0645}", # U+FD8F => 0645 062E 0645
"\xEF\xB6\x92" => "\x{0645}\x{062C}\x{062E}", # U+FD92 => 0645 062C 062E
"\xEF\xB6\x93" => "\x{0647}\x{0645}\x{062C}", # U+FD93 => 0647 0645 062C
"\xEF\xB6\x94" => "\x{0647}\x{0645}\x{0645}", # U+FD94 => 0647 0645 0645
"\xEF\xB6\x95" => "\x{0646}\x{062D}\x{0645}", # U+FD95 => 0646 062D 0645
"\xEF\xB6\x96" => "\x{0646}\x{062D}\x{0649}", # U+FD96 => 0646 062D 0649
"\xEF\xB6\x97" => "\x{0646}\x{062C}\x{0645}", # U+FD97 => 0646 062C 0645
"\xEF\xB6\x98" => "\x{0646}\x{062C}\x{0645}", # U+FD98 => 0646 062C 0645
"\xEF\xB6\x99" => "\x{0646}\x{062C}\x{0649}", # U+FD99 => 0646 062C 0649
"\xEF\xB6\x9A" => "\x{0646}\x{0645}\x{064A}", # U+FD9A => 0646 0645 064A
"\xEF\xB6\x9B" => "\x{0646}\x{0645}\x{0649}", # U+FD9B => 0646 0645 0649
"\xEF\xB6\x9C" => "\x{064A}\x{0645}\x{0645}", # U+FD9C => 064A 0645 0645
"\xEF\xB6\x9D" => "\x{064A}\x{0645}\x{0645}", # U+FD9D => 064A 0645 0645
"\xEF\xB6\x9E" => "\x{0628}\x{062E}\x{064A}", # U+FD9E => 0628 062E 064A
"\xEF\xB6\x9F" => "\x{062A}\x{062C}\x{064A}", # U+FD9F => 062A 062C 064A
"\xEF\xB6\xA0" => "\x{062A}\x{062C}\x{0649}", # U+FDA0 => 062A 062C 0649
"\xEF\xB6\xA1" => "\x{062A}\x{062E}\x{064A}", # U+FDA1 => 062A 062E 064A
"\xEF\xB6\xA2" => "\x{062A}\x{062E}\x{0649}", # U+FDA2 => 062A 062E 0649
"\xEF\xB6\xA3" => "\x{062A}\x{0645}\x{064A}", # U+FDA3 => 062A 0645 064A
"\xEF\xB6\xA4" => "\x{062A}\x{0645}\x{0649}", # U+FDA4 => 062A 0645 0649
"\xEF\xB6\xA5" => "\x{062C}\x{0645}\x{064A}", # U+FDA5 => 062C 0645 064A
"\xEF\xB6\xA6" => "\x{062C}\x{062D}\x{0649}", # U+FDA6 => 062C 062D 0649
"\xEF\xB6\xA7" => "\x{062C}\x{0645}\x{0649}", # U+FDA7 => 062C 0645 0649
"\xEF\xB6\xA8" => "\x{0633}\x{062E}\x{0649}", # U+FDA8 => 0633 062E 0649
"\xEF\xB6\xA9" => "\x{0635}\x{062D}\x{064A}", # U+FDA9 => 0635 062D 064A
"\xEF\xB6\xAA" => "\x{0634}\x{062D}\x{064A}", # U+FDAA => 0634 062D 064A
"\xEF\xB6\xAB" => "\x{0636}\x{062D}\x{064A}", # U+FDAB => 0636 062D 064A
"\xEF\xB6\xAC" => "\x{0644}\x{062C}\x{064A}", # U+FDAC => 0644 062C 064A
"\xEF\xB6\xAD" => "\x{0644}\x{0645}\x{064A}", # U+FDAD => 0644 0645 064A
"\xEF\xB6\xAE" => "\x{064A}\x{062D}\x{064A}", # U+FDAE => 064A 062D 064A
"\xEF\xB6\xAF" => "\x{064A}\x{062C}\x{064A}", # U+FDAF => 064A 062C 064A
"\xEF\xB6\xB0" => "\x{064A}\x{0645}\x{064A}", # U+FDB0 => 064A 0645 064A
"\xEF\xB6\xB1" => "\x{0645}\x{0645}\x{064A}", # U+FDB1 => 0645 0645 064A
"\xEF\xB6\xB2" => "\x{0642}\x{0645}\x{064A}", # U+FDB2 => 0642 0645 064A
"\xEF\xB6\xB3" => "\x{0646}\x{062D}\x{064A}", # U+FDB3 => 0646 062D 064A
"\xEF\xB6\xB4" => "\x{0642}\x{0645}\x{062D}", # U+FDB4 => 0642 0645 062D
"\xEF\xB6\xB5" => "\x{0644}\x{062D}\x{0645}", # U+FDB5 => 0644 062D 0645
"\xEF\xB6\xB6" => "\x{0639}\x{0645}\x{064A}", # U+FDB6 => 0639 0645 064A
"\xEF\xB6\xB7" => "\x{0643}\x{0645}\x{064A}", # U+FDB7 => 0643 0645 064A
"\xEF\xB6\xB8" => "\x{0646}\x{062C}\x{062D}", # U+FDB8 => 0646 062C 062D
"\xEF\xB6\xB9" => "\x{0645}\x{062E}\x{064A}", # U+FDB9 => 0645 062E 064A
"\xEF\xB6\xBA" => "\x{0644}\x{062C}\x{0645}", # U+FDBA => 0644 062C 0645
"\xEF\xB6\xBB" => "\x{0643}\x{0645}\x{0645}", # U+FDBB => 0643 0645 0645
"\xEF\xB6\xBC" => "\x{0644}\x{062C}\x{0645}", # U+FDBC => 0644 062C 0645
"\xEF\xB6\xBD" => "\x{0646}\x{062C}\x{062D}", # U+FDBD => 0646 062C 062D
"\xEF\xB6\xBE" => "\x{062C}\x{062D}\x{064A}", # U+FDBE => 062C 062D 064A
"\xEF\xB6\xBF" => "\x{062D}\x{062C}\x{064A}", # U+FDBF => 062D 062C 064A
"\xEF\xB7\x80" => "\x{0645}\x{062C}\x{064A}", # U+FDC0 => 0645 062C 064A
"\xEF\xB7\x81" => "\x{0641}\x{0645}\x{064A}", # U+FDC1 => 0641 0645 064A
"\xEF\xB7\x82" => "\x{0628}\x{062D}\x{064A}", # U+FDC2 => 0628 062D 064A
"\xEF\xB7\x83" => "\x{0643}\x{0645}\x{0645}", # U+FDC3 => 0643 0645 0645
"\xEF\xB7\x84" => "\x{0639}\x{062C}\x{0645}", # U+FDC4 => 0639 062C 0645
"\xEF\xB7\x85" => "\x{0635}\x{0645}\x{0645}", # U+FDC5 => 0635 0645 0645
"\xEF\xB7\x86" => "\x{0633}\x{062E}\x{064A}", # U+FDC6 => 0633 062E 064A
"\xEF\xB7\x87" => "\x{0646}\x{062C}\x{064A}", # U+FDC7 => 0646 062C 064A
"\xEF\xB7\xB0" => "\x{0635}\x{0644}\x{06D2}", # U+FDF0 => 0635 0644 06D2
"\xEF\xB7\xB1" => "\x{0642}\x{0644}\x{06D2}", # U+FDF1 => 0642 0644 06D2
"\xEF\xB7\xB2" => "\x{0627}\x{0644}\x{0644}\x{0647}", # U+FDF2 => 0627 0644 0644 0647
"\xEF\xB7\xB3" => "\x{0627}\x{0643}\x{0628}\x{0631}", # U+FDF3 => 0627 0643 0628 0631
"\xEF\xB7\xB4" => "\x{0645}\x{062D}\x{0645}\x{062F}", # U+FDF4 => 0645 062D 0645 062F
"\xEF\xB7\xB5" => "\x{0635}\x{0644}\x{0639}\x{0645}", # U+FDF5 => 0635 0644 0639 0645
"\xEF\xB7\xB6" => "\x{0631}\x{0633}\x{0648}\x{0644}", # U+FDF6 => 0631 0633 0648 0644
"\xEF\xB7\xB7" => "\x{0639}\x{0644}\x{064A}\x{0647}", # U+FDF7 => 0639 0644 064A 0647
"\xEF\xB7\xB8" => "\x{0648}\x{0633}\x{0644}\x{0645}", # U+FDF8 => 0648 0633 0644 0645
"\xEF\xB7\xB9" => "\x{0635}\x{0644}\x{0649}", # U+FDF9 => 0635 0644 0649
"\xEF\xB7\xBA" => "\x{0635}\x{0644}\x{0649}\x{0020}\x{0627}\x{0644}\x{0644}\x{0647}\x{0020}\x{0639}\x{0644}\x{064A}\x{0647}\x{0020}\x{0648}\x{0633}\x{0644}\x{0645}", # U+FDFA => 0635 0644 0649 0020 0627 0644 0644 0647 0020 0639 0644 064A 0647 0020 0648 0633 0644 0645
"\xEF\xB7\xBB" => "\x{062C}\x{0644}\x{0020}\x{062C}\x{0644}\x{0627}\x{0644}\x{0647}", # U+FDFB => 062C 0644 0020 062C 0644 0627 0644 0647
"\xEF\xB7\xBC" => "\x{0631}\x{06CC}\x{0627}\x{0644}", # U+FDFC => 0631 06CC 0627 0644
"\xEF\xB8\x80" => "", # U+FE00 =>
"\xEF\xB8\x81" => "", # U+FE01 =>
"\xEF\xB8\x82" => "", # U+FE02 =>
"\xEF\xB8\x83" => "", # U+FE03 =>
"\xEF\xB8\x84" => "", # U+FE04 =>
"\xEF\xB8\x85" => "", # U+FE05 =>
"\xEF\xB8\x86" => "", # U+FE06 =>
"\xEF\xB8\x87" => "", # U+FE07 =>
"\xEF\xB8\x88" => "", # U+FE08 =>
"\xEF\xB8\x89" => "", # U+FE09 =>
"\xEF\xB8\x8A" => "", # U+FE0A =>
"\xEF\xB8\x8B" => "", # U+FE0B =>
"\xEF\xB8\x8C" => "", # U+FE0C =>
"\xEF\xB8\x8D" => "", # U+FE0D =>
"\xEF\xB8\x8E" => "", # U+FE0E =>
"\xEF\xB8\x8F" => "", # U+FE0F =>
"\xEF\xB8\x99" => "\x{002E}\x{002E}\x{002E}", # U+FE19 => 002E 002E 002E
"\xEF\xB8\xB0" => "\x{002E}\x{002E}", # U+FE30 => 002E 002E
"\xEF\xB9\x89" => "\x{0020}\x{0305}", # U+FE49 => 0020 0305
"\xEF\xB9\x8A" => "\x{0020}\x{0305}", # U+FE4A => 0020 0305
"\xEF\xB9\x8B" => "\x{0020}\x{0305}", # U+FE4B => 0020 0305
"\xEF\xB9\x8C" => "\x{0020}\x{0305}", # U+FE4C => 0020 0305
"\xEF\xB9\xB0" => "\x{0020}\x{064B}", # U+FE70 => 0020 064B
"\xEF\xB9\xB1" => "\x{0640}\x{064B}", # U+FE71 => 0640 064B
"\xEF\xB9\xB2" => "\x{0020}\x{064C}", # U+FE72 => 0020 064C
"\xEF\xB9\xB4" => "\x{0020}\x{064D}", # U+FE74 => 0020 064D
"\xEF\xB9\xB6" => "\x{0020}\x{064E}", # U+FE76 => 0020 064E
"\xEF\xB9\xB7" => "\x{0640}\x{064E}", # U+FE77 => 0640 064E
"\xEF\xB9\xB8" => "\x{0020}\x{064F}", # U+FE78 => 0020 064F
"\xEF\xB9\xB9" => "\x{0640}\x{064F}", # U+FE79 => 0640 064F
"\xEF\xB9\xBA" => "\x{0020}\x{0650}", # U+FE7A => 0020 0650
"\xEF\xB9\xBB" => "\x{0640}\x{0650}", # U+FE7B => 0640 0650
"\xEF\xB9\xBC" => "\x{0020}\x{0651}", # U+FE7C => 0020 0651
"\xEF\xB9\xBD" => "\x{0640}\x{0651}", # U+FE7D => 0640 0651
"\xEF\xB9\xBE" => "\x{0020}\x{0652}", # U+FE7E => 0020 0652
"\xEF\xB9\xBF" => "\x{0640}\x{0652}", # U+FE7F => 0640 0652
"\xEF\xBB\xB5" => "\x{0644}\x{0622}", # U+FEF5 => 0644 0622
"\xEF\xBB\xB6" => "\x{0644}\x{0622}", # U+FEF6 => 0644 0622
"\xEF\xBB\xB7" => "\x{0644}\x{0623}", # U+FEF7 => 0644 0623
"\xEF\xBB\xB8" => "\x{0644}\x{0623}", # U+FEF8 => 0644 0623
"\xEF\xBB\xB9" => "\x{0644}\x{0625}", # U+FEF9 => 0644 0625
"\xEF\xBB\xBA" => "\x{0644}\x{0625}", # U+FEFA => 0644 0625
"\xEF\xBB\xBB" => "\x{0644}\x{0627}", # U+FEFB => 0644 0627
"\xEF\xBB\xBC" => "\x{0644}\x{0627}", # U+FEFC => 0644 0627
"\xEF\xBB\xBF" => "", # U+FEFF =>
"\xEF\xBE\xA0" => "", # U+FFA0 =>
"\xEF\xBF\xA3" => "\x{0020}\x{0304}", # U+FFE3 => 0020 0304
"\xEF\xBF\xB0" => "", # U+FFF0 =>
"\xEF\xBF\xB1" => "", # U+FFF1 =>
"\xEF\xBF\xB2" => "", # U+FFF2 =>
"\xEF\xBF\xB3" => "", # U+FFF3 =>
"\xEF\xBF\xB4" => "", # U+FFF4 =>
"\xEF\xBF\xB5" => "", # U+FFF5 =>
"\xEF\xBF\xB6" => "", # U+FFF6 =>
"\xEF\xBF\xB7" => "", # U+FFF7 =>
"\xEF\xBF\xB8" => "", # U+FFF8 =>
"\xF0\x9D\x85\x9E" => "\x{1D157}\x{1D165}", # U+1D15E => 1D157 1D165
"\xF0\x9D\x85\x9F" => "\x{1D158}\x{1D165}", # U+1D15F => 1D158 1D165
"\xF0\x9D\x85\xA0" => "\x{1D158}\x{1D165}\x{1D16E}", # U+1D160 => 1D158 1D165 1D16E
"\xF0\x9D\x85\xA1" => "\x{1D158}\x{1D165}\x{1D16F}", # U+1D161 => 1D158 1D165 1D16F
"\xF0\x9D\x85\xA2" => "\x{1D158}\x{1D165}\x{1D170}", # U+1D162 => 1D158 1D165 1D170
"\xF0\x9D\x85\xA3" => "\x{1D158}\x{1D165}\x{1D171}", # U+1D163 => 1D158 1D165 1D171
"\xF0\x9D\x85\xA4" => "\x{1D158}\x{1D165}\x{1D172}", # U+1D164 => 1D158 1D165 1D172
"\xF0\x9D\x85\xB3" => "", # U+1D173 =>
"\xF0\x9D\x85\xB4" => "", # U+1D174 =>
"\xF0\x9D\x85\xB5" => "", # U+1D175 =>
"\xF0\x9D\x85\xB6" => "", # U+1D176 =>
"\xF0\x9D\x85\xB7" => "", # U+1D177 =>
"\xF0\x9D\x85\xB8" => "", # U+1D178 =>
"\xF0\x9D\x85\xB9" => "", # U+1D179 =>
"\xF0\x9D\x85\xBA" => "", # U+1D17A =>
"\xF0\x9D\x86\xBB" => "\x{1D1B9}\x{1D165}", # U+1D1BB => 1D1B9 1D165
"\xF0\x9D\x86\xBC" => "\x{1D1BA}\x{1D165}", # U+1D1BC => 1D1BA 1D165
"\xF0\x9D\x86\xBD" => "\x{1D1B9}\x{1D165}\x{1D16E}", # U+1D1BD => 1D1B9 1D165 1D16E
"\xF0\x9D\x86\xBE" => "\x{1D1BA}\x{1D165}\x{1D16E}", # U+1D1BE => 1D1BA 1D165 1D16E
"\xF0\x9D\x86\xBF" => "\x{1D1B9}\x{1D165}\x{1D16F}", # U+1D1BF => 1D1B9 1D165 1D16F
"\xF0\x9D\x87\x80" => "\x{1D1BA}\x{1D165}\x{1D16F}", # U+1D1C0 => 1D1BA 1D165 1D16F
"\xF0\x9F\x84\x80" => "\x{0030}\x{002E}", # U+1F100 => 0030 002E
"\xF0\x9F\x84\x81" => "\x{0030}\x{002C}", # U+1F101 => 0030 002C
"\xF0\x9F\x84\x82" => "\x{0031}\x{002C}", # U+1F102 => 0031 002C
"\xF0\x9F\x84\x83" => "\x{0032}\x{002C}", # U+1F103 => 0032 002C
"\xF0\x9F\x84\x84" => "\x{0033}\x{002C}", # U+1F104 => 0033 002C
"\xF0\x9F\x84\x85" => "\x{0034}\x{002C}", # U+1F105 => 0034 002C
"\xF0\x9F\x84\x86" => "\x{0035}\x{002C}", # U+1F106 => 0035 002C
"\xF0\x9F\x84\x87" => "\x{0036}\x{002C}", # U+1F107 => 0036 002C
"\xF0\x9F\x84\x88" => "\x{0037}\x{002C}", # U+1F108 => 0037 002C
"\xF0\x9F\x84\x89" => "\x{0038}\x{002C}", # U+1F109 => 0038 002C
"\xF0\x9F\x84\x8A" => "\x{0039}\x{002C}", # U+1F10A => 0039 002C
"\xF0\x9F\x84\x90" => "\x{0028}\x{0061}\x{0029}", # U+1F110 => 0028 0061 0029
"\xF0\x9F\x84\x91" => "\x{0028}\x{0062}\x{0029}", # U+1F111 => 0028 0062 0029
"\xF0\x9F\x84\x92" => "\x{0028}\x{0063}\x{0029}", # U+1F112 => 0028 0063 0029
"\xF0\x9F\x84\x93" => "\x{0028}\x{0064}\x{0029}", # U+1F113 => 0028 0064 0029
"\xF0\x9F\x84\x94" => "\x{0028}\x{0065}\x{0029}", # U+1F114 => 0028 0065 0029
"\xF0\x9F\x84\x95" => "\x{0028}\x{0066}\x{0029}", # U+1F115 => 0028 0066 0029
"\xF0\x9F\x84\x96" => "\x{0028}\x{0067}\x{0029}", # U+1F116 => 0028 0067 0029
"\xF0\x9F\x84\x97" => "\x{0028}\x{0068}\x{0029}", # U+1F117 => 0028 0068 0029
"\xF0\x9F\x84\x98" => "\x{0028}\x{0069}\x{0029}", # U+1F118 => 0028 0069 0029
"\xF0\x9F\x84\x99" => "\x{0028}\x{006A}\x{0029}", # U+1F119 => 0028 006A 0029
"\xF0\x9F\x84\x9A" => "\x{0028}\x{006B}\x{0029}", # U+1F11A => 0028 006B 0029
"\xF0\x9F\x84\x9B" => "\x{0028}\x{006C}\x{0029}", # U+1F11B => 0028 006C 0029
"\xF0\x9F\x84\x9C" => "\x{0028}\x{006D}\x{0029}", # U+1F11C => 0028 006D 0029
"\xF0\x9F\x84\x9D" => "\x{0028}\x{006E}\x{0029}", # U+1F11D => 0028 006E 0029
"\xF0\x9F\x84\x9E" => "\x{0028}\x{006F}\x{0029}", # U+1F11E => 0028 006F 0029
"\xF0\x9F\x84\x9F" => "\x{0028}\x{0070}\x{0029}", # U+1F11F => 0028 0070 0029
"\xF0\x9F\x84\xA0" => "\x{0028}\x{0071}\x{0029}", # U+1F120 => 0028 0071 0029
"\xF0\x9F\x84\xA1" => "\x{0028}\x{0072}\x{0029}", # U+1F121 => 0028 0072 0029
"\xF0\x9F\x84\xA2" => "\x{0028}\x{0073}\x{0029}", # U+1F122 => 0028 0073 0029
"\xF0\x9F\x84\xA3" => "\x{0028}\x{0074}\x{0029}", # U+1F123 => 0028 0074 0029
"\xF0\x9F\x84\xA4" => "\x{0028}\x{0075}\x{0029}", # U+1F124 => 0028 0075 0029
"\xF0\x9F\x84\xA5" => "\x{0028}\x{0076}\x{0029}", # U+1F125 => 0028 0076 0029
"\xF0\x9F\x84\xA6" => "\x{0028}\x{0077}\x{0029}", # U+1F126 => 0028 0077 0029
"\xF0\x9F\x84\xA7" => "\x{0028}\x{0078}\x{0029}", # U+1F127 => 0028 0078 0029
"\xF0\x9F\x84\xA8" => "\x{0028}\x{0079}\x{0029}", # U+1F128 => 0028 0079 0029
"\xF0\x9F\x84\xA9" => "\x{0028}\x{007A}\x{0029}", # U+1F129 => 0028 007A 0029
"\xF0\x9F\x84\xAA" => "\x{3014}\x{0073}\x{3015}", # U+1F12A => 3014 0073 3015
"\xF0\x9F\x84\xAD" => "\x{0063}\x{0064}", # U+1F12D => 0063 0064
"\xF0\x9F\x84\xAE" => "\x{0077}\x{007A}", # U+1F12E => 0077 007A
"\xF0\x9F\x85\x8A" => "\x{0068}\x{0076}", # U+1F14A => 0068 0076
"\xF0\x9F\x85\x8B" => "\x{006D}\x{0076}", # U+1F14B => 006D 0076
"\xF0\x9F\x85\x8C" => "\x{0073}\x{0064}", # U+1F14C => 0073 0064
"\xF0\x9F\x85\x8D" => "\x{0073}\x{0073}", # U+1F14D => 0073 0073
"\xF0\x9F\x85\x8E" => "\x{0070}\x{0070}\x{0076}", # U+1F14E => 0070 0070 0076
"\xF0\x9F\x85\x8F" => "\x{0077}\x{0063}", # U+1F14F => 0077 0063
"\xF0\x9F\x85\xAA" => "\x{006D}\x{0063}", # U+1F16A => 006D 0063
"\xF0\x9F\x85\xAB" => "\x{006D}\x{0064}", # U+1F16B => 006D 0064
"\xF0\x9F\x86\x90" => "\x{0064}\x{006A}", # U+1F190 => 0064 006A
"\xF0\x9F\x88\x80" => "\x{307B}\x{304B}", # U+1F200 => 307B 304B
"\xF0\x9F\x88\x81" => "\x{30B3}\x{30B3}", # U+1F201 => 30B3 30B3
"\xF0\x9F\x89\x80" => "\x{3014}\x{672C}\x{3015}", # U+1F240 => 3014 672C 3015
"\xF0\x9F\x89\x81" => "\x{3014}\x{4E09}\x{3015}", # U+1F241 => 3014 4E09 3015
"\xF0\x9F\x89\x82" => "\x{3014}\x{4E8C}\x{3015}", # U+1F242 => 3014 4E8C 3015
"\xF0\x9F\x89\x83" => "\x{3014}\x{5B89}\x{3015}", # U+1F243 => 3014 5B89 3015
"\xF0\x9F\x89\x84" => "\x{3014}\x{70B9}\x{3015}", # U+1F244 => 3014 70B9 3015
"\xF0\x9F\x89\x85" => "\x{3014}\x{6253}\x{3015}", # U+1F245 => 3014 6253 3015
"\xF0\x9F\x89\x86" => "\x{3014}\x{76D7}\x{3015}", # U+1F246 => 3014 76D7 3015
"\xF0\x9F\x89\x87" => "\x{3014}\x{52DD}\x{3015}", # U+1F247 => 3014 52DD 3015
"\xF0\x9F\x89\x88" => "\x{3014}\x{6557}\x{3015}", # U+1F248 => 3014 6557 3015
"\xF3\xA0\x80\x80" => "", # U+E0000 =>
"\xF3\xA0\x80\x81" => "", # U+E0001 =>
"\xF3\xA0\x80\x82" => "", # U+E0002 =>
"\xF3\xA0\x80\x83" => "", # U+E0003 =>
"\xF3\xA0\x80\x84" => "", # U+E0004 =>
"\xF3\xA0\x80\x85" => "", # U+E0005 =>
"\xF3\xA0\x80\x86" => "", # U+E0006 =>
"\xF3\xA0\x80\x87" => "", # U+E0007 =>
"\xF3\xA0\x80\x88" => "", # U+E0008 =>
"\xF3\xA0\x80\x89" => "", # U+E0009 =>
"\xF3\xA0\x80\x8A" => "", # U+E000A =>
"\xF3\xA0\x80\x8B" => "", # U+E000B =>
"\xF3\xA0\x80\x8C" => "", # U+E000C =>
"\xF3\xA0\x80\x8D" => "", # U+E000D =>
"\xF3\xA0\x80\x8E" => "", # U+E000E =>
"\xF3\xA0\x80\x8F" => "", # U+E000F =>
"\xF3\xA0\x80\x90" => "", # U+E0010 =>
"\xF3\xA0\x80\x91" => "", # U+E0011 =>
"\xF3\xA0\x80\x92" => "", # U+E0012 =>
"\xF3\xA0\x80\x93" => "", # U+E0013 =>
"\xF3\xA0\x80\x94" => "", # U+E0014 =>
"\xF3\xA0\x80\x95" => "", # U+E0015 =>
"\xF3\xA0\x80\x96" => "", # U+E0016 =>
"\xF3\xA0\x80\x97" => "", # U+E0017 =>
"\xF3\xA0\x80\x98" => "", # U+E0018 =>
"\xF3\xA0\x80\x99" => "", # U+E0019 =>
"\xF3\xA0\x80\x9A" => "", # U+E001A =>
"\xF3\xA0\x80\x9B" => "", # U+E001B =>
"\xF3\xA0\x80\x9C" => "", # U+E001C =>
"\xF3\xA0\x80\x9D" => "", # U+E001D =>
"\xF3\xA0\x80\x9E" => "", # U+E001E =>
"\xF3\xA0\x80\x9F" => "", # U+E001F =>
"\xF3\xA0\x80\xA0" => "", # U+E0020 =>
"\xF3\xA0\x80\xA1" => "", # U+E0021 =>
"\xF3\xA0\x80\xA2" => "", # U+E0022 =>
"\xF3\xA0\x80\xA3" => "", # U+E0023 =>
"\xF3\xA0\x80\xA4" => "", # U+E0024 =>
"\xF3\xA0\x80\xA5" => "", # U+E0025 =>
"\xF3\xA0\x80\xA6" => "", # U+E0026 =>
"\xF3\xA0\x80\xA7" => "", # U+E0027 =>
"\xF3\xA0\x80\xA8" => "", # U+E0028 =>
"\xF3\xA0\x80\xA9" => "", # U+E0029 =>
"\xF3\xA0\x80\xAA" => "", # U+E002A =>
"\xF3\xA0\x80\xAB" => "", # U+E002B =>
"\xF3\xA0\x80\xAC" => "", # U+E002C =>
"\xF3\xA0\x80\xAD" => "", # U+E002D =>
"\xF3\xA0\x80\xAE" => "", # U+E002E =>
"\xF3\xA0\x80\xAF" => "", # U+E002F =>
"\xF3\xA0\x80\xB0" => "", # U+E0030 =>
"\xF3\xA0\x80\xB1" => "", # U+E0031 =>
"\xF3\xA0\x80\xB2" => "", # U+E0032 =>
"\xF3\xA0\x80\xB3" => "", # U+E0033 =>
"\xF3\xA0\x80\xB4" => "", # U+E0034 =>
"\xF3\xA0\x80\xB5" => "", # U+E0035 =>
"\xF3\xA0\x80\xB6" => "", # U+E0036 =>
"\xF3\xA0\x80\xB7" => "", # U+E0037 =>
"\xF3\xA0\x80\xB8" => "", # U+E0038 =>
"\xF3\xA0\x80\xB9" => "", # U+E0039 =>
"\xF3\xA0\x80\xBA" => "", # U+E003A =>
"\xF3\xA0\x80\xBB" => "", # U+E003B =>
"\xF3\xA0\x80\xBC" => "", # U+E003C =>
"\xF3\xA0\x80\xBD" => "", # U+E003D =>
"\xF3\xA0\x80\xBE" => "", # U+E003E =>
"\xF3\xA0\x80\xBF" => "", # U+E003F =>
"\xF3\xA0\x81\x80" => "", # U+E0040 =>
"\xF3\xA0\x81\x81" => "", # U+E0041 =>
"\xF3\xA0\x81\x82" => "", # U+E0042 =>
"\xF3\xA0\x81\x83" => "", # U+E0043 =>
"\xF3\xA0\x81\x84" => "", # U+E0044 =>
"\xF3\xA0\x81\x85" => "", # U+E0045 =>
"\xF3\xA0\x81\x86" => "", # U+E0046 =>
"\xF3\xA0\x81\x87" => "", # U+E0047 =>
"\xF3\xA0\x81\x88" => "", # U+E0048 =>
"\xF3\xA0\x81\x89" => "", # U+E0049 =>
"\xF3\xA0\x81\x8A" => "", # U+E004A =>
"\xF3\xA0\x81\x8B" => "", # U+E004B =>
"\xF3\xA0\x81\x8C" => "", # U+E004C =>
"\xF3\xA0\x81\x8D" => "", # U+E004D =>
"\xF3\xA0\x81\x8E" => "", # U+E004E =>
"\xF3\xA0\x81\x8F" => "", # U+E004F =>
"\xF3\xA0\x81\x90" => "", # U+E0050 =>
"\xF3\xA0\x81\x91" => "", # U+E0051 =>
"\xF3\xA0\x81\x92" => "", # U+E0052 =>
"\xF3\xA0\x81\x93" => "", # U+E0053 =>
"\xF3\xA0\x81\x94" => "", # U+E0054 =>
"\xF3\xA0\x81\x95" => "", # U+E0055 =>
"\xF3\xA0\x81\x96" => "", # U+E0056 =>
"\xF3\xA0\x81\x97" => "", # U+E0057 =>
"\xF3\xA0\x81\x98" => "", # U+E0058 =>
"\xF3\xA0\x81\x99" => "", # U+E0059 =>
"\xF3\xA0\x81\x9A" => "", # U+E005A =>
"\xF3\xA0\x81\x9B" => "", # U+E005B =>
"\xF3\xA0\x81\x9C" => "", # U+E005C =>
"\xF3\xA0\x81\x9D" => "", # U+E005D =>
"\xF3\xA0\x81\x9E" => "", # U+E005E =>
"\xF3\xA0\x81\x9F" => "", # U+E005F =>
"\xF3\xA0\x81\xA0" => "", # U+E0060 =>
"\xF3\xA0\x81\xA1" => "", # U+E0061 =>
"\xF3\xA0\x81\xA2" => "", # U+E0062 =>
"\xF3\xA0\x81\xA3" => "", # U+E0063 =>
"\xF3\xA0\x81\xA4" => "", # U+E0064 =>
"\xF3\xA0\x81\xA5" => "", # U+E0065 =>
"\xF3\xA0\x81\xA6" => "", # U+E0066 =>
"\xF3\xA0\x81\xA7" => "", # U+E0067 =>
"\xF3\xA0\x81\xA8" => "", # U+E0068 =>
"\xF3\xA0\x81\xA9" => "", # U+E0069 =>
"\xF3\xA0\x81\xAA" => "", # U+E006A =>
"\xF3\xA0\x81\xAB" => "", # U+E006B =>
"\xF3\xA0\x81\xAC" => "", # U+E006C =>
"\xF3\xA0\x81\xAD" => "", # U+E006D =>
"\xF3\xA0\x81\xAE" => "", # U+E006E =>
"\xF3\xA0\x81\xAF" => "", # U+E006F =>
"\xF3\xA0\x81\xB0" => "", # U+E0070 =>
"\xF3\xA0\x81\xB1" => "", # U+E0071 =>
"\xF3\xA0\x81\xB2" => "", # U+E0072 =>
"\xF3\xA0\x81\xB3" => "", # U+E0073 =>
"\xF3\xA0\x81\xB4" => "", # U+E0074 =>
"\xF3\xA0\x81\xB5" => "", # U+E0075 =>
"\xF3\xA0\x81\xB6" => "", # U+E0076 =>
"\xF3\xA0\x81\xB7" => "", # U+E0077 =>
"\xF3\xA0\x81\xB8" => "", # U+E0078 =>
"\xF3\xA0\x81\xB9" => "", # U+E0079 =>
"\xF3\xA0\x81\xBA" => "", # U+E007A =>
"\xF3\xA0\x81\xBB" => "", # U+E007B =>
"\xF3\xA0\x81\xBC" => "", # U+E007C =>
"\xF3\xA0\x81\xBD" => "", # U+E007D =>
"\xF3\xA0\x81\xBE" => "", # U+E007E =>
"\xF3\xA0\x81\xBF" => "", # U+E007F =>
"\xF3\xA0\x82\x80" => "", # U+E0080 =>
"\xF3\xA0\x82\x81" => "", # U+E0081 =>
"\xF3\xA0\x82\x82" => "", # U+E0082 =>
"\xF3\xA0\x82\x83" => "", # U+E0083 =>
"\xF3\xA0\x82\x84" => "", # U+E0084 =>
"\xF3\xA0\x82\x85" => "", # U+E0085 =>
"\xF3\xA0\x82\x86" => "", # U+E0086 =>
"\xF3\xA0\x82\x87" => "", # U+E0087 =>
"\xF3\xA0\x82\x88" => "", # U+E0088 =>
"\xF3\xA0\x82\x89" => "", # U+E0089 =>
"\xF3\xA0\x82\x8A" => "", # U+E008A =>
"\xF3\xA0\x82\x8B" => "", # U+E008B =>
"\xF3\xA0\x82\x8C" => "", # U+E008C =>
"\xF3\xA0\x82\x8D" => "", # U+E008D =>
"\xF3\xA0\x82\x8E" => "", # U+E008E =>
"\xF3\xA0\x82\x8F" => "", # U+E008F =>
"\xF3\xA0\x82\x90" => "", # U+E0090 =>
"\xF3\xA0\x82\x91" => "", # U+E0091 =>
"\xF3\xA0\x82\x92" => "", # U+E0092 =>
"\xF3\xA0\x82\x93" => "", # U+E0093 =>
"\xF3\xA0\x82\x94" => "", # U+E0094 =>
"\xF3\xA0\x82\x95" => "", # U+E0095 =>
"\xF3\xA0\x82\x96" => "", # U+E0096 =>
"\xF3\xA0\x82\x97" => "", # U+E0097 =>
"\xF3\xA0\x82\x98" => "", # U+E0098 =>
"\xF3\xA0\x82\x99" => "", # U+E0099 =>
"\xF3\xA0\x82\x9A" => "", # U+E009A =>
"\xF3\xA0\x82\x9B" => "", # U+E009B =>
"\xF3\xA0\x82\x9C" => "", # U+E009C =>
"\xF3\xA0\x82\x9D" => "", # U+E009D =>
"\xF3\xA0\x82\x9E" => "", # U+E009E =>
"\xF3\xA0\x82\x9F" => "", # U+E009F =>
"\xF3\xA0\x82\xA0" => "", # U+E00A0 =>
"\xF3\xA0\x82\xA1" => "", # U+E00A1 =>
"\xF3\xA0\x82\xA2" => "", # U+E00A2 =>
"\xF3\xA0\x82\xA3" => "", # U+E00A3 =>
"\xF3\xA0\x82\xA4" => "", # U+E00A4 =>
"\xF3\xA0\x82\xA5" => "", # U+E00A5 =>
"\xF3\xA0\x82\xA6" => "", # U+E00A6 =>
"\xF3\xA0\x82\xA7" => "", # U+E00A7 =>
"\xF3\xA0\x82\xA8" => "", # U+E00A8 =>
"\xF3\xA0\x82\xA9" => "", # U+E00A9 =>
"\xF3\xA0\x82\xAA" => "", # U+E00AA =>
"\xF3\xA0\x82\xAB" => "", # U+E00AB =>
"\xF3\xA0\x82\xAC" => "", # U+E00AC =>
"\xF3\xA0\x82\xAD" => "", # U+E00AD =>
"\xF3\xA0\x82\xAE" => "", # U+E00AE =>
"\xF3\xA0\x82\xAF" => "", # U+E00AF =>
"\xF3\xA0\x82\xB0" => "", # U+E00B0 =>
"\xF3\xA0\x82\xB1" => "", # U+E00B1 =>
"\xF3\xA0\x82\xB2" => "", # U+E00B2 =>
"\xF3\xA0\x82\xB3" => "", # U+E00B3 =>
"\xF3\xA0\x82\xB4" => "", # U+E00B4 =>
"\xF3\xA0\x82\xB5" => "", # U+E00B5 =>
"\xF3\xA0\x82\xB6" => "", # U+E00B6 =>
"\xF3\xA0\x82\xB7" => "", # U+E00B7 =>
"\xF3\xA0\x82\xB8" => "", # U+E00B8 =>
"\xF3\xA0\x82\xB9" => "", # U+E00B9 =>
"\xF3\xA0\x82\xBA" => "", # U+E00BA =>
"\xF3\xA0\x82\xBB" => "", # U+E00BB =>
"\xF3\xA0\x82\xBC" => "", # U+E00BC =>
"\xF3\xA0\x82\xBD" => "", # U+E00BD =>
"\xF3\xA0\x82\xBE" => "", # U+E00BE =>
"\xF3\xA0\x82\xBF" => "", # U+E00BF =>
"\xF3\xA0\x83\x80" => "", # U+E00C0 =>
"\xF3\xA0\x83\x81" => "", # U+E00C1 =>
"\xF3\xA0\x83\x82" => "", # U+E00C2 =>
"\xF3\xA0\x83\x83" => "", # U+E00C3 =>
"\xF3\xA0\x83\x84" => "", # U+E00C4 =>
"\xF3\xA0\x83\x85" => "", # U+E00C5 =>
"\xF3\xA0\x83\x86" => "", # U+E00C6 =>
"\xF3\xA0\x83\x87" => "", # U+E00C7 =>
"\xF3\xA0\x83\x88" => "", # U+E00C8 =>
"\xF3\xA0\x83\x89" => "", # U+E00C9 =>
"\xF3\xA0\x83\x8A" => "", # U+E00CA =>
"\xF3\xA0\x83\x8B" => "", # U+E00CB =>
"\xF3\xA0\x83\x8C" => "", # U+E00CC =>
"\xF3\xA0\x83\x8D" => "", # U+E00CD =>
"\xF3\xA0\x83\x8E" => "", # U+E00CE =>
"\xF3\xA0\x83\x8F" => "", # U+E00CF =>
"\xF3\xA0\x83\x90" => "", # U+E00D0 =>
"\xF3\xA0\x83\x91" => "", # U+E00D1 =>
"\xF3\xA0\x83\x92" => "", # U+E00D2 =>
"\xF3\xA0\x83\x93" => "", # U+E00D3 =>
"\xF3\xA0\x83\x94" => "", # U+E00D4 =>
"\xF3\xA0\x83\x95" => "", # U+E00D5 =>
"\xF3\xA0\x83\x96" => "", # U+E00D6 =>
"\xF3\xA0\x83\x97" => "", # U+E00D7 =>
"\xF3\xA0\x83\x98" => "", # U+E00D8 =>
"\xF3\xA0\x83\x99" => "", # U+E00D9 =>
"\xF3\xA0\x83\x9A" => "", # U+E00DA =>
"\xF3\xA0\x83\x9B" => "", # U+E00DB =>
"\xF3\xA0\x83\x9C" => "", # U+E00DC =>
"\xF3\xA0\x83\x9D" => "", # U+E00DD =>
"\xF3\xA0\x83\x9E" => "", # U+E00DE =>
"\xF3\xA0\x83\x9F" => "", # U+E00DF =>
"\xF3\xA0\x83\xA0" => "", # U+E00E0 =>
"\xF3\xA0\x83\xA1" => "", # U+E00E1 =>
"\xF3\xA0\x83\xA2" => "", # U+E00E2 =>
"\xF3\xA0\x83\xA3" => "", # U+E00E3 =>
"\xF3\xA0\x83\xA4" => "", # U+E00E4 =>
"\xF3\xA0\x83\xA5" => "", # U+E00E5 =>
"\xF3\xA0\x83\xA6" => "", # U+E00E6 =>
"\xF3\xA0\x83\xA7" => "", # U+E00E7 =>
"\xF3\xA0\x83\xA8" => "", # U+E00E8 =>
"\xF3\xA0\x83\xA9" => "", # U+E00E9 =>
"\xF3\xA0\x83\xAA" => "", # U+E00EA =>
"\xF3\xA0\x83\xAB" => "", # U+E00EB =>
"\xF3\xA0\x83\xAC" => "", # U+E00EC =>
"\xF3\xA0\x83\xAD" => "", # U+E00ED =>
"\xF3\xA0\x83\xAE" => "", # U+E00EE =>
"\xF3\xA0\x83\xAF" => "", # U+E00EF =>
"\xF3\xA0\x83\xB0" => "", # U+E00F0 =>
"\xF3\xA0\x83\xB1" => "", # U+E00F1 =>
"\xF3\xA0\x83\xB2" => "", # U+E00F2 =>
"\xF3\xA0\x83\xB3" => "", # U+E00F3 =>
"\xF3\xA0\x83\xB4" => "", # U+E00F4 =>
"\xF3\xA0\x83\xB5" => "", # U+E00F5 =>
"\xF3\xA0\x83\xB6" => "", # U+E00F6 =>
"\xF3\xA0\x83\xB7" => "", # U+E00F7 =>
"\xF3\xA0\x83\xB8" => "", # U+E00F8 =>
"\xF3\xA0\x83\xB9" => "", # U+E00F9 =>
"\xF3\xA0\x83\xBA" => "", # U+E00FA =>
"\xF3\xA0\x83\xBB" => "", # U+E00FB =>
"\xF3\xA0\x83\xBC" => "", # U+E00FC =>
"\xF3\xA0\x83\xBD" => "", # U+E00FD =>
"\xF3\xA0\x83\xBE" => "", # U+E00FE =>
"\xF3\xA0\x83\xBF" => "", # U+E00FF =>
"\xF3\xA0\x84\x80" => "", # U+E0100 =>
"\xF3\xA0\x84\x81" => "", # U+E0101 =>
"\xF3\xA0\x84\x82" => "", # U+E0102 =>
"\xF3\xA0\x84\x83" => "", # U+E0103 =>
"\xF3\xA0\x84\x84" => "", # U+E0104 =>
"\xF3\xA0\x84\x85" => "", # U+E0105 =>
"\xF3\xA0\x84\x86" => "", # U+E0106 =>
"\xF3\xA0\x84\x87" => "", # U+E0107 =>
"\xF3\xA0\x84\x88" => "", # U+E0108 =>
"\xF3\xA0\x84\x89" => "", # U+E0109 =>
"\xF3\xA0\x84\x8A" => "", # U+E010A =>
"\xF3\xA0\x84\x8B" => "", # U+E010B =>
"\xF3\xA0\x84\x8C" => "", # U+E010C =>
"\xF3\xA0\x84\x8D" => "", # U+E010D =>
"\xF3\xA0\x84\x8E" => "", # U+E010E =>
"\xF3\xA0\x84\x8F" => "", # U+E010F =>
"\xF3\xA0\x84\x90" => "", # U+E0110 =>
"\xF3\xA0\x84\x91" => "", # U+E0111 =>
"\xF3\xA0\x84\x92" => "", # U+E0112 =>
"\xF3\xA0\x84\x93" => "", # U+E0113 =>
"\xF3\xA0\x84\x94" => "", # U+E0114 =>
"\xF3\xA0\x84\x95" => "", # U+E0115 =>
"\xF3\xA0\x84\x96" => "", # U+E0116 =>
"\xF3\xA0\x84\x97" => "", # U+E0117 =>
"\xF3\xA0\x84\x98" => "", # U+E0118 =>
"\xF3\xA0\x84\x99" => "", # U+E0119 =>
"\xF3\xA0\x84\x9A" => "", # U+E011A =>
"\xF3\xA0\x84\x9B" => "", # U+E011B =>
"\xF3\xA0\x84\x9C" => "", # U+E011C =>
"\xF3\xA0\x84\x9D" => "", # U+E011D =>
"\xF3\xA0\x84\x9E" => "", # U+E011E =>
"\xF3\xA0\x84\x9F" => "", # U+E011F =>
"\xF3\xA0\x84\xA0" => "", # U+E0120 =>
"\xF3\xA0\x84\xA1" => "", # U+E0121 =>
"\xF3\xA0\x84\xA2" => "", # U+E0122 =>
"\xF3\xA0\x84\xA3" => "", # U+E0123 =>
"\xF3\xA0\x84\xA4" => "", # U+E0124 =>
"\xF3\xA0\x84\xA5" => "", # U+E0125 =>
"\xF3\xA0\x84\xA6" => "", # U+E0126 =>
"\xF3\xA0\x84\xA7" => "", # U+E0127 =>
"\xF3\xA0\x84\xA8" => "", # U+E0128 =>
"\xF3\xA0\x84\xA9" => "", # U+E0129 =>
"\xF3\xA0\x84\xAA" => "", # U+E012A =>
"\xF3\xA0\x84\xAB" => "", # U+E012B =>
"\xF3\xA0\x84\xAC" => "", # U+E012C =>
"\xF3\xA0\x84\xAD" => "", # U+E012D =>
"\xF3\xA0\x84\xAE" => "", # U+E012E =>
"\xF3\xA0\x84\xAF" => "", # U+E012F =>
"\xF3\xA0\x84\xB0" => "", # U+E0130 =>
"\xF3\xA0\x84\xB1" => "", # U+E0131 =>
"\xF3\xA0\x84\xB2" => "", # U+E0132 =>
"\xF3\xA0\x84\xB3" => "", # U+E0133 =>
"\xF3\xA0\x84\xB4" => "", # U+E0134 =>
"\xF3\xA0\x84\xB5" => "", # U+E0135 =>
"\xF3\xA0\x84\xB6" => "", # U+E0136 =>
"\xF3\xA0\x84\xB7" => "", # U+E0137 =>
"\xF3\xA0\x84\xB8" => "", # U+E0138 =>
"\xF3\xA0\x84\xB9" => "", # U+E0139 =>
"\xF3\xA0\x84\xBA" => "", # U+E013A =>
"\xF3\xA0\x84\xBB" => "", # U+E013B =>
"\xF3\xA0\x84\xBC" => "", # U+E013C =>
"\xF3\xA0\x84\xBD" => "", # U+E013D =>
"\xF3\xA0\x84\xBE" => "", # U+E013E =>
"\xF3\xA0\x84\xBF" => "", # U+E013F =>
"\xF3\xA0\x85\x80" => "", # U+E0140 =>
"\xF3\xA0\x85\x81" => "", # U+E0141 =>
"\xF3\xA0\x85\x82" => "", # U+E0142 =>
"\xF3\xA0\x85\x83" => "", # U+E0143 =>
"\xF3\xA0\x85\x84" => "", # U+E0144 =>
"\xF3\xA0\x85\x85" => "", # U+E0145 =>
"\xF3\xA0\x85\x86" => "", # U+E0146 =>
"\xF3\xA0\x85\x87" => "", # U+E0147 =>
"\xF3\xA0\x85\x88" => "", # U+E0148 =>
"\xF3\xA0\x85\x89" => "", # U+E0149 =>
"\xF3\xA0\x85\x8A" => "", # U+E014A =>
"\xF3\xA0\x85\x8B" => "", # U+E014B =>
"\xF3\xA0\x85\x8C" => "", # U+E014C =>
"\xF3\xA0\x85\x8D" => "", # U+E014D =>
"\xF3\xA0\x85\x8E" => "", # U+E014E =>
"\xF3\xA0\x85\x8F" => "", # U+E014F =>
"\xF3\xA0\x85\x90" => "", # U+E0150 =>
"\xF3\xA0\x85\x91" => "", # U+E0151 =>
"\xF3\xA0\x85\x92" => "", # U+E0152 =>
"\xF3\xA0\x85\x93" => "", # U+E0153 =>
"\xF3\xA0\x85\x94" => "", # U+E0154 =>
"\xF3\xA0\x85\x95" => "", # U+E0155 =>
"\xF3\xA0\x85\x96" => "", # U+E0156 =>
"\xF3\xA0\x85\x97" => "", # U+E0157 =>
"\xF3\xA0\x85\x98" => "", # U+E0158 =>
"\xF3\xA0\x85\x99" => "", # U+E0159 =>
"\xF3\xA0\x85\x9A" => "", # U+E015A =>
"\xF3\xA0\x85\x9B" => "", # U+E015B =>
"\xF3\xA0\x85\x9C" => "", # U+E015C =>
"\xF3\xA0\x85\x9D" => "", # U+E015D =>
"\xF3\xA0\x85\x9E" => "", # U+E015E =>
"\xF3\xA0\x85\x9F" => "", # U+E015F =>
"\xF3\xA0\x85\xA0" => "", # U+E0160 =>
"\xF3\xA0\x85\xA1" => "", # U+E0161 =>
"\xF3\xA0\x85\xA2" => "", # U+E0162 =>
"\xF3\xA0\x85\xA3" => "", # U+E0163 =>
"\xF3\xA0\x85\xA4" => "", # U+E0164 =>
"\xF3\xA0\x85\xA5" => "", # U+E0165 =>
"\xF3\xA0\x85\xA6" => "", # U+E0166 =>
"\xF3\xA0\x85\xA7" => "", # U+E0167 =>
"\xF3\xA0\x85\xA8" => "", # U+E0168 =>
"\xF3\xA0\x85\xA9" => "", # U+E0169 =>
"\xF3\xA0\x85\xAA" => "", # U+E016A =>
"\xF3\xA0\x85\xAB" => "", # U+E016B =>
"\xF3\xA0\x85\xAC" => "", # U+E016C =>
"\xF3\xA0\x85\xAD" => "", # U+E016D =>
"\xF3\xA0\x85\xAE" => "", # U+E016E =>
"\xF3\xA0\x85\xAF" => "", # U+E016F =>
"\xF3\xA0\x85\xB0" => "", # U+E0170 =>
"\xF3\xA0\x85\xB1" => "", # U+E0171 =>
"\xF3\xA0\x85\xB2" => "", # U+E0172 =>
"\xF3\xA0\x85\xB3" => "", # U+E0173 =>
"\xF3\xA0\x85\xB4" => "", # U+E0174 =>
"\xF3\xA0\x85\xB5" => "", # U+E0175 =>
"\xF3\xA0\x85\xB6" => "", # U+E0176 =>
"\xF3\xA0\x85\xB7" => "", # U+E0177 =>
"\xF3\xA0\x85\xB8" => "", # U+E0178 =>
"\xF3\xA0\x85\xB9" => "", # U+E0179 =>
"\xF3\xA0\x85\xBA" => "", # U+E017A =>
"\xF3\xA0\x85\xBB" => "", # U+E017B =>
"\xF3\xA0\x85\xBC" => "", # U+E017C =>
"\xF3\xA0\x85\xBD" => "", # U+E017D =>
"\xF3\xA0\x85\xBE" => "", # U+E017E =>
"\xF3\xA0\x85\xBF" => "", # U+E017F =>
"\xF3\xA0\x86\x80" => "", # U+E0180 =>
"\xF3\xA0\x86\x81" => "", # U+E0181 =>
"\xF3\xA0\x86\x82" => "", # U+E0182 =>
"\xF3\xA0\x86\x83" => "", # U+E0183 =>
"\xF3\xA0\x86\x84" => "", # U+E0184 =>
"\xF3\xA0\x86\x85" => "", # U+E0185 =>
"\xF3\xA0\x86\x86" => "", # U+E0186 =>
"\xF3\xA0\x86\x87" => "", # U+E0187 =>
"\xF3\xA0\x86\x88" => "", # U+E0188 =>
"\xF3\xA0\x86\x89" => "", # U+E0189 =>
"\xF3\xA0\x86\x8A" => "", # U+E018A =>
"\xF3\xA0\x86\x8B" => "", # U+E018B =>
"\xF3\xA0\x86\x8C" => "", # U+E018C =>
"\xF3\xA0\x86\x8D" => "", # U+E018D =>
"\xF3\xA0\x86\x8E" => "", # U+E018E =>
"\xF3\xA0\x86\x8F" => "", # U+E018F =>
"\xF3\xA0\x86\x90" => "", # U+E0190 =>
"\xF3\xA0\x86\x91" => "", # U+E0191 =>
"\xF3\xA0\x86\x92" => "", # U+E0192 =>
"\xF3\xA0\x86\x93" => "", # U+E0193 =>
"\xF3\xA0\x86\x94" => "", # U+E0194 =>
"\xF3\xA0\x86\x95" => "", # U+E0195 =>
"\xF3\xA0\x86\x96" => "", # U+E0196 =>
"\xF3\xA0\x86\x97" => "", # U+E0197 =>
"\xF3\xA0\x86\x98" => "", # U+E0198 =>
"\xF3\xA0\x86\x99" => "", # U+E0199 =>
"\xF3\xA0\x86\x9A" => "", # U+E019A =>
"\xF3\xA0\x86\x9B" => "", # U+E019B =>
"\xF3\xA0\x86\x9C" => "", # U+E019C =>
"\xF3\xA0\x86\x9D" => "", # U+E019D =>
"\xF3\xA0\x86\x9E" => "", # U+E019E =>
"\xF3\xA0\x86\x9F" => "", # U+E019F =>
"\xF3\xA0\x86\xA0" => "", # U+E01A0 =>
"\xF3\xA0\x86\xA1" => "", # U+E01A1 =>
"\xF3\xA0\x86\xA2" => "", # U+E01A2 =>
"\xF3\xA0\x86\xA3" => "", # U+E01A3 =>
"\xF3\xA0\x86\xA4" => "", # U+E01A4 =>
"\xF3\xA0\x86\xA5" => "", # U+E01A5 =>
"\xF3\xA0\x86\xA6" => "", # U+E01A6 =>
"\xF3\xA0\x86\xA7" => "", # U+E01A7 =>
"\xF3\xA0\x86\xA8" => "", # U+E01A8 =>
"\xF3\xA0\x86\xA9" => "", # U+E01A9 =>
"\xF3\xA0\x86\xAA" => "", # U+E01AA =>
"\xF3\xA0\x86\xAB" => "", # U+E01AB =>
"\xF3\xA0\x86\xAC" => "", # U+E01AC =>
"\xF3\xA0\x86\xAD" => "", # U+E01AD =>
"\xF3\xA0\x86\xAE" => "", # U+E01AE =>
"\xF3\xA0\x86\xAF" => "", # U+E01AF =>
"\xF3\xA0\x86\xB0" => "", # U+E01B0 =>
"\xF3\xA0\x86\xB1" => "", # U+E01B1 =>
"\xF3\xA0\x86\xB2" => "", # U+E01B2 =>
"\xF3\xA0\x86\xB3" => "", # U+E01B3 =>
"\xF3\xA0\x86\xB4" => "", # U+E01B4 =>
"\xF3\xA0\x86\xB5" => "", # U+E01B5 =>
"\xF3\xA0\x86\xB6" => "", # U+E01B6 =>
"\xF3\xA0\x86\xB7" => "", # U+E01B7 =>
"\xF3\xA0\x86\xB8" => "", # U+E01B8 =>
"\xF3\xA0\x86\xB9" => "", # U+E01B9 =>
"\xF3\xA0\x86\xBA" => "", # U+E01BA =>
"\xF3\xA0\x86\xBB" => "", # U+E01BB =>
"\xF3\xA0\x86\xBC" => "", # U+E01BC =>
"\xF3\xA0\x86\xBD" => "", # U+E01BD =>
"\xF3\xA0\x86\xBE" => "", # U+E01BE =>
"\xF3\xA0\x86\xBF" => "", # U+E01BF =>
"\xF3\xA0\x87\x80" => "", # U+E01C0 =>
"\xF3\xA0\x87\x81" => "", # U+E01C1 =>
"\xF3\xA0\x87\x82" => "", # U+E01C2 =>
"\xF3\xA0\x87\x83" => "", # U+E01C3 =>
"\xF3\xA0\x87\x84" => "", # U+E01C4 =>
"\xF3\xA0\x87\x85" => "", # U+E01C5 =>
"\xF3\xA0\x87\x86" => "", # U+E01C6 =>
"\xF3\xA0\x87\x87" => "", # U+E01C7 =>
"\xF3\xA0\x87\x88" => "", # U+E01C8 =>
"\xF3\xA0\x87\x89" => "", # U+E01C9 =>
"\xF3\xA0\x87\x8A" => "", # U+E01CA =>
"\xF3\xA0\x87\x8B" => "", # U+E01CB =>
"\xF3\xA0\x87\x8C" => "", # U+E01CC =>
"\xF3\xA0\x87\x8D" => "", # U+E01CD =>
"\xF3\xA0\x87\x8E" => "", # U+E01CE =>
"\xF3\xA0\x87\x8F" => "", # U+E01CF =>
"\xF3\xA0\x87\x90" => "", # U+E01D0 =>
"\xF3\xA0\x87\x91" => "", # U+E01D1 =>
"\xF3\xA0\x87\x92" => "", # U+E01D2 =>
"\xF3\xA0\x87\x93" => "", # U+E01D3 =>
"\xF3\xA0\x87\x94" => "", # U+E01D4 =>
"\xF3\xA0\x87\x95" => "", # U+E01D5 =>
"\xF3\xA0\x87\x96" => "", # U+E01D6 =>
"\xF3\xA0\x87\x97" => "", # U+E01D7 =>
"\xF3\xA0\x87\x98" => "", # U+E01D8 =>
"\xF3\xA0\x87\x99" => "", # U+E01D9 =>
"\xF3\xA0\x87\x9A" => "", # U+E01DA =>
"\xF3\xA0\x87\x9B" => "", # U+E01DB =>
"\xF3\xA0\x87\x9C" => "", # U+E01DC =>
"\xF3\xA0\x87\x9D" => "", # U+E01DD =>
"\xF3\xA0\x87\x9E" => "", # U+E01DE =>
"\xF3\xA0\x87\x9F" => "", # U+E01DF =>
"\xF3\xA0\x87\xA0" => "", # U+E01E0 =>
"\xF3\xA0\x87\xA1" => "", # U+E01E1 =>
"\xF3\xA0\x87\xA2" => "", # U+E01E2 =>
"\xF3\xA0\x87\xA3" => "", # U+E01E3 =>
"\xF3\xA0\x87\xA4" => "", # U+E01E4 =>
"\xF3\xA0\x87\xA5" => "", # U+E01E5 =>
"\xF3\xA0\x87\xA6" => "", # U+E01E6 =>
"\xF3\xA0\x87\xA7" => "", # U+E01E7 =>
"\xF3\xA0\x87\xA8" => "", # U+E01E8 =>
"\xF3\xA0\x87\xA9" => "", # U+E01E9 =>
"\xF3\xA0\x87\xAA" => "", # U+E01EA =>
"\xF3\xA0\x87\xAB" => "", # U+E01EB =>
"\xF3\xA0\x87\xAC" => "", # U+E01EC =>
"\xF3\xA0\x87\xAD" => "", # U+E01ED =>
"\xF3\xA0\x87\xAE" => "", # U+E01EE =>
"\xF3\xA0\x87\xAF" => "", # U+E01EF =>
"\xF3\xA0\x87\xB0" => "", # U+E01F0 =>
"\xF3\xA0\x87\xB1" => "", # U+E01F1 =>
"\xF3\xA0\x87\xB2" => "", # U+E01F2 =>
"\xF3\xA0\x87\xB3" => "", # U+E01F3 =>
"\xF3\xA0\x87\xB4" => "", # U+E01F4 =>
"\xF3\xA0\x87\xB5" => "", # U+E01F5 =>
"\xF3\xA0\x87\xB6" => "", # U+E01F6 =>
"\xF3\xA0\x87\xB7" => "", # U+E01F7 =>
"\xF3\xA0\x87\xB8" => "", # U+E01F8 =>
"\xF3\xA0\x87\xB9" => "", # U+E01F9 =>
"\xF3\xA0\x87\xBA" => "", # U+E01FA =>
"\xF3\xA0\x87\xBB" => "", # U+E01FB =>
"\xF3\xA0\x87\xBC" => "", # U+E01FC =>
"\xF3\xA0\x87\xBD" => "", # U+E01FD =>
"\xF3\xA0\x87\xBE" => "", # U+E01FE =>
"\xF3\xA0\x87\xBF" => "", # U+E01FF =>
"\xF3\xA0\x88\x80" => "", # U+E0200 =>
"\xF3\xA0\x88\x81" => "", # U+E0201 =>
"\xF3\xA0\x88\x82" => "", # U+E0202 =>
"\xF3\xA0\x88\x83" => "", # U+E0203 =>
"\xF3\xA0\x88\x84" => "", # U+E0204 =>
"\xF3\xA0\x88\x85" => "", # U+E0205 =>
"\xF3\xA0\x88\x86" => "", # U+E0206 =>
"\xF3\xA0\x88\x87" => "", # U+E0207 =>
"\xF3\xA0\x88\x88" => "", # U+E0208 =>
"\xF3\xA0\x88\x89" => "", # U+E0209 =>
"\xF3\xA0\x88\x8A" => "", # U+E020A =>
"\xF3\xA0\x88\x8B" => "", # U+E020B =>
"\xF3\xA0\x88\x8C" => "", # U+E020C =>
"\xF3\xA0\x88\x8D" => "", # U+E020D =>
"\xF3\xA0\x88\x8E" => "", # U+E020E =>
"\xF3\xA0\x88\x8F" => "", # U+E020F =>
"\xF3\xA0\x88\x90" => "", # U+E0210 =>
"\xF3\xA0\x88\x91" => "", # U+E0211 =>
"\xF3\xA0\x88\x92" => "", # U+E0212 =>
"\xF3\xA0\x88\x93" => "", # U+E0213 =>
"\xF3\xA0\x88\x94" => "", # U+E0214 =>
"\xF3\xA0\x88\x95" => "", # U+E0215 =>
"\xF3\xA0\x88\x96" => "", # U+E0216 =>
"\xF3\xA0\x88\x97" => "", # U+E0217 =>
"\xF3\xA0\x88\x98" => "", # U+E0218 =>
"\xF3\xA0\x88\x99" => "", # U+E0219 =>
"\xF3\xA0\x88\x9A" => "", # U+E021A =>
"\xF3\xA0\x88\x9B" => "", # U+E021B =>
"\xF3\xA0\x88\x9C" => "", # U+E021C =>
"\xF3\xA0\x88\x9D" => "", # U+E021D =>
"\xF3\xA0\x88\x9E" => "", # U+E021E =>
"\xF3\xA0\x88\x9F" => "", # U+E021F =>
"\xF3\xA0\x88\xA0" => "", # U+E0220 =>
"\xF3\xA0\x88\xA1" => "", # U+E0221 =>
"\xF3\xA0\x88\xA2" => "", # U+E0222 =>
"\xF3\xA0\x88\xA3" => "", # U+E0223 =>
"\xF3\xA0\x88\xA4" => "", # U+E0224 =>
"\xF3\xA0\x88\xA5" => "", # U+E0225 =>
"\xF3\xA0\x88\xA6" => "", # U+E0226 =>
"\xF3\xA0\x88\xA7" => "", # U+E0227 =>
"\xF3\xA0\x88\xA8" => "", # U+E0228 =>
"\xF3\xA0\x88\xA9" => "", # U+E0229 =>
"\xF3\xA0\x88\xAA" => "", # U+E022A =>
"\xF3\xA0\x88\xAB" => "", # U+E022B =>
"\xF3\xA0\x88\xAC" => "", # U+E022C =>
"\xF3\xA0\x88\xAD" => "", # U+E022D =>
"\xF3\xA0\x88\xAE" => "", # U+E022E =>
"\xF3\xA0\x88\xAF" => "", # U+E022F =>
"\xF3\xA0\x88\xB0" => "", # U+E0230 =>
"\xF3\xA0\x88\xB1" => "", # U+E0231 =>
"\xF3\xA0\x88\xB2" => "", # U+E0232 =>
"\xF3\xA0\x88\xB3" => "", # U+E0233 =>
"\xF3\xA0\x88\xB4" => "", # U+E0234 =>
"\xF3\xA0\x88\xB5" => "", # U+E0235 =>
"\xF3\xA0\x88\xB6" => "", # U+E0236 =>
"\xF3\xA0\x88\xB7" => "", # U+E0237 =>
"\xF3\xA0\x88\xB8" => "", # U+E0238 =>
"\xF3\xA0\x88\xB9" => "", # U+E0239 =>
"\xF3\xA0\x88\xBA" => "", # U+E023A =>
"\xF3\xA0\x88\xBB" => "", # U+E023B =>
"\xF3\xA0\x88\xBC" => "", # U+E023C =>
"\xF3\xA0\x88\xBD" => "", # U+E023D =>
"\xF3\xA0\x88\xBE" => "", # U+E023E =>
"\xF3\xA0\x88\xBF" => "", # U+E023F =>
"\xF3\xA0\x89\x80" => "", # U+E0240 =>
"\xF3\xA0\x89\x81" => "", # U+E0241 =>
"\xF3\xA0\x89\x82" => "", # U+E0242 =>
"\xF3\xA0\x89\x83" => "", # U+E0243 =>
"\xF3\xA0\x89\x84" => "", # U+E0244 =>
"\xF3\xA0\x89\x85" => "", # U+E0245 =>
"\xF3\xA0\x89\x86" => "", # U+E0246 =>
"\xF3\xA0\x89\x87" => "", # U+E0247 =>
"\xF3\xA0\x89\x88" => "", # U+E0248 =>
"\xF3\xA0\x89\x89" => "", # U+E0249 =>
"\xF3\xA0\x89\x8A" => "", # U+E024A =>
"\xF3\xA0\x89\x8B" => "", # U+E024B =>
"\xF3\xA0\x89\x8C" => "", # U+E024C =>
"\xF3\xA0\x89\x8D" => "", # U+E024D =>
"\xF3\xA0\x89\x8E" => "", # U+E024E =>
"\xF3\xA0\x89\x8F" => "", # U+E024F =>
"\xF3\xA0\x89\x90" => "", # U+E0250 =>
"\xF3\xA0\x89\x91" => "", # U+E0251 =>
"\xF3\xA0\x89\x92" => "", # U+E0252 =>
"\xF3\xA0\x89\x93" => "", # U+E0253 =>
"\xF3\xA0\x89\x94" => "", # U+E0254 =>
"\xF3\xA0\x89\x95" => "", # U+E0255 =>
"\xF3\xA0\x89\x96" => "", # U+E0256 =>
"\xF3\xA0\x89\x97" => "", # U+E0257 =>
"\xF3\xA0\x89\x98" => "", # U+E0258 =>
"\xF3\xA0\x89\x99" => "", # U+E0259 =>
"\xF3\xA0\x89\x9A" => "", # U+E025A =>
"\xF3\xA0\x89\x9B" => "", # U+E025B =>
"\xF3\xA0\x89\x9C" => "", # U+E025C =>
"\xF3\xA0\x89\x9D" => "", # U+E025D =>
"\xF3\xA0\x89\x9E" => "", # U+E025E =>
"\xF3\xA0\x89\x9F" => "", # U+E025F =>
"\xF3\xA0\x89\xA0" => "", # U+E0260 =>
"\xF3\xA0\x89\xA1" => "", # U+E0261 =>
"\xF3\xA0\x89\xA2" => "", # U+E0262 =>
"\xF3\xA0\x89\xA3" => "", # U+E0263 =>
"\xF3\xA0\x89\xA4" => "", # U+E0264 =>
"\xF3\xA0\x89\xA5" => "", # U+E0265 =>
"\xF3\xA0\x89\xA6" => "", # U+E0266 =>
"\xF3\xA0\x89\xA7" => "", # U+E0267 =>
"\xF3\xA0\x89\xA8" => "", # U+E0268 =>
"\xF3\xA0\x89\xA9" => "", # U+E0269 =>
"\xF3\xA0\x89\xAA" => "", # U+E026A =>
"\xF3\xA0\x89\xAB" => "", # U+E026B =>
"\xF3\xA0\x89\xAC" => "", # U+E026C =>
"\xF3\xA0\x89\xAD" => "", # U+E026D =>
"\xF3\xA0\x89\xAE" => "", # U+E026E =>
"\xF3\xA0\x89\xAF" => "", # U+E026F =>
"\xF3\xA0\x89\xB0" => "", # U+E0270 =>
"\xF3\xA0\x89\xB1" => "", # U+E0271 =>
"\xF3\xA0\x89\xB2" => "", # U+E0272 =>
"\xF3\xA0\x89\xB3" => "", # U+E0273 =>
"\xF3\xA0\x89\xB4" => "", # U+E0274 =>
"\xF3\xA0\x89\xB5" => "", # U+E0275 =>
"\xF3\xA0\x89\xB6" => "", # U+E0276 =>
"\xF3\xA0\x89\xB7" => "", # U+E0277 =>
"\xF3\xA0\x89\xB8" => "", # U+E0278 =>
"\xF3\xA0\x89\xB9" => "", # U+E0279 =>
"\xF3\xA0\x89\xBA" => "", # U+E027A =>
"\xF3\xA0\x89\xBB" => "", # U+E027B =>
"\xF3\xA0\x89\xBC" => "", # U+E027C =>
"\xF3\xA0\x89\xBD" => "", # U+E027D =>
"\xF3\xA0\x89\xBE" => "", # U+E027E =>
"\xF3\xA0\x89\xBF" => "", # U+E027F =>
"\xF3\xA0\x8A\x80" => "", # U+E0280 =>
"\xF3\xA0\x8A\x81" => "", # U+E0281 =>
"\xF3\xA0\x8A\x82" => "", # U+E0282 =>
"\xF3\xA0\x8A\x83" => "", # U+E0283 =>
"\xF3\xA0\x8A\x84" => "", # U+E0284 =>
"\xF3\xA0\x8A\x85" => "", # U+E0285 =>
"\xF3\xA0\x8A\x86" => "", # U+E0286 =>
"\xF3\xA0\x8A\x87" => "", # U+E0287 =>
"\xF3\xA0\x8A\x88" => "", # U+E0288 =>
"\xF3\xA0\x8A\x89" => "", # U+E0289 =>
"\xF3\xA0\x8A\x8A" => "", # U+E028A =>
"\xF3\xA0\x8A\x8B" => "", # U+E028B =>
"\xF3\xA0\x8A\x8C" => "", # U+E028C =>
"\xF3\xA0\x8A\x8D" => "", # U+E028D =>
"\xF3\xA0\x8A\x8E" => "", # U+E028E =>
"\xF3\xA0\x8A\x8F" => "", # U+E028F =>
"\xF3\xA0\x8A\x90" => "", # U+E0290 =>
"\xF3\xA0\x8A\x91" => "", # U+E0291 =>
"\xF3\xA0\x8A\x92" => "", # U+E0292 =>
"\xF3\xA0\x8A\x93" => "", # U+E0293 =>
"\xF3\xA0\x8A\x94" => "", # U+E0294 =>
"\xF3\xA0\x8A\x95" => "", # U+E0295 =>
"\xF3\xA0\x8A\x96" => "", # U+E0296 =>
"\xF3\xA0\x8A\x97" => "", # U+E0297 =>
"\xF3\xA0\x8A\x98" => "", # U+E0298 =>
"\xF3\xA0\x8A\x99" => "", # U+E0299 =>
"\xF3\xA0\x8A\x9A" => "", # U+E029A =>
"\xF3\xA0\x8A\x9B" => "", # U+E029B =>
"\xF3\xA0\x8A\x9C" => "", # U+E029C =>
"\xF3\xA0\x8A\x9D" => "", # U+E029D =>
"\xF3\xA0\x8A\x9E" => "", # U+E029E =>
"\xF3\xA0\x8A\x9F" => "", # U+E029F =>
"\xF3\xA0\x8A\xA0" => "", # U+E02A0 =>
"\xF3\xA0\x8A\xA1" => "", # U+E02A1 =>
"\xF3\xA0\x8A\xA2" => "", # U+E02A2 =>
"\xF3\xA0\x8A\xA3" => "", # U+E02A3 =>
"\xF3\xA0\x8A\xA4" => "", # U+E02A4 =>
"\xF3\xA0\x8A\xA5" => "", # U+E02A5 =>
"\xF3\xA0\x8A\xA6" => "", # U+E02A6 =>
"\xF3\xA0\x8A\xA7" => "", # U+E02A7 =>
"\xF3\xA0\x8A\xA8" => "", # U+E02A8 =>
"\xF3\xA0\x8A\xA9" => "", # U+E02A9 =>
"\xF3\xA0\x8A\xAA" => "", # U+E02AA =>
"\xF3\xA0\x8A\xAB" => "", # U+E02AB =>
"\xF3\xA0\x8A\xAC" => "", # U+E02AC =>
"\xF3\xA0\x8A\xAD" => "", # U+E02AD =>
"\xF3\xA0\x8A\xAE" => "", # U+E02AE =>
"\xF3\xA0\x8A\xAF" => "", # U+E02AF =>
"\xF3\xA0\x8A\xB0" => "", # U+E02B0 =>
"\xF3\xA0\x8A\xB1" => "", # U+E02B1 =>
"\xF3\xA0\x8A\xB2" => "", # U+E02B2 =>
"\xF3\xA0\x8A\xB3" => "", # U+E02B3 =>
"\xF3\xA0\x8A\xB4" => "", # U+E02B4 =>
"\xF3\xA0\x8A\xB5" => "", # U+E02B5 =>
"\xF3\xA0\x8A\xB6" => "", # U+E02B6 =>
"\xF3\xA0\x8A\xB7" => "", # U+E02B7 =>
"\xF3\xA0\x8A\xB8" => "", # U+E02B8 =>
"\xF3\xA0\x8A\xB9" => "", # U+E02B9 =>
"\xF3\xA0\x8A\xBA" => "", # U+E02BA =>
"\xF3\xA0\x8A\xBB" => "", # U+E02BB =>
"\xF3\xA0\x8A\xBC" => "", # U+E02BC =>
"\xF3\xA0\x8A\xBD" => "", # U+E02BD =>
"\xF3\xA0\x8A\xBE" => "", # U+E02BE =>
"\xF3\xA0\x8A\xBF" => "", # U+E02BF =>
"\xF3\xA0\x8B\x80" => "", # U+E02C0 =>
"\xF3\xA0\x8B\x81" => "", # U+E02C1 =>
"\xF3\xA0\x8B\x82" => "", # U+E02C2 =>
"\xF3\xA0\x8B\x83" => "", # U+E02C3 =>
"\xF3\xA0\x8B\x84" => "", # U+E02C4 =>
"\xF3\xA0\x8B\x85" => "", # U+E02C5 =>
"\xF3\xA0\x8B\x86" => "", # U+E02C6 =>
"\xF3\xA0\x8B\x87" => "", # U+E02C7 =>
"\xF3\xA0\x8B\x88" => "", # U+E02C8 =>
"\xF3\xA0\x8B\x89" => "", # U+E02C9 =>
"\xF3\xA0\x8B\x8A" => "", # U+E02CA =>
"\xF3\xA0\x8B\x8B" => "", # U+E02CB =>
"\xF3\xA0\x8B\x8C" => "", # U+E02CC =>
"\xF3\xA0\x8B\x8D" => "", # U+E02CD =>
"\xF3\xA0\x8B\x8E" => "", # U+E02CE =>
"\xF3\xA0\x8B\x8F" => "", # U+E02CF =>
"\xF3\xA0\x8B\x90" => "", # U+E02D0 =>
"\xF3\xA0\x8B\x91" => "", # U+E02D1 =>
"\xF3\xA0\x8B\x92" => "", # U+E02D2 =>
"\xF3\xA0\x8B\x93" => "", # U+E02D3 =>
"\xF3\xA0\x8B\x94" => "", # U+E02D4 =>
"\xF3\xA0\x8B\x95" => "", # U+E02D5 =>
"\xF3\xA0\x8B\x96" => "", # U+E02D6 =>
"\xF3\xA0\x8B\x97" => "", # U+E02D7 =>
"\xF3\xA0\x8B\x98" => "", # U+E02D8 =>
"\xF3\xA0\x8B\x99" => "", # U+E02D9 =>
"\xF3\xA0\x8B\x9A" => "", # U+E02DA =>
"\xF3\xA0\x8B\x9B" => "", # U+E02DB =>
"\xF3\xA0\x8B\x9C" => "", # U+E02DC =>
"\xF3\xA0\x8B\x9D" => "", # U+E02DD =>
"\xF3\xA0\x8B\x9E" => "", # U+E02DE =>
"\xF3\xA0\x8B\x9F" => "", # U+E02DF =>
"\xF3\xA0\x8B\xA0" => "", # U+E02E0 =>
"\xF3\xA0\x8B\xA1" => "", # U+E02E1 =>
"\xF3\xA0\x8B\xA2" => "", # U+E02E2 =>
"\xF3\xA0\x8B\xA3" => "", # U+E02E3 =>
"\xF3\xA0\x8B\xA4" => "", # U+E02E4 =>
"\xF3\xA0\x8B\xA5" => "", # U+E02E5 =>
"\xF3\xA0\x8B\xA6" => "", # U+E02E6 =>
"\xF3\xA0\x8B\xA7" => "", # U+E02E7 =>
"\xF3\xA0\x8B\xA8" => "", # U+E02E8 =>
"\xF3\xA0\x8B\xA9" => "", # U+E02E9 =>
"\xF3\xA0\x8B\xAA" => "", # U+E02EA =>
"\xF3\xA0\x8B\xAB" => "", # U+E02EB =>
"\xF3\xA0\x8B\xAC" => "", # U+E02EC =>
"\xF3\xA0\x8B\xAD" => "", # U+E02ED =>
"\xF3\xA0\x8B\xAE" => "", # U+E02EE =>
"\xF3\xA0\x8B\xAF" => "", # U+E02EF =>
"\xF3\xA0\x8B\xB0" => "", # U+E02F0 =>
"\xF3\xA0\x8B\xB1" => "", # U+E02F1 =>
"\xF3\xA0\x8B\xB2" => "", # U+E02F2 =>
"\xF3\xA0\x8B\xB3" => "", # U+E02F3 =>
"\xF3\xA0\x8B\xB4" => "", # U+E02F4 =>
"\xF3\xA0\x8B\xB5" => "", # U+E02F5 =>
"\xF3\xA0\x8B\xB6" => "", # U+E02F6 =>
"\xF3\xA0\x8B\xB7" => "", # U+E02F7 =>
"\xF3\xA0\x8B\xB8" => "", # U+E02F8 =>
"\xF3\xA0\x8B\xB9" => "", # U+E02F9 =>
"\xF3\xA0\x8B\xBA" => "", # U+E02FA =>
"\xF3\xA0\x8B\xBB" => "", # U+E02FB =>
"\xF3\xA0\x8B\xBC" => "", # U+E02FC =>
"\xF3\xA0\x8B\xBD" => "", # U+E02FD =>
"\xF3\xA0\x8B\xBE" => "", # U+E02FE =>
"\xF3\xA0\x8B\xBF" => "", # U+E02FF =>
"\xF3\xA0\x8C\x80" => "", # U+E0300 =>
"\xF3\xA0\x8C\x81" => "", # U+E0301 =>
"\xF3\xA0\x8C\x82" => "", # U+E0302 =>
"\xF3\xA0\x8C\x83" => "", # U+E0303 =>
"\xF3\xA0\x8C\x84" => "", # U+E0304 =>
"\xF3\xA0\x8C\x85" => "", # U+E0305 =>
"\xF3\xA0\x8C\x86" => "", # U+E0306 =>
"\xF3\xA0\x8C\x87" => "", # U+E0307 =>
"\xF3\xA0\x8C\x88" => "", # U+E0308 =>
"\xF3\xA0\x8C\x89" => "", # U+E0309 =>
"\xF3\xA0\x8C\x8A" => "", # U+E030A =>
"\xF3\xA0\x8C\x8B" => "", # U+E030B =>
"\xF3\xA0\x8C\x8C" => "", # U+E030C =>
"\xF3\xA0\x8C\x8D" => "", # U+E030D =>
"\xF3\xA0\x8C\x8E" => "", # U+E030E =>
"\xF3\xA0\x8C\x8F" => "", # U+E030F =>
"\xF3\xA0\x8C\x90" => "", # U+E0310 =>
"\xF3\xA0\x8C\x91" => "", # U+E0311 =>
"\xF3\xA0\x8C\x92" => "", # U+E0312 =>
"\xF3\xA0\x8C\x93" => "", # U+E0313 =>
"\xF3\xA0\x8C\x94" => "", # U+E0314 =>
"\xF3\xA0\x8C\x95" => "", # U+E0315 =>
"\xF3\xA0\x8C\x96" => "", # U+E0316 =>
"\xF3\xA0\x8C\x97" => "", # U+E0317 =>
"\xF3\xA0\x8C\x98" => "", # U+E0318 =>
"\xF3\xA0\x8C\x99" => "", # U+E0319 =>
"\xF3\xA0\x8C\x9A" => "", # U+E031A =>
"\xF3\xA0\x8C\x9B" => "", # U+E031B =>
"\xF3\xA0\x8C\x9C" => "", # U+E031C =>
"\xF3\xA0\x8C\x9D" => "", # U+E031D =>
"\xF3\xA0\x8C\x9E" => "", # U+E031E =>
"\xF3\xA0\x8C\x9F" => "", # U+E031F =>
"\xF3\xA0\x8C\xA0" => "", # U+E0320 =>
"\xF3\xA0\x8C\xA1" => "", # U+E0321 =>
"\xF3\xA0\x8C\xA2" => "", # U+E0322 =>
"\xF3\xA0\x8C\xA3" => "", # U+E0323 =>
"\xF3\xA0\x8C\xA4" => "", # U+E0324 =>
"\xF3\xA0\x8C\xA5" => "", # U+E0325 =>
"\xF3\xA0\x8C\xA6" => "", # U+E0326 =>
"\xF3\xA0\x8C\xA7" => "", # U+E0327 =>
"\xF3\xA0\x8C\xA8" => "", # U+E0328 =>
"\xF3\xA0\x8C\xA9" => "", # U+E0329 =>
"\xF3\xA0\x8C\xAA" => "", # U+E032A =>
"\xF3\xA0\x8C\xAB" => "", # U+E032B =>
"\xF3\xA0\x8C\xAC" => "", # U+E032C =>
"\xF3\xA0\x8C\xAD" => "", # U+E032D =>
"\xF3\xA0\x8C\xAE" => "", # U+E032E =>
"\xF3\xA0\x8C\xAF" => "", # U+E032F =>
"\xF3\xA0\x8C\xB0" => "", # U+E0330 =>
"\xF3\xA0\x8C\xB1" => "", # U+E0331 =>
"\xF3\xA0\x8C\xB2" => "", # U+E0332 =>
"\xF3\xA0\x8C\xB3" => "", # U+E0333 =>
"\xF3\xA0\x8C\xB4" => "", # U+E0334 =>
"\xF3\xA0\x8C\xB5" => "", # U+E0335 =>
"\xF3\xA0\x8C\xB6" => "", # U+E0336 =>
"\xF3\xA0\x8C\xB7" => "", # U+E0337 =>
"\xF3\xA0\x8C\xB8" => "", # U+E0338 =>
"\xF3\xA0\x8C\xB9" => "", # U+E0339 =>
"\xF3\xA0\x8C\xBA" => "", # U+E033A =>
"\xF3\xA0\x8C\xBB" => "", # U+E033B =>
"\xF3\xA0\x8C\xBC" => "", # U+E033C =>
"\xF3\xA0\x8C\xBD" => "", # U+E033D =>
"\xF3\xA0\x8C\xBE" => "", # U+E033E =>
"\xF3\xA0\x8C\xBF" => "", # U+E033F =>
"\xF3\xA0\x8D\x80" => "", # U+E0340 =>
"\xF3\xA0\x8D\x81" => "", # U+E0341 =>
"\xF3\xA0\x8D\x82" => "", # U+E0342 =>
"\xF3\xA0\x8D\x83" => "", # U+E0343 =>
"\xF3\xA0\x8D\x84" => "", # U+E0344 =>
"\xF3\xA0\x8D\x85" => "", # U+E0345 =>
"\xF3\xA0\x8D\x86" => "", # U+E0346 =>
"\xF3\xA0\x8D\x87" => "", # U+E0347 =>
"\xF3\xA0\x8D\x88" => "", # U+E0348 =>
"\xF3\xA0\x8D\x89" => "", # U+E0349 =>
"\xF3\xA0\x8D\x8A" => "", # U+E034A =>
"\xF3\xA0\x8D\x8B" => "", # U+E034B =>
"\xF3\xA0\x8D\x8C" => "", # U+E034C =>
"\xF3\xA0\x8D\x8D" => "", # U+E034D =>
"\xF3\xA0\x8D\x8E" => "", # U+E034E =>
"\xF3\xA0\x8D\x8F" => "", # U+E034F =>
"\xF3\xA0\x8D\x90" => "", # U+E0350 =>
"\xF3\xA0\x8D\x91" => "", # U+E0351 =>
"\xF3\xA0\x8D\x92" => "", # U+E0352 =>
"\xF3\xA0\x8D\x93" => "", # U+E0353 =>
"\xF3\xA0\x8D\x94" => "", # U+E0354 =>
"\xF3\xA0\x8D\x95" => "", # U+E0355 =>
"\xF3\xA0\x8D\x96" => "", # U+E0356 =>
"\xF3\xA0\x8D\x97" => "", # U+E0357 =>
"\xF3\xA0\x8D\x98" => "", # U+E0358 =>
"\xF3\xA0\x8D\x99" => "", # U+E0359 =>
"\xF3\xA0\x8D\x9A" => "", # U+E035A =>
"\xF3\xA0\x8D\x9B" => "", # U+E035B =>
"\xF3\xA0\x8D\x9C" => "", # U+E035C =>
"\xF3\xA0\x8D\x9D" => "", # U+E035D =>
"\xF3\xA0\x8D\x9E" => "", # U+E035E =>
"\xF3\xA0\x8D\x9F" => "", # U+E035F =>
"\xF3\xA0\x8D\xA0" => "", # U+E0360 =>
"\xF3\xA0\x8D\xA1" => "", # U+E0361 =>
"\xF3\xA0\x8D\xA2" => "", # U+E0362 =>
"\xF3\xA0\x8D\xA3" => "", # U+E0363 =>
"\xF3\xA0\x8D\xA4" => "", # U+E0364 =>
"\xF3\xA0\x8D\xA5" => "", # U+E0365 =>
"\xF3\xA0\x8D\xA6" => "", # U+E0366 =>
"\xF3\xA0\x8D\xA7" => "", # U+E0367 =>
"\xF3\xA0\x8D\xA8" => "", # U+E0368 =>
"\xF3\xA0\x8D\xA9" => "", # U+E0369 =>
"\xF3\xA0\x8D\xAA" => "", # U+E036A =>
"\xF3\xA0\x8D\xAB" => "", # U+E036B =>
"\xF3\xA0\x8D\xAC" => "", # U+E036C =>
"\xF3\xA0\x8D\xAD" => "", # U+E036D =>
"\xF3\xA0\x8D\xAE" => "", # U+E036E =>
"\xF3\xA0\x8D\xAF" => "", # U+E036F =>
"\xF3\xA0\x8D\xB0" => "", # U+E0370 =>
"\xF3\xA0\x8D\xB1" => "", # U+E0371 =>
"\xF3\xA0\x8D\xB2" => "", # U+E0372 =>
"\xF3\xA0\x8D\xB3" => "", # U+E0373 =>
"\xF3\xA0\x8D\xB4" => "", # U+E0374 =>
"\xF3\xA0\x8D\xB5" => "", # U+E0375 =>
"\xF3\xA0\x8D\xB6" => "", # U+E0376 =>
"\xF3\xA0\x8D\xB7" => "", # U+E0377 =>
"\xF3\xA0\x8D\xB8" => "", # U+E0378 =>
"\xF3\xA0\x8D\xB9" => "", # U+E0379 =>
"\xF3\xA0\x8D\xBA" => "", # U+E037A =>
"\xF3\xA0\x8D\xBB" => "", # U+E037B =>
"\xF3\xA0\x8D\xBC" => "", # U+E037C =>
"\xF3\xA0\x8D\xBD" => "", # U+E037D =>
"\xF3\xA0\x8D\xBE" => "", # U+E037E =>
"\xF3\xA0\x8D\xBF" => "", # U+E037F =>
"\xF3\xA0\x8E\x80" => "", # U+E0380 =>
"\xF3\xA0\x8E\x81" => "", # U+E0381 =>
"\xF3\xA0\x8E\x82" => "", # U+E0382 =>
"\xF3\xA0\x8E\x83" => "", # U+E0383 =>
"\xF3\xA0\x8E\x84" => "", # U+E0384 =>
"\xF3\xA0\x8E\x85" => "", # U+E0385 =>
"\xF3\xA0\x8E\x86" => "", # U+E0386 =>
"\xF3\xA0\x8E\x87" => "", # U+E0387 =>
"\xF3\xA0\x8E\x88" => "", # U+E0388 =>
"\xF3\xA0\x8E\x89" => "", # U+E0389 =>
"\xF3\xA0\x8E\x8A" => "", # U+E038A =>
"\xF3\xA0\x8E\x8B" => "", # U+E038B =>
"\xF3\xA0\x8E\x8C" => "", # U+E038C =>
"\xF3\xA0\x8E\x8D" => "", # U+E038D =>
"\xF3\xA0\x8E\x8E" => "", # U+E038E =>
"\xF3\xA0\x8E\x8F" => "", # U+E038F =>
"\xF3\xA0\x8E\x90" => "", # U+E0390 =>
"\xF3\xA0\x8E\x91" => "", # U+E0391 =>
"\xF3\xA0\x8E\x92" => "", # U+E0392 =>
"\xF3\xA0\x8E\x93" => "", # U+E0393 =>
"\xF3\xA0\x8E\x94" => "", # U+E0394 =>
"\xF3\xA0\x8E\x95" => "", # U+E0395 =>
"\xF3\xA0\x8E\x96" => "", # U+E0396 =>
"\xF3\xA0\x8E\x97" => "", # U+E0397 =>
"\xF3\xA0\x8E\x98" => "", # U+E0398 =>
"\xF3\xA0\x8E\x99" => "", # U+E0399 =>
"\xF3\xA0\x8E\x9A" => "", # U+E039A =>
"\xF3\xA0\x8E\x9B" => "", # U+E039B =>
"\xF3\xA0\x8E\x9C" => "", # U+E039C =>
"\xF3\xA0\x8E\x9D" => "", # U+E039D =>
"\xF3\xA0\x8E\x9E" => "", # U+E039E =>
"\xF3\xA0\x8E\x9F" => "", # U+E039F =>
"\xF3\xA0\x8E\xA0" => "", # U+E03A0 =>
"\xF3\xA0\x8E\xA1" => "", # U+E03A1 =>
"\xF3\xA0\x8E\xA2" => "", # U+E03A2 =>
"\xF3\xA0\x8E\xA3" => "", # U+E03A3 =>
"\xF3\xA0\x8E\xA4" => "", # U+E03A4 =>
"\xF3\xA0\x8E\xA5" => "", # U+E03A5 =>
"\xF3\xA0\x8E\xA6" => "", # U+E03A6 =>
"\xF3\xA0\x8E\xA7" => "", # U+E03A7 =>
"\xF3\xA0\x8E\xA8" => "", # U+E03A8 =>
"\xF3\xA0\x8E\xA9" => "", # U+E03A9 =>
"\xF3\xA0\x8E\xAA" => "", # U+E03AA =>
"\xF3\xA0\x8E\xAB" => "", # U+E03AB =>
"\xF3\xA0\x8E\xAC" => "", # U+E03AC =>
"\xF3\xA0\x8E\xAD" => "", # U+E03AD =>
"\xF3\xA0\x8E\xAE" => "", # U+E03AE =>
"\xF3\xA0\x8E\xAF" => "", # U+E03AF =>
"\xF3\xA0\x8E\xB0" => "", # U+E03B0 =>
"\xF3\xA0\x8E\xB1" => "", # U+E03B1 =>
"\xF3\xA0\x8E\xB2" => "", # U+E03B2 =>
"\xF3\xA0\x8E\xB3" => "", # U+E03B3 =>
"\xF3\xA0\x8E\xB4" => "", # U+E03B4 =>
"\xF3\xA0\x8E\xB5" => "", # U+E03B5 =>
"\xF3\xA0\x8E\xB6" => "", # U+E03B6 =>
"\xF3\xA0\x8E\xB7" => "", # U+E03B7 =>
"\xF3\xA0\x8E\xB8" => "", # U+E03B8 =>
"\xF3\xA0\x8E\xB9" => "", # U+E03B9 =>
"\xF3\xA0\x8E\xBA" => "", # U+E03BA =>
"\xF3\xA0\x8E\xBB" => "", # U+E03BB =>
"\xF3\xA0\x8E\xBC" => "", # U+E03BC =>
"\xF3\xA0\x8E\xBD" => "", # U+E03BD =>
"\xF3\xA0\x8E\xBE" => "", # U+E03BE =>
"\xF3\xA0\x8E\xBF" => "", # U+E03BF =>
"\xF3\xA0\x8F\x80" => "", # U+E03C0 =>
"\xF3\xA0\x8F\x81" => "", # U+E03C1 =>
"\xF3\xA0\x8F\x82" => "", # U+E03C2 =>
"\xF3\xA0\x8F\x83" => "", # U+E03C3 =>
"\xF3\xA0\x8F\x84" => "", # U+E03C4 =>
"\xF3\xA0\x8F\x85" => "", # U+E03C5 =>
"\xF3\xA0\x8F\x86" => "", # U+E03C6 =>
"\xF3\xA0\x8F\x87" => "", # U+E03C7 =>
"\xF3\xA0\x8F\x88" => "", # U+E03C8 =>
"\xF3\xA0\x8F\x89" => "", # U+E03C9 =>
"\xF3\xA0\x8F\x8A" => "", # U+E03CA =>
"\xF3\xA0\x8F\x8B" => "", # U+E03CB =>
"\xF3\xA0\x8F\x8C" => "", # U+E03CC =>
"\xF3\xA0\x8F\x8D" => "", # U+E03CD =>
"\xF3\xA0\x8F\x8E" => "", # U+E03CE =>
"\xF3\xA0\x8F\x8F" => "", # U+E03CF =>
"\xF3\xA0\x8F\x90" => "", # U+E03D0 =>
"\xF3\xA0\x8F\x91" => "", # U+E03D1 =>
"\xF3\xA0\x8F\x92" => "", # U+E03D2 =>
"\xF3\xA0\x8F\x93" => "", # U+E03D3 =>
"\xF3\xA0\x8F\x94" => "", # U+E03D4 =>
"\xF3\xA0\x8F\x95" => "", # U+E03D5 =>
"\xF3\xA0\x8F\x96" => "", # U+E03D6 =>
"\xF3\xA0\x8F\x97" => "", # U+E03D7 =>
"\xF3\xA0\x8F\x98" => "", # U+E03D8 =>
"\xF3\xA0\x8F\x99" => "", # U+E03D9 =>
"\xF3\xA0\x8F\x9A" => "", # U+E03DA =>
"\xF3\xA0\x8F\x9B" => "", # U+E03DB =>
"\xF3\xA0\x8F\x9C" => "", # U+E03DC =>
"\xF3\xA0\x8F\x9D" => "", # U+E03DD =>
"\xF3\xA0\x8F\x9E" => "", # U+E03DE =>
"\xF3\xA0\x8F\x9F" => "", # U+E03DF =>
"\xF3\xA0\x8F\xA0" => "", # U+E03E0 =>
"\xF3\xA0\x8F\xA1" => "", # U+E03E1 =>
"\xF3\xA0\x8F\xA2" => "", # U+E03E2 =>
"\xF3\xA0\x8F\xA3" => "", # U+E03E3 =>
"\xF3\xA0\x8F\xA4" => "", # U+E03E4 =>
"\xF3\xA0\x8F\xA5" => "", # U+E03E5 =>
"\xF3\xA0\x8F\xA6" => "", # U+E03E6 =>
"\xF3\xA0\x8F\xA7" => "", # U+E03E7 =>
"\xF3\xA0\x8F\xA8" => "", # U+E03E8 =>
"\xF3\xA0\x8F\xA9" => "", # U+E03E9 =>
"\xF3\xA0\x8F\xAA" => "", # U+E03EA =>
"\xF3\xA0\x8F\xAB" => "", # U+E03EB =>
"\xF3\xA0\x8F\xAC" => "", # U+E03EC =>
"\xF3\xA0\x8F\xAD" => "", # U+E03ED =>
"\xF3\xA0\x8F\xAE" => "", # U+E03EE =>
"\xF3\xA0\x8F\xAF" => "", # U+E03EF =>
"\xF3\xA0\x8F\xB0" => "", # U+E03F0 =>
"\xF3\xA0\x8F\xB1" => "", # U+E03F1 =>
"\xF3\xA0\x8F\xB2" => "", # U+E03F2 =>
"\xF3\xA0\x8F\xB3" => "", # U+E03F3 =>
"\xF3\xA0\x8F\xB4" => "", # U+E03F4 =>
"\xF3\xA0\x8F\xB5" => "", # U+E03F5 =>
"\xF3\xA0\x8F\xB6" => "", # U+E03F6 =>
"\xF3\xA0\x8F\xB7" => "", # U+E03F7 =>
"\xF3\xA0\x8F\xB8" => "", # U+E03F8 =>
"\xF3\xA0\x8F\xB9" => "", # U+E03F9 =>
"\xF3\xA0\x8F\xBA" => "", # U+E03FA =>
"\xF3\xA0\x8F\xBB" => "", # U+E03FB =>
"\xF3\xA0\x8F\xBC" => "", # U+E03FC =>
"\xF3\xA0\x8F\xBD" => "", # U+E03FD =>
"\xF3\xA0\x8F\xBE" => "", # U+E03FE =>
"\xF3\xA0\x8F\xBF" => "", # U+E03FF =>
"\xF3\xA0\x90\x80" => "", # U+E0400 =>
"\xF3\xA0\x90\x81" => "", # U+E0401 =>
"\xF3\xA0\x90\x82" => "", # U+E0402 =>
"\xF3\xA0\x90\x83" => "", # U+E0403 =>
"\xF3\xA0\x90\x84" => "", # U+E0404 =>
"\xF3\xA0\x90\x85" => "", # U+E0405 =>
"\xF3\xA0\x90\x86" => "", # U+E0406 =>
"\xF3\xA0\x90\x87" => "", # U+E0407 =>
"\xF3\xA0\x90\x88" => "", # U+E0408 =>
"\xF3\xA0\x90\x89" => "", # U+E0409 =>
"\xF3\xA0\x90\x8A" => "", # U+E040A =>
"\xF3\xA0\x90\x8B" => "", # U+E040B =>
"\xF3\xA0\x90\x8C" => "", # U+E040C =>
"\xF3\xA0\x90\x8D" => "", # U+E040D =>
"\xF3\xA0\x90\x8E" => "", # U+E040E =>
"\xF3\xA0\x90\x8F" => "", # U+E040F =>
"\xF3\xA0\x90\x90" => "", # U+E0410 =>
"\xF3\xA0\x90\x91" => "", # U+E0411 =>
"\xF3\xA0\x90\x92" => "", # U+E0412 =>
"\xF3\xA0\x90\x93" => "", # U+E0413 =>
"\xF3\xA0\x90\x94" => "", # U+E0414 =>
"\xF3\xA0\x90\x95" => "", # U+E0415 =>
"\xF3\xA0\x90\x96" => "", # U+E0416 =>
"\xF3\xA0\x90\x97" => "", # U+E0417 =>
"\xF3\xA0\x90\x98" => "", # U+E0418 =>
"\xF3\xA0\x90\x99" => "", # U+E0419 =>
"\xF3\xA0\x90\x9A" => "", # U+E041A =>
"\xF3\xA0\x90\x9B" => "", # U+E041B =>
"\xF3\xA0\x90\x9C" => "", # U+E041C =>
"\xF3\xA0\x90\x9D" => "", # U+E041D =>
"\xF3\xA0\x90\x9E" => "", # U+E041E =>
"\xF3\xA0\x90\x9F" => "", # U+E041F =>
"\xF3\xA0\x90\xA0" => "", # U+E0420 =>
"\xF3\xA0\x90\xA1" => "", # U+E0421 =>
"\xF3\xA0\x90\xA2" => "", # U+E0422 =>
"\xF3\xA0\x90\xA3" => "", # U+E0423 =>
"\xF3\xA0\x90\xA4" => "", # U+E0424 =>
"\xF3\xA0\x90\xA5" => "", # U+E0425 =>
"\xF3\xA0\x90\xA6" => "", # U+E0426 =>
"\xF3\xA0\x90\xA7" => "", # U+E0427 =>
"\xF3\xA0\x90\xA8" => "", # U+E0428 =>
"\xF3\xA0\x90\xA9" => "", # U+E0429 =>
"\xF3\xA0\x90\xAA" => "", # U+E042A =>
"\xF3\xA0\x90\xAB" => "", # U+E042B =>
"\xF3\xA0\x90\xAC" => "", # U+E042C =>
"\xF3\xA0\x90\xAD" => "", # U+E042D =>
"\xF3\xA0\x90\xAE" => "", # U+E042E =>
"\xF3\xA0\x90\xAF" => "", # U+E042F =>
"\xF3\xA0\x90\xB0" => "", # U+E0430 =>
"\xF3\xA0\x90\xB1" => "", # U+E0431 =>
"\xF3\xA0\x90\xB2" => "", # U+E0432 =>
"\xF3\xA0\x90\xB3" => "", # U+E0433 =>
"\xF3\xA0\x90\xB4" => "", # U+E0434 =>
"\xF3\xA0\x90\xB5" => "", # U+E0435 =>
"\xF3\xA0\x90\xB6" => "", # U+E0436 =>
"\xF3\xA0\x90\xB7" => "", # U+E0437 =>
"\xF3\xA0\x90\xB8" => "", # U+E0438 =>
"\xF3\xA0\x90\xB9" => "", # U+E0439 =>
"\xF3\xA0\x90\xBA" => "", # U+E043A =>
"\xF3\xA0\x90\xBB" => "", # U+E043B =>
"\xF3\xA0\x90\xBC" => "", # U+E043C =>
"\xF3\xA0\x90\xBD" => "", # U+E043D =>
"\xF3\xA0\x90\xBE" => "", # U+E043E =>
"\xF3\xA0\x90\xBF" => "", # U+E043F =>
"\xF3\xA0\x91\x80" => "", # U+E0440 =>
"\xF3\xA0\x91\x81" => "", # U+E0441 =>
"\xF3\xA0\x91\x82" => "", # U+E0442 =>
"\xF3\xA0\x91\x83" => "", # U+E0443 =>
"\xF3\xA0\x91\x84" => "", # U+E0444 =>
"\xF3\xA0\x91\x85" => "", # U+E0445 =>
"\xF3\xA0\x91\x86" => "", # U+E0446 =>
"\xF3\xA0\x91\x87" => "", # U+E0447 =>
"\xF3\xA0\x91\x88" => "", # U+E0448 =>
"\xF3\xA0\x91\x89" => "", # U+E0449 =>
"\xF3\xA0\x91\x8A" => "", # U+E044A =>
"\xF3\xA0\x91\x8B" => "", # U+E044B =>
"\xF3\xA0\x91\x8C" => "", # U+E044C =>
"\xF3\xA0\x91\x8D" => "", # U+E044D =>
"\xF3\xA0\x91\x8E" => "", # U+E044E =>
"\xF3\xA0\x91\x8F" => "", # U+E044F =>
"\xF3\xA0\x91\x90" => "", # U+E0450 =>
"\xF3\xA0\x91\x91" => "", # U+E0451 =>
"\xF3\xA0\x91\x92" => "", # U+E0452 =>
"\xF3\xA0\x91\x93" => "", # U+E0453 =>
"\xF3\xA0\x91\x94" => "", # U+E0454 =>
"\xF3\xA0\x91\x95" => "", # U+E0455 =>
"\xF3\xA0\x91\x96" => "", # U+E0456 =>
"\xF3\xA0\x91\x97" => "", # U+E0457 =>
"\xF3\xA0\x91\x98" => "", # U+E0458 =>
"\xF3\xA0\x91\x99" => "", # U+E0459 =>
"\xF3\xA0\x91\x9A" => "", # U+E045A =>
"\xF3\xA0\x91\x9B" => "", # U+E045B =>
"\xF3\xA0\x91\x9C" => "", # U+E045C =>
"\xF3\xA0\x91\x9D" => "", # U+E045D =>
"\xF3\xA0\x91\x9E" => "", # U+E045E =>
"\xF3\xA0\x91\x9F" => "", # U+E045F =>
"\xF3\xA0\x91\xA0" => "", # U+E0460 =>
"\xF3\xA0\x91\xA1" => "", # U+E0461 =>
"\xF3\xA0\x91\xA2" => "", # U+E0462 =>
"\xF3\xA0\x91\xA3" => "", # U+E0463 =>
"\xF3\xA0\x91\xA4" => "", # U+E0464 =>
"\xF3\xA0\x91\xA5" => "", # U+E0465 =>
"\xF3\xA0\x91\xA6" => "", # U+E0466 =>
"\xF3\xA0\x91\xA7" => "", # U+E0467 =>
"\xF3\xA0\x91\xA8" => "", # U+E0468 =>
"\xF3\xA0\x91\xA9" => "", # U+E0469 =>
"\xF3\xA0\x91\xAA" => "", # U+E046A =>
"\xF3\xA0\x91\xAB" => "", # U+E046B =>
"\xF3\xA0\x91\xAC" => "", # U+E046C =>
"\xF3\xA0\x91\xAD" => "", # U+E046D =>
"\xF3\xA0\x91\xAE" => "", # U+E046E =>
"\xF3\xA0\x91\xAF" => "", # U+E046F =>
"\xF3\xA0\x91\xB0" => "", # U+E0470 =>
"\xF3\xA0\x91\xB1" => "", # U+E0471 =>
"\xF3\xA0\x91\xB2" => "", # U+E0472 =>
"\xF3\xA0\x91\xB3" => "", # U+E0473 =>
"\xF3\xA0\x91\xB4" => "", # U+E0474 =>
"\xF3\xA0\x91\xB5" => "", # U+E0475 =>
"\xF3\xA0\x91\xB6" => "", # U+E0476 =>
"\xF3\xA0\x91\xB7" => "", # U+E0477 =>
"\xF3\xA0\x91\xB8" => "", # U+E0478 =>
"\xF3\xA0\x91\xB9" => "", # U+E0479 =>
"\xF3\xA0\x91\xBA" => "", # U+E047A =>
"\xF3\xA0\x91\xBB" => "", # U+E047B =>
"\xF3\xA0\x91\xBC" => "", # U+E047C =>
"\xF3\xA0\x91\xBD" => "", # U+E047D =>
"\xF3\xA0\x91\xBE" => "", # U+E047E =>
"\xF3\xA0\x91\xBF" => "", # U+E047F =>
"\xF3\xA0\x92\x80" => "", # U+E0480 =>
"\xF3\xA0\x92\x81" => "", # U+E0481 =>
"\xF3\xA0\x92\x82" => "", # U+E0482 =>
"\xF3\xA0\x92\x83" => "", # U+E0483 =>
"\xF3\xA0\x92\x84" => "", # U+E0484 =>
"\xF3\xA0\x92\x85" => "", # U+E0485 =>
"\xF3\xA0\x92\x86" => "", # U+E0486 =>
"\xF3\xA0\x92\x87" => "", # U+E0487 =>
"\xF3\xA0\x92\x88" => "", # U+E0488 =>
"\xF3\xA0\x92\x89" => "", # U+E0489 =>
"\xF3\xA0\x92\x8A" => "", # U+E048A =>
"\xF3\xA0\x92\x8B" => "", # U+E048B =>
"\xF3\xA0\x92\x8C" => "", # U+E048C =>
"\xF3\xA0\x92\x8D" => "", # U+E048D =>
"\xF3\xA0\x92\x8E" => "", # U+E048E =>
"\xF3\xA0\x92\x8F" => "", # U+E048F =>
"\xF3\xA0\x92\x90" => "", # U+E0490 =>
"\xF3\xA0\x92\x91" => "", # U+E0491 =>
"\xF3\xA0\x92\x92" => "", # U+E0492 =>
"\xF3\xA0\x92\x93" => "", # U+E0493 =>
"\xF3\xA0\x92\x94" => "", # U+E0494 =>
"\xF3\xA0\x92\x95" => "", # U+E0495 =>
"\xF3\xA0\x92\x96" => "", # U+E0496 =>
"\xF3\xA0\x92\x97" => "", # U+E0497 =>
"\xF3\xA0\x92\x98" => "", # U+E0498 =>
"\xF3\xA0\x92\x99" => "", # U+E0499 =>
"\xF3\xA0\x92\x9A" => "", # U+E049A =>
"\xF3\xA0\x92\x9B" => "", # U+E049B =>
"\xF3\xA0\x92\x9C" => "", # U+E049C =>
"\xF3\xA0\x92\x9D" => "", # U+E049D =>
"\xF3\xA0\x92\x9E" => "", # U+E049E =>
"\xF3\xA0\x92\x9F" => "", # U+E049F =>
"\xF3\xA0\x92\xA0" => "", # U+E04A0 =>
"\xF3\xA0\x92\xA1" => "", # U+E04A1 =>
"\xF3\xA0\x92\xA2" => "", # U+E04A2 =>
"\xF3\xA0\x92\xA3" => "", # U+E04A3 =>
"\xF3\xA0\x92\xA4" => "", # U+E04A4 =>
"\xF3\xA0\x92\xA5" => "", # U+E04A5 =>
"\xF3\xA0\x92\xA6" => "", # U+E04A6 =>
"\xF3\xA0\x92\xA7" => "", # U+E04A7 =>
"\xF3\xA0\x92\xA8" => "", # U+E04A8 =>
"\xF3\xA0\x92\xA9" => "", # U+E04A9 =>
"\xF3\xA0\x92\xAA" => "", # U+E04AA =>
"\xF3\xA0\x92\xAB" => "", # U+E04AB =>
"\xF3\xA0\x92\xAC" => "", # U+E04AC =>
"\xF3\xA0\x92\xAD" => "", # U+E04AD =>
"\xF3\xA0\x92\xAE" => "", # U+E04AE =>
"\xF3\xA0\x92\xAF" => "", # U+E04AF =>
"\xF3\xA0\x92\xB0" => "", # U+E04B0 =>
"\xF3\xA0\x92\xB1" => "", # U+E04B1 =>
"\xF3\xA0\x92\xB2" => "", # U+E04B2 =>
"\xF3\xA0\x92\xB3" => "", # U+E04B3 =>
"\xF3\xA0\x92\xB4" => "", # U+E04B4 =>
"\xF3\xA0\x92\xB5" => "", # U+E04B5 =>
"\xF3\xA0\x92\xB6" => "", # U+E04B6 =>
"\xF3\xA0\x92\xB7" => "", # U+E04B7 =>
"\xF3\xA0\x92\xB8" => "", # U+E04B8 =>
"\xF3\xA0\x92\xB9" => "", # U+E04B9 =>
"\xF3\xA0\x92\xBA" => "", # U+E04BA =>
"\xF3\xA0\x92\xBB" => "", # U+E04BB =>
"\xF3\xA0\x92\xBC" => "", # U+E04BC =>
"\xF3\xA0\x92\xBD" => "", # U+E04BD =>
"\xF3\xA0\x92\xBE" => "", # U+E04BE =>
"\xF3\xA0\x92\xBF" => "", # U+E04BF =>
"\xF3\xA0\x93\x80" => "", # U+E04C0 =>
"\xF3\xA0\x93\x81" => "", # U+E04C1 =>
"\xF3\xA0\x93\x82" => "", # U+E04C2 =>
"\xF3\xA0\x93\x83" => "", # U+E04C3 =>
"\xF3\xA0\x93\x84" => "", # U+E04C4 =>
"\xF3\xA0\x93\x85" => "", # U+E04C5 =>
"\xF3\xA0\x93\x86" => "", # U+E04C6 =>
"\xF3\xA0\x93\x87" => "", # U+E04C7 =>
"\xF3\xA0\x93\x88" => "", # U+E04C8 =>
"\xF3\xA0\x93\x89" => "", # U+E04C9 =>
"\xF3\xA0\x93\x8A" => "", # U+E04CA =>
"\xF3\xA0\x93\x8B" => "", # U+E04CB =>
"\xF3\xA0\x93\x8C" => "", # U+E04CC =>
"\xF3\xA0\x93\x8D" => "", # U+E04CD =>
"\xF3\xA0\x93\x8E" => "", # U+E04CE =>
"\xF3\xA0\x93\x8F" => "", # U+E04CF =>
"\xF3\xA0\x93\x90" => "", # U+E04D0 =>
"\xF3\xA0\x93\x91" => "", # U+E04D1 =>
"\xF3\xA0\x93\x92" => "", # U+E04D2 =>
"\xF3\xA0\x93\x93" => "", # U+E04D3 =>
"\xF3\xA0\x93\x94" => "", # U+E04D4 =>
"\xF3\xA0\x93\x95" => "", # U+E04D5 =>
"\xF3\xA0\x93\x96" => "", # U+E04D6 =>
"\xF3\xA0\x93\x97" => "", # U+E04D7 =>
"\xF3\xA0\x93\x98" => "", # U+E04D8 =>
"\xF3\xA0\x93\x99" => "", # U+E04D9 =>
"\xF3\xA0\x93\x9A" => "", # U+E04DA =>
"\xF3\xA0\x93\x9B" => "", # U+E04DB =>
"\xF3\xA0\x93\x9C" => "", # U+E04DC =>
"\xF3\xA0\x93\x9D" => "", # U+E04DD =>
"\xF3\xA0\x93\x9E" => "", # U+E04DE =>
"\xF3\xA0\x93\x9F" => "", # U+E04DF =>
"\xF3\xA0\x93\xA0" => "", # U+E04E0 =>
"\xF3\xA0\x93\xA1" => "", # U+E04E1 =>
"\xF3\xA0\x93\xA2" => "", # U+E04E2 =>
"\xF3\xA0\x93\xA3" => "", # U+E04E3 =>
"\xF3\xA0\x93\xA4" => "", # U+E04E4 =>
"\xF3\xA0\x93\xA5" => "", # U+E04E5 =>
"\xF3\xA0\x93\xA6" => "", # U+E04E6 =>
"\xF3\xA0\x93\xA7" => "", # U+E04E7 =>
"\xF3\xA0\x93\xA8" => "", # U+E04E8 =>
"\xF3\xA0\x93\xA9" => "", # U+E04E9 =>
"\xF3\xA0\x93\xAA" => "", # U+E04EA =>
"\xF3\xA0\x93\xAB" => "", # U+E04EB =>
"\xF3\xA0\x93\xAC" => "", # U+E04EC =>
"\xF3\xA0\x93\xAD" => "", # U+E04ED =>
"\xF3\xA0\x93\xAE" => "", # U+E04EE =>
"\xF3\xA0\x93\xAF" => "", # U+E04EF =>
"\xF3\xA0\x93\xB0" => "", # U+E04F0 =>
"\xF3\xA0\x93\xB1" => "", # U+E04F1 =>
"\xF3\xA0\x93\xB2" => "", # U+E04F2 =>
"\xF3\xA0\x93\xB3" => "", # U+E04F3 =>
"\xF3\xA0\x93\xB4" => "", # U+E04F4 =>
"\xF3\xA0\x93\xB5" => "", # U+E04F5 =>
"\xF3\xA0\x93\xB6" => "", # U+E04F6 =>
"\xF3\xA0\x93\xB7" => "", # U+E04F7 =>
"\xF3\xA0\x93\xB8" => "", # U+E04F8 =>
"\xF3\xA0\x93\xB9" => "", # U+E04F9 =>
"\xF3\xA0\x93\xBA" => "", # U+E04FA =>
"\xF3\xA0\x93\xBB" => "", # U+E04FB =>
"\xF3\xA0\x93\xBC" => "", # U+E04FC =>
"\xF3\xA0\x93\xBD" => "", # U+E04FD =>
"\xF3\xA0\x93\xBE" => "", # U+E04FE =>
"\xF3\xA0\x93\xBF" => "", # U+E04FF =>
"\xF3\xA0\x94\x80" => "", # U+E0500 =>
"\xF3\xA0\x94\x81" => "", # U+E0501 =>
"\xF3\xA0\x94\x82" => "", # U+E0502 =>
"\xF3\xA0\x94\x83" => "", # U+E0503 =>
"\xF3\xA0\x94\x84" => "", # U+E0504 =>
"\xF3\xA0\x94\x85" => "", # U+E0505 =>
"\xF3\xA0\x94\x86" => "", # U+E0506 =>
"\xF3\xA0\x94\x87" => "", # U+E0507 =>
"\xF3\xA0\x94\x88" => "", # U+E0508 =>
"\xF3\xA0\x94\x89" => "", # U+E0509 =>
"\xF3\xA0\x94\x8A" => "", # U+E050A =>
"\xF3\xA0\x94\x8B" => "", # U+E050B =>
"\xF3\xA0\x94\x8C" => "", # U+E050C =>
"\xF3\xA0\x94\x8D" => "", # U+E050D =>
"\xF3\xA0\x94\x8E" => "", # U+E050E =>
"\xF3\xA0\x94\x8F" => "", # U+E050F =>
"\xF3\xA0\x94\x90" => "", # U+E0510 =>
"\xF3\xA0\x94\x91" => "", # U+E0511 =>
"\xF3\xA0\x94\x92" => "", # U+E0512 =>
"\xF3\xA0\x94\x93" => "", # U+E0513 =>
"\xF3\xA0\x94\x94" => "", # U+E0514 =>
"\xF3\xA0\x94\x95" => "", # U+E0515 =>
"\xF3\xA0\x94\x96" => "", # U+E0516 =>
"\xF3\xA0\x94\x97" => "", # U+E0517 =>
"\xF3\xA0\x94\x98" => "", # U+E0518 =>
"\xF3\xA0\x94\x99" => "", # U+E0519 =>
"\xF3\xA0\x94\x9A" => "", # U+E051A =>
"\xF3\xA0\x94\x9B" => "", # U+E051B =>
"\xF3\xA0\x94\x9C" => "", # U+E051C =>
"\xF3\xA0\x94\x9D" => "", # U+E051D =>
"\xF3\xA0\x94\x9E" => "", # U+E051E =>
"\xF3\xA0\x94\x9F" => "", # U+E051F =>
"\xF3\xA0\x94\xA0" => "", # U+E0520 =>
"\xF3\xA0\x94\xA1" => "", # U+E0521 =>
"\xF3\xA0\x94\xA2" => "", # U+E0522 =>
"\xF3\xA0\x94\xA3" => "", # U+E0523 =>
"\xF3\xA0\x94\xA4" => "", # U+E0524 =>
"\xF3\xA0\x94\xA5" => "", # U+E0525 =>
"\xF3\xA0\x94\xA6" => "", # U+E0526 =>
"\xF3\xA0\x94\xA7" => "", # U+E0527 =>
"\xF3\xA0\x94\xA8" => "", # U+E0528 =>
"\xF3\xA0\x94\xA9" => "", # U+E0529 =>
"\xF3\xA0\x94\xAA" => "", # U+E052A =>
"\xF3\xA0\x94\xAB" => "", # U+E052B =>
"\xF3\xA0\x94\xAC" => "", # U+E052C =>
"\xF3\xA0\x94\xAD" => "", # U+E052D =>
"\xF3\xA0\x94\xAE" => "", # U+E052E =>
"\xF3\xA0\x94\xAF" => "", # U+E052F =>
"\xF3\xA0\x94\xB0" => "", # U+E0530 =>
"\xF3\xA0\x94\xB1" => "", # U+E0531 =>
"\xF3\xA0\x94\xB2" => "", # U+E0532 =>
"\xF3\xA0\x94\xB3" => "", # U+E0533 =>
"\xF3\xA0\x94\xB4" => "", # U+E0534 =>
"\xF3\xA0\x94\xB5" => "", # U+E0535 =>
"\xF3\xA0\x94\xB6" => "", # U+E0536 =>
"\xF3\xA0\x94\xB7" => "", # U+E0537 =>
"\xF3\xA0\x94\xB8" => "", # U+E0538 =>
"\xF3\xA0\x94\xB9" => "", # U+E0539 =>
"\xF3\xA0\x94\xBA" => "", # U+E053A =>
"\xF3\xA0\x94\xBB" => "", # U+E053B =>
"\xF3\xA0\x94\xBC" => "", # U+E053C =>
"\xF3\xA0\x94\xBD" => "", # U+E053D =>
"\xF3\xA0\x94\xBE" => "", # U+E053E =>
"\xF3\xA0\x94\xBF" => "", # U+E053F =>
"\xF3\xA0\x95\x80" => "", # U+E0540 =>
"\xF3\xA0\x95\x81" => "", # U+E0541 =>
"\xF3\xA0\x95\x82" => "", # U+E0542 =>
"\xF3\xA0\x95\x83" => "", # U+E0543 =>
"\xF3\xA0\x95\x84" => "", # U+E0544 =>
"\xF3\xA0\x95\x85" => "", # U+E0545 =>
"\xF3\xA0\x95\x86" => "", # U+E0546 =>
"\xF3\xA0\x95\x87" => "", # U+E0547 =>
"\xF3\xA0\x95\x88" => "", # U+E0548 =>
"\xF3\xA0\x95\x89" => "", # U+E0549 =>
"\xF3\xA0\x95\x8A" => "", # U+E054A =>
"\xF3\xA0\x95\x8B" => "", # U+E054B =>
"\xF3\xA0\x95\x8C" => "", # U+E054C =>
"\xF3\xA0\x95\x8D" => "", # U+E054D =>
"\xF3\xA0\x95\x8E" => "", # U+E054E =>
"\xF3\xA0\x95\x8F" => "", # U+E054F =>
"\xF3\xA0\x95\x90" => "", # U+E0550 =>
"\xF3\xA0\x95\x91" => "", # U+E0551 =>
"\xF3\xA0\x95\x92" => "", # U+E0552 =>
"\xF3\xA0\x95\x93" => "", # U+E0553 =>
"\xF3\xA0\x95\x94" => "", # U+E0554 =>
"\xF3\xA0\x95\x95" => "", # U+E0555 =>
"\xF3\xA0\x95\x96" => "", # U+E0556 =>
"\xF3\xA0\x95\x97" => "", # U+E0557 =>
"\xF3\xA0\x95\x98" => "", # U+E0558 =>
"\xF3\xA0\x95\x99" => "", # U+E0559 =>
"\xF3\xA0\x95\x9A" => "", # U+E055A =>
"\xF3\xA0\x95\x9B" => "", # U+E055B =>
"\xF3\xA0\x95\x9C" => "", # U+E055C =>
"\xF3\xA0\x95\x9D" => "", # U+E055D =>
"\xF3\xA0\x95\x9E" => "", # U+E055E =>
"\xF3\xA0\x95\x9F" => "", # U+E055F =>
"\xF3\xA0\x95\xA0" => "", # U+E0560 =>
"\xF3\xA0\x95\xA1" => "", # U+E0561 =>
"\xF3\xA0\x95\xA2" => "", # U+E0562 =>
"\xF3\xA0\x95\xA3" => "", # U+E0563 =>
"\xF3\xA0\x95\xA4" => "", # U+E0564 =>
"\xF3\xA0\x95\xA5" => "", # U+E0565 =>
"\xF3\xA0\x95\xA6" => "", # U+E0566 =>
"\xF3\xA0\x95\xA7" => "", # U+E0567 =>
"\xF3\xA0\x95\xA8" => "", # U+E0568 =>
"\xF3\xA0\x95\xA9" => "", # U+E0569 =>
"\xF3\xA0\x95\xAA" => "", # U+E056A =>
"\xF3\xA0\x95\xAB" => "", # U+E056B =>
"\xF3\xA0\x95\xAC" => "", # U+E056C =>
"\xF3\xA0\x95\xAD" => "", # U+E056D =>
"\xF3\xA0\x95\xAE" => "", # U+E056E =>
"\xF3\xA0\x95\xAF" => "", # U+E056F =>
"\xF3\xA0\x95\xB0" => "", # U+E0570 =>
"\xF3\xA0\x95\xB1" => "", # U+E0571 =>
"\xF3\xA0\x95\xB2" => "", # U+E0572 =>
"\xF3\xA0\x95\xB3" => "", # U+E0573 =>
"\xF3\xA0\x95\xB4" => "", # U+E0574 =>
"\xF3\xA0\x95\xB5" => "", # U+E0575 =>
"\xF3\xA0\x95\xB6" => "", # U+E0576 =>
"\xF3\xA0\x95\xB7" => "", # U+E0577 =>
"\xF3\xA0\x95\xB8" => "", # U+E0578 =>
"\xF3\xA0\x95\xB9" => "", # U+E0579 =>
"\xF3\xA0\x95\xBA" => "", # U+E057A =>
"\xF3\xA0\x95\xBB" => "", # U+E057B =>
"\xF3\xA0\x95\xBC" => "", # U+E057C =>
"\xF3\xA0\x95\xBD" => "", # U+E057D =>
"\xF3\xA0\x95\xBE" => "", # U+E057E =>
"\xF3\xA0\x95\xBF" => "", # U+E057F =>
"\xF3\xA0\x96\x80" => "", # U+E0580 =>
"\xF3\xA0\x96\x81" => "", # U+E0581 =>
"\xF3\xA0\x96\x82" => "", # U+E0582 =>
"\xF3\xA0\x96\x83" => "", # U+E0583 =>
"\xF3\xA0\x96\x84" => "", # U+E0584 =>
"\xF3\xA0\x96\x85" => "", # U+E0585 =>
"\xF3\xA0\x96\x86" => "", # U+E0586 =>
"\xF3\xA0\x96\x87" => "", # U+E0587 =>
"\xF3\xA0\x96\x88" => "", # U+E0588 =>
"\xF3\xA0\x96\x89" => "", # U+E0589 =>
"\xF3\xA0\x96\x8A" => "", # U+E058A =>
"\xF3\xA0\x96\x8B" => "", # U+E058B =>
"\xF3\xA0\x96\x8C" => "", # U+E058C =>
"\xF3\xA0\x96\x8D" => "", # U+E058D =>
"\xF3\xA0\x96\x8E" => "", # U+E058E =>
"\xF3\xA0\x96\x8F" => "", # U+E058F =>
"\xF3\xA0\x96\x90" => "", # U+E0590 =>
"\xF3\xA0\x96\x91" => "", # U+E0591 =>
"\xF3\xA0\x96\x92" => "", # U+E0592 =>
"\xF3\xA0\x96\x93" => "", # U+E0593 =>
"\xF3\xA0\x96\x94" => "", # U+E0594 =>
"\xF3\xA0\x96\x95" => "", # U+E0595 =>
"\xF3\xA0\x96\x96" => "", # U+E0596 =>
"\xF3\xA0\x96\x97" => "", # U+E0597 =>
"\xF3\xA0\x96\x98" => "", # U+E0598 =>
"\xF3\xA0\x96\x99" => "", # U+E0599 =>
"\xF3\xA0\x96\x9A" => "", # U+E059A =>
"\xF3\xA0\x96\x9B" => "", # U+E059B =>
"\xF3\xA0\x96\x9C" => "", # U+E059C =>
"\xF3\xA0\x96\x9D" => "", # U+E059D =>
"\xF3\xA0\x96\x9E" => "", # U+E059E =>
"\xF3\xA0\x96\x9F" => "", # U+E059F =>
"\xF3\xA0\x96\xA0" => "", # U+E05A0 =>
"\xF3\xA0\x96\xA1" => "", # U+E05A1 =>
"\xF3\xA0\x96\xA2" => "", # U+E05A2 =>
"\xF3\xA0\x96\xA3" => "", # U+E05A3 =>
"\xF3\xA0\x96\xA4" => "", # U+E05A4 =>
"\xF3\xA0\x96\xA5" => "", # U+E05A5 =>
"\xF3\xA0\x96\xA6" => "", # U+E05A6 =>
"\xF3\xA0\x96\xA7" => "", # U+E05A7 =>
"\xF3\xA0\x96\xA8" => "", # U+E05A8 =>
"\xF3\xA0\x96\xA9" => "", # U+E05A9 =>
"\xF3\xA0\x96\xAA" => "", # U+E05AA =>
"\xF3\xA0\x96\xAB" => "", # U+E05AB =>
"\xF3\xA0\x96\xAC" => "", # U+E05AC =>
"\xF3\xA0\x96\xAD" => "", # U+E05AD =>
"\xF3\xA0\x96\xAE" => "", # U+E05AE =>
"\xF3\xA0\x96\xAF" => "", # U+E05AF =>
"\xF3\xA0\x96\xB0" => "", # U+E05B0 =>
"\xF3\xA0\x96\xB1" => "", # U+E05B1 =>
"\xF3\xA0\x96\xB2" => "", # U+E05B2 =>
"\xF3\xA0\x96\xB3" => "", # U+E05B3 =>
"\xF3\xA0\x96\xB4" => "", # U+E05B4 =>
"\xF3\xA0\x96\xB5" => "", # U+E05B5 =>
"\xF3\xA0\x96\xB6" => "", # U+E05B6 =>
"\xF3\xA0\x96\xB7" => "", # U+E05B7 =>
"\xF3\xA0\x96\xB8" => "", # U+E05B8 =>
"\xF3\xA0\x96\xB9" => "", # U+E05B9 =>
"\xF3\xA0\x96\xBA" => "", # U+E05BA =>
"\xF3\xA0\x96\xBB" => "", # U+E05BB =>
"\xF3\xA0\x96\xBC" => "", # U+E05BC =>
"\xF3\xA0\x96\xBD" => "", # U+E05BD =>
"\xF3\xA0\x96\xBE" => "", # U+E05BE =>
"\xF3\xA0\x96\xBF" => "", # U+E05BF =>
"\xF3\xA0\x97\x80" => "", # U+E05C0 =>
"\xF3\xA0\x97\x81" => "", # U+E05C1 =>
"\xF3\xA0\x97\x82" => "", # U+E05C2 =>
"\xF3\xA0\x97\x83" => "", # U+E05C3 =>
"\xF3\xA0\x97\x84" => "", # U+E05C4 =>
"\xF3\xA0\x97\x85" => "", # U+E05C5 =>
"\xF3\xA0\x97\x86" => "", # U+E05C6 =>
"\xF3\xA0\x97\x87" => "", # U+E05C7 =>
"\xF3\xA0\x97\x88" => "", # U+E05C8 =>
"\xF3\xA0\x97\x89" => "", # U+E05C9 =>
"\xF3\xA0\x97\x8A" => "", # U+E05CA =>
"\xF3\xA0\x97\x8B" => "", # U+E05CB =>
"\xF3\xA0\x97\x8C" => "", # U+E05CC =>
"\xF3\xA0\x97\x8D" => "", # U+E05CD =>
"\xF3\xA0\x97\x8E" => "", # U+E05CE =>
"\xF3\xA0\x97\x8F" => "", # U+E05CF =>
"\xF3\xA0\x97\x90" => "", # U+E05D0 =>
"\xF3\xA0\x97\x91" => "", # U+E05D1 =>
"\xF3\xA0\x97\x92" => "", # U+E05D2 =>
"\xF3\xA0\x97\x93" => "", # U+E05D3 =>
"\xF3\xA0\x97\x94" => "", # U+E05D4 =>
"\xF3\xA0\x97\x95" => "", # U+E05D5 =>
"\xF3\xA0\x97\x96" => "", # U+E05D6 =>
"\xF3\xA0\x97\x97" => "", # U+E05D7 =>
"\xF3\xA0\x97\x98" => "", # U+E05D8 =>
"\xF3\xA0\x97\x99" => "", # U+E05D9 =>
"\xF3\xA0\x97\x9A" => "", # U+E05DA =>
"\xF3\xA0\x97\x9B" => "", # U+E05DB =>
"\xF3\xA0\x97\x9C" => "", # U+E05DC =>
"\xF3\xA0\x97\x9D" => "", # U+E05DD =>
"\xF3\xA0\x97\x9E" => "", # U+E05DE =>
"\xF3\xA0\x97\x9F" => "", # U+E05DF =>
"\xF3\xA0\x97\xA0" => "", # U+E05E0 =>
"\xF3\xA0\x97\xA1" => "", # U+E05E1 =>
"\xF3\xA0\x97\xA2" => "", # U+E05E2 =>
"\xF3\xA0\x97\xA3" => "", # U+E05E3 =>
"\xF3\xA0\x97\xA4" => "", # U+E05E4 =>
"\xF3\xA0\x97\xA5" => "", # U+E05E5 =>
"\xF3\xA0\x97\xA6" => "", # U+E05E6 =>
"\xF3\xA0\x97\xA7" => "", # U+E05E7 =>
"\xF3\xA0\x97\xA8" => "", # U+E05E8 =>
"\xF3\xA0\x97\xA9" => "", # U+E05E9 =>
"\xF3\xA0\x97\xAA" => "", # U+E05EA =>
"\xF3\xA0\x97\xAB" => "", # U+E05EB =>
"\xF3\xA0\x97\xAC" => "", # U+E05EC =>
"\xF3\xA0\x97\xAD" => "", # U+E05ED =>
"\xF3\xA0\x97\xAE" => "", # U+E05EE =>
"\xF3\xA0\x97\xAF" => "", # U+E05EF =>
"\xF3\xA0\x97\xB0" => "", # U+E05F0 =>
"\xF3\xA0\x97\xB1" => "", # U+E05F1 =>
"\xF3\xA0\x97\xB2" => "", # U+E05F2 =>
"\xF3\xA0\x97\xB3" => "", # U+E05F3 =>
"\xF3\xA0\x97\xB4" => "", # U+E05F4 =>
"\xF3\xA0\x97\xB5" => "", # U+E05F5 =>
"\xF3\xA0\x97\xB6" => "", # U+E05F6 =>
"\xF3\xA0\x97\xB7" => "", # U+E05F7 =>
"\xF3\xA0\x97\xB8" => "", # U+E05F8 =>
"\xF3\xA0\x97\xB9" => "", # U+E05F9 =>
"\xF3\xA0\x97\xBA" => "", # U+E05FA =>
"\xF3\xA0\x97\xBB" => "", # U+E05FB =>
"\xF3\xA0\x97\xBC" => "", # U+E05FC =>
"\xF3\xA0\x97\xBD" => "", # U+E05FD =>
"\xF3\xA0\x97\xBE" => "", # U+E05FE =>
"\xF3\xA0\x97\xBF" => "", # U+E05FF =>
"\xF3\xA0\x98\x80" => "", # U+E0600 =>
"\xF3\xA0\x98\x81" => "", # U+E0601 =>
"\xF3\xA0\x98\x82" => "", # U+E0602 =>
"\xF3\xA0\x98\x83" => "", # U+E0603 =>
"\xF3\xA0\x98\x84" => "", # U+E0604 =>
"\xF3\xA0\x98\x85" => "", # U+E0605 =>
"\xF3\xA0\x98\x86" => "", # U+E0606 =>
"\xF3\xA0\x98\x87" => "", # U+E0607 =>
"\xF3\xA0\x98\x88" => "", # U+E0608 =>
"\xF3\xA0\x98\x89" => "", # U+E0609 =>
"\xF3\xA0\x98\x8A" => "", # U+E060A =>
"\xF3\xA0\x98\x8B" => "", # U+E060B =>
"\xF3\xA0\x98\x8C" => "", # U+E060C =>
"\xF3\xA0\x98\x8D" => "", # U+E060D =>
"\xF3\xA0\x98\x8E" => "", # U+E060E =>
"\xF3\xA0\x98\x8F" => "", # U+E060F =>
"\xF3\xA0\x98\x90" => "", # U+E0610 =>
"\xF3\xA0\x98\x91" => "", # U+E0611 =>
"\xF3\xA0\x98\x92" => "", # U+E0612 =>
"\xF3\xA0\x98\x93" => "", # U+E0613 =>
"\xF3\xA0\x98\x94" => "", # U+E0614 =>
"\xF3\xA0\x98\x95" => "", # U+E0615 =>
"\xF3\xA0\x98\x96" => "", # U+E0616 =>
"\xF3\xA0\x98\x97" => "", # U+E0617 =>
"\xF3\xA0\x98\x98" => "", # U+E0618 =>
"\xF3\xA0\x98\x99" => "", # U+E0619 =>
"\xF3\xA0\x98\x9A" => "", # U+E061A =>
"\xF3\xA0\x98\x9B" => "", # U+E061B =>
"\xF3\xA0\x98\x9C" => "", # U+E061C =>
"\xF3\xA0\x98\x9D" => "", # U+E061D =>
"\xF3\xA0\x98\x9E" => "", # U+E061E =>
"\xF3\xA0\x98\x9F" => "", # U+E061F =>
"\xF3\xA0\x98\xA0" => "", # U+E0620 =>
"\xF3\xA0\x98\xA1" => "", # U+E0621 =>
"\xF3\xA0\x98\xA2" => "", # U+E0622 =>
"\xF3\xA0\x98\xA3" => "", # U+E0623 =>
"\xF3\xA0\x98\xA4" => "", # U+E0624 =>
"\xF3\xA0\x98\xA5" => "", # U+E0625 =>
"\xF3\xA0\x98\xA6" => "", # U+E0626 =>
"\xF3\xA0\x98\xA7" => "", # U+E0627 =>
"\xF3\xA0\x98\xA8" => "", # U+E0628 =>
"\xF3\xA0\x98\xA9" => "", # U+E0629 =>
"\xF3\xA0\x98\xAA" => "", # U+E062A =>
"\xF3\xA0\x98\xAB" => "", # U+E062B =>
"\xF3\xA0\x98\xAC" => "", # U+E062C =>
"\xF3\xA0\x98\xAD" => "", # U+E062D =>
"\xF3\xA0\x98\xAE" => "", # U+E062E =>
"\xF3\xA0\x98\xAF" => "", # U+E062F =>
"\xF3\xA0\x98\xB0" => "", # U+E0630 =>
"\xF3\xA0\x98\xB1" => "", # U+E0631 =>
"\xF3\xA0\x98\xB2" => "", # U+E0632 =>
"\xF3\xA0\x98\xB3" => "", # U+E0633 =>
"\xF3\xA0\x98\xB4" => "", # U+E0634 =>
"\xF3\xA0\x98\xB5" => "", # U+E0635 =>
"\xF3\xA0\x98\xB6" => "", # U+E0636 =>
"\xF3\xA0\x98\xB7" => "", # U+E0637 =>
"\xF3\xA0\x98\xB8" => "", # U+E0638 =>
"\xF3\xA0\x98\xB9" => "", # U+E0639 =>
"\xF3\xA0\x98\xBA" => "", # U+E063A =>
"\xF3\xA0\x98\xBB" => "", # U+E063B =>
"\xF3\xA0\x98\xBC" => "", # U+E063C =>
"\xF3\xA0\x98\xBD" => "", # U+E063D =>
"\xF3\xA0\x98\xBE" => "", # U+E063E =>
"\xF3\xA0\x98\xBF" => "", # U+E063F =>
"\xF3\xA0\x99\x80" => "", # U+E0640 =>
"\xF3\xA0\x99\x81" => "", # U+E0641 =>
"\xF3\xA0\x99\x82" => "", # U+E0642 =>
"\xF3\xA0\x99\x83" => "", # U+E0643 =>
"\xF3\xA0\x99\x84" => "", # U+E0644 =>
"\xF3\xA0\x99\x85" => "", # U+E0645 =>
"\xF3\xA0\x99\x86" => "", # U+E0646 =>
"\xF3\xA0\x99\x87" => "", # U+E0647 =>
"\xF3\xA0\x99\x88" => "", # U+E0648 =>
"\xF3\xA0\x99\x89" => "", # U+E0649 =>
"\xF3\xA0\x99\x8A" => "", # U+E064A =>
"\xF3\xA0\x99\x8B" => "", # U+E064B =>
"\xF3\xA0\x99\x8C" => "", # U+E064C =>
"\xF3\xA0\x99\x8D" => "", # U+E064D =>
"\xF3\xA0\x99\x8E" => "", # U+E064E =>
"\xF3\xA0\x99\x8F" => "", # U+E064F =>
"\xF3\xA0\x99\x90" => "", # U+E0650 =>
"\xF3\xA0\x99\x91" => "", # U+E0651 =>
"\xF3\xA0\x99\x92" => "", # U+E0652 =>
"\xF3\xA0\x99\x93" => "", # U+E0653 =>
"\xF3\xA0\x99\x94" => "", # U+E0654 =>
"\xF3\xA0\x99\x95" => "", # U+E0655 =>
"\xF3\xA0\x99\x96" => "", # U+E0656 =>
"\xF3\xA0\x99\x97" => "", # U+E0657 =>
"\xF3\xA0\x99\x98" => "", # U+E0658 =>
"\xF3\xA0\x99\x99" => "", # U+E0659 =>
"\xF3\xA0\x99\x9A" => "", # U+E065A =>
"\xF3\xA0\x99\x9B" => "", # U+E065B =>
"\xF3\xA0\x99\x9C" => "", # U+E065C =>
"\xF3\xA0\x99\x9D" => "", # U+E065D =>
"\xF3\xA0\x99\x9E" => "", # U+E065E =>
"\xF3\xA0\x99\x9F" => "", # U+E065F =>
"\xF3\xA0\x99\xA0" => "", # U+E0660 =>
"\xF3\xA0\x99\xA1" => "", # U+E0661 =>
"\xF3\xA0\x99\xA2" => "", # U+E0662 =>
"\xF3\xA0\x99\xA3" => "", # U+E0663 =>
"\xF3\xA0\x99\xA4" => "", # U+E0664 =>
"\xF3\xA0\x99\xA5" => "", # U+E0665 =>
"\xF3\xA0\x99\xA6" => "", # U+E0666 =>
"\xF3\xA0\x99\xA7" => "", # U+E0667 =>
"\xF3\xA0\x99\xA8" => "", # U+E0668 =>
"\xF3\xA0\x99\xA9" => "", # U+E0669 =>
"\xF3\xA0\x99\xAA" => "", # U+E066A =>
"\xF3\xA0\x99\xAB" => "", # U+E066B =>
"\xF3\xA0\x99\xAC" => "", # U+E066C =>
"\xF3\xA0\x99\xAD" => "", # U+E066D =>
"\xF3\xA0\x99\xAE" => "", # U+E066E =>
"\xF3\xA0\x99\xAF" => "", # U+E066F =>
"\xF3\xA0\x99\xB0" => "", # U+E0670 =>
"\xF3\xA0\x99\xB1" => "", # U+E0671 =>
"\xF3\xA0\x99\xB2" => "", # U+E0672 =>
"\xF3\xA0\x99\xB3" => "", # U+E0673 =>
"\xF3\xA0\x99\xB4" => "", # U+E0674 =>
"\xF3\xA0\x99\xB5" => "", # U+E0675 =>
"\xF3\xA0\x99\xB6" => "", # U+E0676 =>
"\xF3\xA0\x99\xB7" => "", # U+E0677 =>
"\xF3\xA0\x99\xB8" => "", # U+E0678 =>
"\xF3\xA0\x99\xB9" => "", # U+E0679 =>
"\xF3\xA0\x99\xBA" => "", # U+E067A =>
"\xF3\xA0\x99\xBB" => "", # U+E067B =>
"\xF3\xA0\x99\xBC" => "", # U+E067C =>
"\xF3\xA0\x99\xBD" => "", # U+E067D =>
"\xF3\xA0\x99\xBE" => "", # U+E067E =>
"\xF3\xA0\x99\xBF" => "", # U+E067F =>
"\xF3\xA0\x9A\x80" => "", # U+E0680 =>
"\xF3\xA0\x9A\x81" => "", # U+E0681 =>
"\xF3\xA0\x9A\x82" => "", # U+E0682 =>
"\xF3\xA0\x9A\x83" => "", # U+E0683 =>
"\xF3\xA0\x9A\x84" => "", # U+E0684 =>
"\xF3\xA0\x9A\x85" => "", # U+E0685 =>
"\xF3\xA0\x9A\x86" => "", # U+E0686 =>
"\xF3\xA0\x9A\x87" => "", # U+E0687 =>
"\xF3\xA0\x9A\x88" => "", # U+E0688 =>
"\xF3\xA0\x9A\x89" => "", # U+E0689 =>
"\xF3\xA0\x9A\x8A" => "", # U+E068A =>
"\xF3\xA0\x9A\x8B" => "", # U+E068B =>
"\xF3\xA0\x9A\x8C" => "", # U+E068C =>
"\xF3\xA0\x9A\x8D" => "", # U+E068D =>
"\xF3\xA0\x9A\x8E" => "", # U+E068E =>
"\xF3\xA0\x9A\x8F" => "", # U+E068F =>
"\xF3\xA0\x9A\x90" => "", # U+E0690 =>
"\xF3\xA0\x9A\x91" => "", # U+E0691 =>
"\xF3\xA0\x9A\x92" => "", # U+E0692 =>
"\xF3\xA0\x9A\x93" => "", # U+E0693 =>
"\xF3\xA0\x9A\x94" => "", # U+E0694 =>
"\xF3\xA0\x9A\x95" => "", # U+E0695 =>
"\xF3\xA0\x9A\x96" => "", # U+E0696 =>
"\xF3\xA0\x9A\x97" => "", # U+E0697 =>
"\xF3\xA0\x9A\x98" => "", # U+E0698 =>
"\xF3\xA0\x9A\x99" => "", # U+E0699 =>
"\xF3\xA0\x9A\x9A" => "", # U+E069A =>
"\xF3\xA0\x9A\x9B" => "", # U+E069B =>
"\xF3\xA0\x9A\x9C" => "", # U+E069C =>
"\xF3\xA0\x9A\x9D" => "", # U+E069D =>
"\xF3\xA0\x9A\x9E" => "", # U+E069E =>
"\xF3\xA0\x9A\x9F" => "", # U+E069F =>
"\xF3\xA0\x9A\xA0" => "", # U+E06A0 =>
"\xF3\xA0\x9A\xA1" => "", # U+E06A1 =>
"\xF3\xA0\x9A\xA2" => "", # U+E06A2 =>
"\xF3\xA0\x9A\xA3" => "", # U+E06A3 =>
"\xF3\xA0\x9A\xA4" => "", # U+E06A4 =>
"\xF3\xA0\x9A\xA5" => "", # U+E06A5 =>
"\xF3\xA0\x9A\xA6" => "", # U+E06A6 =>
"\xF3\xA0\x9A\xA7" => "", # U+E06A7 =>
"\xF3\xA0\x9A\xA8" => "", # U+E06A8 =>
"\xF3\xA0\x9A\xA9" => "", # U+E06A9 =>
"\xF3\xA0\x9A\xAA" => "", # U+E06AA =>
"\xF3\xA0\x9A\xAB" => "", # U+E06AB =>
"\xF3\xA0\x9A\xAC" => "", # U+E06AC =>
"\xF3\xA0\x9A\xAD" => "", # U+E06AD =>
"\xF3\xA0\x9A\xAE" => "", # U+E06AE =>
"\xF3\xA0\x9A\xAF" => "", # U+E06AF =>
"\xF3\xA0\x9A\xB0" => "", # U+E06B0 =>
"\xF3\xA0\x9A\xB1" => "", # U+E06B1 =>
"\xF3\xA0\x9A\xB2" => "", # U+E06B2 =>
"\xF3\xA0\x9A\xB3" => "", # U+E06B3 =>
"\xF3\xA0\x9A\xB4" => "", # U+E06B4 =>
"\xF3\xA0\x9A\xB5" => "", # U+E06B5 =>
"\xF3\xA0\x9A\xB6" => "", # U+E06B6 =>
"\xF3\xA0\x9A\xB7" => "", # U+E06B7 =>
"\xF3\xA0\x9A\xB8" => "", # U+E06B8 =>
"\xF3\xA0\x9A\xB9" => "", # U+E06B9 =>
"\xF3\xA0\x9A\xBA" => "", # U+E06BA =>
"\xF3\xA0\x9A\xBB" => "", # U+E06BB =>
"\xF3\xA0\x9A\xBC" => "", # U+E06BC =>
"\xF3\xA0\x9A\xBD" => "", # U+E06BD =>
"\xF3\xA0\x9A\xBE" => "", # U+E06BE =>
"\xF3\xA0\x9A\xBF" => "", # U+E06BF =>
"\xF3\xA0\x9B\x80" => "", # U+E06C0 =>
"\xF3\xA0\x9B\x81" => "", # U+E06C1 =>
"\xF3\xA0\x9B\x82" => "", # U+E06C2 =>
"\xF3\xA0\x9B\x83" => "", # U+E06C3 =>
"\xF3\xA0\x9B\x84" => "", # U+E06C4 =>
"\xF3\xA0\x9B\x85" => "", # U+E06C5 =>
"\xF3\xA0\x9B\x86" => "", # U+E06C6 =>
"\xF3\xA0\x9B\x87" => "", # U+E06C7 =>
"\xF3\xA0\x9B\x88" => "", # U+E06C8 =>
"\xF3\xA0\x9B\x89" => "", # U+E06C9 =>
"\xF3\xA0\x9B\x8A" => "", # U+E06CA =>
"\xF3\xA0\x9B\x8B" => "", # U+E06CB =>
"\xF3\xA0\x9B\x8C" => "", # U+E06CC =>
"\xF3\xA0\x9B\x8D" => "", # U+E06CD =>
"\xF3\xA0\x9B\x8E" => "", # U+E06CE =>
"\xF3\xA0\x9B\x8F" => "", # U+E06CF =>
"\xF3\xA0\x9B\x90" => "", # U+E06D0 =>
"\xF3\xA0\x9B\x91" => "", # U+E06D1 =>
"\xF3\xA0\x9B\x92" => "", # U+E06D2 =>
"\xF3\xA0\x9B\x93" => "", # U+E06D3 =>
"\xF3\xA0\x9B\x94" => "", # U+E06D4 =>
"\xF3\xA0\x9B\x95" => "", # U+E06D5 =>
"\xF3\xA0\x9B\x96" => "", # U+E06D6 =>
"\xF3\xA0\x9B\x97" => "", # U+E06D7 =>
"\xF3\xA0\x9B\x98" => "", # U+E06D8 =>
"\xF3\xA0\x9B\x99" => "", # U+E06D9 =>
"\xF3\xA0\x9B\x9A" => "", # U+E06DA =>
"\xF3\xA0\x9B\x9B" => "", # U+E06DB =>
"\xF3\xA0\x9B\x9C" => "", # U+E06DC =>
"\xF3\xA0\x9B\x9D" => "", # U+E06DD =>
"\xF3\xA0\x9B\x9E" => "", # U+E06DE =>
"\xF3\xA0\x9B\x9F" => "", # U+E06DF =>
"\xF3\xA0\x9B\xA0" => "", # U+E06E0 =>
"\xF3\xA0\x9B\xA1" => "", # U+E06E1 =>
"\xF3\xA0\x9B\xA2" => "", # U+E06E2 =>
"\xF3\xA0\x9B\xA3" => "", # U+E06E3 =>
"\xF3\xA0\x9B\xA4" => "", # U+E06E4 =>
"\xF3\xA0\x9B\xA5" => "", # U+E06E5 =>
"\xF3\xA0\x9B\xA6" => "", # U+E06E6 =>
"\xF3\xA0\x9B\xA7" => "", # U+E06E7 =>
"\xF3\xA0\x9B\xA8" => "", # U+E06E8 =>
"\xF3\xA0\x9B\xA9" => "", # U+E06E9 =>
"\xF3\xA0\x9B\xAA" => "", # U+E06EA =>
"\xF3\xA0\x9B\xAB" => "", # U+E06EB =>
"\xF3\xA0\x9B\xAC" => "", # U+E06EC =>
"\xF3\xA0\x9B\xAD" => "", # U+E06ED =>
"\xF3\xA0\x9B\xAE" => "", # U+E06EE =>
"\xF3\xA0\x9B\xAF" => "", # U+E06EF =>
"\xF3\xA0\x9B\xB0" => "", # U+E06F0 =>
"\xF3\xA0\x9B\xB1" => "", # U+E06F1 =>
"\xF3\xA0\x9B\xB2" => "", # U+E06F2 =>
"\xF3\xA0\x9B\xB3" => "", # U+E06F3 =>
"\xF3\xA0\x9B\xB4" => "", # U+E06F4 =>
"\xF3\xA0\x9B\xB5" => "", # U+E06F5 =>
"\xF3\xA0\x9B\xB6" => "", # U+E06F6 =>
"\xF3\xA0\x9B\xB7" => "", # U+E06F7 =>
"\xF3\xA0\x9B\xB8" => "", # U+E06F8 =>
"\xF3\xA0\x9B\xB9" => "", # U+E06F9 =>
"\xF3\xA0\x9B\xBA" => "", # U+E06FA =>
"\xF3\xA0\x9B\xBB" => "", # U+E06FB =>
"\xF3\xA0\x9B\xBC" => "", # U+E06FC =>
"\xF3\xA0\x9B\xBD" => "", # U+E06FD =>
"\xF3\xA0\x9B\xBE" => "", # U+E06FE =>
"\xF3\xA0\x9B\xBF" => "", # U+E06FF =>
"\xF3\xA0\x9C\x80" => "", # U+E0700 =>
"\xF3\xA0\x9C\x81" => "", # U+E0701 =>
"\xF3\xA0\x9C\x82" => "", # U+E0702 =>
"\xF3\xA0\x9C\x83" => "", # U+E0703 =>
"\xF3\xA0\x9C\x84" => "", # U+E0704 =>
"\xF3\xA0\x9C\x85" => "", # U+E0705 =>
"\xF3\xA0\x9C\x86" => "", # U+E0706 =>
"\xF3\xA0\x9C\x87" => "", # U+E0707 =>
"\xF3\xA0\x9C\x88" => "", # U+E0708 =>
"\xF3\xA0\x9C\x89" => "", # U+E0709 =>
"\xF3\xA0\x9C\x8A" => "", # U+E070A =>
"\xF3\xA0\x9C\x8B" => "", # U+E070B =>
"\xF3\xA0\x9C\x8C" => "", # U+E070C =>
"\xF3\xA0\x9C\x8D" => "", # U+E070D =>
"\xF3\xA0\x9C\x8E" => "", # U+E070E =>
"\xF3\xA0\x9C\x8F" => "", # U+E070F =>
"\xF3\xA0\x9C\x90" => "", # U+E0710 =>
"\xF3\xA0\x9C\x91" => "", # U+E0711 =>
"\xF3\xA0\x9C\x92" => "", # U+E0712 =>
"\xF3\xA0\x9C\x93" => "", # U+E0713 =>
"\xF3\xA0\x9C\x94" => "", # U+E0714 =>
"\xF3\xA0\x9C\x95" => "", # U+E0715 =>
"\xF3\xA0\x9C\x96" => "", # U+E0716 =>
"\xF3\xA0\x9C\x97" => "", # U+E0717 =>
"\xF3\xA0\x9C\x98" => "", # U+E0718 =>
"\xF3\xA0\x9C\x99" => "", # U+E0719 =>
"\xF3\xA0\x9C\x9A" => "", # U+E071A =>
"\xF3\xA0\x9C\x9B" => "", # U+E071B =>
"\xF3\xA0\x9C\x9C" => "", # U+E071C =>
"\xF3\xA0\x9C\x9D" => "", # U+E071D =>
"\xF3\xA0\x9C\x9E" => "", # U+E071E =>
"\xF3\xA0\x9C\x9F" => "", # U+E071F =>
"\xF3\xA0\x9C\xA0" => "", # U+E0720 =>
"\xF3\xA0\x9C\xA1" => "", # U+E0721 =>
"\xF3\xA0\x9C\xA2" => "", # U+E0722 =>
"\xF3\xA0\x9C\xA3" => "", # U+E0723 =>
"\xF3\xA0\x9C\xA4" => "", # U+E0724 =>
"\xF3\xA0\x9C\xA5" => "", # U+E0725 =>
"\xF3\xA0\x9C\xA6" => "", # U+E0726 =>
"\xF3\xA0\x9C\xA7" => "", # U+E0727 =>
"\xF3\xA0\x9C\xA8" => "", # U+E0728 =>
"\xF3\xA0\x9C\xA9" => "", # U+E0729 =>
"\xF3\xA0\x9C\xAA" => "", # U+E072A =>
"\xF3\xA0\x9C\xAB" => "", # U+E072B =>
"\xF3\xA0\x9C\xAC" => "", # U+E072C =>
"\xF3\xA0\x9C\xAD" => "", # U+E072D =>
"\xF3\xA0\x9C\xAE" => "", # U+E072E =>
"\xF3\xA0\x9C\xAF" => "", # U+E072F =>
"\xF3\xA0\x9C\xB0" => "", # U+E0730 =>
"\xF3\xA0\x9C\xB1" => "", # U+E0731 =>
"\xF3\xA0\x9C\xB2" => "", # U+E0732 =>
"\xF3\xA0\x9C\xB3" => "", # U+E0733 =>
"\xF3\xA0\x9C\xB4" => "", # U+E0734 =>
"\xF3\xA0\x9C\xB5" => "", # U+E0735 =>
"\xF3\xA0\x9C\xB6" => "", # U+E0736 =>
"\xF3\xA0\x9C\xB7" => "", # U+E0737 =>
"\xF3\xA0\x9C\xB8" => "", # U+E0738 =>
"\xF3\xA0\x9C\xB9" => "", # U+E0739 =>
"\xF3\xA0\x9C\xBA" => "", # U+E073A =>
"\xF3\xA0\x9C\xBB" => "", # U+E073B =>
"\xF3\xA0\x9C\xBC" => "", # U+E073C =>
"\xF3\xA0\x9C\xBD" => "", # U+E073D =>
"\xF3\xA0\x9C\xBE" => "", # U+E073E =>
"\xF3\xA0\x9C\xBF" => "", # U+E073F =>
"\xF3\xA0\x9D\x80" => "", # U+E0740 =>
"\xF3\xA0\x9D\x81" => "", # U+E0741 =>
"\xF3\xA0\x9D\x82" => "", # U+E0742 =>
"\xF3\xA0\x9D\x83" => "", # U+E0743 =>
"\xF3\xA0\x9D\x84" => "", # U+E0744 =>
"\xF3\xA0\x9D\x85" => "", # U+E0745 =>
"\xF3\xA0\x9D\x86" => "", # U+E0746 =>
"\xF3\xA0\x9D\x87" => "", # U+E0747 =>
"\xF3\xA0\x9D\x88" => "", # U+E0748 =>
"\xF3\xA0\x9D\x89" => "", # U+E0749 =>
"\xF3\xA0\x9D\x8A" => "", # U+E074A =>
"\xF3\xA0\x9D\x8B" => "", # U+E074B =>
"\xF3\xA0\x9D\x8C" => "", # U+E074C =>
"\xF3\xA0\x9D\x8D" => "", # U+E074D =>
"\xF3\xA0\x9D\x8E" => "", # U+E074E =>
"\xF3\xA0\x9D\x8F" => "", # U+E074F =>
"\xF3\xA0\x9D\x90" => "", # U+E0750 =>
"\xF3\xA0\x9D\x91" => "", # U+E0751 =>
"\xF3\xA0\x9D\x92" => "", # U+E0752 =>
"\xF3\xA0\x9D\x93" => "", # U+E0753 =>
"\xF3\xA0\x9D\x94" => "", # U+E0754 =>
"\xF3\xA0\x9D\x95" => "", # U+E0755 =>
"\xF3\xA0\x9D\x96" => "", # U+E0756 =>
"\xF3\xA0\x9D\x97" => "", # U+E0757 =>
"\xF3\xA0\x9D\x98" => "", # U+E0758 =>
"\xF3\xA0\x9D\x99" => "", # U+E0759 =>
"\xF3\xA0\x9D\x9A" => "", # U+E075A =>
"\xF3\xA0\x9D\x9B" => "", # U+E075B =>
"\xF3\xA0\x9D\x9C" => "", # U+E075C =>
"\xF3\xA0\x9D\x9D" => "", # U+E075D =>
"\xF3\xA0\x9D\x9E" => "", # U+E075E =>
"\xF3\xA0\x9D\x9F" => "", # U+E075F =>
"\xF3\xA0\x9D\xA0" => "", # U+E0760 =>
"\xF3\xA0\x9D\xA1" => "", # U+E0761 =>
"\xF3\xA0\x9D\xA2" => "", # U+E0762 =>
"\xF3\xA0\x9D\xA3" => "", # U+E0763 =>
"\xF3\xA0\x9D\xA4" => "", # U+E0764 =>
"\xF3\xA0\x9D\xA5" => "", # U+E0765 =>
"\xF3\xA0\x9D\xA6" => "", # U+E0766 =>
"\xF3\xA0\x9D\xA7" => "", # U+E0767 =>
"\xF3\xA0\x9D\xA8" => "", # U+E0768 =>
"\xF3\xA0\x9D\xA9" => "", # U+E0769 =>
"\xF3\xA0\x9D\xAA" => "", # U+E076A =>
"\xF3\xA0\x9D\xAB" => "", # U+E076B =>
"\xF3\xA0\x9D\xAC" => "", # U+E076C =>
"\xF3\xA0\x9D\xAD" => "", # U+E076D =>
"\xF3\xA0\x9D\xAE" => "", # U+E076E =>
"\xF3\xA0\x9D\xAF" => "", # U+E076F =>
"\xF3\xA0\x9D\xB0" => "", # U+E0770 =>
"\xF3\xA0\x9D\xB1" => "", # U+E0771 =>
"\xF3\xA0\x9D\xB2" => "", # U+E0772 =>
"\xF3\xA0\x9D\xB3" => "", # U+E0773 =>
"\xF3\xA0\x9D\xB4" => "", # U+E0774 =>
"\xF3\xA0\x9D\xB5" => "", # U+E0775 =>
"\xF3\xA0\x9D\xB6" => "", # U+E0776 =>
"\xF3\xA0\x9D\xB7" => "", # U+E0777 =>
"\xF3\xA0\x9D\xB8" => "", # U+E0778 =>
"\xF3\xA0\x9D\xB9" => "", # U+E0779 =>
"\xF3\xA0\x9D\xBA" => "", # U+E077A =>
"\xF3\xA0\x9D\xBB" => "", # U+E077B =>
"\xF3\xA0\x9D\xBC" => "", # U+E077C =>
"\xF3\xA0\x9D\xBD" => "", # U+E077D =>
"\xF3\xA0\x9D\xBE" => "", # U+E077E =>
"\xF3\xA0\x9D\xBF" => "", # U+E077F =>
"\xF3\xA0\x9E\x80" => "", # U+E0780 =>
"\xF3\xA0\x9E\x81" => "", # U+E0781 =>
"\xF3\xA0\x9E\x82" => "", # U+E0782 =>
"\xF3\xA0\x9E\x83" => "", # U+E0783 =>
"\xF3\xA0\x9E\x84" => "", # U+E0784 =>
"\xF3\xA0\x9E\x85" => "", # U+E0785 =>
"\xF3\xA0\x9E\x86" => "", # U+E0786 =>
"\xF3\xA0\x9E\x87" => "", # U+E0787 =>
"\xF3\xA0\x9E\x88" => "", # U+E0788 =>
"\xF3\xA0\x9E\x89" => "", # U+E0789 =>
"\xF3\xA0\x9E\x8A" => "", # U+E078A =>
"\xF3\xA0\x9E\x8B" => "", # U+E078B =>
"\xF3\xA0\x9E\x8C" => "", # U+E078C =>
"\xF3\xA0\x9E\x8D" => "", # U+E078D =>
"\xF3\xA0\x9E\x8E" => "", # U+E078E =>
"\xF3\xA0\x9E\x8F" => "", # U+E078F =>
"\xF3\xA0\x9E\x90" => "", # U+E0790 =>
"\xF3\xA0\x9E\x91" => "", # U+E0791 =>
"\xF3\xA0\x9E\x92" => "", # U+E0792 =>
"\xF3\xA0\x9E\x93" => "", # U+E0793 =>
"\xF3\xA0\x9E\x94" => "", # U+E0794 =>
"\xF3\xA0\x9E\x95" => "", # U+E0795 =>
"\xF3\xA0\x9E\x96" => "", # U+E0796 =>
"\xF3\xA0\x9E\x97" => "", # U+E0797 =>
"\xF3\xA0\x9E\x98" => "", # U+E0798 =>
"\xF3\xA0\x9E\x99" => "", # U+E0799 =>
"\xF3\xA0\x9E\x9A" => "", # U+E079A =>
"\xF3\xA0\x9E\x9B" => "", # U+E079B =>
"\xF3\xA0\x9E\x9C" => "", # U+E079C =>
"\xF3\xA0\x9E\x9D" => "", # U+E079D =>
"\xF3\xA0\x9E\x9E" => "", # U+E079E =>
"\xF3\xA0\x9E\x9F" => "", # U+E079F =>
"\xF3\xA0\x9E\xA0" => "", # U+E07A0 =>
"\xF3\xA0\x9E\xA1" => "", # U+E07A1 =>
"\xF3\xA0\x9E\xA2" => "", # U+E07A2 =>
"\xF3\xA0\x9E\xA3" => "", # U+E07A3 =>
"\xF3\xA0\x9E\xA4" => "", # U+E07A4 =>
"\xF3\xA0\x9E\xA5" => "", # U+E07A5 =>
"\xF3\xA0\x9E\xA6" => "", # U+E07A6 =>
"\xF3\xA0\x9E\xA7" => "", # U+E07A7 =>
"\xF3\xA0\x9E\xA8" => "", # U+E07A8 =>
"\xF3\xA0\x9E\xA9" => "", # U+E07A9 =>
"\xF3\xA0\x9E\xAA" => "", # U+E07AA =>
"\xF3\xA0\x9E\xAB" => "", # U+E07AB =>
"\xF3\xA0\x9E\xAC" => "", # U+E07AC =>
"\xF3\xA0\x9E\xAD" => "", # U+E07AD =>
"\xF3\xA0\x9E\xAE" => "", # U+E07AE =>
"\xF3\xA0\x9E\xAF" => "", # U+E07AF =>
"\xF3\xA0\x9E\xB0" => "", # U+E07B0 =>
"\xF3\xA0\x9E\xB1" => "", # U+E07B1 =>
"\xF3\xA0\x9E\xB2" => "", # U+E07B2 =>
"\xF3\xA0\x9E\xB3" => "", # U+E07B3 =>
"\xF3\xA0\x9E\xB4" => "", # U+E07B4 =>
"\xF3\xA0\x9E\xB5" => "", # U+E07B5 =>
"\xF3\xA0\x9E\xB6" => "", # U+E07B6 =>
"\xF3\xA0\x9E\xB7" => "", # U+E07B7 =>
"\xF3\xA0\x9E\xB8" => "", # U+E07B8 =>
"\xF3\xA0\x9E\xB9" => "", # U+E07B9 =>
"\xF3\xA0\x9E\xBA" => "", # U+E07BA =>
"\xF3\xA0\x9E\xBB" => "", # U+E07BB =>
"\xF3\xA0\x9E\xBC" => "", # U+E07BC =>
"\xF3\xA0\x9E\xBD" => "", # U+E07BD =>
"\xF3\xA0\x9E\xBE" => "", # U+E07BE =>
"\xF3\xA0\x9E\xBF" => "", # U+E07BF =>
"\xF3\xA0\x9F\x80" => "", # U+E07C0 =>
"\xF3\xA0\x9F\x81" => "", # U+E07C1 =>
"\xF3\xA0\x9F\x82" => "", # U+E07C2 =>
"\xF3\xA0\x9F\x83" => "", # U+E07C3 =>
"\xF3\xA0\x9F\x84" => "", # U+E07C4 =>
"\xF3\xA0\x9F\x85" => "", # U+E07C5 =>
"\xF3\xA0\x9F\x86" => "", # U+E07C6 =>
"\xF3\xA0\x9F\x87" => "", # U+E07C7 =>
"\xF3\xA0\x9F\x88" => "", # U+E07C8 =>
"\xF3\xA0\x9F\x89" => "", # U+E07C9 =>
"\xF3\xA0\x9F\x8A" => "", # U+E07CA =>
"\xF3\xA0\x9F\x8B" => "", # U+E07CB =>
"\xF3\xA0\x9F\x8C" => "", # U+E07CC =>
"\xF3\xA0\x9F\x8D" => "", # U+E07CD =>
"\xF3\xA0\x9F\x8E" => "", # U+E07CE =>
"\xF3\xA0\x9F\x8F" => "", # U+E07CF =>
"\xF3\xA0\x9F\x90" => "", # U+E07D0 =>
"\xF3\xA0\x9F\x91" => "", # U+E07D1 =>
"\xF3\xA0\x9F\x92" => "", # U+E07D2 =>
"\xF3\xA0\x9F\x93" => "", # U+E07D3 =>
"\xF3\xA0\x9F\x94" => "", # U+E07D4 =>
"\xF3\xA0\x9F\x95" => "", # U+E07D5 =>
"\xF3\xA0\x9F\x96" => "", # U+E07D6 =>
"\xF3\xA0\x9F\x97" => "", # U+E07D7 =>
"\xF3\xA0\x9F\x98" => "", # U+E07D8 =>
"\xF3\xA0\x9F\x99" => "", # U+E07D9 =>
"\xF3\xA0\x9F\x9A" => "", # U+E07DA =>
"\xF3\xA0\x9F\x9B" => "", # U+E07DB =>
"\xF3\xA0\x9F\x9C" => "", # U+E07DC =>
"\xF3\xA0\x9F\x9D" => "", # U+E07DD =>
"\xF3\xA0\x9F\x9E" => "", # U+E07DE =>
"\xF3\xA0\x9F\x9F" => "", # U+E07DF =>
"\xF3\xA0\x9F\xA0" => "", # U+E07E0 =>
"\xF3\xA0\x9F\xA1" => "", # U+E07E1 =>
"\xF3\xA0\x9F\xA2" => "", # U+E07E2 =>
"\xF3\xA0\x9F\xA3" => "", # U+E07E3 =>
"\xF3\xA0\x9F\xA4" => "", # U+E07E4 =>
"\xF3\xA0\x9F\xA5" => "", # U+E07E5 =>
"\xF3\xA0\x9F\xA6" => "", # U+E07E6 =>
"\xF3\xA0\x9F\xA7" => "", # U+E07E7 =>
"\xF3\xA0\x9F\xA8" => "", # U+E07E8 =>
"\xF3\xA0\x9F\xA9" => "", # U+E07E9 =>
"\xF3\xA0\x9F\xAA" => "", # U+E07EA =>
"\xF3\xA0\x9F\xAB" => "", # U+E07EB =>
"\xF3\xA0\x9F\xAC" => "", # U+E07EC =>
"\xF3\xA0\x9F\xAD" => "", # U+E07ED =>
"\xF3\xA0\x9F\xAE" => "", # U+E07EE =>
"\xF3\xA0\x9F\xAF" => "", # U+E07EF =>
"\xF3\xA0\x9F\xB0" => "", # U+E07F0 =>
"\xF3\xA0\x9F\xB1" => "", # U+E07F1 =>
"\xF3\xA0\x9F\xB2" => "", # U+E07F2 =>
"\xF3\xA0\x9F\xB3" => "", # U+E07F3 =>
"\xF3\xA0\x9F\xB4" => "", # U+E07F4 =>
"\xF3\xA0\x9F\xB5" => "", # U+E07F5 =>
"\xF3\xA0\x9F\xB6" => "", # U+E07F6 =>
"\xF3\xA0\x9F\xB7" => "", # U+E07F7 =>
"\xF3\xA0\x9F\xB8" => "", # U+E07F8 =>
"\xF3\xA0\x9F\xB9" => "", # U+E07F9 =>
"\xF3\xA0\x9F\xBA" => "", # U+E07FA =>
"\xF3\xA0\x9F\xBB" => "", # U+E07FB =>
"\xF3\xA0\x9F\xBC" => "", # U+E07FC =>
"\xF3\xA0\x9F\xBD" => "", # U+E07FD =>
"\xF3\xA0\x9F\xBE" => "", # U+E07FE =>
"\xF3\xA0\x9F\xBF" => "", # U+E07FF =>
"\xF3\xA0\xA0\x80" => "", # U+E0800 =>
"\xF3\xA0\xA0\x81" => "", # U+E0801 =>
"\xF3\xA0\xA0\x82" => "", # U+E0802 =>
"\xF3\xA0\xA0\x83" => "", # U+E0803 =>
"\xF3\xA0\xA0\x84" => "", # U+E0804 =>
"\xF3\xA0\xA0\x85" => "", # U+E0805 =>
"\xF3\xA0\xA0\x86" => "", # U+E0806 =>
"\xF3\xA0\xA0\x87" => "", # U+E0807 =>
"\xF3\xA0\xA0\x88" => "", # U+E0808 =>
"\xF3\xA0\xA0\x89" => "", # U+E0809 =>
"\xF3\xA0\xA0\x8A" => "", # U+E080A =>
"\xF3\xA0\xA0\x8B" => "", # U+E080B =>
"\xF3\xA0\xA0\x8C" => "", # U+E080C =>
"\xF3\xA0\xA0\x8D" => "", # U+E080D =>
"\xF3\xA0\xA0\x8E" => "", # U+E080E =>
"\xF3\xA0\xA0\x8F" => "", # U+E080F =>
"\xF3\xA0\xA0\x90" => "", # U+E0810 =>
"\xF3\xA0\xA0\x91" => "", # U+E0811 =>
"\xF3\xA0\xA0\x92" => "", # U+E0812 =>
"\xF3\xA0\xA0\x93" => "", # U+E0813 =>
"\xF3\xA0\xA0\x94" => "", # U+E0814 =>
"\xF3\xA0\xA0\x95" => "", # U+E0815 =>
"\xF3\xA0\xA0\x96" => "", # U+E0816 =>
"\xF3\xA0\xA0\x97" => "", # U+E0817 =>
"\xF3\xA0\xA0\x98" => "", # U+E0818 =>
"\xF3\xA0\xA0\x99" => "", # U+E0819 =>
"\xF3\xA0\xA0\x9A" => "", # U+E081A =>
"\xF3\xA0\xA0\x9B" => "", # U+E081B =>
"\xF3\xA0\xA0\x9C" => "", # U+E081C =>
"\xF3\xA0\xA0\x9D" => "", # U+E081D =>
"\xF3\xA0\xA0\x9E" => "", # U+E081E =>
"\xF3\xA0\xA0\x9F" => "", # U+E081F =>
"\xF3\xA0\xA0\xA0" => "", # U+E0820 =>
"\xF3\xA0\xA0\xA1" => "", # U+E0821 =>
"\xF3\xA0\xA0\xA2" => "", # U+E0822 =>
"\xF3\xA0\xA0\xA3" => "", # U+E0823 =>
"\xF3\xA0\xA0\xA4" => "", # U+E0824 =>
"\xF3\xA0\xA0\xA5" => "", # U+E0825 =>
"\xF3\xA0\xA0\xA6" => "", # U+E0826 =>
"\xF3\xA0\xA0\xA7" => "", # U+E0827 =>
"\xF3\xA0\xA0\xA8" => "", # U+E0828 =>
"\xF3\xA0\xA0\xA9" => "", # U+E0829 =>
"\xF3\xA0\xA0\xAA" => "", # U+E082A =>
"\xF3\xA0\xA0\xAB" => "", # U+E082B =>
"\xF3\xA0\xA0\xAC" => "", # U+E082C =>
"\xF3\xA0\xA0\xAD" => "", # U+E082D =>
"\xF3\xA0\xA0\xAE" => "", # U+E082E =>
"\xF3\xA0\xA0\xAF" => "", # U+E082F =>
"\xF3\xA0\xA0\xB0" => "", # U+E0830 =>
"\xF3\xA0\xA0\xB1" => "", # U+E0831 =>
"\xF3\xA0\xA0\xB2" => "", # U+E0832 =>
"\xF3\xA0\xA0\xB3" => "", # U+E0833 =>
"\xF3\xA0\xA0\xB4" => "", # U+E0834 =>
"\xF3\xA0\xA0\xB5" => "", # U+E0835 =>
"\xF3\xA0\xA0\xB6" => "", # U+E0836 =>
"\xF3\xA0\xA0\xB7" => "", # U+E0837 =>
"\xF3\xA0\xA0\xB8" => "", # U+E0838 =>
"\xF3\xA0\xA0\xB9" => "", # U+E0839 =>
"\xF3\xA0\xA0\xBA" => "", # U+E083A =>
"\xF3\xA0\xA0\xBB" => "", # U+E083B =>
"\xF3\xA0\xA0\xBC" => "", # U+E083C =>
"\xF3\xA0\xA0\xBD" => "", # U+E083D =>
"\xF3\xA0\xA0\xBE" => "", # U+E083E =>
"\xF3\xA0\xA0\xBF" => "", # U+E083F =>
"\xF3\xA0\xA1\x80" => "", # U+E0840 =>
"\xF3\xA0\xA1\x81" => "", # U+E0841 =>
"\xF3\xA0\xA1\x82" => "", # U+E0842 =>
"\xF3\xA0\xA1\x83" => "", # U+E0843 =>
"\xF3\xA0\xA1\x84" => "", # U+E0844 =>
"\xF3\xA0\xA1\x85" => "", # U+E0845 =>
"\xF3\xA0\xA1\x86" => "", # U+E0846 =>
"\xF3\xA0\xA1\x87" => "", # U+E0847 =>
"\xF3\xA0\xA1\x88" => "", # U+E0848 =>
"\xF3\xA0\xA1\x89" => "", # U+E0849 =>
"\xF3\xA0\xA1\x8A" => "", # U+E084A =>
"\xF3\xA0\xA1\x8B" => "", # U+E084B =>
"\xF3\xA0\xA1\x8C" => "", # U+E084C =>
"\xF3\xA0\xA1\x8D" => "", # U+E084D =>
"\xF3\xA0\xA1\x8E" => "", # U+E084E =>
"\xF3\xA0\xA1\x8F" => "", # U+E084F =>
"\xF3\xA0\xA1\x90" => "", # U+E0850 =>
"\xF3\xA0\xA1\x91" => "", # U+E0851 =>
"\xF3\xA0\xA1\x92" => "", # U+E0852 =>
"\xF3\xA0\xA1\x93" => "", # U+E0853 =>
"\xF3\xA0\xA1\x94" => "", # U+E0854 =>
"\xF3\xA0\xA1\x95" => "", # U+E0855 =>
"\xF3\xA0\xA1\x96" => "", # U+E0856 =>
"\xF3\xA0\xA1\x97" => "", # U+E0857 =>
"\xF3\xA0\xA1\x98" => "", # U+E0858 =>
"\xF3\xA0\xA1\x99" => "", # U+E0859 =>
"\xF3\xA0\xA1\x9A" => "", # U+E085A =>
"\xF3\xA0\xA1\x9B" => "", # U+E085B =>
"\xF3\xA0\xA1\x9C" => "", # U+E085C =>
"\xF3\xA0\xA1\x9D" => "", # U+E085D =>
"\xF3\xA0\xA1\x9E" => "", # U+E085E =>
"\xF3\xA0\xA1\x9F" => "", # U+E085F =>
"\xF3\xA0\xA1\xA0" => "", # U+E0860 =>
"\xF3\xA0\xA1\xA1" => "", # U+E0861 =>
"\xF3\xA0\xA1\xA2" => "", # U+E0862 =>
"\xF3\xA0\xA1\xA3" => "", # U+E0863 =>
"\xF3\xA0\xA1\xA4" => "", # U+E0864 =>
"\xF3\xA0\xA1\xA5" => "", # U+E0865 =>
"\xF3\xA0\xA1\xA6" => "", # U+E0866 =>
"\xF3\xA0\xA1\xA7" => "", # U+E0867 =>
"\xF3\xA0\xA1\xA8" => "", # U+E0868 =>
"\xF3\xA0\xA1\xA9" => "", # U+E0869 =>
"\xF3\xA0\xA1\xAA" => "", # U+E086A =>
"\xF3\xA0\xA1\xAB" => "", # U+E086B =>
"\xF3\xA0\xA1\xAC" => "", # U+E086C =>
"\xF3\xA0\xA1\xAD" => "", # U+E086D =>
"\xF3\xA0\xA1\xAE" => "", # U+E086E =>
"\xF3\xA0\xA1\xAF" => "", # U+E086F =>
"\xF3\xA0\xA1\xB0" => "", # U+E0870 =>
"\xF3\xA0\xA1\xB1" => "", # U+E0871 =>
"\xF3\xA0\xA1\xB2" => "", # U+E0872 =>
"\xF3\xA0\xA1\xB3" => "", # U+E0873 =>
"\xF3\xA0\xA1\xB4" => "", # U+E0874 =>
"\xF3\xA0\xA1\xB5" => "", # U+E0875 =>
"\xF3\xA0\xA1\xB6" => "", # U+E0876 =>
"\xF3\xA0\xA1\xB7" => "", # U+E0877 =>
"\xF3\xA0\xA1\xB8" => "", # U+E0878 =>
"\xF3\xA0\xA1\xB9" => "", # U+E0879 =>
"\xF3\xA0\xA1\xBA" => "", # U+E087A =>
"\xF3\xA0\xA1\xBB" => "", # U+E087B =>
"\xF3\xA0\xA1\xBC" => "", # U+E087C =>
"\xF3\xA0\xA1\xBD" => "", # U+E087D =>
"\xF3\xA0\xA1\xBE" => "", # U+E087E =>
"\xF3\xA0\xA1\xBF" => "", # U+E087F =>
"\xF3\xA0\xA2\x80" => "", # U+E0880 =>
"\xF3\xA0\xA2\x81" => "", # U+E0881 =>
"\xF3\xA0\xA2\x82" => "", # U+E0882 =>
"\xF3\xA0\xA2\x83" => "", # U+E0883 =>
"\xF3\xA0\xA2\x84" => "", # U+E0884 =>
"\xF3\xA0\xA2\x85" => "", # U+E0885 =>
"\xF3\xA0\xA2\x86" => "", # U+E0886 =>
"\xF3\xA0\xA2\x87" => "", # U+E0887 =>
"\xF3\xA0\xA2\x88" => "", # U+E0888 =>
"\xF3\xA0\xA2\x89" => "", # U+E0889 =>
"\xF3\xA0\xA2\x8A" => "", # U+E088A =>
"\xF3\xA0\xA2\x8B" => "", # U+E088B =>
"\xF3\xA0\xA2\x8C" => "", # U+E088C =>
"\xF3\xA0\xA2\x8D" => "", # U+E088D =>
"\xF3\xA0\xA2\x8E" => "", # U+E088E =>
"\xF3\xA0\xA2\x8F" => "", # U+E088F =>
"\xF3\xA0\xA2\x90" => "", # U+E0890 =>
"\xF3\xA0\xA2\x91" => "", # U+E0891 =>
"\xF3\xA0\xA2\x92" => "", # U+E0892 =>
"\xF3\xA0\xA2\x93" => "", # U+E0893 =>
"\xF3\xA0\xA2\x94" => "", # U+E0894 =>
"\xF3\xA0\xA2\x95" => "", # U+E0895 =>
"\xF3\xA0\xA2\x96" => "", # U+E0896 =>
"\xF3\xA0\xA2\x97" => "", # U+E0897 =>
"\xF3\xA0\xA2\x98" => "", # U+E0898 =>
"\xF3\xA0\xA2\x99" => "", # U+E0899 =>
"\xF3\xA0\xA2\x9A" => "", # U+E089A =>
"\xF3\xA0\xA2\x9B" => "", # U+E089B =>
"\xF3\xA0\xA2\x9C" => "", # U+E089C =>
"\xF3\xA0\xA2\x9D" => "", # U+E089D =>
"\xF3\xA0\xA2\x9E" => "", # U+E089E =>
"\xF3\xA0\xA2\x9F" => "", # U+E089F =>
"\xF3\xA0\xA2\xA0" => "", # U+E08A0 =>
"\xF3\xA0\xA2\xA1" => "", # U+E08A1 =>
"\xF3\xA0\xA2\xA2" => "", # U+E08A2 =>
"\xF3\xA0\xA2\xA3" => "", # U+E08A3 =>
"\xF3\xA0\xA2\xA4" => "", # U+E08A4 =>
"\xF3\xA0\xA2\xA5" => "", # U+E08A5 =>
"\xF3\xA0\xA2\xA6" => "", # U+E08A6 =>
"\xF3\xA0\xA2\xA7" => "", # U+E08A7 =>
"\xF3\xA0\xA2\xA8" => "", # U+E08A8 =>
"\xF3\xA0\xA2\xA9" => "", # U+E08A9 =>
"\xF3\xA0\xA2\xAA" => "", # U+E08AA =>
"\xF3\xA0\xA2\xAB" => "", # U+E08AB =>
"\xF3\xA0\xA2\xAC" => "", # U+E08AC =>
"\xF3\xA0\xA2\xAD" => "", # U+E08AD =>
"\xF3\xA0\xA2\xAE" => "", # U+E08AE =>
"\xF3\xA0\xA2\xAF" => "", # U+E08AF =>
"\xF3\xA0\xA2\xB0" => "", # U+E08B0 =>
"\xF3\xA0\xA2\xB1" => "", # U+E08B1 =>
"\xF3\xA0\xA2\xB2" => "", # U+E08B2 =>
"\xF3\xA0\xA2\xB3" => "", # U+E08B3 =>
"\xF3\xA0\xA2\xB4" => "", # U+E08B4 =>
"\xF3\xA0\xA2\xB5" => "", # U+E08B5 =>
"\xF3\xA0\xA2\xB6" => "", # U+E08B6 =>
"\xF3\xA0\xA2\xB7" => "", # U+E08B7 =>
"\xF3\xA0\xA2\xB8" => "", # U+E08B8 =>
"\xF3\xA0\xA2\xB9" => "", # U+E08B9 =>
"\xF3\xA0\xA2\xBA" => "", # U+E08BA =>
"\xF3\xA0\xA2\xBB" => "", # U+E08BB =>
"\xF3\xA0\xA2\xBC" => "", # U+E08BC =>
"\xF3\xA0\xA2\xBD" => "", # U+E08BD =>
"\xF3\xA0\xA2\xBE" => "", # U+E08BE =>
"\xF3\xA0\xA2\xBF" => "", # U+E08BF =>
"\xF3\xA0\xA3\x80" => "", # U+E08C0 =>
"\xF3\xA0\xA3\x81" => "", # U+E08C1 =>
"\xF3\xA0\xA3\x82" => "", # U+E08C2 =>
"\xF3\xA0\xA3\x83" => "", # U+E08C3 =>
"\xF3\xA0\xA3\x84" => "", # U+E08C4 =>
"\xF3\xA0\xA3\x85" => "", # U+E08C5 =>
"\xF3\xA0\xA3\x86" => "", # U+E08C6 =>
"\xF3\xA0\xA3\x87" => "", # U+E08C7 =>
"\xF3\xA0\xA3\x88" => "", # U+E08C8 =>
"\xF3\xA0\xA3\x89" => "", # U+E08C9 =>
"\xF3\xA0\xA3\x8A" => "", # U+E08CA =>
"\xF3\xA0\xA3\x8B" => "", # U+E08CB =>
"\xF3\xA0\xA3\x8C" => "", # U+E08CC =>
"\xF3\xA0\xA3\x8D" => "", # U+E08CD =>
"\xF3\xA0\xA3\x8E" => "", # U+E08CE =>
"\xF3\xA0\xA3\x8F" => "", # U+E08CF =>
"\xF3\xA0\xA3\x90" => "", # U+E08D0 =>
"\xF3\xA0\xA3\x91" => "", # U+E08D1 =>
"\xF3\xA0\xA3\x92" => "", # U+E08D2 =>
"\xF3\xA0\xA3\x93" => "", # U+E08D3 =>
"\xF3\xA0\xA3\x94" => "", # U+E08D4 =>
"\xF3\xA0\xA3\x95" => "", # U+E08D5 =>
"\xF3\xA0\xA3\x96" => "", # U+E08D6 =>
"\xF3\xA0\xA3\x97" => "", # U+E08D7 =>
"\xF3\xA0\xA3\x98" => "", # U+E08D8 =>
"\xF3\xA0\xA3\x99" => "", # U+E08D9 =>
"\xF3\xA0\xA3\x9A" => "", # U+E08DA =>
"\xF3\xA0\xA3\x9B" => "", # U+E08DB =>
"\xF3\xA0\xA3\x9C" => "", # U+E08DC =>
"\xF3\xA0\xA3\x9D" => "", # U+E08DD =>
"\xF3\xA0\xA3\x9E" => "", # U+E08DE =>
"\xF3\xA0\xA3\x9F" => "", # U+E08DF =>
"\xF3\xA0\xA3\xA0" => "", # U+E08E0 =>
"\xF3\xA0\xA3\xA1" => "", # U+E08E1 =>
"\xF3\xA0\xA3\xA2" => "", # U+E08E2 =>
"\xF3\xA0\xA3\xA3" => "", # U+E08E3 =>
"\xF3\xA0\xA3\xA4" => "", # U+E08E4 =>
"\xF3\xA0\xA3\xA5" => "", # U+E08E5 =>
"\xF3\xA0\xA3\xA6" => "", # U+E08E6 =>
"\xF3\xA0\xA3\xA7" => "", # U+E08E7 =>
"\xF3\xA0\xA3\xA8" => "", # U+E08E8 =>
"\xF3\xA0\xA3\xA9" => "", # U+E08E9 =>
"\xF3\xA0\xA3\xAA" => "", # U+E08EA =>
"\xF3\xA0\xA3\xAB" => "", # U+E08EB =>
"\xF3\xA0\xA3\xAC" => "", # U+E08EC =>
"\xF3\xA0\xA3\xAD" => "", # U+E08ED =>
"\xF3\xA0\xA3\xAE" => "", # U+E08EE =>
"\xF3\xA0\xA3\xAF" => "", # U+E08EF =>
"\xF3\xA0\xA3\xB0" => "", # U+E08F0 =>
"\xF3\xA0\xA3\xB1" => "", # U+E08F1 =>
"\xF3\xA0\xA3\xB2" => "", # U+E08F2 =>
"\xF3\xA0\xA3\xB3" => "", # U+E08F3 =>
"\xF3\xA0\xA3\xB4" => "", # U+E08F4 =>
"\xF3\xA0\xA3\xB5" => "", # U+E08F5 =>
"\xF3\xA0\xA3\xB6" => "", # U+E08F6 =>
"\xF3\xA0\xA3\xB7" => "", # U+E08F7 =>
"\xF3\xA0\xA3\xB8" => "", # U+E08F8 =>
"\xF3\xA0\xA3\xB9" => "", # U+E08F9 =>
"\xF3\xA0\xA3\xBA" => "", # U+E08FA =>
"\xF3\xA0\xA3\xBB" => "", # U+E08FB =>
"\xF3\xA0\xA3\xBC" => "", # U+E08FC =>
"\xF3\xA0\xA3\xBD" => "", # U+E08FD =>
"\xF3\xA0\xA3\xBE" => "", # U+E08FE =>
"\xF3\xA0\xA3\xBF" => "", # U+E08FF =>
"\xF3\xA0\xA4\x80" => "", # U+E0900 =>
"\xF3\xA0\xA4\x81" => "", # U+E0901 =>
"\xF3\xA0\xA4\x82" => "", # U+E0902 =>
"\xF3\xA0\xA4\x83" => "", # U+E0903 =>
"\xF3\xA0\xA4\x84" => "", # U+E0904 =>
"\xF3\xA0\xA4\x85" => "", # U+E0905 =>
"\xF3\xA0\xA4\x86" => "", # U+E0906 =>
"\xF3\xA0\xA4\x87" => "", # U+E0907 =>
"\xF3\xA0\xA4\x88" => "", # U+E0908 =>
"\xF3\xA0\xA4\x89" => "", # U+E0909 =>
"\xF3\xA0\xA4\x8A" => "", # U+E090A =>
"\xF3\xA0\xA4\x8B" => "", # U+E090B =>
"\xF3\xA0\xA4\x8C" => "", # U+E090C =>
"\xF3\xA0\xA4\x8D" => "", # U+E090D =>
"\xF3\xA0\xA4\x8E" => "", # U+E090E =>
"\xF3\xA0\xA4\x8F" => "", # U+E090F =>
"\xF3\xA0\xA4\x90" => "", # U+E0910 =>
"\xF3\xA0\xA4\x91" => "", # U+E0911 =>
"\xF3\xA0\xA4\x92" => "", # U+E0912 =>
"\xF3\xA0\xA4\x93" => "", # U+E0913 =>
"\xF3\xA0\xA4\x94" => "", # U+E0914 =>
"\xF3\xA0\xA4\x95" => "", # U+E0915 =>
"\xF3\xA0\xA4\x96" => "", # U+E0916 =>
"\xF3\xA0\xA4\x97" => "", # U+E0917 =>
"\xF3\xA0\xA4\x98" => "", # U+E0918 =>
"\xF3\xA0\xA4\x99" => "", # U+E0919 =>
"\xF3\xA0\xA4\x9A" => "", # U+E091A =>
"\xF3\xA0\xA4\x9B" => "", # U+E091B =>
"\xF3\xA0\xA4\x9C" => "", # U+E091C =>
"\xF3\xA0\xA4\x9D" => "", # U+E091D =>
"\xF3\xA0\xA4\x9E" => "", # U+E091E =>
"\xF3\xA0\xA4\x9F" => "", # U+E091F =>
"\xF3\xA0\xA4\xA0" => "", # U+E0920 =>
"\xF3\xA0\xA4\xA1" => "", # U+E0921 =>
"\xF3\xA0\xA4\xA2" => "", # U+E0922 =>
"\xF3\xA0\xA4\xA3" => "", # U+E0923 =>
"\xF3\xA0\xA4\xA4" => "", # U+E0924 =>
"\xF3\xA0\xA4\xA5" => "", # U+E0925 =>
"\xF3\xA0\xA4\xA6" => "", # U+E0926 =>
"\xF3\xA0\xA4\xA7" => "", # U+E0927 =>
"\xF3\xA0\xA4\xA8" => "", # U+E0928 =>
"\xF3\xA0\xA4\xA9" => "", # U+E0929 =>
"\xF3\xA0\xA4\xAA" => "", # U+E092A =>
"\xF3\xA0\xA4\xAB" => "", # U+E092B =>
"\xF3\xA0\xA4\xAC" => "", # U+E092C =>
"\xF3\xA0\xA4\xAD" => "", # U+E092D =>
"\xF3\xA0\xA4\xAE" => "", # U+E092E =>
"\xF3\xA0\xA4\xAF" => "", # U+E092F =>
"\xF3\xA0\xA4\xB0" => "", # U+E0930 =>
"\xF3\xA0\xA4\xB1" => "", # U+E0931 =>
"\xF3\xA0\xA4\xB2" => "", # U+E0932 =>
"\xF3\xA0\xA4\xB3" => "", # U+E0933 =>
"\xF3\xA0\xA4\xB4" => "", # U+E0934 =>
"\xF3\xA0\xA4\xB5" => "", # U+E0935 =>
"\xF3\xA0\xA4\xB6" => "", # U+E0936 =>
"\xF3\xA0\xA4\xB7" => "", # U+E0937 =>
"\xF3\xA0\xA4\xB8" => "", # U+E0938 =>
"\xF3\xA0\xA4\xB9" => "", # U+E0939 =>
"\xF3\xA0\xA4\xBA" => "", # U+E093A =>
"\xF3\xA0\xA4\xBB" => "", # U+E093B =>
"\xF3\xA0\xA4\xBC" => "", # U+E093C =>
"\xF3\xA0\xA4\xBD" => "", # U+E093D =>
"\xF3\xA0\xA4\xBE" => "", # U+E093E =>
"\xF3\xA0\xA4\xBF" => "", # U+E093F =>
"\xF3\xA0\xA5\x80" => "", # U+E0940 =>
"\xF3\xA0\xA5\x81" => "", # U+E0941 =>
"\xF3\xA0\xA5\x82" => "", # U+E0942 =>
"\xF3\xA0\xA5\x83" => "", # U+E0943 =>
"\xF3\xA0\xA5\x84" => "", # U+E0944 =>
"\xF3\xA0\xA5\x85" => "", # U+E0945 =>
"\xF3\xA0\xA5\x86" => "", # U+E0946 =>
"\xF3\xA0\xA5\x87" => "", # U+E0947 =>
"\xF3\xA0\xA5\x88" => "", # U+E0948 =>
"\xF3\xA0\xA5\x89" => "", # U+E0949 =>
"\xF3\xA0\xA5\x8A" => "", # U+E094A =>
"\xF3\xA0\xA5\x8B" => "", # U+E094B =>
"\xF3\xA0\xA5\x8C" => "", # U+E094C =>
"\xF3\xA0\xA5\x8D" => "", # U+E094D =>
"\xF3\xA0\xA5\x8E" => "", # U+E094E =>
"\xF3\xA0\xA5\x8F" => "", # U+E094F =>
"\xF3\xA0\xA5\x90" => "", # U+E0950 =>
"\xF3\xA0\xA5\x91" => "", # U+E0951 =>
"\xF3\xA0\xA5\x92" => "", # U+E0952 =>
"\xF3\xA0\xA5\x93" => "", # U+E0953 =>
"\xF3\xA0\xA5\x94" => "", # U+E0954 =>
"\xF3\xA0\xA5\x95" => "", # U+E0955 =>
"\xF3\xA0\xA5\x96" => "", # U+E0956 =>
"\xF3\xA0\xA5\x97" => "", # U+E0957 =>
"\xF3\xA0\xA5\x98" => "", # U+E0958 =>
"\xF3\xA0\xA5\x99" => "", # U+E0959 =>
"\xF3\xA0\xA5\x9A" => "", # U+E095A =>
"\xF3\xA0\xA5\x9B" => "", # U+E095B =>
"\xF3\xA0\xA5\x9C" => "", # U+E095C =>
"\xF3\xA0\xA5\x9D" => "", # U+E095D =>
"\xF3\xA0\xA5\x9E" => "", # U+E095E =>
"\xF3\xA0\xA5\x9F" => "", # U+E095F =>
"\xF3\xA0\xA5\xA0" => "", # U+E0960 =>
"\xF3\xA0\xA5\xA1" => "", # U+E0961 =>
"\xF3\xA0\xA5\xA2" => "", # U+E0962 =>
"\xF3\xA0\xA5\xA3" => "", # U+E0963 =>
"\xF3\xA0\xA5\xA4" => "", # U+E0964 =>
"\xF3\xA0\xA5\xA5" => "", # U+E0965 =>
"\xF3\xA0\xA5\xA6" => "", # U+E0966 =>
"\xF3\xA0\xA5\xA7" => "", # U+E0967 =>
"\xF3\xA0\xA5\xA8" => "", # U+E0968 =>
"\xF3\xA0\xA5\xA9" => "", # U+E0969 =>
"\xF3\xA0\xA5\xAA" => "", # U+E096A =>
"\xF3\xA0\xA5\xAB" => "", # U+E096B =>
"\xF3\xA0\xA5\xAC" => "", # U+E096C =>
"\xF3\xA0\xA5\xAD" => "", # U+E096D =>
"\xF3\xA0\xA5\xAE" => "", # U+E096E =>
"\xF3\xA0\xA5\xAF" => "", # U+E096F =>
"\xF3\xA0\xA5\xB0" => "", # U+E0970 =>
"\xF3\xA0\xA5\xB1" => "", # U+E0971 =>
"\xF3\xA0\xA5\xB2" => "", # U+E0972 =>
"\xF3\xA0\xA5\xB3" => "", # U+E0973 =>
"\xF3\xA0\xA5\xB4" => "", # U+E0974 =>
"\xF3\xA0\xA5\xB5" => "", # U+E0975 =>
"\xF3\xA0\xA5\xB6" => "", # U+E0976 =>
"\xF3\xA0\xA5\xB7" => "", # U+E0977 =>
"\xF3\xA0\xA5\xB8" => "", # U+E0978 =>
"\xF3\xA0\xA5\xB9" => "", # U+E0979 =>
"\xF3\xA0\xA5\xBA" => "", # U+E097A =>
"\xF3\xA0\xA5\xBB" => "", # U+E097B =>
"\xF3\xA0\xA5\xBC" => "", # U+E097C =>
"\xF3\xA0\xA5\xBD" => "", # U+E097D =>
"\xF3\xA0\xA5\xBE" => "", # U+E097E =>
"\xF3\xA0\xA5\xBF" => "", # U+E097F =>
"\xF3\xA0\xA6\x80" => "", # U+E0980 =>
"\xF3\xA0\xA6\x81" => "", # U+E0981 =>
"\xF3\xA0\xA6\x82" => "", # U+E0982 =>
"\xF3\xA0\xA6\x83" => "", # U+E0983 =>
"\xF3\xA0\xA6\x84" => "", # U+E0984 =>
"\xF3\xA0\xA6\x85" => "", # U+E0985 =>
"\xF3\xA0\xA6\x86" => "", # U+E0986 =>
"\xF3\xA0\xA6\x87" => "", # U+E0987 =>
"\xF3\xA0\xA6\x88" => "", # U+E0988 =>
"\xF3\xA0\xA6\x89" => "", # U+E0989 =>
"\xF3\xA0\xA6\x8A" => "", # U+E098A =>
"\xF3\xA0\xA6\x8B" => "", # U+E098B =>
"\xF3\xA0\xA6\x8C" => "", # U+E098C =>
"\xF3\xA0\xA6\x8D" => "", # U+E098D =>
"\xF3\xA0\xA6\x8E" => "", # U+E098E =>
"\xF3\xA0\xA6\x8F" => "", # U+E098F =>
"\xF3\xA0\xA6\x90" => "", # U+E0990 =>
"\xF3\xA0\xA6\x91" => "", # U+E0991 =>
"\xF3\xA0\xA6\x92" => "", # U+E0992 =>
"\xF3\xA0\xA6\x93" => "", # U+E0993 =>
"\xF3\xA0\xA6\x94" => "", # U+E0994 =>
"\xF3\xA0\xA6\x95" => "", # U+E0995 =>
"\xF3\xA0\xA6\x96" => "", # U+E0996 =>
"\xF3\xA0\xA6\x97" => "", # U+E0997 =>
"\xF3\xA0\xA6\x98" => "", # U+E0998 =>
"\xF3\xA0\xA6\x99" => "", # U+E0999 =>
"\xF3\xA0\xA6\x9A" => "", # U+E099A =>
"\xF3\xA0\xA6\x9B" => "", # U+E099B =>
"\xF3\xA0\xA6\x9C" => "", # U+E099C =>
"\xF3\xA0\xA6\x9D" => "", # U+E099D =>
"\xF3\xA0\xA6\x9E" => "", # U+E099E =>
"\xF3\xA0\xA6\x9F" => "", # U+E099F =>
"\xF3\xA0\xA6\xA0" => "", # U+E09A0 =>
"\xF3\xA0\xA6\xA1" => "", # U+E09A1 =>
"\xF3\xA0\xA6\xA2" => "", # U+E09A2 =>
"\xF3\xA0\xA6\xA3" => "", # U+E09A3 =>
"\xF3\xA0\xA6\xA4" => "", # U+E09A4 =>
"\xF3\xA0\xA6\xA5" => "", # U+E09A5 =>
"\xF3\xA0\xA6\xA6" => "", # U+E09A6 =>
"\xF3\xA0\xA6\xA7" => "", # U+E09A7 =>
"\xF3\xA0\xA6\xA8" => "", # U+E09A8 =>
"\xF3\xA0\xA6\xA9" => "", # U+E09A9 =>
"\xF3\xA0\xA6\xAA" => "", # U+E09AA =>
"\xF3\xA0\xA6\xAB" => "", # U+E09AB =>
"\xF3\xA0\xA6\xAC" => "", # U+E09AC =>
"\xF3\xA0\xA6\xAD" => "", # U+E09AD =>
"\xF3\xA0\xA6\xAE" => "", # U+E09AE =>
"\xF3\xA0\xA6\xAF" => "", # U+E09AF =>
"\xF3\xA0\xA6\xB0" => "", # U+E09B0 =>
"\xF3\xA0\xA6\xB1" => "", # U+E09B1 =>
"\xF3\xA0\xA6\xB2" => "", # U+E09B2 =>
"\xF3\xA0\xA6\xB3" => "", # U+E09B3 =>
"\xF3\xA0\xA6\xB4" => "", # U+E09B4 =>
"\xF3\xA0\xA6\xB5" => "", # U+E09B5 =>
"\xF3\xA0\xA6\xB6" => "", # U+E09B6 =>
"\xF3\xA0\xA6\xB7" => "", # U+E09B7 =>
"\xF3\xA0\xA6\xB8" => "", # U+E09B8 =>
"\xF3\xA0\xA6\xB9" => "", # U+E09B9 =>
"\xF3\xA0\xA6\xBA" => "", # U+E09BA =>
"\xF3\xA0\xA6\xBB" => "", # U+E09BB =>
"\xF3\xA0\xA6\xBC" => "", # U+E09BC =>
"\xF3\xA0\xA6\xBD" => "", # U+E09BD =>
"\xF3\xA0\xA6\xBE" => "", # U+E09BE =>
"\xF3\xA0\xA6\xBF" => "", # U+E09BF =>
"\xF3\xA0\xA7\x80" => "", # U+E09C0 =>
"\xF3\xA0\xA7\x81" => "", # U+E09C1 =>
"\xF3\xA0\xA7\x82" => "", # U+E09C2 =>
"\xF3\xA0\xA7\x83" => "", # U+E09C3 =>
"\xF3\xA0\xA7\x84" => "", # U+E09C4 =>
"\xF3\xA0\xA7\x85" => "", # U+E09C5 =>
"\xF3\xA0\xA7\x86" => "", # U+E09C6 =>
"\xF3\xA0\xA7\x87" => "", # U+E09C7 =>
"\xF3\xA0\xA7\x88" => "", # U+E09C8 =>
"\xF3\xA0\xA7\x89" => "", # U+E09C9 =>
"\xF3\xA0\xA7\x8A" => "", # U+E09CA =>
"\xF3\xA0\xA7\x8B" => "", # U+E09CB =>
"\xF3\xA0\xA7\x8C" => "", # U+E09CC =>
"\xF3\xA0\xA7\x8D" => "", # U+E09CD =>
"\xF3\xA0\xA7\x8E" => "", # U+E09CE =>
"\xF3\xA0\xA7\x8F" => "", # U+E09CF =>
"\xF3\xA0\xA7\x90" => "", # U+E09D0 =>
"\xF3\xA0\xA7\x91" => "", # U+E09D1 =>
"\xF3\xA0\xA7\x92" => "", # U+E09D2 =>
"\xF3\xA0\xA7\x93" => "", # U+E09D3 =>
"\xF3\xA0\xA7\x94" => "", # U+E09D4 =>
"\xF3\xA0\xA7\x95" => "", # U+E09D5 =>
"\xF3\xA0\xA7\x96" => "", # U+E09D6 =>
"\xF3\xA0\xA7\x97" => "", # U+E09D7 =>
"\xF3\xA0\xA7\x98" => "", # U+E09D8 =>
"\xF3\xA0\xA7\x99" => "", # U+E09D9 =>
"\xF3\xA0\xA7\x9A" => "", # U+E09DA =>
"\xF3\xA0\xA7\x9B" => "", # U+E09DB =>
"\xF3\xA0\xA7\x9C" => "", # U+E09DC =>
"\xF3\xA0\xA7\x9D" => "", # U+E09DD =>
"\xF3\xA0\xA7\x9E" => "", # U+E09DE =>
"\xF3\xA0\xA7\x9F" => "", # U+E09DF =>
"\xF3\xA0\xA7\xA0" => "", # U+E09E0 =>
"\xF3\xA0\xA7\xA1" => "", # U+E09E1 =>
"\xF3\xA0\xA7\xA2" => "", # U+E09E2 =>
"\xF3\xA0\xA7\xA3" => "", # U+E09E3 =>
"\xF3\xA0\xA7\xA4" => "", # U+E09E4 =>
"\xF3\xA0\xA7\xA5" => "", # U+E09E5 =>
"\xF3\xA0\xA7\xA6" => "", # U+E09E6 =>
"\xF3\xA0\xA7\xA7" => "", # U+E09E7 =>
"\xF3\xA0\xA7\xA8" => "", # U+E09E8 =>
"\xF3\xA0\xA7\xA9" => "", # U+E09E9 =>
"\xF3\xA0\xA7\xAA" => "", # U+E09EA =>
"\xF3\xA0\xA7\xAB" => "", # U+E09EB =>
"\xF3\xA0\xA7\xAC" => "", # U+E09EC =>
"\xF3\xA0\xA7\xAD" => "", # U+E09ED =>
"\xF3\xA0\xA7\xAE" => "", # U+E09EE =>
"\xF3\xA0\xA7\xAF" => "", # U+E09EF =>
"\xF3\xA0\xA7\xB0" => "", # U+E09F0 =>
"\xF3\xA0\xA7\xB1" => "", # U+E09F1 =>
"\xF3\xA0\xA7\xB2" => "", # U+E09F2 =>
"\xF3\xA0\xA7\xB3" => "", # U+E09F3 =>
"\xF3\xA0\xA7\xB4" => "", # U+E09F4 =>
"\xF3\xA0\xA7\xB5" => "", # U+E09F5 =>
"\xF3\xA0\xA7\xB6" => "", # U+E09F6 =>
"\xF3\xA0\xA7\xB7" => "", # U+E09F7 =>
"\xF3\xA0\xA7\xB8" => "", # U+E09F8 =>
"\xF3\xA0\xA7\xB9" => "", # U+E09F9 =>
"\xF3\xA0\xA7\xBA" => "", # U+E09FA =>
"\xF3\xA0\xA7\xBB" => "", # U+E09FB =>
"\xF3\xA0\xA7\xBC" => "", # U+E09FC =>
"\xF3\xA0\xA7\xBD" => "", # U+E09FD =>
"\xF3\xA0\xA7\xBE" => "", # U+E09FE =>
"\xF3\xA0\xA7\xBF" => "", # U+E09FF =>
"\xF3\xA0\xA8\x80" => "", # U+E0A00 =>
"\xF3\xA0\xA8\x81" => "", # U+E0A01 =>
"\xF3\xA0\xA8\x82" => "", # U+E0A02 =>
"\xF3\xA0\xA8\x83" => "", # U+E0A03 =>
"\xF3\xA0\xA8\x84" => "", # U+E0A04 =>
"\xF3\xA0\xA8\x85" => "", # U+E0A05 =>
"\xF3\xA0\xA8\x86" => "", # U+E0A06 =>
"\xF3\xA0\xA8\x87" => "", # U+E0A07 =>
"\xF3\xA0\xA8\x88" => "", # U+E0A08 =>
"\xF3\xA0\xA8\x89" => "", # U+E0A09 =>
"\xF3\xA0\xA8\x8A" => "", # U+E0A0A =>
"\xF3\xA0\xA8\x8B" => "", # U+E0A0B =>
"\xF3\xA0\xA8\x8C" => "", # U+E0A0C =>
"\xF3\xA0\xA8\x8D" => "", # U+E0A0D =>
"\xF3\xA0\xA8\x8E" => "", # U+E0A0E =>
"\xF3\xA0\xA8\x8F" => "", # U+E0A0F =>
"\xF3\xA0\xA8\x90" => "", # U+E0A10 =>
"\xF3\xA0\xA8\x91" => "", # U+E0A11 =>
"\xF3\xA0\xA8\x92" => "", # U+E0A12 =>
"\xF3\xA0\xA8\x93" => "", # U+E0A13 =>
"\xF3\xA0\xA8\x94" => "", # U+E0A14 =>
"\xF3\xA0\xA8\x95" => "", # U+E0A15 =>
"\xF3\xA0\xA8\x96" => "", # U+E0A16 =>
"\xF3\xA0\xA8\x97" => "", # U+E0A17 =>
"\xF3\xA0\xA8\x98" => "", # U+E0A18 =>
"\xF3\xA0\xA8\x99" => "", # U+E0A19 =>
"\xF3\xA0\xA8\x9A" => "", # U+E0A1A =>
"\xF3\xA0\xA8\x9B" => "", # U+E0A1B =>
"\xF3\xA0\xA8\x9C" => "", # U+E0A1C =>
"\xF3\xA0\xA8\x9D" => "", # U+E0A1D =>
"\xF3\xA0\xA8\x9E" => "", # U+E0A1E =>
"\xF3\xA0\xA8\x9F" => "", # U+E0A1F =>
"\xF3\xA0\xA8\xA0" => "", # U+E0A20 =>
"\xF3\xA0\xA8\xA1" => "", # U+E0A21 =>
"\xF3\xA0\xA8\xA2" => "", # U+E0A22 =>
"\xF3\xA0\xA8\xA3" => "", # U+E0A23 =>
"\xF3\xA0\xA8\xA4" => "", # U+E0A24 =>
"\xF3\xA0\xA8\xA5" => "", # U+E0A25 =>
"\xF3\xA0\xA8\xA6" => "", # U+E0A26 =>
"\xF3\xA0\xA8\xA7" => "", # U+E0A27 =>
"\xF3\xA0\xA8\xA8" => "", # U+E0A28 =>
"\xF3\xA0\xA8\xA9" => "", # U+E0A29 =>
"\xF3\xA0\xA8\xAA" => "", # U+E0A2A =>
"\xF3\xA0\xA8\xAB" => "", # U+E0A2B =>
"\xF3\xA0\xA8\xAC" => "", # U+E0A2C =>
"\xF3\xA0\xA8\xAD" => "", # U+E0A2D =>
"\xF3\xA0\xA8\xAE" => "", # U+E0A2E =>
"\xF3\xA0\xA8\xAF" => "", # U+E0A2F =>
"\xF3\xA0\xA8\xB0" => "", # U+E0A30 =>
"\xF3\xA0\xA8\xB1" => "", # U+E0A31 =>
"\xF3\xA0\xA8\xB2" => "", # U+E0A32 =>
"\xF3\xA0\xA8\xB3" => "", # U+E0A33 =>
"\xF3\xA0\xA8\xB4" => "", # U+E0A34 =>
"\xF3\xA0\xA8\xB5" => "", # U+E0A35 =>
"\xF3\xA0\xA8\xB6" => "", # U+E0A36 =>
"\xF3\xA0\xA8\xB7" => "", # U+E0A37 =>
"\xF3\xA0\xA8\xB8" => "", # U+E0A38 =>
"\xF3\xA0\xA8\xB9" => "", # U+E0A39 =>
"\xF3\xA0\xA8\xBA" => "", # U+E0A3A =>
"\xF3\xA0\xA8\xBB" => "", # U+E0A3B =>
"\xF3\xA0\xA8\xBC" => "", # U+E0A3C =>
"\xF3\xA0\xA8\xBD" => "", # U+E0A3D =>
"\xF3\xA0\xA8\xBE" => "", # U+E0A3E =>
"\xF3\xA0\xA8\xBF" => "", # U+E0A3F =>
"\xF3\xA0\xA9\x80" => "", # U+E0A40 =>
"\xF3\xA0\xA9\x81" => "", # U+E0A41 =>
"\xF3\xA0\xA9\x82" => "", # U+E0A42 =>
"\xF3\xA0\xA9\x83" => "", # U+E0A43 =>
"\xF3\xA0\xA9\x84" => "", # U+E0A44 =>
"\xF3\xA0\xA9\x85" => "", # U+E0A45 =>
"\xF3\xA0\xA9\x86" => "", # U+E0A46 =>
"\xF3\xA0\xA9\x87" => "", # U+E0A47 =>
"\xF3\xA0\xA9\x88" => "", # U+E0A48 =>
"\xF3\xA0\xA9\x89" => "", # U+E0A49 =>
"\xF3\xA0\xA9\x8A" => "", # U+E0A4A =>
"\xF3\xA0\xA9\x8B" => "", # U+E0A4B =>
"\xF3\xA0\xA9\x8C" => "", # U+E0A4C =>
"\xF3\xA0\xA9\x8D" => "", # U+E0A4D =>
"\xF3\xA0\xA9\x8E" => "", # U+E0A4E =>
"\xF3\xA0\xA9\x8F" => "", # U+E0A4F =>
"\xF3\xA0\xA9\x90" => "", # U+E0A50 =>
"\xF3\xA0\xA9\x91" => "", # U+E0A51 =>
"\xF3\xA0\xA9\x92" => "", # U+E0A52 =>
"\xF3\xA0\xA9\x93" => "", # U+E0A53 =>
"\xF3\xA0\xA9\x94" => "", # U+E0A54 =>
"\xF3\xA0\xA9\x95" => "", # U+E0A55 =>
"\xF3\xA0\xA9\x96" => "", # U+E0A56 =>
"\xF3\xA0\xA9\x97" => "", # U+E0A57 =>
"\xF3\xA0\xA9\x98" => "", # U+E0A58 =>
"\xF3\xA0\xA9\x99" => "", # U+E0A59 =>
"\xF3\xA0\xA9\x9A" => "", # U+E0A5A =>
"\xF3\xA0\xA9\x9B" => "", # U+E0A5B =>
"\xF3\xA0\xA9\x9C" => "", # U+E0A5C =>
"\xF3\xA0\xA9\x9D" => "", # U+E0A5D =>
"\xF3\xA0\xA9\x9E" => "", # U+E0A5E =>
"\xF3\xA0\xA9\x9F" => "", # U+E0A5F =>
"\xF3\xA0\xA9\xA0" => "", # U+E0A60 =>
"\xF3\xA0\xA9\xA1" => "", # U+E0A61 =>
"\xF3\xA0\xA9\xA2" => "", # U+E0A62 =>
"\xF3\xA0\xA9\xA3" => "", # U+E0A63 =>
"\xF3\xA0\xA9\xA4" => "", # U+E0A64 =>
"\xF3\xA0\xA9\xA5" => "", # U+E0A65 =>
"\xF3\xA0\xA9\xA6" => "", # U+E0A66 =>
"\xF3\xA0\xA9\xA7" => "", # U+E0A67 =>
"\xF3\xA0\xA9\xA8" => "", # U+E0A68 =>
"\xF3\xA0\xA9\xA9" => "", # U+E0A69 =>
"\xF3\xA0\xA9\xAA" => "", # U+E0A6A =>
"\xF3\xA0\xA9\xAB" => "", # U+E0A6B =>
"\xF3\xA0\xA9\xAC" => "", # U+E0A6C =>
"\xF3\xA0\xA9\xAD" => "", # U+E0A6D =>
"\xF3\xA0\xA9\xAE" => "", # U+E0A6E =>
"\xF3\xA0\xA9\xAF" => "", # U+E0A6F =>
"\xF3\xA0\xA9\xB0" => "", # U+E0A70 =>
"\xF3\xA0\xA9\xB1" => "", # U+E0A71 =>
"\xF3\xA0\xA9\xB2" => "", # U+E0A72 =>
"\xF3\xA0\xA9\xB3" => "", # U+E0A73 =>
"\xF3\xA0\xA9\xB4" => "", # U+E0A74 =>
"\xF3\xA0\xA9\xB5" => "", # U+E0A75 =>
"\xF3\xA0\xA9\xB6" => "", # U+E0A76 =>
"\xF3\xA0\xA9\xB7" => "", # U+E0A77 =>
"\xF3\xA0\xA9\xB8" => "", # U+E0A78 =>
"\xF3\xA0\xA9\xB9" => "", # U+E0A79 =>
"\xF3\xA0\xA9\xBA" => "", # U+E0A7A =>
"\xF3\xA0\xA9\xBB" => "", # U+E0A7B =>
"\xF3\xA0\xA9\xBC" => "", # U+E0A7C =>
"\xF3\xA0\xA9\xBD" => "", # U+E0A7D =>
"\xF3\xA0\xA9\xBE" => "", # U+E0A7E =>
"\xF3\xA0\xA9\xBF" => "", # U+E0A7F =>
"\xF3\xA0\xAA\x80" => "", # U+E0A80 =>
"\xF3\xA0\xAA\x81" => "", # U+E0A81 =>
"\xF3\xA0\xAA\x82" => "", # U+E0A82 =>
"\xF3\xA0\xAA\x83" => "", # U+E0A83 =>
"\xF3\xA0\xAA\x84" => "", # U+E0A84 =>
"\xF3\xA0\xAA\x85" => "", # U+E0A85 =>
"\xF3\xA0\xAA\x86" => "", # U+E0A86 =>
"\xF3\xA0\xAA\x87" => "", # U+E0A87 =>
"\xF3\xA0\xAA\x88" => "", # U+E0A88 =>
"\xF3\xA0\xAA\x89" => "", # U+E0A89 =>
"\xF3\xA0\xAA\x8A" => "", # U+E0A8A =>
"\xF3\xA0\xAA\x8B" => "", # U+E0A8B =>
"\xF3\xA0\xAA\x8C" => "", # U+E0A8C =>
"\xF3\xA0\xAA\x8D" => "", # U+E0A8D =>
"\xF3\xA0\xAA\x8E" => "", # U+E0A8E =>
"\xF3\xA0\xAA\x8F" => "", # U+E0A8F =>
"\xF3\xA0\xAA\x90" => "", # U+E0A90 =>
"\xF3\xA0\xAA\x91" => "", # U+E0A91 =>
"\xF3\xA0\xAA\x92" => "", # U+E0A92 =>
"\xF3\xA0\xAA\x93" => "", # U+E0A93 =>
"\xF3\xA0\xAA\x94" => "", # U+E0A94 =>
"\xF3\xA0\xAA\x95" => "", # U+E0A95 =>
"\xF3\xA0\xAA\x96" => "", # U+E0A96 =>
"\xF3\xA0\xAA\x97" => "", # U+E0A97 =>
"\xF3\xA0\xAA\x98" => "", # U+E0A98 =>
"\xF3\xA0\xAA\x99" => "", # U+E0A99 =>
"\xF3\xA0\xAA\x9A" => "", # U+E0A9A =>
"\xF3\xA0\xAA\x9B" => "", # U+E0A9B =>
"\xF3\xA0\xAA\x9C" => "", # U+E0A9C =>
"\xF3\xA0\xAA\x9D" => "", # U+E0A9D =>
"\xF3\xA0\xAA\x9E" => "", # U+E0A9E =>
"\xF3\xA0\xAA\x9F" => "", # U+E0A9F =>
"\xF3\xA0\xAA\xA0" => "", # U+E0AA0 =>
"\xF3\xA0\xAA\xA1" => "", # U+E0AA1 =>
"\xF3\xA0\xAA\xA2" => "", # U+E0AA2 =>
"\xF3\xA0\xAA\xA3" => "", # U+E0AA3 =>
"\xF3\xA0\xAA\xA4" => "", # U+E0AA4 =>
"\xF3\xA0\xAA\xA5" => "", # U+E0AA5 =>
"\xF3\xA0\xAA\xA6" => "", # U+E0AA6 =>
"\xF3\xA0\xAA\xA7" => "", # U+E0AA7 =>
"\xF3\xA0\xAA\xA8" => "", # U+E0AA8 =>
"\xF3\xA0\xAA\xA9" => "", # U+E0AA9 =>
"\xF3\xA0\xAA\xAA" => "", # U+E0AAA =>
"\xF3\xA0\xAA\xAB" => "", # U+E0AAB =>
"\xF3\xA0\xAA\xAC" => "", # U+E0AAC =>
"\xF3\xA0\xAA\xAD" => "", # U+E0AAD =>
"\xF3\xA0\xAA\xAE" => "", # U+E0AAE =>
"\xF3\xA0\xAA\xAF" => "", # U+E0AAF =>
"\xF3\xA0\xAA\xB0" => "", # U+E0AB0 =>
"\xF3\xA0\xAA\xB1" => "", # U+E0AB1 =>
"\xF3\xA0\xAA\xB2" => "", # U+E0AB2 =>
"\xF3\xA0\xAA\xB3" => "", # U+E0AB3 =>
"\xF3\xA0\xAA\xB4" => "", # U+E0AB4 =>
"\xF3\xA0\xAA\xB5" => "", # U+E0AB5 =>
"\xF3\xA0\xAA\xB6" => "", # U+E0AB6 =>
"\xF3\xA0\xAA\xB7" => "", # U+E0AB7 =>
"\xF3\xA0\xAA\xB8" => "", # U+E0AB8 =>
"\xF3\xA0\xAA\xB9" => "", # U+E0AB9 =>
"\xF3\xA0\xAA\xBA" => "", # U+E0ABA =>
"\xF3\xA0\xAA\xBB" => "", # U+E0ABB =>
"\xF3\xA0\xAA\xBC" => "", # U+E0ABC =>
"\xF3\xA0\xAA\xBD" => "", # U+E0ABD =>
"\xF3\xA0\xAA\xBE" => "", # U+E0ABE =>
"\xF3\xA0\xAA\xBF" => "", # U+E0ABF =>
"\xF3\xA0\xAB\x80" => "", # U+E0AC0 =>
"\xF3\xA0\xAB\x81" => "", # U+E0AC1 =>
"\xF3\xA0\xAB\x82" => "", # U+E0AC2 =>
"\xF3\xA0\xAB\x83" => "", # U+E0AC3 =>
"\xF3\xA0\xAB\x84" => "", # U+E0AC4 =>
"\xF3\xA0\xAB\x85" => "", # U+E0AC5 =>
"\xF3\xA0\xAB\x86" => "", # U+E0AC6 =>
"\xF3\xA0\xAB\x87" => "", # U+E0AC7 =>
"\xF3\xA0\xAB\x88" => "", # U+E0AC8 =>
"\xF3\xA0\xAB\x89" => "", # U+E0AC9 =>
"\xF3\xA0\xAB\x8A" => "", # U+E0ACA =>
"\xF3\xA0\xAB\x8B" => "", # U+E0ACB =>
"\xF3\xA0\xAB\x8C" => "", # U+E0ACC =>
"\xF3\xA0\xAB\x8D" => "", # U+E0ACD =>
"\xF3\xA0\xAB\x8E" => "", # U+E0ACE =>
"\xF3\xA0\xAB\x8F" => "", # U+E0ACF =>
"\xF3\xA0\xAB\x90" => "", # U+E0AD0 =>
"\xF3\xA0\xAB\x91" => "", # U+E0AD1 =>
"\xF3\xA0\xAB\x92" => "", # U+E0AD2 =>
"\xF3\xA0\xAB\x93" => "", # U+E0AD3 =>
"\xF3\xA0\xAB\x94" => "", # U+E0AD4 =>
"\xF3\xA0\xAB\x95" => "", # U+E0AD5 =>
"\xF3\xA0\xAB\x96" => "", # U+E0AD6 =>
"\xF3\xA0\xAB\x97" => "", # U+E0AD7 =>
"\xF3\xA0\xAB\x98" => "", # U+E0AD8 =>
"\xF3\xA0\xAB\x99" => "", # U+E0AD9 =>
"\xF3\xA0\xAB\x9A" => "", # U+E0ADA =>
"\xF3\xA0\xAB\x9B" => "", # U+E0ADB =>
"\xF3\xA0\xAB\x9C" => "", # U+E0ADC =>
"\xF3\xA0\xAB\x9D" => "", # U+E0ADD =>
"\xF3\xA0\xAB\x9E" => "", # U+E0ADE =>
"\xF3\xA0\xAB\x9F" => "", # U+E0ADF =>
"\xF3\xA0\xAB\xA0" => "", # U+E0AE0 =>
"\xF3\xA0\xAB\xA1" => "", # U+E0AE1 =>
"\xF3\xA0\xAB\xA2" => "", # U+E0AE2 =>
"\xF3\xA0\xAB\xA3" => "", # U+E0AE3 =>
"\xF3\xA0\xAB\xA4" => "", # U+E0AE4 =>
"\xF3\xA0\xAB\xA5" => "", # U+E0AE5 =>
"\xF3\xA0\xAB\xA6" => "", # U+E0AE6 =>
"\xF3\xA0\xAB\xA7" => "", # U+E0AE7 =>
"\xF3\xA0\xAB\xA8" => "", # U+E0AE8 =>
"\xF3\xA0\xAB\xA9" => "", # U+E0AE9 =>
"\xF3\xA0\xAB\xAA" => "", # U+E0AEA =>
"\xF3\xA0\xAB\xAB" => "", # U+E0AEB =>
"\xF3\xA0\xAB\xAC" => "", # U+E0AEC =>
"\xF3\xA0\xAB\xAD" => "", # U+E0AED =>
"\xF3\xA0\xAB\xAE" => "", # U+E0AEE =>
"\xF3\xA0\xAB\xAF" => "", # U+E0AEF =>
"\xF3\xA0\xAB\xB0" => "", # U+E0AF0 =>
"\xF3\xA0\xAB\xB1" => "", # U+E0AF1 =>
"\xF3\xA0\xAB\xB2" => "", # U+E0AF2 =>
"\xF3\xA0\xAB\xB3" => "", # U+E0AF3 =>
"\xF3\xA0\xAB\xB4" => "", # U+E0AF4 =>
"\xF3\xA0\xAB\xB5" => "", # U+E0AF5 =>
"\xF3\xA0\xAB\xB6" => "", # U+E0AF6 =>
"\xF3\xA0\xAB\xB7" => "", # U+E0AF7 =>
"\xF3\xA0\xAB\xB8" => "", # U+E0AF8 =>
"\xF3\xA0\xAB\xB9" => "", # U+E0AF9 =>
"\xF3\xA0\xAB\xBA" => "", # U+E0AFA =>
"\xF3\xA0\xAB\xBB" => "", # U+E0AFB =>
"\xF3\xA0\xAB\xBC" => "", # U+E0AFC =>
"\xF3\xA0\xAB\xBD" => "", # U+E0AFD =>
"\xF3\xA0\xAB\xBE" => "", # U+E0AFE =>
"\xF3\xA0\xAB\xBF" => "", # U+E0AFF =>
"\xF3\xA0\xAC\x80" => "", # U+E0B00 =>
"\xF3\xA0\xAC\x81" => "", # U+E0B01 =>
"\xF3\xA0\xAC\x82" => "", # U+E0B02 =>
"\xF3\xA0\xAC\x83" => "", # U+E0B03 =>
"\xF3\xA0\xAC\x84" => "", # U+E0B04 =>
"\xF3\xA0\xAC\x85" => "", # U+E0B05 =>
"\xF3\xA0\xAC\x86" => "", # U+E0B06 =>
"\xF3\xA0\xAC\x87" => "", # U+E0B07 =>
"\xF3\xA0\xAC\x88" => "", # U+E0B08 =>
"\xF3\xA0\xAC\x89" => "", # U+E0B09 =>
"\xF3\xA0\xAC\x8A" => "", # U+E0B0A =>
"\xF3\xA0\xAC\x8B" => "", # U+E0B0B =>
"\xF3\xA0\xAC\x8C" => "", # U+E0B0C =>
"\xF3\xA0\xAC\x8D" => "", # U+E0B0D =>
"\xF3\xA0\xAC\x8E" => "", # U+E0B0E =>
"\xF3\xA0\xAC\x8F" => "", # U+E0B0F =>
"\xF3\xA0\xAC\x90" => "", # U+E0B10 =>
"\xF3\xA0\xAC\x91" => "", # U+E0B11 =>
"\xF3\xA0\xAC\x92" => "", # U+E0B12 =>
"\xF3\xA0\xAC\x93" => "", # U+E0B13 =>
"\xF3\xA0\xAC\x94" => "", # U+E0B14 =>
"\xF3\xA0\xAC\x95" => "", # U+E0B15 =>
"\xF3\xA0\xAC\x96" => "", # U+E0B16 =>
"\xF3\xA0\xAC\x97" => "", # U+E0B17 =>
"\xF3\xA0\xAC\x98" => "", # U+E0B18 =>
"\xF3\xA0\xAC\x99" => "", # U+E0B19 =>
"\xF3\xA0\xAC\x9A" => "", # U+E0B1A =>
"\xF3\xA0\xAC\x9B" => "", # U+E0B1B =>
"\xF3\xA0\xAC\x9C" => "", # U+E0B1C =>
"\xF3\xA0\xAC\x9D" => "", # U+E0B1D =>
"\xF3\xA0\xAC\x9E" => "", # U+E0B1E =>
"\xF3\xA0\xAC\x9F" => "", # U+E0B1F =>
"\xF3\xA0\xAC\xA0" => "", # U+E0B20 =>
"\xF3\xA0\xAC\xA1" => "", # U+E0B21 =>
"\xF3\xA0\xAC\xA2" => "", # U+E0B22 =>
"\xF3\xA0\xAC\xA3" => "", # U+E0B23 =>
"\xF3\xA0\xAC\xA4" => "", # U+E0B24 =>
"\xF3\xA0\xAC\xA5" => "", # U+E0B25 =>
"\xF3\xA0\xAC\xA6" => "", # U+E0B26 =>
"\xF3\xA0\xAC\xA7" => "", # U+E0B27 =>
"\xF3\xA0\xAC\xA8" => "", # U+E0B28 =>
"\xF3\xA0\xAC\xA9" => "", # U+E0B29 =>
"\xF3\xA0\xAC\xAA" => "", # U+E0B2A =>
"\xF3\xA0\xAC\xAB" => "", # U+E0B2B =>
"\xF3\xA0\xAC\xAC" => "", # U+E0B2C =>
"\xF3\xA0\xAC\xAD" => "", # U+E0B2D =>
"\xF3\xA0\xAC\xAE" => "", # U+E0B2E =>
"\xF3\xA0\xAC\xAF" => "", # U+E0B2F =>
"\xF3\xA0\xAC\xB0" => "", # U+E0B30 =>
"\xF3\xA0\xAC\xB1" => "", # U+E0B31 =>
"\xF3\xA0\xAC\xB2" => "", # U+E0B32 =>
"\xF3\xA0\xAC\xB3" => "", # U+E0B33 =>
"\xF3\xA0\xAC\xB4" => "", # U+E0B34 =>
"\xF3\xA0\xAC\xB5" => "", # U+E0B35 =>
"\xF3\xA0\xAC\xB6" => "", # U+E0B36 =>
"\xF3\xA0\xAC\xB7" => "", # U+E0B37 =>
"\xF3\xA0\xAC\xB8" => "", # U+E0B38 =>
"\xF3\xA0\xAC\xB9" => "", # U+E0B39 =>
"\xF3\xA0\xAC\xBA" => "", # U+E0B3A =>
"\xF3\xA0\xAC\xBB" => "", # U+E0B3B =>
"\xF3\xA0\xAC\xBC" => "", # U+E0B3C =>
"\xF3\xA0\xAC\xBD" => "", # U+E0B3D =>
"\xF3\xA0\xAC\xBE" => "", # U+E0B3E =>
"\xF3\xA0\xAC\xBF" => "", # U+E0B3F =>
"\xF3\xA0\xAD\x80" => "", # U+E0B40 =>
"\xF3\xA0\xAD\x81" => "", # U+E0B41 =>
"\xF3\xA0\xAD\x82" => "", # U+E0B42 =>
"\xF3\xA0\xAD\x83" => "", # U+E0B43 =>
"\xF3\xA0\xAD\x84" => "", # U+E0B44 =>
"\xF3\xA0\xAD\x85" => "", # U+E0B45 =>
"\xF3\xA0\xAD\x86" => "", # U+E0B46 =>
"\xF3\xA0\xAD\x87" => "", # U+E0B47 =>
"\xF3\xA0\xAD\x88" => "", # U+E0B48 =>
"\xF3\xA0\xAD\x89" => "", # U+E0B49 =>
"\xF3\xA0\xAD\x8A" => "", # U+E0B4A =>
"\xF3\xA0\xAD\x8B" => "", # U+E0B4B =>
"\xF3\xA0\xAD\x8C" => "", # U+E0B4C =>
"\xF3\xA0\xAD\x8D" => "", # U+E0B4D =>
"\xF3\xA0\xAD\x8E" => "", # U+E0B4E =>
"\xF3\xA0\xAD\x8F" => "", # U+E0B4F =>
"\xF3\xA0\xAD\x90" => "", # U+E0B50 =>
"\xF3\xA0\xAD\x91" => "", # U+E0B51 =>
"\xF3\xA0\xAD\x92" => "", # U+E0B52 =>
"\xF3\xA0\xAD\x93" => "", # U+E0B53 =>
"\xF3\xA0\xAD\x94" => "", # U+E0B54 =>
"\xF3\xA0\xAD\x95" => "", # U+E0B55 =>
"\xF3\xA0\xAD\x96" => "", # U+E0B56 =>
"\xF3\xA0\xAD\x97" => "", # U+E0B57 =>
"\xF3\xA0\xAD\x98" => "", # U+E0B58 =>
"\xF3\xA0\xAD\x99" => "", # U+E0B59 =>
"\xF3\xA0\xAD\x9A" => "", # U+E0B5A =>
"\xF3\xA0\xAD\x9B" => "", # U+E0B5B =>
"\xF3\xA0\xAD\x9C" => "", # U+E0B5C =>
"\xF3\xA0\xAD\x9D" => "", # U+E0B5D =>
"\xF3\xA0\xAD\x9E" => "", # U+E0B5E =>
"\xF3\xA0\xAD\x9F" => "", # U+E0B5F =>
"\xF3\xA0\xAD\xA0" => "", # U+E0B60 =>
"\xF3\xA0\xAD\xA1" => "", # U+E0B61 =>
"\xF3\xA0\xAD\xA2" => "", # U+E0B62 =>
"\xF3\xA0\xAD\xA3" => "", # U+E0B63 =>
"\xF3\xA0\xAD\xA4" => "", # U+E0B64 =>
"\xF3\xA0\xAD\xA5" => "", # U+E0B65 =>
"\xF3\xA0\xAD\xA6" => "", # U+E0B66 =>
"\xF3\xA0\xAD\xA7" => "", # U+E0B67 =>
"\xF3\xA0\xAD\xA8" => "", # U+E0B68 =>
"\xF3\xA0\xAD\xA9" => "", # U+E0B69 =>
"\xF3\xA0\xAD\xAA" => "", # U+E0B6A =>
"\xF3\xA0\xAD\xAB" => "", # U+E0B6B =>
"\xF3\xA0\xAD\xAC" => "", # U+E0B6C =>
"\xF3\xA0\xAD\xAD" => "", # U+E0B6D =>
"\xF3\xA0\xAD\xAE" => "", # U+E0B6E =>
"\xF3\xA0\xAD\xAF" => "", # U+E0B6F =>
"\xF3\xA0\xAD\xB0" => "", # U+E0B70 =>
"\xF3\xA0\xAD\xB1" => "", # U+E0B71 =>
"\xF3\xA0\xAD\xB2" => "", # U+E0B72 =>
"\xF3\xA0\xAD\xB3" => "", # U+E0B73 =>
"\xF3\xA0\xAD\xB4" => "", # U+E0B74 =>
"\xF3\xA0\xAD\xB5" => "", # U+E0B75 =>
"\xF3\xA0\xAD\xB6" => "", # U+E0B76 =>
"\xF3\xA0\xAD\xB7" => "", # U+E0B77 =>
"\xF3\xA0\xAD\xB8" => "", # U+E0B78 =>
"\xF3\xA0\xAD\xB9" => "", # U+E0B79 =>
"\xF3\xA0\xAD\xBA" => "", # U+E0B7A =>
"\xF3\xA0\xAD\xBB" => "", # U+E0B7B =>
"\xF3\xA0\xAD\xBC" => "", # U+E0B7C =>
"\xF3\xA0\xAD\xBD" => "", # U+E0B7D =>
"\xF3\xA0\xAD\xBE" => "", # U+E0B7E =>
"\xF3\xA0\xAD\xBF" => "", # U+E0B7F =>
"\xF3\xA0\xAE\x80" => "", # U+E0B80 =>
"\xF3\xA0\xAE\x81" => "", # U+E0B81 =>
"\xF3\xA0\xAE\x82" => "", # U+E0B82 =>
"\xF3\xA0\xAE\x83" => "", # U+E0B83 =>
"\xF3\xA0\xAE\x84" => "", # U+E0B84 =>
"\xF3\xA0\xAE\x85" => "", # U+E0B85 =>
"\xF3\xA0\xAE\x86" => "", # U+E0B86 =>
"\xF3\xA0\xAE\x87" => "", # U+E0B87 =>
"\xF3\xA0\xAE\x88" => "", # U+E0B88 =>
"\xF3\xA0\xAE\x89" => "", # U+E0B89 =>
"\xF3\xA0\xAE\x8A" => "", # U+E0B8A =>
"\xF3\xA0\xAE\x8B" => "", # U+E0B8B =>
"\xF3\xA0\xAE\x8C" => "", # U+E0B8C =>
"\xF3\xA0\xAE\x8D" => "", # U+E0B8D =>
"\xF3\xA0\xAE\x8E" => "", # U+E0B8E =>
"\xF3\xA0\xAE\x8F" => "", # U+E0B8F =>
"\xF3\xA0\xAE\x90" => "", # U+E0B90 =>
"\xF3\xA0\xAE\x91" => "", # U+E0B91 =>
"\xF3\xA0\xAE\x92" => "", # U+E0B92 =>
"\xF3\xA0\xAE\x93" => "", # U+E0B93 =>
"\xF3\xA0\xAE\x94" => "", # U+E0B94 =>
"\xF3\xA0\xAE\x95" => "", # U+E0B95 =>
"\xF3\xA0\xAE\x96" => "", # U+E0B96 =>
"\xF3\xA0\xAE\x97" => "", # U+E0B97 =>
"\xF3\xA0\xAE\x98" => "", # U+E0B98 =>
"\xF3\xA0\xAE\x99" => "", # U+E0B99 =>
"\xF3\xA0\xAE\x9A" => "", # U+E0B9A =>
"\xF3\xA0\xAE\x9B" => "", # U+E0B9B =>
"\xF3\xA0\xAE\x9C" => "", # U+E0B9C =>
"\xF3\xA0\xAE\x9D" => "", # U+E0B9D =>
"\xF3\xA0\xAE\x9E" => "", # U+E0B9E =>
"\xF3\xA0\xAE\x9F" => "", # U+E0B9F =>
"\xF3\xA0\xAE\xA0" => "", # U+E0BA0 =>
"\xF3\xA0\xAE\xA1" => "", # U+E0BA1 =>
"\xF3\xA0\xAE\xA2" => "", # U+E0BA2 =>
"\xF3\xA0\xAE\xA3" => "", # U+E0BA3 =>
"\xF3\xA0\xAE\xA4" => "", # U+E0BA4 =>
"\xF3\xA0\xAE\xA5" => "", # U+E0BA5 =>
"\xF3\xA0\xAE\xA6" => "", # U+E0BA6 =>
"\xF3\xA0\xAE\xA7" => "", # U+E0BA7 =>
"\xF3\xA0\xAE\xA8" => "", # U+E0BA8 =>
"\xF3\xA0\xAE\xA9" => "", # U+E0BA9 =>
"\xF3\xA0\xAE\xAA" => "", # U+E0BAA =>
"\xF3\xA0\xAE\xAB" => "", # U+E0BAB =>
"\xF3\xA0\xAE\xAC" => "", # U+E0BAC =>
"\xF3\xA0\xAE\xAD" => "", # U+E0BAD =>
"\xF3\xA0\xAE\xAE" => "", # U+E0BAE =>
"\xF3\xA0\xAE\xAF" => "", # U+E0BAF =>
"\xF3\xA0\xAE\xB0" => "", # U+E0BB0 =>
"\xF3\xA0\xAE\xB1" => "", # U+E0BB1 =>
"\xF3\xA0\xAE\xB2" => "", # U+E0BB2 =>
"\xF3\xA0\xAE\xB3" => "", # U+E0BB3 =>
"\xF3\xA0\xAE\xB4" => "", # U+E0BB4 =>
"\xF3\xA0\xAE\xB5" => "", # U+E0BB5 =>
"\xF3\xA0\xAE\xB6" => "", # U+E0BB6 =>
"\xF3\xA0\xAE\xB7" => "", # U+E0BB7 =>
"\xF3\xA0\xAE\xB8" => "", # U+E0BB8 =>
"\xF3\xA0\xAE\xB9" => "", # U+E0BB9 =>
"\xF3\xA0\xAE\xBA" => "", # U+E0BBA =>
"\xF3\xA0\xAE\xBB" => "", # U+E0BBB =>
"\xF3\xA0\xAE\xBC" => "", # U+E0BBC =>
"\xF3\xA0\xAE\xBD" => "", # U+E0BBD =>
"\xF3\xA0\xAE\xBE" => "", # U+E0BBE =>
"\xF3\xA0\xAE\xBF" => "", # U+E0BBF =>
"\xF3\xA0\xAF\x80" => "", # U+E0BC0 =>
"\xF3\xA0\xAF\x81" => "", # U+E0BC1 =>
"\xF3\xA0\xAF\x82" => "", # U+E0BC2 =>
"\xF3\xA0\xAF\x83" => "", # U+E0BC3 =>
"\xF3\xA0\xAF\x84" => "", # U+E0BC4 =>
"\xF3\xA0\xAF\x85" => "", # U+E0BC5 =>
"\xF3\xA0\xAF\x86" => "", # U+E0BC6 =>
"\xF3\xA0\xAF\x87" => "", # U+E0BC7 =>
"\xF3\xA0\xAF\x88" => "", # U+E0BC8 =>
"\xF3\xA0\xAF\x89" => "", # U+E0BC9 =>
"\xF3\xA0\xAF\x8A" => "", # U+E0BCA =>
"\xF3\xA0\xAF\x8B" => "", # U+E0BCB =>
"\xF3\xA0\xAF\x8C" => "", # U+E0BCC =>
"\xF3\xA0\xAF\x8D" => "", # U+E0BCD =>
"\xF3\xA0\xAF\x8E" => "", # U+E0BCE =>
"\xF3\xA0\xAF\x8F" => "", # U+E0BCF =>
"\xF3\xA0\xAF\x90" => "", # U+E0BD0 =>
"\xF3\xA0\xAF\x91" => "", # U+E0BD1 =>
"\xF3\xA0\xAF\x92" => "", # U+E0BD2 =>
"\xF3\xA0\xAF\x93" => "", # U+E0BD3 =>
"\xF3\xA0\xAF\x94" => "", # U+E0BD4 =>
"\xF3\xA0\xAF\x95" => "", # U+E0BD5 =>
"\xF3\xA0\xAF\x96" => "", # U+E0BD6 =>
"\xF3\xA0\xAF\x97" => "", # U+E0BD7 =>
"\xF3\xA0\xAF\x98" => "", # U+E0BD8 =>
"\xF3\xA0\xAF\x99" => "", # U+E0BD9 =>
"\xF3\xA0\xAF\x9A" => "", # U+E0BDA =>
"\xF3\xA0\xAF\x9B" => "", # U+E0BDB =>
"\xF3\xA0\xAF\x9C" => "", # U+E0BDC =>
"\xF3\xA0\xAF\x9D" => "", # U+E0BDD =>
"\xF3\xA0\xAF\x9E" => "", # U+E0BDE =>
"\xF3\xA0\xAF\x9F" => "", # U+E0BDF =>
"\xF3\xA0\xAF\xA0" => "", # U+E0BE0 =>
"\xF3\xA0\xAF\xA1" => "", # U+E0BE1 =>
"\xF3\xA0\xAF\xA2" => "", # U+E0BE2 =>
"\xF3\xA0\xAF\xA3" => "", # U+E0BE3 =>
"\xF3\xA0\xAF\xA4" => "", # U+E0BE4 =>
"\xF3\xA0\xAF\xA5" => "", # U+E0BE5 =>
"\xF3\xA0\xAF\xA6" => "", # U+E0BE6 =>
"\xF3\xA0\xAF\xA7" => "", # U+E0BE7 =>
"\xF3\xA0\xAF\xA8" => "", # U+E0BE8 =>
"\xF3\xA0\xAF\xA9" => "", # U+E0BE9 =>
"\xF3\xA0\xAF\xAA" => "", # U+E0BEA =>
"\xF3\xA0\xAF\xAB" => "", # U+E0BEB =>
"\xF3\xA0\xAF\xAC" => "", # U+E0BEC =>
"\xF3\xA0\xAF\xAD" => "", # U+E0BED =>
"\xF3\xA0\xAF\xAE" => "", # U+E0BEE =>
"\xF3\xA0\xAF\xAF" => "", # U+E0BEF =>
"\xF3\xA0\xAF\xB0" => "", # U+E0BF0 =>
"\xF3\xA0\xAF\xB1" => "", # U+E0BF1 =>
"\xF3\xA0\xAF\xB2" => "", # U+E0BF2 =>
"\xF3\xA0\xAF\xB3" => "", # U+E0BF3 =>
"\xF3\xA0\xAF\xB4" => "", # U+E0BF4 =>
"\xF3\xA0\xAF\xB5" => "", # U+E0BF5 =>
"\xF3\xA0\xAF\xB6" => "", # U+E0BF6 =>
"\xF3\xA0\xAF\xB7" => "", # U+E0BF7 =>
"\xF3\xA0\xAF\xB8" => "", # U+E0BF8 =>
"\xF3\xA0\xAF\xB9" => "", # U+E0BF9 =>
"\xF3\xA0\xAF\xBA" => "", # U+E0BFA =>
"\xF3\xA0\xAF\xBB" => "", # U+E0BFB =>
"\xF3\xA0\xAF\xBC" => "", # U+E0BFC =>
"\xF3\xA0\xAF\xBD" => "", # U+E0BFD =>
"\xF3\xA0\xAF\xBE" => "", # U+E0BFE =>
"\xF3\xA0\xAF\xBF" => "", # U+E0BFF =>
"\xF3\xA0\xB0\x80" => "", # U+E0C00 =>
"\xF3\xA0\xB0\x81" => "", # U+E0C01 =>
"\xF3\xA0\xB0\x82" => "", # U+E0C02 =>
"\xF3\xA0\xB0\x83" => "", # U+E0C03 =>
"\xF3\xA0\xB0\x84" => "", # U+E0C04 =>
"\xF3\xA0\xB0\x85" => "", # U+E0C05 =>
"\xF3\xA0\xB0\x86" => "", # U+E0C06 =>
"\xF3\xA0\xB0\x87" => "", # U+E0C07 =>
"\xF3\xA0\xB0\x88" => "", # U+E0C08 =>
"\xF3\xA0\xB0\x89" => "", # U+E0C09 =>
"\xF3\xA0\xB0\x8A" => "", # U+E0C0A =>
"\xF3\xA0\xB0\x8B" => "", # U+E0C0B =>
"\xF3\xA0\xB0\x8C" => "", # U+E0C0C =>
"\xF3\xA0\xB0\x8D" => "", # U+E0C0D =>
"\xF3\xA0\xB0\x8E" => "", # U+E0C0E =>
"\xF3\xA0\xB0\x8F" => "", # U+E0C0F =>
"\xF3\xA0\xB0\x90" => "", # U+E0C10 =>
"\xF3\xA0\xB0\x91" => "", # U+E0C11 =>
"\xF3\xA0\xB0\x92" => "", # U+E0C12 =>
"\xF3\xA0\xB0\x93" => "", # U+E0C13 =>
"\xF3\xA0\xB0\x94" => "", # U+E0C14 =>
"\xF3\xA0\xB0\x95" => "", # U+E0C15 =>
"\xF3\xA0\xB0\x96" => "", # U+E0C16 =>
"\xF3\xA0\xB0\x97" => "", # U+E0C17 =>
"\xF3\xA0\xB0\x98" => "", # U+E0C18 =>
"\xF3\xA0\xB0\x99" => "", # U+E0C19 =>
"\xF3\xA0\xB0\x9A" => "", # U+E0C1A =>
"\xF3\xA0\xB0\x9B" => "", # U+E0C1B =>
"\xF3\xA0\xB0\x9C" => "", # U+E0C1C =>
"\xF3\xA0\xB0\x9D" => "", # U+E0C1D =>
"\xF3\xA0\xB0\x9E" => "", # U+E0C1E =>
"\xF3\xA0\xB0\x9F" => "", # U+E0C1F =>
"\xF3\xA0\xB0\xA0" => "", # U+E0C20 =>
"\xF3\xA0\xB0\xA1" => "", # U+E0C21 =>
"\xF3\xA0\xB0\xA2" => "", # U+E0C22 =>
"\xF3\xA0\xB0\xA3" => "", # U+E0C23 =>
"\xF3\xA0\xB0\xA4" => "", # U+E0C24 =>
"\xF3\xA0\xB0\xA5" => "", # U+E0C25 =>
"\xF3\xA0\xB0\xA6" => "", # U+E0C26 =>
"\xF3\xA0\xB0\xA7" => "", # U+E0C27 =>
"\xF3\xA0\xB0\xA8" => "", # U+E0C28 =>
"\xF3\xA0\xB0\xA9" => "", # U+E0C29 =>
"\xF3\xA0\xB0\xAA" => "", # U+E0C2A =>
"\xF3\xA0\xB0\xAB" => "", # U+E0C2B =>
"\xF3\xA0\xB0\xAC" => "", # U+E0C2C =>
"\xF3\xA0\xB0\xAD" => "", # U+E0C2D =>
"\xF3\xA0\xB0\xAE" => "", # U+E0C2E =>
"\xF3\xA0\xB0\xAF" => "", # U+E0C2F =>
"\xF3\xA0\xB0\xB0" => "", # U+E0C30 =>
"\xF3\xA0\xB0\xB1" => "", # U+E0C31 =>
"\xF3\xA0\xB0\xB2" => "", # U+E0C32 =>
"\xF3\xA0\xB0\xB3" => "", # U+E0C33 =>
"\xF3\xA0\xB0\xB4" => "", # U+E0C34 =>
"\xF3\xA0\xB0\xB5" => "", # U+E0C35 =>
"\xF3\xA0\xB0\xB6" => "", # U+E0C36 =>
"\xF3\xA0\xB0\xB7" => "", # U+E0C37 =>
"\xF3\xA0\xB0\xB8" => "", # U+E0C38 =>
"\xF3\xA0\xB0\xB9" => "", # U+E0C39 =>
"\xF3\xA0\xB0\xBA" => "", # U+E0C3A =>
"\xF3\xA0\xB0\xBB" => "", # U+E0C3B =>
"\xF3\xA0\xB0\xBC" => "", # U+E0C3C =>
"\xF3\xA0\xB0\xBD" => "", # U+E0C3D =>
"\xF3\xA0\xB0\xBE" => "", # U+E0C3E =>
"\xF3\xA0\xB0\xBF" => "", # U+E0C3F =>
"\xF3\xA0\xB1\x80" => "", # U+E0C40 =>
"\xF3\xA0\xB1\x81" => "", # U+E0C41 =>
"\xF3\xA0\xB1\x82" => "", # U+E0C42 =>
"\xF3\xA0\xB1\x83" => "", # U+E0C43 =>
"\xF3\xA0\xB1\x84" => "", # U+E0C44 =>
"\xF3\xA0\xB1\x85" => "", # U+E0C45 =>
"\xF3\xA0\xB1\x86" => "", # U+E0C46 =>
"\xF3\xA0\xB1\x87" => "", # U+E0C47 =>
"\xF3\xA0\xB1\x88" => "", # U+E0C48 =>
"\xF3\xA0\xB1\x89" => "", # U+E0C49 =>
"\xF3\xA0\xB1\x8A" => "", # U+E0C4A =>
"\xF3\xA0\xB1\x8B" => "", # U+E0C4B =>
"\xF3\xA0\xB1\x8C" => "", # U+E0C4C =>
"\xF3\xA0\xB1\x8D" => "", # U+E0C4D =>
"\xF3\xA0\xB1\x8E" => "", # U+E0C4E =>
"\xF3\xA0\xB1\x8F" => "", # U+E0C4F =>
"\xF3\xA0\xB1\x90" => "", # U+E0C50 =>
"\xF3\xA0\xB1\x91" => "", # U+E0C51 =>
"\xF3\xA0\xB1\x92" => "", # U+E0C52 =>
"\xF3\xA0\xB1\x93" => "", # U+E0C53 =>
"\xF3\xA0\xB1\x94" => "", # U+E0C54 =>
"\xF3\xA0\xB1\x95" => "", # U+E0C55 =>
"\xF3\xA0\xB1\x96" => "", # U+E0C56 =>
"\xF3\xA0\xB1\x97" => "", # U+E0C57 =>
"\xF3\xA0\xB1\x98" => "", # U+E0C58 =>
"\xF3\xA0\xB1\x99" => "", # U+E0C59 =>
"\xF3\xA0\xB1\x9A" => "", # U+E0C5A =>
"\xF3\xA0\xB1\x9B" => "", # U+E0C5B =>
"\xF3\xA0\xB1\x9C" => "", # U+E0C5C =>
"\xF3\xA0\xB1\x9D" => "", # U+E0C5D =>
"\xF3\xA0\xB1\x9E" => "", # U+E0C5E =>
"\xF3\xA0\xB1\x9F" => "", # U+E0C5F =>
"\xF3\xA0\xB1\xA0" => "", # U+E0C60 =>
"\xF3\xA0\xB1\xA1" => "", # U+E0C61 =>
"\xF3\xA0\xB1\xA2" => "", # U+E0C62 =>
"\xF3\xA0\xB1\xA3" => "", # U+E0C63 =>
"\xF3\xA0\xB1\xA4" => "", # U+E0C64 =>
"\xF3\xA0\xB1\xA5" => "", # U+E0C65 =>
"\xF3\xA0\xB1\xA6" => "", # U+E0C66 =>
"\xF3\xA0\xB1\xA7" => "", # U+E0C67 =>
"\xF3\xA0\xB1\xA8" => "", # U+E0C68 =>
"\xF3\xA0\xB1\xA9" => "", # U+E0C69 =>
"\xF3\xA0\xB1\xAA" => "", # U+E0C6A =>
"\xF3\xA0\xB1\xAB" => "", # U+E0C6B =>
"\xF3\xA0\xB1\xAC" => "", # U+E0C6C =>
"\xF3\xA0\xB1\xAD" => "", # U+E0C6D =>
"\xF3\xA0\xB1\xAE" => "", # U+E0C6E =>
"\xF3\xA0\xB1\xAF" => "", # U+E0C6F =>
"\xF3\xA0\xB1\xB0" => "", # U+E0C70 =>
"\xF3\xA0\xB1\xB1" => "", # U+E0C71 =>
"\xF3\xA0\xB1\xB2" => "", # U+E0C72 =>
"\xF3\xA0\xB1\xB3" => "", # U+E0C73 =>
"\xF3\xA0\xB1\xB4" => "", # U+E0C74 =>
"\xF3\xA0\xB1\xB5" => "", # U+E0C75 =>
"\xF3\xA0\xB1\xB6" => "", # U+E0C76 =>
"\xF3\xA0\xB1\xB7" => "", # U+E0C77 =>
"\xF3\xA0\xB1\xB8" => "", # U+E0C78 =>
"\xF3\xA0\xB1\xB9" => "", # U+E0C79 =>
"\xF3\xA0\xB1\xBA" => "", # U+E0C7A =>
"\xF3\xA0\xB1\xBB" => "", # U+E0C7B =>
"\xF3\xA0\xB1\xBC" => "", # U+E0C7C =>
"\xF3\xA0\xB1\xBD" => "", # U+E0C7D =>
"\xF3\xA0\xB1\xBE" => "", # U+E0C7E =>
"\xF3\xA0\xB1\xBF" => "", # U+E0C7F =>
"\xF3\xA0\xB2\x80" => "", # U+E0C80 =>
"\xF3\xA0\xB2\x81" => "", # U+E0C81 =>
"\xF3\xA0\xB2\x82" => "", # U+E0C82 =>
"\xF3\xA0\xB2\x83" => "", # U+E0C83 =>
"\xF3\xA0\xB2\x84" => "", # U+E0C84 =>
"\xF3\xA0\xB2\x85" => "", # U+E0C85 =>
"\xF3\xA0\xB2\x86" => "", # U+E0C86 =>
"\xF3\xA0\xB2\x87" => "", # U+E0C87 =>
"\xF3\xA0\xB2\x88" => "", # U+E0C88 =>
"\xF3\xA0\xB2\x89" => "", # U+E0C89 =>
"\xF3\xA0\xB2\x8A" => "", # U+E0C8A =>
"\xF3\xA0\xB2\x8B" => "", # U+E0C8B =>
"\xF3\xA0\xB2\x8C" => "", # U+E0C8C =>
"\xF3\xA0\xB2\x8D" => "", # U+E0C8D =>
"\xF3\xA0\xB2\x8E" => "", # U+E0C8E =>
"\xF3\xA0\xB2\x8F" => "", # U+E0C8F =>
"\xF3\xA0\xB2\x90" => "", # U+E0C90 =>
"\xF3\xA0\xB2\x91" => "", # U+E0C91 =>
"\xF3\xA0\xB2\x92" => "", # U+E0C92 =>
"\xF3\xA0\xB2\x93" => "", # U+E0C93 =>
"\xF3\xA0\xB2\x94" => "", # U+E0C94 =>
"\xF3\xA0\xB2\x95" => "", # U+E0C95 =>
"\xF3\xA0\xB2\x96" => "", # U+E0C96 =>
"\xF3\xA0\xB2\x97" => "", # U+E0C97 =>
"\xF3\xA0\xB2\x98" => "", # U+E0C98 =>
"\xF3\xA0\xB2\x99" => "", # U+E0C99 =>
"\xF3\xA0\xB2\x9A" => "", # U+E0C9A =>
"\xF3\xA0\xB2\x9B" => "", # U+E0C9B =>
"\xF3\xA0\xB2\x9C" => "", # U+E0C9C =>
"\xF3\xA0\xB2\x9D" => "", # U+E0C9D =>
"\xF3\xA0\xB2\x9E" => "", # U+E0C9E =>
"\xF3\xA0\xB2\x9F" => "", # U+E0C9F =>
"\xF3\xA0\xB2\xA0" => "", # U+E0CA0 =>
"\xF3\xA0\xB2\xA1" => "", # U+E0CA1 =>
"\xF3\xA0\xB2\xA2" => "", # U+E0CA2 =>
"\xF3\xA0\xB2\xA3" => "", # U+E0CA3 =>
"\xF3\xA0\xB2\xA4" => "", # U+E0CA4 =>
"\xF3\xA0\xB2\xA5" => "", # U+E0CA5 =>
"\xF3\xA0\xB2\xA6" => "", # U+E0CA6 =>
"\xF3\xA0\xB2\xA7" => "", # U+E0CA7 =>
"\xF3\xA0\xB2\xA8" => "", # U+E0CA8 =>
"\xF3\xA0\xB2\xA9" => "", # U+E0CA9 =>
"\xF3\xA0\xB2\xAA" => "", # U+E0CAA =>
"\xF3\xA0\xB2\xAB" => "", # U+E0CAB =>
"\xF3\xA0\xB2\xAC" => "", # U+E0CAC =>
"\xF3\xA0\xB2\xAD" => "", # U+E0CAD =>
"\xF3\xA0\xB2\xAE" => "", # U+E0CAE =>
"\xF3\xA0\xB2\xAF" => "", # U+E0CAF =>
"\xF3\xA0\xB2\xB0" => "", # U+E0CB0 =>
"\xF3\xA0\xB2\xB1" => "", # U+E0CB1 =>
"\xF3\xA0\xB2\xB2" => "", # U+E0CB2 =>
"\xF3\xA0\xB2\xB3" => "", # U+E0CB3 =>
"\xF3\xA0\xB2\xB4" => "", # U+E0CB4 =>
"\xF3\xA0\xB2\xB5" => "", # U+E0CB5 =>
"\xF3\xA0\xB2\xB6" => "", # U+E0CB6 =>
"\xF3\xA0\xB2\xB7" => "", # U+E0CB7 =>
"\xF3\xA0\xB2\xB8" => "", # U+E0CB8 =>
"\xF3\xA0\xB2\xB9" => "", # U+E0CB9 =>
"\xF3\xA0\xB2\xBA" => "", # U+E0CBA =>
"\xF3\xA0\xB2\xBB" => "", # U+E0CBB =>
"\xF3\xA0\xB2\xBC" => "", # U+E0CBC =>
"\xF3\xA0\xB2\xBD" => "", # U+E0CBD =>
"\xF3\xA0\xB2\xBE" => "", # U+E0CBE =>
"\xF3\xA0\xB2\xBF" => "", # U+E0CBF =>
"\xF3\xA0\xB3\x80" => "", # U+E0CC0 =>
"\xF3\xA0\xB3\x81" => "", # U+E0CC1 =>
"\xF3\xA0\xB3\x82" => "", # U+E0CC2 =>
"\xF3\xA0\xB3\x83" => "", # U+E0CC3 =>
"\xF3\xA0\xB3\x84" => "", # U+E0CC4 =>
"\xF3\xA0\xB3\x85" => "", # U+E0CC5 =>
"\xF3\xA0\xB3\x86" => "", # U+E0CC6 =>
"\xF3\xA0\xB3\x87" => "", # U+E0CC7 =>
"\xF3\xA0\xB3\x88" => "", # U+E0CC8 =>
"\xF3\xA0\xB3\x89" => "", # U+E0CC9 =>
"\xF3\xA0\xB3\x8A" => "", # U+E0CCA =>
"\xF3\xA0\xB3\x8B" => "", # U+E0CCB =>
"\xF3\xA0\xB3\x8C" => "", # U+E0CCC =>
"\xF3\xA0\xB3\x8D" => "", # U+E0CCD =>
"\xF3\xA0\xB3\x8E" => "", # U+E0CCE =>
"\xF3\xA0\xB3\x8F" => "", # U+E0CCF =>
"\xF3\xA0\xB3\x90" => "", # U+E0CD0 =>
"\xF3\xA0\xB3\x91" => "", # U+E0CD1 =>
"\xF3\xA0\xB3\x92" => "", # U+E0CD2 =>
"\xF3\xA0\xB3\x93" => "", # U+E0CD3 =>
"\xF3\xA0\xB3\x94" => "", # U+E0CD4 =>
"\xF3\xA0\xB3\x95" => "", # U+E0CD5 =>
"\xF3\xA0\xB3\x96" => "", # U+E0CD6 =>
"\xF3\xA0\xB3\x97" => "", # U+E0CD7 =>
"\xF3\xA0\xB3\x98" => "", # U+E0CD8 =>
"\xF3\xA0\xB3\x99" => "", # U+E0CD9 =>
"\xF3\xA0\xB3\x9A" => "", # U+E0CDA =>
"\xF3\xA0\xB3\x9B" => "", # U+E0CDB =>
"\xF3\xA0\xB3\x9C" => "", # U+E0CDC =>
"\xF3\xA0\xB3\x9D" => "", # U+E0CDD =>
"\xF3\xA0\xB3\x9E" => "", # U+E0CDE =>
"\xF3\xA0\xB3\x9F" => "", # U+E0CDF =>
"\xF3\xA0\xB3\xA0" => "", # U+E0CE0 =>
"\xF3\xA0\xB3\xA1" => "", # U+E0CE1 =>
"\xF3\xA0\xB3\xA2" => "", # U+E0CE2 =>
"\xF3\xA0\xB3\xA3" => "", # U+E0CE3 =>
"\xF3\xA0\xB3\xA4" => "", # U+E0CE4 =>
"\xF3\xA0\xB3\xA5" => "", # U+E0CE5 =>
"\xF3\xA0\xB3\xA6" => "", # U+E0CE6 =>
"\xF3\xA0\xB3\xA7" => "", # U+E0CE7 =>
"\xF3\xA0\xB3\xA8" => "", # U+E0CE8 =>
"\xF3\xA0\xB3\xA9" => "", # U+E0CE9 =>
"\xF3\xA0\xB3\xAA" => "", # U+E0CEA =>
"\xF3\xA0\xB3\xAB" => "", # U+E0CEB =>
"\xF3\xA0\xB3\xAC" => "", # U+E0CEC =>
"\xF3\xA0\xB3\xAD" => "", # U+E0CED =>
"\xF3\xA0\xB3\xAE" => "", # U+E0CEE =>
"\xF3\xA0\xB3\xAF" => "", # U+E0CEF =>
"\xF3\xA0\xB3\xB0" => "", # U+E0CF0 =>
"\xF3\xA0\xB3\xB1" => "", # U+E0CF1 =>
"\xF3\xA0\xB3\xB2" => "", # U+E0CF2 =>
"\xF3\xA0\xB3\xB3" => "", # U+E0CF3 =>
"\xF3\xA0\xB3\xB4" => "", # U+E0CF4 =>
"\xF3\xA0\xB3\xB5" => "", # U+E0CF5 =>
"\xF3\xA0\xB3\xB6" => "", # U+E0CF6 =>
"\xF3\xA0\xB3\xB7" => "", # U+E0CF7 =>
"\xF3\xA0\xB3\xB8" => "", # U+E0CF8 =>
"\xF3\xA0\xB3\xB9" => "", # U+E0CF9 =>
"\xF3\xA0\xB3\xBA" => "", # U+E0CFA =>
"\xF3\xA0\xB3\xBB" => "", # U+E0CFB =>
"\xF3\xA0\xB3\xBC" => "", # U+E0CFC =>
"\xF3\xA0\xB3\xBD" => "", # U+E0CFD =>
"\xF3\xA0\xB3\xBE" => "", # U+E0CFE =>
"\xF3\xA0\xB3\xBF" => "", # U+E0CFF =>
"\xF3\xA0\xB4\x80" => "", # U+E0D00 =>
"\xF3\xA0\xB4\x81" => "", # U+E0D01 =>
"\xF3\xA0\xB4\x82" => "", # U+E0D02 =>
"\xF3\xA0\xB4\x83" => "", # U+E0D03 =>
"\xF3\xA0\xB4\x84" => "", # U+E0D04 =>
"\xF3\xA0\xB4\x85" => "", # U+E0D05 =>
"\xF3\xA0\xB4\x86" => "", # U+E0D06 =>
"\xF3\xA0\xB4\x87" => "", # U+E0D07 =>
"\xF3\xA0\xB4\x88" => "", # U+E0D08 =>
"\xF3\xA0\xB4\x89" => "", # U+E0D09 =>
"\xF3\xA0\xB4\x8A" => "", # U+E0D0A =>
"\xF3\xA0\xB4\x8B" => "", # U+E0D0B =>
"\xF3\xA0\xB4\x8C" => "", # U+E0D0C =>
"\xF3\xA0\xB4\x8D" => "", # U+E0D0D =>
"\xF3\xA0\xB4\x8E" => "", # U+E0D0E =>
"\xF3\xA0\xB4\x8F" => "", # U+E0D0F =>
"\xF3\xA0\xB4\x90" => "", # U+E0D10 =>
"\xF3\xA0\xB4\x91" => "", # U+E0D11 =>
"\xF3\xA0\xB4\x92" => "", # U+E0D12 =>
"\xF3\xA0\xB4\x93" => "", # U+E0D13 =>
"\xF3\xA0\xB4\x94" => "", # U+E0D14 =>
"\xF3\xA0\xB4\x95" => "", # U+E0D15 =>
"\xF3\xA0\xB4\x96" => "", # U+E0D16 =>
"\xF3\xA0\xB4\x97" => "", # U+E0D17 =>
"\xF3\xA0\xB4\x98" => "", # U+E0D18 =>
"\xF3\xA0\xB4\x99" => "", # U+E0D19 =>
"\xF3\xA0\xB4\x9A" => "", # U+E0D1A =>
"\xF3\xA0\xB4\x9B" => "", # U+E0D1B =>
"\xF3\xA0\xB4\x9C" => "", # U+E0D1C =>
"\xF3\xA0\xB4\x9D" => "", # U+E0D1D =>
"\xF3\xA0\xB4\x9E" => "", # U+E0D1E =>
"\xF3\xA0\xB4\x9F" => "", # U+E0D1F =>
"\xF3\xA0\xB4\xA0" => "", # U+E0D20 =>
"\xF3\xA0\xB4\xA1" => "", # U+E0D21 =>
"\xF3\xA0\xB4\xA2" => "", # U+E0D22 =>
"\xF3\xA0\xB4\xA3" => "", # U+E0D23 =>
"\xF3\xA0\xB4\xA4" => "", # U+E0D24 =>
"\xF3\xA0\xB4\xA5" => "", # U+E0D25 =>
"\xF3\xA0\xB4\xA6" => "", # U+E0D26 =>
"\xF3\xA0\xB4\xA7" => "", # U+E0D27 =>
"\xF3\xA0\xB4\xA8" => "", # U+E0D28 =>
"\xF3\xA0\xB4\xA9" => "", # U+E0D29 =>
"\xF3\xA0\xB4\xAA" => "", # U+E0D2A =>
"\xF3\xA0\xB4\xAB" => "", # U+E0D2B =>
"\xF3\xA0\xB4\xAC" => "", # U+E0D2C =>
"\xF3\xA0\xB4\xAD" => "", # U+E0D2D =>
"\xF3\xA0\xB4\xAE" => "", # U+E0D2E =>
"\xF3\xA0\xB4\xAF" => "", # U+E0D2F =>
"\xF3\xA0\xB4\xB0" => "", # U+E0D30 =>
"\xF3\xA0\xB4\xB1" => "", # U+E0D31 =>
"\xF3\xA0\xB4\xB2" => "", # U+E0D32 =>
"\xF3\xA0\xB4\xB3" => "", # U+E0D33 =>
"\xF3\xA0\xB4\xB4" => "", # U+E0D34 =>
"\xF3\xA0\xB4\xB5" => "", # U+E0D35 =>
"\xF3\xA0\xB4\xB6" => "", # U+E0D36 =>
"\xF3\xA0\xB4\xB7" => "", # U+E0D37 =>
"\xF3\xA0\xB4\xB8" => "", # U+E0D38 =>
"\xF3\xA0\xB4\xB9" => "", # U+E0D39 =>
"\xF3\xA0\xB4\xBA" => "", # U+E0D3A =>
"\xF3\xA0\xB4\xBB" => "", # U+E0D3B =>
"\xF3\xA0\xB4\xBC" => "", # U+E0D3C =>
"\xF3\xA0\xB4\xBD" => "", # U+E0D3D =>
"\xF3\xA0\xB4\xBE" => "", # U+E0D3E =>
"\xF3\xA0\xB4\xBF" => "", # U+E0D3F =>
"\xF3\xA0\xB5\x80" => "", # U+E0D40 =>
"\xF3\xA0\xB5\x81" => "", # U+E0D41 =>
"\xF3\xA0\xB5\x82" => "", # U+E0D42 =>
"\xF3\xA0\xB5\x83" => "", # U+E0D43 =>
"\xF3\xA0\xB5\x84" => "", # U+E0D44 =>
"\xF3\xA0\xB5\x85" => "", # U+E0D45 =>
"\xF3\xA0\xB5\x86" => "", # U+E0D46 =>
"\xF3\xA0\xB5\x87" => "", # U+E0D47 =>
"\xF3\xA0\xB5\x88" => "", # U+E0D48 =>
"\xF3\xA0\xB5\x89" => "", # U+E0D49 =>
"\xF3\xA0\xB5\x8A" => "", # U+E0D4A =>
"\xF3\xA0\xB5\x8B" => "", # U+E0D4B =>
"\xF3\xA0\xB5\x8C" => "", # U+E0D4C =>
"\xF3\xA0\xB5\x8D" => "", # U+E0D4D =>
"\xF3\xA0\xB5\x8E" => "", # U+E0D4E =>
"\xF3\xA0\xB5\x8F" => "", # U+E0D4F =>
"\xF3\xA0\xB5\x90" => "", # U+E0D50 =>
"\xF3\xA0\xB5\x91" => "", # U+E0D51 =>
"\xF3\xA0\xB5\x92" => "", # U+E0D52 =>
"\xF3\xA0\xB5\x93" => "", # U+E0D53 =>
"\xF3\xA0\xB5\x94" => "", # U+E0D54 =>
"\xF3\xA0\xB5\x95" => "", # U+E0D55 =>
"\xF3\xA0\xB5\x96" => "", # U+E0D56 =>
"\xF3\xA0\xB5\x97" => "", # U+E0D57 =>
"\xF3\xA0\xB5\x98" => "", # U+E0D58 =>
"\xF3\xA0\xB5\x99" => "", # U+E0D59 =>
"\xF3\xA0\xB5\x9A" => "", # U+E0D5A =>
"\xF3\xA0\xB5\x9B" => "", # U+E0D5B =>
"\xF3\xA0\xB5\x9C" => "", # U+E0D5C =>
"\xF3\xA0\xB5\x9D" => "", # U+E0D5D =>
"\xF3\xA0\xB5\x9E" => "", # U+E0D5E =>
"\xF3\xA0\xB5\x9F" => "", # U+E0D5F =>
"\xF3\xA0\xB5\xA0" => "", # U+E0D60 =>
"\xF3\xA0\xB5\xA1" => "", # U+E0D61 =>
"\xF3\xA0\xB5\xA2" => "", # U+E0D62 =>
"\xF3\xA0\xB5\xA3" => "", # U+E0D63 =>
"\xF3\xA0\xB5\xA4" => "", # U+E0D64 =>
"\xF3\xA0\xB5\xA5" => "", # U+E0D65 =>
"\xF3\xA0\xB5\xA6" => "", # U+E0D66 =>
"\xF3\xA0\xB5\xA7" => "", # U+E0D67 =>
"\xF3\xA0\xB5\xA8" => "", # U+E0D68 =>
"\xF3\xA0\xB5\xA9" => "", # U+E0D69 =>
"\xF3\xA0\xB5\xAA" => "", # U+E0D6A =>
"\xF3\xA0\xB5\xAB" => "", # U+E0D6B =>
"\xF3\xA0\xB5\xAC" => "", # U+E0D6C =>
"\xF3\xA0\xB5\xAD" => "", # U+E0D6D =>
"\xF3\xA0\xB5\xAE" => "", # U+E0D6E =>
"\xF3\xA0\xB5\xAF" => "", # U+E0D6F =>
"\xF3\xA0\xB5\xB0" => "", # U+E0D70 =>
"\xF3\xA0\xB5\xB1" => "", # U+E0D71 =>
"\xF3\xA0\xB5\xB2" => "", # U+E0D72 =>
"\xF3\xA0\xB5\xB3" => "", # U+E0D73 =>
"\xF3\xA0\xB5\xB4" => "", # U+E0D74 =>
"\xF3\xA0\xB5\xB5" => "", # U+E0D75 =>
"\xF3\xA0\xB5\xB6" => "", # U+E0D76 =>
"\xF3\xA0\xB5\xB7" => "", # U+E0D77 =>
"\xF3\xA0\xB5\xB8" => "", # U+E0D78 =>
"\xF3\xA0\xB5\xB9" => "", # U+E0D79 =>
"\xF3\xA0\xB5\xBA" => "", # U+E0D7A =>
"\xF3\xA0\xB5\xBB" => "", # U+E0D7B =>
"\xF3\xA0\xB5\xBC" => "", # U+E0D7C =>
"\xF3\xA0\xB5\xBD" => "", # U+E0D7D =>
"\xF3\xA0\xB5\xBE" => "", # U+E0D7E =>
"\xF3\xA0\xB5\xBF" => "", # U+E0D7F =>
"\xF3\xA0\xB6\x80" => "", # U+E0D80 =>
"\xF3\xA0\xB6\x81" => "", # U+E0D81 =>
"\xF3\xA0\xB6\x82" => "", # U+E0D82 =>
"\xF3\xA0\xB6\x83" => "", # U+E0D83 =>
"\xF3\xA0\xB6\x84" => "", # U+E0D84 =>
"\xF3\xA0\xB6\x85" => "", # U+E0D85 =>
"\xF3\xA0\xB6\x86" => "", # U+E0D86 =>
"\xF3\xA0\xB6\x87" => "", # U+E0D87 =>
"\xF3\xA0\xB6\x88" => "", # U+E0D88 =>
"\xF3\xA0\xB6\x89" => "", # U+E0D89 =>
"\xF3\xA0\xB6\x8A" => "", # U+E0D8A =>
"\xF3\xA0\xB6\x8B" => "", # U+E0D8B =>
"\xF3\xA0\xB6\x8C" => "", # U+E0D8C =>
"\xF3\xA0\xB6\x8D" => "", # U+E0D8D =>
"\xF3\xA0\xB6\x8E" => "", # U+E0D8E =>
"\xF3\xA0\xB6\x8F" => "", # U+E0D8F =>
"\xF3\xA0\xB6\x90" => "", # U+E0D90 =>
"\xF3\xA0\xB6\x91" => "", # U+E0D91 =>
"\xF3\xA0\xB6\x92" => "", # U+E0D92 =>
"\xF3\xA0\xB6\x93" => "", # U+E0D93 =>
"\xF3\xA0\xB6\x94" => "", # U+E0D94 =>
"\xF3\xA0\xB6\x95" => "", # U+E0D95 =>
"\xF3\xA0\xB6\x96" => "", # U+E0D96 =>
"\xF3\xA0\xB6\x97" => "", # U+E0D97 =>
"\xF3\xA0\xB6\x98" => "", # U+E0D98 =>
"\xF3\xA0\xB6\x99" => "", # U+E0D99 =>
"\xF3\xA0\xB6\x9A" => "", # U+E0D9A =>
"\xF3\xA0\xB6\x9B" => "", # U+E0D9B =>
"\xF3\xA0\xB6\x9C" => "", # U+E0D9C =>
"\xF3\xA0\xB6\x9D" => "", # U+E0D9D =>
"\xF3\xA0\xB6\x9E" => "", # U+E0D9E =>
"\xF3\xA0\xB6\x9F" => "", # U+E0D9F =>
"\xF3\xA0\xB6\xA0" => "", # U+E0DA0 =>
"\xF3\xA0\xB6\xA1" => "", # U+E0DA1 =>
"\xF3\xA0\xB6\xA2" => "", # U+E0DA2 =>
"\xF3\xA0\xB6\xA3" => "", # U+E0DA3 =>
"\xF3\xA0\xB6\xA4" => "", # U+E0DA4 =>
"\xF3\xA0\xB6\xA5" => "", # U+E0DA5 =>
"\xF3\xA0\xB6\xA6" => "", # U+E0DA6 =>
"\xF3\xA0\xB6\xA7" => "", # U+E0DA7 =>
"\xF3\xA0\xB6\xA8" => "", # U+E0DA8 =>
"\xF3\xA0\xB6\xA9" => "", # U+E0DA9 =>
"\xF3\xA0\xB6\xAA" => "", # U+E0DAA =>
"\xF3\xA0\xB6\xAB" => "", # U+E0DAB =>
"\xF3\xA0\xB6\xAC" => "", # U+E0DAC =>
"\xF3\xA0\xB6\xAD" => "", # U+E0DAD =>
"\xF3\xA0\xB6\xAE" => "", # U+E0DAE =>
"\xF3\xA0\xB6\xAF" => "", # U+E0DAF =>
"\xF3\xA0\xB6\xB0" => "", # U+E0DB0 =>
"\xF3\xA0\xB6\xB1" => "", # U+E0DB1 =>
"\xF3\xA0\xB6\xB2" => "", # U+E0DB2 =>
"\xF3\xA0\xB6\xB3" => "", # U+E0DB3 =>
"\xF3\xA0\xB6\xB4" => "", # U+E0DB4 =>
"\xF3\xA0\xB6\xB5" => "", # U+E0DB5 =>
"\xF3\xA0\xB6\xB6" => "", # U+E0DB6 =>
"\xF3\xA0\xB6\xB7" => "", # U+E0DB7 =>
"\xF3\xA0\xB6\xB8" => "", # U+E0DB8 =>
"\xF3\xA0\xB6\xB9" => "", # U+E0DB9 =>
"\xF3\xA0\xB6\xBA" => "", # U+E0DBA =>
"\xF3\xA0\xB6\xBB" => "", # U+E0DBB =>
"\xF3\xA0\xB6\xBC" => "", # U+E0DBC =>
"\xF3\xA0\xB6\xBD" => "", # U+E0DBD =>
"\xF3\xA0\xB6\xBE" => "", # U+E0DBE =>
"\xF3\xA0\xB6\xBF" => "", # U+E0DBF =>
"\xF3\xA0\xB7\x80" => "", # U+E0DC0 =>
"\xF3\xA0\xB7\x81" => "", # U+E0DC1 =>
"\xF3\xA0\xB7\x82" => "", # U+E0DC2 =>
"\xF3\xA0\xB7\x83" => "", # U+E0DC3 =>
"\xF3\xA0\xB7\x84" => "", # U+E0DC4 =>
"\xF3\xA0\xB7\x85" => "", # U+E0DC5 =>
"\xF3\xA0\xB7\x86" => "", # U+E0DC6 =>
"\xF3\xA0\xB7\x87" => "", # U+E0DC7 =>
"\xF3\xA0\xB7\x88" => "", # U+E0DC8 =>
"\xF3\xA0\xB7\x89" => "", # U+E0DC9 =>
"\xF3\xA0\xB7\x8A" => "", # U+E0DCA =>
"\xF3\xA0\xB7\x8B" => "", # U+E0DCB =>
"\xF3\xA0\xB7\x8C" => "", # U+E0DCC =>
"\xF3\xA0\xB7\x8D" => "", # U+E0DCD =>
"\xF3\xA0\xB7\x8E" => "", # U+E0DCE =>
"\xF3\xA0\xB7\x8F" => "", # U+E0DCF =>
"\xF3\xA0\xB7\x90" => "", # U+E0DD0 =>
"\xF3\xA0\xB7\x91" => "", # U+E0DD1 =>
"\xF3\xA0\xB7\x92" => "", # U+E0DD2 =>
"\xF3\xA0\xB7\x93" => "", # U+E0DD3 =>
"\xF3\xA0\xB7\x94" => "", # U+E0DD4 =>
"\xF3\xA0\xB7\x95" => "", # U+E0DD5 =>
"\xF3\xA0\xB7\x96" => "", # U+E0DD6 =>
"\xF3\xA0\xB7\x97" => "", # U+E0DD7 =>
"\xF3\xA0\xB7\x98" => "", # U+E0DD8 =>
"\xF3\xA0\xB7\x99" => "", # U+E0DD9 =>
"\xF3\xA0\xB7\x9A" => "", # U+E0DDA =>
"\xF3\xA0\xB7\x9B" => "", # U+E0DDB =>
"\xF3\xA0\xB7\x9C" => "", # U+E0DDC =>
"\xF3\xA0\xB7\x9D" => "", # U+E0DDD =>
"\xF3\xA0\xB7\x9E" => "", # U+E0DDE =>
"\xF3\xA0\xB7\x9F" => "", # U+E0DDF =>
"\xF3\xA0\xB7\xA0" => "", # U+E0DE0 =>
"\xF3\xA0\xB7\xA1" => "", # U+E0DE1 =>
"\xF3\xA0\xB7\xA2" => "", # U+E0DE2 =>
"\xF3\xA0\xB7\xA3" => "", # U+E0DE3 =>
"\xF3\xA0\xB7\xA4" => "", # U+E0DE4 =>
"\xF3\xA0\xB7\xA5" => "", # U+E0DE5 =>
"\xF3\xA0\xB7\xA6" => "", # U+E0DE6 =>
"\xF3\xA0\xB7\xA7" => "", # U+E0DE7 =>
"\xF3\xA0\xB7\xA8" => "", # U+E0DE8 =>
"\xF3\xA0\xB7\xA9" => "", # U+E0DE9 =>
"\xF3\xA0\xB7\xAA" => "", # U+E0DEA =>
"\xF3\xA0\xB7\xAB" => "", # U+E0DEB =>
"\xF3\xA0\xB7\xAC" => "", # U+E0DEC =>
"\xF3\xA0\xB7\xAD" => "", # U+E0DED =>
"\xF3\xA0\xB7\xAE" => "", # U+E0DEE =>
"\xF3\xA0\xB7\xAF" => "", # U+E0DEF =>
"\xF3\xA0\xB7\xB0" => "", # U+E0DF0 =>
"\xF3\xA0\xB7\xB1" => "", # U+E0DF1 =>
"\xF3\xA0\xB7\xB2" => "", # U+E0DF2 =>
"\xF3\xA0\xB7\xB3" => "", # U+E0DF3 =>
"\xF3\xA0\xB7\xB4" => "", # U+E0DF4 =>
"\xF3\xA0\xB7\xB5" => "", # U+E0DF5 =>
"\xF3\xA0\xB7\xB6" => "", # U+E0DF6 =>
"\xF3\xA0\xB7\xB7" => "", # U+E0DF7 =>
"\xF3\xA0\xB7\xB8" => "", # U+E0DF8 =>
"\xF3\xA0\xB7\xB9" => "", # U+E0DF9 =>
"\xF3\xA0\xB7\xBA" => "", # U+E0DFA =>
"\xF3\xA0\xB7\xBB" => "", # U+E0DFB =>
"\xF3\xA0\xB7\xBC" => "", # U+E0DFC =>
"\xF3\xA0\xB7\xBD" => "", # U+E0DFD =>
"\xF3\xA0\xB7\xBE" => "", # U+E0DFE =>
"\xF3\xA0\xB7\xBF" => "", # U+E0DFF =>
"\xF3\xA0\xB8\x80" => "", # U+E0E00 =>
"\xF3\xA0\xB8\x81" => "", # U+E0E01 =>
"\xF3\xA0\xB8\x82" => "", # U+E0E02 =>
"\xF3\xA0\xB8\x83" => "", # U+E0E03 =>
"\xF3\xA0\xB8\x84" => "", # U+E0E04 =>
"\xF3\xA0\xB8\x85" => "", # U+E0E05 =>
"\xF3\xA0\xB8\x86" => "", # U+E0E06 =>
"\xF3\xA0\xB8\x87" => "", # U+E0E07 =>
"\xF3\xA0\xB8\x88" => "", # U+E0E08 =>
"\xF3\xA0\xB8\x89" => "", # U+E0E09 =>
"\xF3\xA0\xB8\x8A" => "", # U+E0E0A =>
"\xF3\xA0\xB8\x8B" => "", # U+E0E0B =>
"\xF3\xA0\xB8\x8C" => "", # U+E0E0C =>
"\xF3\xA0\xB8\x8D" => "", # U+E0E0D =>
"\xF3\xA0\xB8\x8E" => "", # U+E0E0E =>
"\xF3\xA0\xB8\x8F" => "", # U+E0E0F =>
"\xF3\xA0\xB8\x90" => "", # U+E0E10 =>
"\xF3\xA0\xB8\x91" => "", # U+E0E11 =>
"\xF3\xA0\xB8\x92" => "", # U+E0E12 =>
"\xF3\xA0\xB8\x93" => "", # U+E0E13 =>
"\xF3\xA0\xB8\x94" => "", # U+E0E14 =>
"\xF3\xA0\xB8\x95" => "", # U+E0E15 =>
"\xF3\xA0\xB8\x96" => "", # U+E0E16 =>
"\xF3\xA0\xB8\x97" => "", # U+E0E17 =>
"\xF3\xA0\xB8\x98" => "", # U+E0E18 =>
"\xF3\xA0\xB8\x99" => "", # U+E0E19 =>
"\xF3\xA0\xB8\x9A" => "", # U+E0E1A =>
"\xF3\xA0\xB8\x9B" => "", # U+E0E1B =>
"\xF3\xA0\xB8\x9C" => "", # U+E0E1C =>
"\xF3\xA0\xB8\x9D" => "", # U+E0E1D =>
"\xF3\xA0\xB8\x9E" => "", # U+E0E1E =>
"\xF3\xA0\xB8\x9F" => "", # U+E0E1F =>
"\xF3\xA0\xB8\xA0" => "", # U+E0E20 =>
"\xF3\xA0\xB8\xA1" => "", # U+E0E21 =>
"\xF3\xA0\xB8\xA2" => "", # U+E0E22 =>
"\xF3\xA0\xB8\xA3" => "", # U+E0E23 =>
"\xF3\xA0\xB8\xA4" => "", # U+E0E24 =>
"\xF3\xA0\xB8\xA5" => "", # U+E0E25 =>
"\xF3\xA0\xB8\xA6" => "", # U+E0E26 =>
"\xF3\xA0\xB8\xA7" => "", # U+E0E27 =>
"\xF3\xA0\xB8\xA8" => "", # U+E0E28 =>
"\xF3\xA0\xB8\xA9" => "", # U+E0E29 =>
"\xF3\xA0\xB8\xAA" => "", # U+E0E2A =>
"\xF3\xA0\xB8\xAB" => "", # U+E0E2B =>
"\xF3\xA0\xB8\xAC" => "", # U+E0E2C =>
"\xF3\xA0\xB8\xAD" => "", # U+E0E2D =>
"\xF3\xA0\xB8\xAE" => "", # U+E0E2E =>
"\xF3\xA0\xB8\xAF" => "", # U+E0E2F =>
"\xF3\xA0\xB8\xB0" => "", # U+E0E30 =>
"\xF3\xA0\xB8\xB1" => "", # U+E0E31 =>
"\xF3\xA0\xB8\xB2" => "", # U+E0E32 =>
"\xF3\xA0\xB8\xB3" => "", # U+E0E33 =>
"\xF3\xA0\xB8\xB4" => "", # U+E0E34 =>
"\xF3\xA0\xB8\xB5" => "", # U+E0E35 =>
"\xF3\xA0\xB8\xB6" => "", # U+E0E36 =>
"\xF3\xA0\xB8\xB7" => "", # U+E0E37 =>
"\xF3\xA0\xB8\xB8" => "", # U+E0E38 =>
"\xF3\xA0\xB8\xB9" => "", # U+E0E39 =>
"\xF3\xA0\xB8\xBA" => "", # U+E0E3A =>
"\xF3\xA0\xB8\xBB" => "", # U+E0E3B =>
"\xF3\xA0\xB8\xBC" => "", # U+E0E3C =>
"\xF3\xA0\xB8\xBD" => "", # U+E0E3D =>
"\xF3\xA0\xB8\xBE" => "", # U+E0E3E =>
"\xF3\xA0\xB8\xBF" => "", # U+E0E3F =>
"\xF3\xA0\xB9\x80" => "", # U+E0E40 =>
"\xF3\xA0\xB9\x81" => "", # U+E0E41 =>
"\xF3\xA0\xB9\x82" => "", # U+E0E42 =>
"\xF3\xA0\xB9\x83" => "", # U+E0E43 =>
"\xF3\xA0\xB9\x84" => "", # U+E0E44 =>
"\xF3\xA0\xB9\x85" => "", # U+E0E45 =>
"\xF3\xA0\xB9\x86" => "", # U+E0E46 =>
"\xF3\xA0\xB9\x87" => "", # U+E0E47 =>
"\xF3\xA0\xB9\x88" => "", # U+E0E48 =>
"\xF3\xA0\xB9\x89" => "", # U+E0E49 =>
"\xF3\xA0\xB9\x8A" => "", # U+E0E4A =>
"\xF3\xA0\xB9\x8B" => "", # U+E0E4B =>
"\xF3\xA0\xB9\x8C" => "", # U+E0E4C =>
"\xF3\xA0\xB9\x8D" => "", # U+E0E4D =>
"\xF3\xA0\xB9\x8E" => "", # U+E0E4E =>
"\xF3\xA0\xB9\x8F" => "", # U+E0E4F =>
"\xF3\xA0\xB9\x90" => "", # U+E0E50 =>
"\xF3\xA0\xB9\x91" => "", # U+E0E51 =>
"\xF3\xA0\xB9\x92" => "", # U+E0E52 =>
"\xF3\xA0\xB9\x93" => "", # U+E0E53 =>
"\xF3\xA0\xB9\x94" => "", # U+E0E54 =>
"\xF3\xA0\xB9\x95" => "", # U+E0E55 =>
"\xF3\xA0\xB9\x96" => "", # U+E0E56 =>
"\xF3\xA0\xB9\x97" => "", # U+E0E57 =>
"\xF3\xA0\xB9\x98" => "", # U+E0E58 =>
"\xF3\xA0\xB9\x99" => "", # U+E0E59 =>
"\xF3\xA0\xB9\x9A" => "", # U+E0E5A =>
"\xF3\xA0\xB9\x9B" => "", # U+E0E5B =>
"\xF3\xA0\xB9\x9C" => "", # U+E0E5C =>
"\xF3\xA0\xB9\x9D" => "", # U+E0E5D =>
"\xF3\xA0\xB9\x9E" => "", # U+E0E5E =>
"\xF3\xA0\xB9\x9F" => "", # U+E0E5F =>
"\xF3\xA0\xB9\xA0" => "", # U+E0E60 =>
"\xF3\xA0\xB9\xA1" => "", # U+E0E61 =>
"\xF3\xA0\xB9\xA2" => "", # U+E0E62 =>
"\xF3\xA0\xB9\xA3" => "", # U+E0E63 =>
"\xF3\xA0\xB9\xA4" => "", # U+E0E64 =>
"\xF3\xA0\xB9\xA5" => "", # U+E0E65 =>
"\xF3\xA0\xB9\xA6" => "", # U+E0E66 =>
"\xF3\xA0\xB9\xA7" => "", # U+E0E67 =>
"\xF3\xA0\xB9\xA8" => "", # U+E0E68 =>
"\xF3\xA0\xB9\xA9" => "", # U+E0E69 =>
"\xF3\xA0\xB9\xAA" => "", # U+E0E6A =>
"\xF3\xA0\xB9\xAB" => "", # U+E0E6B =>
"\xF3\xA0\xB9\xAC" => "", # U+E0E6C =>
"\xF3\xA0\xB9\xAD" => "", # U+E0E6D =>
"\xF3\xA0\xB9\xAE" => "", # U+E0E6E =>
"\xF3\xA0\xB9\xAF" => "", # U+E0E6F =>
"\xF3\xA0\xB9\xB0" => "", # U+E0E70 =>
"\xF3\xA0\xB9\xB1" => "", # U+E0E71 =>
"\xF3\xA0\xB9\xB2" => "", # U+E0E72 =>
"\xF3\xA0\xB9\xB3" => "", # U+E0E73 =>
"\xF3\xA0\xB9\xB4" => "", # U+E0E74 =>
"\xF3\xA0\xB9\xB5" => "", # U+E0E75 =>
"\xF3\xA0\xB9\xB6" => "", # U+E0E76 =>
"\xF3\xA0\xB9\xB7" => "", # U+E0E77 =>
"\xF3\xA0\xB9\xB8" => "", # U+E0E78 =>
"\xF3\xA0\xB9\xB9" => "", # U+E0E79 =>
"\xF3\xA0\xB9\xBA" => "", # U+E0E7A =>
"\xF3\xA0\xB9\xBB" => "", # U+E0E7B =>
"\xF3\xA0\xB9\xBC" => "", # U+E0E7C =>
"\xF3\xA0\xB9\xBD" => "", # U+E0E7D =>
"\xF3\xA0\xB9\xBE" => "", # U+E0E7E =>
"\xF3\xA0\xB9\xBF" => "", # U+E0E7F =>
"\xF3\xA0\xBA\x80" => "", # U+E0E80 =>
"\xF3\xA0\xBA\x81" => "", # U+E0E81 =>
"\xF3\xA0\xBA\x82" => "", # U+E0E82 =>
"\xF3\xA0\xBA\x83" => "", # U+E0E83 =>
"\xF3\xA0\xBA\x84" => "", # U+E0E84 =>
"\xF3\xA0\xBA\x85" => "", # U+E0E85 =>
"\xF3\xA0\xBA\x86" => "", # U+E0E86 =>
"\xF3\xA0\xBA\x87" => "", # U+E0E87 =>
"\xF3\xA0\xBA\x88" => "", # U+E0E88 =>
"\xF3\xA0\xBA\x89" => "", # U+E0E89 =>
"\xF3\xA0\xBA\x8A" => "", # U+E0E8A =>
"\xF3\xA0\xBA\x8B" => "", # U+E0E8B =>
"\xF3\xA0\xBA\x8C" => "", # U+E0E8C =>
"\xF3\xA0\xBA\x8D" => "", # U+E0E8D =>
"\xF3\xA0\xBA\x8E" => "", # U+E0E8E =>
"\xF3\xA0\xBA\x8F" => "", # U+E0E8F =>
"\xF3\xA0\xBA\x90" => "", # U+E0E90 =>
"\xF3\xA0\xBA\x91" => "", # U+E0E91 =>
"\xF3\xA0\xBA\x92" => "", # U+E0E92 =>
"\xF3\xA0\xBA\x93" => "", # U+E0E93 =>
"\xF3\xA0\xBA\x94" => "", # U+E0E94 =>
"\xF3\xA0\xBA\x95" => "", # U+E0E95 =>
"\xF3\xA0\xBA\x96" => "", # U+E0E96 =>
"\xF3\xA0\xBA\x97" => "", # U+E0E97 =>
"\xF3\xA0\xBA\x98" => "", # U+E0E98 =>
"\xF3\xA0\xBA\x99" => "", # U+E0E99 =>
"\xF3\xA0\xBA\x9A" => "", # U+E0E9A =>
"\xF3\xA0\xBA\x9B" => "", # U+E0E9B =>
"\xF3\xA0\xBA\x9C" => "", # U+E0E9C =>
"\xF3\xA0\xBA\x9D" => "", # U+E0E9D =>
"\xF3\xA0\xBA\x9E" => "", # U+E0E9E =>
"\xF3\xA0\xBA\x9F" => "", # U+E0E9F =>
"\xF3\xA0\xBA\xA0" => "", # U+E0EA0 =>
"\xF3\xA0\xBA\xA1" => "", # U+E0EA1 =>
"\xF3\xA0\xBA\xA2" => "", # U+E0EA2 =>
"\xF3\xA0\xBA\xA3" => "", # U+E0EA3 =>
"\xF3\xA0\xBA\xA4" => "", # U+E0EA4 =>
"\xF3\xA0\xBA\xA5" => "", # U+E0EA5 =>
"\xF3\xA0\xBA\xA6" => "", # U+E0EA6 =>
"\xF3\xA0\xBA\xA7" => "", # U+E0EA7 =>
"\xF3\xA0\xBA\xA8" => "", # U+E0EA8 =>
"\xF3\xA0\xBA\xA9" => "", # U+E0EA9 =>
"\xF3\xA0\xBA\xAA" => "", # U+E0EAA =>
"\xF3\xA0\xBA\xAB" => "", # U+E0EAB =>
"\xF3\xA0\xBA\xAC" => "", # U+E0EAC =>
"\xF3\xA0\xBA\xAD" => "", # U+E0EAD =>
"\xF3\xA0\xBA\xAE" => "", # U+E0EAE =>
"\xF3\xA0\xBA\xAF" => "", # U+E0EAF =>
"\xF3\xA0\xBA\xB0" => "", # U+E0EB0 =>
"\xF3\xA0\xBA\xB1" => "", # U+E0EB1 =>
"\xF3\xA0\xBA\xB2" => "", # U+E0EB2 =>
"\xF3\xA0\xBA\xB3" => "", # U+E0EB3 =>
"\xF3\xA0\xBA\xB4" => "", # U+E0EB4 =>
"\xF3\xA0\xBA\xB5" => "", # U+E0EB5 =>
"\xF3\xA0\xBA\xB6" => "", # U+E0EB6 =>
"\xF3\xA0\xBA\xB7" => "", # U+E0EB7 =>
"\xF3\xA0\xBA\xB8" => "", # U+E0EB8 =>
"\xF3\xA0\xBA\xB9" => "", # U+E0EB9 =>
"\xF3\xA0\xBA\xBA" => "", # U+E0EBA =>
"\xF3\xA0\xBA\xBB" => "", # U+E0EBB =>
"\xF3\xA0\xBA\xBC" => "", # U+E0EBC =>
"\xF3\xA0\xBA\xBD" => "", # U+E0EBD =>
"\xF3\xA0\xBA\xBE" => "", # U+E0EBE =>
"\xF3\xA0\xBA\xBF" => "", # U+E0EBF =>
"\xF3\xA0\xBB\x80" => "", # U+E0EC0 =>
"\xF3\xA0\xBB\x81" => "", # U+E0EC1 =>
"\xF3\xA0\xBB\x82" => "", # U+E0EC2 =>
"\xF3\xA0\xBB\x83" => "", # U+E0EC3 =>
"\xF3\xA0\xBB\x84" => "", # U+E0EC4 =>
"\xF3\xA0\xBB\x85" => "", # U+E0EC5 =>
"\xF3\xA0\xBB\x86" => "", # U+E0EC6 =>
"\xF3\xA0\xBB\x87" => "", # U+E0EC7 =>
"\xF3\xA0\xBB\x88" => "", # U+E0EC8 =>
"\xF3\xA0\xBB\x89" => "", # U+E0EC9 =>
"\xF3\xA0\xBB\x8A" => "", # U+E0ECA =>
"\xF3\xA0\xBB\x8B" => "", # U+E0ECB =>
"\xF3\xA0\xBB\x8C" => "", # U+E0ECC =>
"\xF3\xA0\xBB\x8D" => "", # U+E0ECD =>
"\xF3\xA0\xBB\x8E" => "", # U+E0ECE =>
"\xF3\xA0\xBB\x8F" => "", # U+E0ECF =>
"\xF3\xA0\xBB\x90" => "", # U+E0ED0 =>
"\xF3\xA0\xBB\x91" => "", # U+E0ED1 =>
"\xF3\xA0\xBB\x92" => "", # U+E0ED2 =>
"\xF3\xA0\xBB\x93" => "", # U+E0ED3 =>
"\xF3\xA0\xBB\x94" => "", # U+E0ED4 =>
"\xF3\xA0\xBB\x95" => "", # U+E0ED5 =>
"\xF3\xA0\xBB\x96" => "", # U+E0ED6 =>
"\xF3\xA0\xBB\x97" => "", # U+E0ED7 =>
"\xF3\xA0\xBB\x98" => "", # U+E0ED8 =>
"\xF3\xA0\xBB\x99" => "", # U+E0ED9 =>
"\xF3\xA0\xBB\x9A" => "", # U+E0EDA =>
"\xF3\xA0\xBB\x9B" => "", # U+E0EDB =>
"\xF3\xA0\xBB\x9C" => "", # U+E0EDC =>
"\xF3\xA0\xBB\x9D" => "", # U+E0EDD =>
"\xF3\xA0\xBB\x9E" => "", # U+E0EDE =>
"\xF3\xA0\xBB\x9F" => "", # U+E0EDF =>
"\xF3\xA0\xBB\xA0" => "", # U+E0EE0 =>
"\xF3\xA0\xBB\xA1" => "", # U+E0EE1 =>
"\xF3\xA0\xBB\xA2" => "", # U+E0EE2 =>
"\xF3\xA0\xBB\xA3" => "", # U+E0EE3 =>
"\xF3\xA0\xBB\xA4" => "", # U+E0EE4 =>
"\xF3\xA0\xBB\xA5" => "", # U+E0EE5 =>
"\xF3\xA0\xBB\xA6" => "", # U+E0EE6 =>
"\xF3\xA0\xBB\xA7" => "", # U+E0EE7 =>
"\xF3\xA0\xBB\xA8" => "", # U+E0EE8 =>
"\xF3\xA0\xBB\xA9" => "", # U+E0EE9 =>
"\xF3\xA0\xBB\xAA" => "", # U+E0EEA =>
"\xF3\xA0\xBB\xAB" => "", # U+E0EEB =>
"\xF3\xA0\xBB\xAC" => "", # U+E0EEC =>
"\xF3\xA0\xBB\xAD" => "", # U+E0EED =>
"\xF3\xA0\xBB\xAE" => "", # U+E0EEE =>
"\xF3\xA0\xBB\xAF" => "", # U+E0EEF =>
"\xF3\xA0\xBB\xB0" => "", # U+E0EF0 =>
"\xF3\xA0\xBB\xB1" => "", # U+E0EF1 =>
"\xF3\xA0\xBB\xB2" => "", # U+E0EF2 =>
"\xF3\xA0\xBB\xB3" => "", # U+E0EF3 =>
"\xF3\xA0\xBB\xB4" => "", # U+E0EF4 =>
"\xF3\xA0\xBB\xB5" => "", # U+E0EF5 =>
"\xF3\xA0\xBB\xB6" => "", # U+E0EF6 =>
"\xF3\xA0\xBB\xB7" => "", # U+E0EF7 =>
"\xF3\xA0\xBB\xB8" => "", # U+E0EF8 =>
"\xF3\xA0\xBB\xB9" => "", # U+E0EF9 =>
"\xF3\xA0\xBB\xBA" => "", # U+E0EFA =>
"\xF3\xA0\xBB\xBB" => "", # U+E0EFB =>
"\xF3\xA0\xBB\xBC" => "", # U+E0EFC =>
"\xF3\xA0\xBB\xBD" => "", # U+E0EFD =>
"\xF3\xA0\xBB\xBE" => "", # U+E0EFE =>
"\xF3\xA0\xBB\xBF" => "", # U+E0EFF =>
"\xF3\xA0\xBC\x80" => "", # U+E0F00 =>
"\xF3\xA0\xBC\x81" => "", # U+E0F01 =>
"\xF3\xA0\xBC\x82" => "", # U+E0F02 =>
"\xF3\xA0\xBC\x83" => "", # U+E0F03 =>
"\xF3\xA0\xBC\x84" => "", # U+E0F04 =>
"\xF3\xA0\xBC\x85" => "", # U+E0F05 =>
"\xF3\xA0\xBC\x86" => "", # U+E0F06 =>
"\xF3\xA0\xBC\x87" => "", # U+E0F07 =>
"\xF3\xA0\xBC\x88" => "", # U+E0F08 =>
"\xF3\xA0\xBC\x89" => "", # U+E0F09 =>
"\xF3\xA0\xBC\x8A" => "", # U+E0F0A =>
"\xF3\xA0\xBC\x8B" => "", # U+E0F0B =>
"\xF3\xA0\xBC\x8C" => "", # U+E0F0C =>
"\xF3\xA0\xBC\x8D" => "", # U+E0F0D =>
"\xF3\xA0\xBC\x8E" => "", # U+E0F0E =>
"\xF3\xA0\xBC\x8F" => "", # U+E0F0F =>
"\xF3\xA0\xBC\x90" => "", # U+E0F10 =>
"\xF3\xA0\xBC\x91" => "", # U+E0F11 =>
"\xF3\xA0\xBC\x92" => "", # U+E0F12 =>
"\xF3\xA0\xBC\x93" => "", # U+E0F13 =>
"\xF3\xA0\xBC\x94" => "", # U+E0F14 =>
"\xF3\xA0\xBC\x95" => "", # U+E0F15 =>
"\xF3\xA0\xBC\x96" => "", # U+E0F16 =>
"\xF3\xA0\xBC\x97" => "", # U+E0F17 =>
"\xF3\xA0\xBC\x98" => "", # U+E0F18 =>
"\xF3\xA0\xBC\x99" => "", # U+E0F19 =>
"\xF3\xA0\xBC\x9A" => "", # U+E0F1A =>
"\xF3\xA0\xBC\x9B" => "", # U+E0F1B =>
"\xF3\xA0\xBC\x9C" => "", # U+E0F1C =>
"\xF3\xA0\xBC\x9D" => "", # U+E0F1D =>
"\xF3\xA0\xBC\x9E" => "", # U+E0F1E =>
"\xF3\xA0\xBC\x9F" => "", # U+E0F1F =>
"\xF3\xA0\xBC\xA0" => "", # U+E0F20 =>
"\xF3\xA0\xBC\xA1" => "", # U+E0F21 =>
"\xF3\xA0\xBC\xA2" => "", # U+E0F22 =>
"\xF3\xA0\xBC\xA3" => "", # U+E0F23 =>
"\xF3\xA0\xBC\xA4" => "", # U+E0F24 =>
"\xF3\xA0\xBC\xA5" => "", # U+E0F25 =>
"\xF3\xA0\xBC\xA6" => "", # U+E0F26 =>
"\xF3\xA0\xBC\xA7" => "", # U+E0F27 =>
"\xF3\xA0\xBC\xA8" => "", # U+E0F28 =>
"\xF3\xA0\xBC\xA9" => "", # U+E0F29 =>
"\xF3\xA0\xBC\xAA" => "", # U+E0F2A =>
"\xF3\xA0\xBC\xAB" => "", # U+E0F2B =>
"\xF3\xA0\xBC\xAC" => "", # U+E0F2C =>
"\xF3\xA0\xBC\xAD" => "", # U+E0F2D =>
"\xF3\xA0\xBC\xAE" => "", # U+E0F2E =>
"\xF3\xA0\xBC\xAF" => "", # U+E0F2F =>
"\xF3\xA0\xBC\xB0" => "", # U+E0F30 =>
"\xF3\xA0\xBC\xB1" => "", # U+E0F31 =>
"\xF3\xA0\xBC\xB2" => "", # U+E0F32 =>
"\xF3\xA0\xBC\xB3" => "", # U+E0F33 =>
"\xF3\xA0\xBC\xB4" => "", # U+E0F34 =>
"\xF3\xA0\xBC\xB5" => "", # U+E0F35 =>
"\xF3\xA0\xBC\xB6" => "", # U+E0F36 =>
"\xF3\xA0\xBC\xB7" => "", # U+E0F37 =>
"\xF3\xA0\xBC\xB8" => "", # U+E0F38 =>
"\xF3\xA0\xBC\xB9" => "", # U+E0F39 =>
"\xF3\xA0\xBC\xBA" => "", # U+E0F3A =>
"\xF3\xA0\xBC\xBB" => "", # U+E0F3B =>
"\xF3\xA0\xBC\xBC" => "", # U+E0F3C =>
"\xF3\xA0\xBC\xBD" => "", # U+E0F3D =>
"\xF3\xA0\xBC\xBE" => "", # U+E0F3E =>
"\xF3\xA0\xBC\xBF" => "", # U+E0F3F =>
"\xF3\xA0\xBD\x80" => "", # U+E0F40 =>
"\xF3\xA0\xBD\x81" => "", # U+E0F41 =>
"\xF3\xA0\xBD\x82" => "", # U+E0F42 =>
"\xF3\xA0\xBD\x83" => "", # U+E0F43 =>
"\xF3\xA0\xBD\x84" => "", # U+E0F44 =>
"\xF3\xA0\xBD\x85" => "", # U+E0F45 =>
"\xF3\xA0\xBD\x86" => "", # U+E0F46 =>
"\xF3\xA0\xBD\x87" => "", # U+E0F47 =>
"\xF3\xA0\xBD\x88" => "", # U+E0F48 =>
"\xF3\xA0\xBD\x89" => "", # U+E0F49 =>
"\xF3\xA0\xBD\x8A" => "", # U+E0F4A =>
"\xF3\xA0\xBD\x8B" => "", # U+E0F4B =>
"\xF3\xA0\xBD\x8C" => "", # U+E0F4C =>
"\xF3\xA0\xBD\x8D" => "", # U+E0F4D =>
"\xF3\xA0\xBD\x8E" => "", # U+E0F4E =>
"\xF3\xA0\xBD\x8F" => "", # U+E0F4F =>
"\xF3\xA0\xBD\x90" => "", # U+E0F50 =>
"\xF3\xA0\xBD\x91" => "", # U+E0F51 =>
"\xF3\xA0\xBD\x92" => "", # U+E0F52 =>
"\xF3\xA0\xBD\x93" => "", # U+E0F53 =>
"\xF3\xA0\xBD\x94" => "", # U+E0F54 =>
"\xF3\xA0\xBD\x95" => "", # U+E0F55 =>
"\xF3\xA0\xBD\x96" => "", # U+E0F56 =>
"\xF3\xA0\xBD\x97" => "", # U+E0F57 =>
"\xF3\xA0\xBD\x98" => "", # U+E0F58 =>
"\xF3\xA0\xBD\x99" => "", # U+E0F59 =>
"\xF3\xA0\xBD\x9A" => "", # U+E0F5A =>
"\xF3\xA0\xBD\x9B" => "", # U+E0F5B =>
"\xF3\xA0\xBD\x9C" => "", # U+E0F5C =>
"\xF3\xA0\xBD\x9D" => "", # U+E0F5D =>
"\xF3\xA0\xBD\x9E" => "", # U+E0F5E =>
"\xF3\xA0\xBD\x9F" => "", # U+E0F5F =>
"\xF3\xA0\xBD\xA0" => "", # U+E0F60 =>
"\xF3\xA0\xBD\xA1" => "", # U+E0F61 =>
"\xF3\xA0\xBD\xA2" => "", # U+E0F62 =>
"\xF3\xA0\xBD\xA3" => "", # U+E0F63 =>
"\xF3\xA0\xBD\xA4" => "", # U+E0F64 =>
"\xF3\xA0\xBD\xA5" => "", # U+E0F65 =>
"\xF3\xA0\xBD\xA6" => "", # U+E0F66 =>
"\xF3\xA0\xBD\xA7" => "", # U+E0F67 =>
"\xF3\xA0\xBD\xA8" => "", # U+E0F68 =>
"\xF3\xA0\xBD\xA9" => "", # U+E0F69 =>
"\xF3\xA0\xBD\xAA" => "", # U+E0F6A =>
"\xF3\xA0\xBD\xAB" => "", # U+E0F6B =>
"\xF3\xA0\xBD\xAC" => "", # U+E0F6C =>
"\xF3\xA0\xBD\xAD" => "", # U+E0F6D =>
"\xF3\xA0\xBD\xAE" => "", # U+E0F6E =>
"\xF3\xA0\xBD\xAF" => "", # U+E0F6F =>
"\xF3\xA0\xBD\xB0" => "", # U+E0F70 =>
"\xF3\xA0\xBD\xB1" => "", # U+E0F71 =>
"\xF3\xA0\xBD\xB2" => "", # U+E0F72 =>
"\xF3\xA0\xBD\xB3" => "", # U+E0F73 =>
"\xF3\xA0\xBD\xB4" => "", # U+E0F74 =>
"\xF3\xA0\xBD\xB5" => "", # U+E0F75 =>
"\xF3\xA0\xBD\xB6" => "", # U+E0F76 =>
"\xF3\xA0\xBD\xB7" => "", # U+E0F77 =>
"\xF3\xA0\xBD\xB8" => "", # U+E0F78 =>
"\xF3\xA0\xBD\xB9" => "", # U+E0F79 =>
"\xF3\xA0\xBD\xBA" => "", # U+E0F7A =>
"\xF3\xA0\xBD\xBB" => "", # U+E0F7B =>
"\xF3\xA0\xBD\xBC" => "", # U+E0F7C =>
"\xF3\xA0\xBD\xBD" => "", # U+E0F7D =>
"\xF3\xA0\xBD\xBE" => "", # U+E0F7E =>
"\xF3\xA0\xBD\xBF" => "", # U+E0F7F =>
"\xF3\xA0\xBE\x80" => "", # U+E0F80 =>
"\xF3\xA0\xBE\x81" => "", # U+E0F81 =>
"\xF3\xA0\xBE\x82" => "", # U+E0F82 =>
"\xF3\xA0\xBE\x83" => "", # U+E0F83 =>
"\xF3\xA0\xBE\x84" => "", # U+E0F84 =>
"\xF3\xA0\xBE\x85" => "", # U+E0F85 =>
"\xF3\xA0\xBE\x86" => "", # U+E0F86 =>
"\xF3\xA0\xBE\x87" => "", # U+E0F87 =>
"\xF3\xA0\xBE\x88" => "", # U+E0F88 =>
"\xF3\xA0\xBE\x89" => "", # U+E0F89 =>
"\xF3\xA0\xBE\x8A" => "", # U+E0F8A =>
"\xF3\xA0\xBE\x8B" => "", # U+E0F8B =>
"\xF3\xA0\xBE\x8C" => "", # U+E0F8C =>
"\xF3\xA0\xBE\x8D" => "", # U+E0F8D =>
"\xF3\xA0\xBE\x8E" => "", # U+E0F8E =>
"\xF3\xA0\xBE\x8F" => "", # U+E0F8F =>
"\xF3\xA0\xBE\x90" => "", # U+E0F90 =>
"\xF3\xA0\xBE\x91" => "", # U+E0F91 =>
"\xF3\xA0\xBE\x92" => "", # U+E0F92 =>
"\xF3\xA0\xBE\x93" => "", # U+E0F93 =>
"\xF3\xA0\xBE\x94" => "", # U+E0F94 =>
"\xF3\xA0\xBE\x95" => "", # U+E0F95 =>
"\xF3\xA0\xBE\x96" => "", # U+E0F96 =>
"\xF3\xA0\xBE\x97" => "", # U+E0F97 =>
"\xF3\xA0\xBE\x98" => "", # U+E0F98 =>
"\xF3\xA0\xBE\x99" => "", # U+E0F99 =>
"\xF3\xA0\xBE\x9A" => "", # U+E0F9A =>
"\xF3\xA0\xBE\x9B" => "", # U+E0F9B =>
"\xF3\xA0\xBE\x9C" => "", # U+E0F9C =>
"\xF3\xA0\xBE\x9D" => "", # U+E0F9D =>
"\xF3\xA0\xBE\x9E" => "", # U+E0F9E =>
"\xF3\xA0\xBE\x9F" => "", # U+E0F9F =>
"\xF3\xA0\xBE\xA0" => "", # U+E0FA0 =>
"\xF3\xA0\xBE\xA1" => "", # U+E0FA1 =>
"\xF3\xA0\xBE\xA2" => "", # U+E0FA2 =>
"\xF3\xA0\xBE\xA3" => "", # U+E0FA3 =>
"\xF3\xA0\xBE\xA4" => "", # U+E0FA4 =>
"\xF3\xA0\xBE\xA5" => "", # U+E0FA5 =>
"\xF3\xA0\xBE\xA6" => "", # U+E0FA6 =>
"\xF3\xA0\xBE\xA7" => "", # U+E0FA7 =>
"\xF3\xA0\xBE\xA8" => "", # U+E0FA8 =>
"\xF3\xA0\xBE\xA9" => "", # U+E0FA9 =>
"\xF3\xA0\xBE\xAA" => "", # U+E0FAA =>
"\xF3\xA0\xBE\xAB" => "", # U+E0FAB =>
"\xF3\xA0\xBE\xAC" => "", # U+E0FAC =>
"\xF3\xA0\xBE\xAD" => "", # U+E0FAD =>
"\xF3\xA0\xBE\xAE" => "", # U+E0FAE =>
"\xF3\xA0\xBE\xAF" => "", # U+E0FAF =>
"\xF3\xA0\xBE\xB0" => "", # U+E0FB0 =>
"\xF3\xA0\xBE\xB1" => "", # U+E0FB1 =>
"\xF3\xA0\xBE\xB2" => "", # U+E0FB2 =>
"\xF3\xA0\xBE\xB3" => "", # U+E0FB3 =>
"\xF3\xA0\xBE\xB4" => "", # U+E0FB4 =>
"\xF3\xA0\xBE\xB5" => "", # U+E0FB5 =>
"\xF3\xA0\xBE\xB6" => "", # U+E0FB6 =>
"\xF3\xA0\xBE\xB7" => "", # U+E0FB7 =>
"\xF3\xA0\xBE\xB8" => "", # U+E0FB8 =>
"\xF3\xA0\xBE\xB9" => "", # U+E0FB9 =>
"\xF3\xA0\xBE\xBA" => "", # U+E0FBA =>
"\xF3\xA0\xBE\xBB" => "", # U+E0FBB =>
"\xF3\xA0\xBE\xBC" => "", # U+E0FBC =>
"\xF3\xA0\xBE\xBD" => "", # U+E0FBD =>
"\xF3\xA0\xBE\xBE" => "", # U+E0FBE =>
"\xF3\xA0\xBE\xBF" => "", # U+E0FBF =>
"\xF3\xA0\xBF\x80" => "", # U+E0FC0 =>
"\xF3\xA0\xBF\x81" => "", # U+E0FC1 =>
"\xF3\xA0\xBF\x82" => "", # U+E0FC2 =>
"\xF3\xA0\xBF\x83" => "", # U+E0FC3 =>
"\xF3\xA0\xBF\x84" => "", # U+E0FC4 =>
"\xF3\xA0\xBF\x85" => "", # U+E0FC5 =>
"\xF3\xA0\xBF\x86" => "", # U+E0FC6 =>
"\xF3\xA0\xBF\x87" => "", # U+E0FC7 =>
"\xF3\xA0\xBF\x88" => "", # U+E0FC8 =>
"\xF3\xA0\xBF\x89" => "", # U+E0FC9 =>
"\xF3\xA0\xBF\x8A" => "", # U+E0FCA =>
"\xF3\xA0\xBF\x8B" => "", # U+E0FCB =>
"\xF3\xA0\xBF\x8C" => "", # U+E0FCC =>
"\xF3\xA0\xBF\x8D" => "", # U+E0FCD =>
"\xF3\xA0\xBF\x8E" => "", # U+E0FCE =>
"\xF3\xA0\xBF\x8F" => "", # U+E0FCF =>
"\xF3\xA0\xBF\x90" => "", # U+E0FD0 =>
"\xF3\xA0\xBF\x91" => "", # U+E0FD1 =>
"\xF3\xA0\xBF\x92" => "", # U+E0FD2 =>
"\xF3\xA0\xBF\x93" => "", # U+E0FD3 =>
"\xF3\xA0\xBF\x94" => "", # U+E0FD4 =>
"\xF3\xA0\xBF\x95" => "", # U+E0FD5 =>
"\xF3\xA0\xBF\x96" => "", # U+E0FD6 =>
"\xF3\xA0\xBF\x97" => "", # U+E0FD7 =>
"\xF3\xA0\xBF\x98" => "", # U+E0FD8 =>
"\xF3\xA0\xBF\x99" => "", # U+E0FD9 =>
"\xF3\xA0\xBF\x9A" => "", # U+E0FDA =>
"\xF3\xA0\xBF\x9B" => "", # U+E0FDB =>
"\xF3\xA0\xBF\x9C" => "", # U+E0FDC =>
"\xF3\xA0\xBF\x9D" => "", # U+E0FDD =>
"\xF3\xA0\xBF\x9E" => "", # U+E0FDE =>
"\xF3\xA0\xBF\x9F" => "", # U+E0FDF =>
"\xF3\xA0\xBF\xA0" => "", # U+E0FE0 =>
"\xF3\xA0\xBF\xA1" => "", # U+E0FE1 =>
"\xF3\xA0\xBF\xA2" => "", # U+E0FE2 =>
"\xF3\xA0\xBF\xA3" => "", # U+E0FE3 =>
"\xF3\xA0\xBF\xA4" => "", # U+E0FE4 =>
"\xF3\xA0\xBF\xA5" => "", # U+E0FE5 =>
"\xF3\xA0\xBF\xA6" => "", # U+E0FE6 =>
"\xF3\xA0\xBF\xA7" => "", # U+E0FE7 =>
"\xF3\xA0\xBF\xA8" => "", # U+E0FE8 =>
"\xF3\xA0\xBF\xA9" => "", # U+E0FE9 =>
"\xF3\xA0\xBF\xAA" => "", # U+E0FEA =>
"\xF3\xA0\xBF\xAB" => "", # U+E0FEB =>
"\xF3\xA0\xBF\xAC" => "", # U+E0FEC =>
"\xF3\xA0\xBF\xAD" => "", # U+E0FED =>
"\xF3\xA0\xBF\xAE" => "", # U+E0FEE =>
"\xF3\xA0\xBF\xAF" => "", # U+E0FEF =>
"\xF3\xA0\xBF\xB0" => "", # U+E0FF0 =>
"\xF3\xA0\xBF\xB1" => "", # U+E0FF1 =>
"\xF3\xA0\xBF\xB2" => "", # U+E0FF2 =>
"\xF3\xA0\xBF\xB3" => "", # U+E0FF3 =>
"\xF3\xA0\xBF\xB4" => "", # U+E0FF4 =>
"\xF3\xA0\xBF\xB5" => "", # U+E0FF5 =>
"\xF3\xA0\xBF\xB6" => "", # U+E0FF6 =>
"\xF3\xA0\xBF\xB7" => "", # U+E0FF7 =>
"\xF3\xA0\xBF\xB8" => "", # U+E0FF8 =>
"\xF3\xA0\xBF\xB9" => "", # U+E0FF9 =>
"\xF3\xA0\xBF\xBA" => "", # U+E0FFA =>
"\xF3\xA0\xBF\xBB" => "", # U+E0FFB =>
"\xF3\xA0\xBF\xBC" => "", # U+E0FFC =>
"\xF3\xA0\xBF\xBD" => "", # U+E0FFD =>
"\xF3\xA0\xBF\xBE" => "", # U+E0FFE =>
"\xF3\xA0\xBF\xBF" => "", # U+E0FFF =>
);
return <<'END';
0041 0061
0042 0062
0043 0063
0044 0064
0045 0065
0046 0066
0047 0067
0048 0068
0049 0069
004A 006A
004B 006B
004C 006C
004D 006D
004E 006E
004F 006F
0050 0070
0051 0071
0052 0072
0053 0073
0054 0074
0055 0075
0056 0076
0057 0077
0058 0078
0059 0079
005A 007A
00A0 0020
00AA 0061
00B2 0032
00B3 0033
00B5 03BC
00B9 0031
00BA 006F
00C0 00E0
00C1 00E1
00C2 00E2
00C3 00E3
00C4 00E4
00C5 00E5
00C6 00E6
00C7 00E7
00C8 00E8
00C9 00E9
00CA 00EA
00CB 00EB
00CC 00EC
00CD 00ED
00CE 00EE
00CF 00EF
00D0 00F0
00D1 00F1
00D2 00F2
00D3 00F3
00D4 00F4
00D5 00F5
00D6 00F6
00D8 00F8
00D9 00F9
00DA 00FA
00DB 00FB
00DC 00FC
00DD 00FD
00DE 00FE
0100 0101
0102 0103
0104 0105
0106 0107
0108 0109
010A 010B
010C 010D
010E 010F
0110 0111
0112 0113
0114 0115
0116 0117
0118 0119
011A 011B
011C 011D
011E 011F
0120 0121
0122 0123
0124 0125
0126 0127
0128 0129
012A 012B
012C 012D
012E 012F
0134 0135
0136 0137
0139 013A
013B 013C
013D 013E
0141 0142
0143 0144
0145 0146
0147 0148
014A 014B
014C 014D
014E 014F
0150 0151
0152 0153
0154 0155
0156 0157
0158 0159
015A 015B
015C 015D
015E 015F
0160 0161
0162 0163
0164 0165
0166 0167
0168 0169
016A 016B
016C 016D
016E 016F
0170 0171
0172 0173
0174 0175
0176 0177
0178 00FF
0179 017A
017B 017C
017D 017E
017F 0073
0181 0253
0182 0183
0184 0185
0186 0254
0187 0188
0189 0256
018A 0257
018B 018C
018E 01DD
018F 0259
0190 025B
0191 0192
0193 0260
0194 0263
0196 0269
0197 0268
0198 0199
019C 026F
019D 0272
019F 0275
01A0 01A1
01A2 01A3
01A4 01A5
01A6 0280
01A7 01A8
01A9 0283
01AC 01AD
01AE 0288
01AF 01B0
01B1 028A
01B2 028B
01B3 01B4
01B5 01B6
01B7 0292
01B8 01B9
01BC 01BD
01CD 01CE
01CF 01D0
01D1 01D2
01D3 01D4
01D5 01D6
01D7 01D8
01D9 01DA
01DB 01DC
01DE 01DF
01E0 01E1
01E2 01E3
01E4 01E5
01E6 01E7
01E8 01E9
01EA 01EB
01EC 01ED
01EE 01EF
01F4 01F5
01F6 0195
01F7 01BF
01F8 01F9
01FA 01FB
01FC 01FD
01FE 01FF
0200 0201
0202 0203
0204 0205
0206 0207
0208 0209
020A 020B
020C 020D
020E 020F
0210 0211
0212 0213
0214 0215
0216 0217
0218 0219
021A 021B
021C 021D
021E 021F
0220 019E
0222 0223
0224 0225
0226 0227
0228 0229
022A 022B
022C 022D
022E 022F
0230 0231
0232 0233
023A 2C65
023B 023C
023D 019A
023E 2C66
0241 0242
0243 0180
0244 0289
0245 028C
0246 0247
0248 0249
024A 024B
024C 024D
024E 024F
02B0 0068
02B1 0266
02B2 006A
02B3 0072
02B4 0279
02B5 027B
02B6 0281
02B7 0077
02B8 0079
02E0 0263
02E1 006C
02E2 0073
02E3 0078
02E4 0295
0340 0300
0341 0301
0343 0313
0345 03B9
0370 0371
0372 0373
0374 02B9
0376 0377
037E 003B
0386 03AC
0387 00B7
0388 03AD
0389 03AE
038A 03AF
038C 03CC
038E 03CD
038F 03CE
0391 03B1
0392 03B2
0393 03B3
0394 03B4
0395 03B5
0396 03B6
0397 03B7
0398 03B8
0399 03B9
039A 03BA
039B 03BB
039C 03BC
039D 03BD
039E 03BE
039F 03BF
03A0 03C0
03A1 03C1
03A3 03C3
03A4 03C4
03A5 03C5
03A6 03C6
03A7 03C7
03A8 03C8
03A9 03C9
03AA 03CA
03AB 03CB
03C2 03C3
03CF 03D7
03D0 03B2
03D1 03B8
03D2 03C5
03D3 03CD
03D4 03CB
03D5 03C6
03D6 03C0
03D8 03D9
03DA 03DB
03DC 03DD
03DE 03DF
03E0 03E1
03E2 03E3
03E4 03E5
03E6 03E7
03E8 03E9
03EA 03EB
03EC 03ED
03EE 03EF
03F0 03BA
03F1 03C1
03F2 03C3
03F4 03B8
03F5 03B5
03F7 03F8
03F9 03C3
03FA 03FB
03FD 037B
03FE 037C
03FF 037D
0400 0450
0401 0451
0402 0452
0403 0453
0404 0454
0405 0455
0406 0456
0407 0457
0408 0458
0409 0459
040A 045A
040B 045B
040C 045C
040D 045D
040E 045E
040F 045F
0410 0430
0411 0431
0412 0432
0413 0433
0414 0434
0415 0435
0416 0436
0417 0437
0418 0438
0419 0439
041A 043A
041B 043B
041C 043C
041D 043D
041E 043E
041F 043F
0420 0440
0421 0441
0422 0442
0423 0443
0424 0444
0425 0445
0426 0446
0427 0447
0428 0448
0429 0449
042A 044A
042B 044B
042C 044C
042D 044D
042E 044E
042F 044F
0460 0461
0462 0463
0464 0465
0466 0467
0468 0469
046A 046B
046C 046D
046E 046F
0470 0471
0472 0473
0474 0475
0476 0477
0478 0479
047A 047B
047C 047D
047E 047F
0480 0481
048A 048B
048C 048D
048E 048F
0490 0491
0492 0493
0494 0495
0496 0497
0498 0499
049A 049B
049C 049D
049E 049F
04A0 04A1
04A2 04A3
04A4 04A5
04A6 04A7
04A8 04A9
04AA 04AB
04AC 04AD
04AE 04AF
04B0 04B1
04B2 04B3
04B4 04B5
04B6 04B7
04B8 04B9
04BA 04BB
04BC 04BD
04BE 04BF
04C0 04CF
04C1 04C2
04C3 04C4
04C5 04C6
04C7 04C8
04C9 04CA
04CB 04CC
04CD 04CE
04D0 04D1
04D2 04D3
04D4 04D5
04D6 04D7
04D8 04D9
04DA 04DB
04DC 04DD
04DE 04DF
04E0 04E1
04E2 04E3
04E4 04E5
04E6 04E7
04E8 04E9
04EA 04EB
04EC 04ED
04EE 04EF
04F0 04F1
04F2 04F3
04F4 04F5
04F6 04F7
04F8 04F9
04FA 04FB
04FC 04FD
04FE 04FF
0500 0501
0502 0503
0504 0505
0506 0507
0508 0509
050A 050B
050C 050D
050E 050F
0510 0511
0512 0513
0514 0515
0516 0517
0518 0519
051A 051B
051C 051D
051E 051F
0520 0521
0522 0523
0524 0525
0526 0527
0531 0561
0532 0562
0533 0563
0534 0564
0535 0565
0536 0566
0537 0567
0538 0568
0539 0569
053A 056A
053B 056B
053C 056C
053D 056D
053E 056E
053F 056F
0540 0570
0541 0571
0542 0572
0543 0573
0544 0574
0545 0575
0546 0576
0547 0577
0548 0578
0549 0579
054A 057A
054B 057B
054C 057C
054D 057D
054E 057E
054F 057F
0550 0580
0551 0581
0552 0582
0553 0583
0554 0584
0555 0585
0556 0586
0F0C 0F0B
10A0 2D00
10A1 2D01
10A2 2D02
10A3 2D03
10A4 2D04
10A5 2D05
10A6 2D06
10A7 2D07
10A8 2D08
10A9 2D09
10AA 2D0A
10AB 2D0B
10AC 2D0C
10AD 2D0D
10AE 2D0E
10AF 2D0F
10B0 2D10
10B1 2D11
10B2 2D12
10B3 2D13
10B4 2D14
10B5 2D15
10B6 2D16
10B7 2D17
10B8 2D18
10B9 2D19
10BA 2D1A
10BB 2D1B
10BC 2D1C
10BD 2D1D
10BE 2D1E
10BF 2D1F
10C0 2D20
10C1 2D21
10C2 2D22
10C3 2D23
10C4 2D24
10C5 2D25
10C7 2D27
10CD 2D2D
10FC 10DC
1D2C 0061
1D2D 00E6
1D2E 0062
1D30 0064
1D31 0065
1D32 01DD
1D33 0067
1D34 0068
1D35 0069
1D36 006A
1D37 006B
1D38 006C
1D39 006D
1D3A 006E
1D3C 006F
1D3D 0223
1D3E 0070
1D3F 0072
1D40 0074
1D41 0075
1D42 0077
1D43 0061
1D44 0250
1D45 0251
1D46 1D02
1D47 0062
1D48 0064
1D49 0065
1D4A 0259
1D4B 025B
1D4C 025C
1D4D 0067
1D4F 006B
1D50 006D
1D51 014B
1D52 006F
1D53 0254
1D54 1D16
1D55 1D17
1D56 0070
1D57 0074
1D58 0075
1D59 1D1D
1D5A 026F
1D5B 0076
1D5C 1D25
1D5D 03B2
1D5E 03B3
1D5F 03B4
1D60 03C6
1D61 03C7
1D62 0069
1D63 0072
1D64 0075
1D65 0076
1D66 03B2
1D67 03B3
1D68 03C1
1D69 03C6
1D6A 03C7
1D78 043D
1D9B 0252
1D9C 0063
1D9D 0255
1D9E 00F0
1D9F 025C
1DA0 0066
1DA1 025F
1DA2 0261
1DA3 0265
1DA4 0268
1DA5 0269
1DA6 026A
1DA7 1D7B
1DA8 029D
1DA9 026D
1DAA 1D85
1DAB 029F
1DAC 0271
1DAD 0270
1DAE 0272
1DAF 0273
1DB0 0274
1DB1 0275
1DB2 0278
1DB3 0282
1DB4 0283
1DB5 01AB
1DB6 0289
1DB7 028A
1DB8 1D1C
1DB9 028B
1DBA 028C
1DBB 007A
1DBC 0290
1DBD 0291
1DBE 0292
1DBF 03B8
1E00 1E01
1E02 1E03
1E04 1E05
1E06 1E07
1E08 1E09
1E0A 1E0B
1E0C 1E0D
1E0E 1E0F
1E10 1E11
1E12 1E13
1E14 1E15
1E16 1E17
1E18 1E19
1E1A 1E1B
1E1C 1E1D
1E1E 1E1F
1E20 1E21
1E22 1E23
1E24 1E25
1E26 1E27
1E28 1E29
1E2A 1E2B
1E2C 1E2D
1E2E 1E2F
1E30 1E31
1E32 1E33
1E34 1E35
1E36 1E37
1E38 1E39
1E3A 1E3B
1E3C 1E3D
1E3E 1E3F
1E40 1E41
1E42 1E43
1E44 1E45
1E46 1E47
1E48 1E49
1E4A 1E4B
1E4C 1E4D
1E4E 1E4F
1E50 1E51
1E52 1E53
1E54 1E55
1E56 1E57
1E58 1E59
1E5A 1E5B
1E5C 1E5D
1E5E 1E5F
1E60 1E61
1E62 1E63
1E64 1E65
1E66 1E67
1E68 1E69
1E6A 1E6B
1E6C 1E6D
1E6E 1E6F
1E70 1E71
1E72 1E73
1E74 1E75
1E76 1E77
1E78 1E79
1E7A 1E7B
1E7C 1E7D
1E7E 1E7F
1E80 1E81
1E82 1E83
1E84 1E85
1E86 1E87
1E88 1E89
1E8A 1E8B
1E8C 1E8D
1E8E 1E8F
1E90 1E91
1E92 1E93
1E94 1E95
1E9B 1E61
1EA0 1EA1
1EA2 1EA3
1EA4 1EA5
1EA6 1EA7
1EA8 1EA9
1EAA 1EAB
1EAC 1EAD
1EAE 1EAF
1EB0 1EB1
1EB2 1EB3
1EB4 1EB5
1EB6 1EB7
1EB8 1EB9
1EBA 1EBB
1EBC 1EBD
1EBE 1EBF
1EC0 1EC1
1EC2 1EC3
1EC4 1EC5
1EC6 1EC7
1EC8 1EC9
1ECA 1ECB
1ECC 1ECD
1ECE 1ECF
1ED0 1ED1
1ED2 1ED3
1ED4 1ED5
1ED6 1ED7
1ED8 1ED9
1EDA 1EDB
1EDC 1EDD
1EDE 1EDF
1EE0 1EE1
1EE2 1EE3
1EE4 1EE5
1EE6 1EE7
1EE8 1EE9
1EEA 1EEB
1EEC 1EED
1EEE 1EEF
1EF0 1EF1
1EF2 1EF3
1EF4 1EF5
1EF6 1EF7
1EF8 1EF9
1EFA 1EFB
1EFC 1EFD
1EFE 1EFF
1F08 1F00
1F09 1F01
1F0A 1F02
1F0B 1F03
1F0C 1F04
1F0D 1F05
1F0E 1F06
1F0F 1F07
1F18 1F10
1F19 1F11
1F1A 1F12
1F1B 1F13
1F1C 1F14
1F1D 1F15
1F28 1F20
1F29 1F21
1F2A 1F22
1F2B 1F23
1F2C 1F24
1F2D 1F25
1F2E 1F26
1F2F 1F27
1F38 1F30
1F39 1F31
1F3A 1F32
1F3B 1F33
1F3C 1F34
1F3D 1F35
1F3E 1F36
1F3F 1F37
1F48 1F40
1F49 1F41
1F4A 1F42
1F4B 1F43
1F4C 1F44
1F4D 1F45
1F59 1F51
1F5B 1F53
1F5D 1F55
1F5F 1F57
1F68 1F60
1F69 1F61
1F6A 1F62
1F6B 1F63
1F6C 1F64
1F6D 1F65
1F6E 1F66
1F6F 1F67
1F71 03AC
1F73 03AD
1F75 03AE
1F77 03AF
1F79 03CC
1F7B 03CD
1F7D 03CE
1FB8 1FB0
1FB9 1FB1
1FBA 1F70
1FBB 03AC
1FBE 03B9
1FC8 1F72
1FC9 03AD
1FCA 1F74
1FCB 03AE
1FD3 0390
1FD8 1FD0
1FD9 1FD1
1FDA 1F76
1FDB 03AF
1FE3 03B0
1FE8 1FE0
1FE9 1FE1
1FEA 1F7A
1FEB 03CD
1FEC 1FE5
1FEF 0060
1FF8 1F78
1FF9 03CC
1FFA 1F7C
1FFB 03CE
2000 0020
2001 0020
2002 0020
2003 0020
2004 0020
2005 0020
2006 0020
2007 0020
2008 0020
2009 0020
200A 0020
2011 2010
2024 002E
202F 0020
205F 0020
2070 0030
2071 0069
2074 0034
2075 0035
2076 0036
2077 0037
2078 0038
2079 0039
207A 002B
207B 2212
207C 003D
207D 0028
207E 0029
207F 006E
2080 0030
2081 0031
2082 0032
2083 0033
2084 0034
2085 0035
2086 0036
2087 0037
2088 0038
2089 0039
208A 002B
208B 2212
208C 003D
208D 0028
208E 0029
2090 0061
2091 0065
2092 006F
2093 0078
2094 0259
2095 0068
2096 006B
2097 006C
2098 006D
2099 006E
209A 0070
209B 0073
209C 0074
2102 0063
2107 025B
210A 0067
210B 0068
210C 0068
210D 0068
210E 0068
210F 0127
2110 0069
2111 0069
2112 006C
2113 006C
2115 006E
2119 0070
211A 0071
211B 0072
211C 0072
211D 0072
2124 007A
2126 03C9
2128 007A
212A 006B
212B 00E5
212C 0062
212D 0063
212F 0065
2130 0065
2131 0066
2132 214E
2133 006D
2134 006F
2135 05D0
2136 05D1
2137 05D2
2138 05D3
2139 0069
213C 03C0
213D 03B3
213E 03B3
213F 03C0
2140 2211
2145 0064
2146 0064
2147 0065
2148 0069
2149 006A
2160 0069
2164 0076
2169 0078
216C 006C
216D 0063
216E 0064
216F 006D
2170 0069
2174 0076
2179 0078
217C 006C
217D 0063
217E 0064
217F 006D
2183 2184
2329 3008
232A 3009
2460 0031
2461 0032
2462 0033
2463 0034
2464 0035
2465 0036
2466 0037
2467 0038
2468 0039
24B6 0061
24B7 0062
24B8 0063
24B9 0064
24BA 0065
24BB 0066
24BC 0067
24BD 0068
24BE 0069
24BF 006A
24C0 006B
24C1 006C
24C2 006D
24C3 006E
24C4 006F
24C5 0070
24C6 0071
24C7 0072
24C8 0073
24C9 0074
24CA 0075
24CB 0076
24CC 0077
24CD 0078
24CE 0079
24CF 007A
24D0 0061
24D1 0062
24D2 0063
24D3 0064
24D4 0065
24D5 0066
24D6 0067
24D7 0068
24D8 0069
24D9 006A
24DA 006B
24DB 006C
24DC 006D
24DD 006E
24DE 006F
24DF 0070
24E0 0071
24E1 0072
24E2 0073
24E3 0074
24E4 0075
24E5 0076
24E6 0077
24E7 0078
24E8 0079
24E9 007A
24EA 0030
2C00 2C30
2C01 2C31
2C02 2C32
2C03 2C33
2C04 2C34
2C05 2C35
2C06 2C36
2C07 2C37
2C08 2C38
2C09 2C39
2C0A 2C3A
2C0B 2C3B
2C0C 2C3C
2C0D 2C3D
2C0E 2C3E
2C0F 2C3F
2C10 2C40
2C11 2C41
2C12 2C42
2C13 2C43
2C14 2C44
2C15 2C45
2C16 2C46
2C17 2C47
2C18 2C48
2C19 2C49
2C1A 2C4A
2C1B 2C4B
2C1C 2C4C
2C1D 2C4D
2C1E 2C4E
2C1F 2C4F
2C20 2C50
2C21 2C51
2C22 2C52
2C23 2C53
2C24 2C54
2C25 2C55
2C26 2C56
2C27 2C57
2C28 2C58
2C29 2C59
2C2A 2C5A
2C2B 2C5B
2C2C 2C5C
2C2D 2C5D
2C2E 2C5E
2C60 2C61
2C62 026B
2C63 1D7D
2C64 027D
2C67 2C68
2C69 2C6A
2C6B 2C6C
2C6D 0251
2C6E 0271
2C6F 0250
2C70 0252
2C72 2C73
2C75 2C76
2C7C 006A
2C7D 0076
2C7E 023F
2C7F 0240
2C80 2C81
2C82 2C83
2C84 2C85
2C86 2C87
2C88 2C89
2C8A 2C8B
2C8C 2C8D
2C8E 2C8F
2C90 2C91
2C92 2C93
2C94 2C95
2C96 2C97
2C98 2C99
2C9A 2C9B
2C9C 2C9D
2C9E 2C9F
2CA0 2CA1
2CA2 2CA3
2CA4 2CA5
2CA6 2CA7
2CA8 2CA9
2CAA 2CAB
2CAC 2CAD
2CAE 2CAF
2CB0 2CB1
2CB2 2CB3
2CB4 2CB5
2CB6 2CB7
2CB8 2CB9
2CBA 2CBB
2CBC 2CBD
2CBE 2CBF
2CC0 2CC1
2CC2 2CC3
2CC4 2CC5
2CC6 2CC7
2CC8 2CC9
2CCA 2CCB
2CCC 2CCD
2CCE 2CCF
2CD0 2CD1
2CD2 2CD3
2CD4 2CD5
2CD6 2CD7
2CD8 2CD9
2CDA 2CDB
2CDC 2CDD
2CDE 2CDF
2CE0 2CE1
2CE2 2CE3
2CEB 2CEC
2CED 2CEE
2CF2 2CF3
2D6F 2D61
2E9F 6BCD
2EF3 9F9F
2F00 4E00
2F01 4E28
2F02 4E36
2F03 4E3F
2F04 4E59
2F05 4E85
2F06 4E8C
2F07 4EA0
2F08 4EBA
2F09 513F
2F0A 5165
2F0B 516B
2F0C 5182
2F0D 5196
2F0E 51AB
2F0F 51E0
2F10 51F5
2F11 5200
2F12 529B
2F13 52F9
2F14 5315
2F15 531A
2F16 5338
2F17 5341
2F18 535C
2F19 5369
2F1A 5382
2F1B 53B6
2F1C 53C8
2F1D 53E3
2F1E 56D7
2F1F 571F
2F20 58EB
2F21 5902
2F22 590A
2F23 5915
2F24 5927
2F25 5973
2F26 5B50
2F27 5B80
2F28 5BF8
2F29 5C0F
2F2A 5C22
2F2B 5C38
2F2C 5C6E
2F2D 5C71
2F2E 5DDB
2F2F 5DE5
2F30 5DF1
2F31 5DFE
2F32 5E72
2F33 5E7A
2F34 5E7F
2F35 5EF4
2F36 5EFE
2F37 5F0B
2F38 5F13
2F39 5F50
2F3A 5F61
2F3B 5F73
2F3C 5FC3
2F3D 6208
2F3E 6236
2F3F 624B
2F40 652F
2F41 6534
2F42 6587
2F43 6597
2F44 65A4
2F45 65B9
2F46 65E0
2F47 65E5
2F48 66F0
2F49 6708
2F4A 6728
2F4B 6B20
2F4C 6B62
2F4D 6B79
2F4E 6BB3
2F4F 6BCB
2F50 6BD4
2F51 6BDB
2F52 6C0F
2F53 6C14
2F54 6C34
2F55 706B
2F56 722A
2F57 7236
2F58 723B
2F59 723F
2F5A 7247
2F5B 7259
2F5C 725B
2F5D 72AC
2F5E 7384
2F5F 7389
2F60 74DC
2F61 74E6
2F62 7518
2F63 751F
2F64 7528
2F65 7530
2F66 758B
2F67 7592
2F68 7676
2F69 767D
2F6A 76AE
2F6B 76BF
2F6C 76EE
2F6D 77DB
2F6E 77E2
2F6F 77F3
2F70 793A
2F71 79B8
2F72 79BE
2F73 7A74
2F74 7ACB
2F75 7AF9
2F76 7C73
2F77 7CF8
2F78 7F36
2F79 7F51
2F7A 7F8A
2F7B 7FBD
2F7C 8001
2F7D 800C
2F7E 8012
2F7F 8033
2F80 807F
2F81 8089
2F82 81E3
2F83 81EA
2F84 81F3
2F85 81FC
2F86 820C
2F87 821B
2F88 821F
2F89 826E
2F8A 8272
2F8B 8278
2F8C 864D
2F8D 866B
2F8E 8840
2F8F 884C
2F90 8863
2F91 897E
2F92 898B
2F93 89D2
2F94 8A00
2F95 8C37
2F96 8C46
2F97 8C55
2F98 8C78
2F99 8C9D
2F9A 8D64
2F9B 8D70
2F9C 8DB3
2F9D 8EAB
2F9E 8ECA
2F9F 8F9B
2FA0 8FB0
2FA1 8FB5
2FA2 9091
2FA3 9149
2FA4 91C6
2FA5 91CC
2FA6 91D1
2FA7 9577
2FA8 9580
2FA9 961C
2FAA 96B6
2FAB 96B9
2FAC 96E8
2FAD 9751
2FAE 975E
2FAF 9762
2FB0 9769
2FB1 97CB
2FB2 97ED
2FB3 97F3
2FB4 9801
2FB5 98A8
2FB6 98DB
2FB7 98DF
2FB8 9996
2FB9 9999
2FBA 99AC
2FBB 9AA8
2FBC 9AD8
2FBD 9ADF
2FBE 9B25
2FBF 9B2F
2FC0 9B32
2FC1 9B3C
2FC2 9B5A
2FC3 9CE5
2FC4 9E75
2FC5 9E7F
2FC6 9EA5
2FC7 9EBB
2FC8 9EC3
2FC9 9ECD
2FCA 9ED1
2FCB 9EF9
2FCC 9EFD
2FCD 9F0E
2FCE 9F13
2FCF 9F20
2FD0 9F3B
2FD1 9F4A
2FD2 9F52
2FD3 9F8D
2FD4 9F9C
2FD5 9FA0
3000 0020
3036 3012
3038 5341
3039 5344
303A 5345
3131 1100
3132 1101
3133 11AA
3134 1102
3135 11AC
3136 11AD
3137 1103
3138 1104
3139 1105
313A 11B0
313B 11B1
313C 11B2
313D 11B3
313E 11B4
313F 11B5
3140 111A
3141 1106
3142 1107
3143 1108
3144 1121
3145 1109
3146 110A
3147 110B
3148 110C
3149 110D
314A 110E
314B 110F
314C 1110
314D 1111
314E 1112
314F 1161
3150 1162
3151 1163
3152 1164
3153 1165
3154 1166
3155 1167
3156 1168
3157 1169
3158 116A
3159 116B
315A 116C
315B 116D
315C 116E
315D 116F
315E 1170
315F 1171
3160 1172
3161 1173
3162 1174
3163 1175
3165 1114
3166 1115
3167 11C7
3168 11C8
3169 11CC
316A 11CE
316B 11D3
316C 11D7
316D 11D9
316E 111C
316F 11DD
3170 11DF
3171 111D
3172 111E
3173 1120
3174 1122
3175 1123
3176 1127
3177 1129
3178 112B
3179 112C
317A 112D
317B 112E
317C 112F
317D 1132
317E 1136
317F 1140
3180 1147
3181 114C
3182 11F1
3183 11F2
3184 1157
3185 1158
3186 1159
3187 1184
3188 1185
3189 1188
318A 1191
318B 1192
318C 1194
318D 119E
318E 11A1
3192 4E00
3193 4E8C
3194 4E09
3195 56DB
3196 4E0A
3197 4E2D
3198 4E0B
3199 7532
319A 4E59
319B 4E19
319C 4E01
319D 5929
319E 5730
319F 4EBA
3244 554F
3245 5E7C
3246 6587
3247 7B8F
3260 1100
3261 1102
3262 1103
3263 1105
3264 1106
3265 1107
3266 1109
3267 110B
3268 110C
3269 110E
326A 110F
326B 1110
326C 1111
326D 1112
326E AC00
326F B098
3270 B2E4
3271 B77C
3272 B9C8
3273 BC14
3274 C0AC
3275 C544
3276 C790
3277 CC28
3278 CE74
3279 D0C0
327A D30C
327B D558
327E C6B0
3280 4E00
3281 4E8C
3282 4E09
3283 56DB
3284 4E94
3285 516D
3286 4E03
3287 516B
3288 4E5D
3289 5341
328A 6708
328B 706B
328C 6C34
328D 6728
328E 91D1
328F 571F
3290 65E5
3291 682A
3292 6709
3293 793E
3294 540D
3295 7279
3296 8CA1
3297 795D
3298 52B4
3299 79D8
329A 7537
329B 5973
329C 9069
329D 512A
329E 5370
329F 6CE8
32A0 9805
32A1 4F11
32A2 5199
32A3 6B63
32A4 4E0A
32A5 4E2D
32A6 4E0B
32A7 5DE6
32A8 53F3
32A9 533B
32AA 5B97
32AB 5B66
32AC 76E3
32AD 4F01
32AE 8CC7
32AF 5354
32B0 591C
32D0 30A2
32D1 30A4
32D2 30A6
32D3 30A8
32D4 30AA
32D5 30AB
32D6 30AD
32D7 30AF
32D8 30B1
32D9 30B3
32DA 30B5
32DB 30B7
32DC 30B9
32DD 30BB
32DE 30BD
32DF 30BF
32E0 30C1
32E1 30C4
32E2 30C6
32E3 30C8
32E4 30CA
32E5 30CB
32E6 30CC
32E7 30CD
32E8 30CE
32E9 30CF
32EA 30D2
32EB 30D5
32EC 30D8
32ED 30DB
32EE 30DE
32EF 30DF
32F0 30E0
32F1 30E1
32F2 30E2
32F3 30E4
32F4 30E6
32F5 30E8
32F6 30E9
32F7 30EA
32F8 30EB
32F9 30EC
32FA 30ED
32FB 30EF
32FC 30F0
32FD 30F1
32FE 30F2
A640 A641
A642 A643
A644 A645
A646 A647
A648 A649
A64A A64B
A64C A64D
A64E A64F
A650 A651
A652 A653
A654 A655
A656 A657
A658 A659
A65A A65B
A65C A65D
A65E A65F
A660 A661
A662 A663
A664 A665
A666 A667
A668 A669
A66A A66B
A66C A66D
A680 A681
A682 A683
A684 A685
A686 A687
A688 A689
A68A A68B
A68C A68D
A68E A68F
A690 A691
A692 A693
A694 A695
A696 A697
A722 A723
A724 A725
A726 A727
A728 A729
A72A A72B
A72C A72D
A72E A72F
A732 A733
A734 A735
A736 A737
A738 A739
A73A A73B
A73C A73D
A73E A73F
A740 A741
A742 A743
A744 A745
A746 A747
A748 A749
A74A A74B
A74C A74D
A74E A74F
A750 A751
A752 A753
A754 A755
A756 A757
A758 A759
A75A A75B
A75C A75D
A75E A75F
A760 A761
A762 A763
A764 A765
A766 A767
A768 A769
A76A A76B
A76C A76D
A76E A76F
A770 A76F
A779 A77A
A77B A77C
A77D 1D79
A77E A77F
A780 A781
A782 A783
A784 A785
A786 A787
A78B A78C
A78D 0265
A790 A791
A792 A793
A7A0 A7A1
A7A2 A7A3
A7A4 A7A5
A7A6 A7A7
A7A8 A7A9
A7AA 0266
A7F8 0127
A7F9 0153
F900 8C48
F901 66F4
F902 8ECA
F903 8CC8
F904 6ED1
F905 4E32
F906 53E5
F907 9F9C
F908 9F9C
F909 5951
F90A 91D1
F90B 5587
F90C 5948
F90D 61F6
F90E 7669
F90F 7F85
F910 863F
F911 87BA
F912 88F8
F913 908F
F914 6A02
F915 6D1B
F916 70D9
F917 73DE
F918 843D
F919 916A
F91A 99F1
F91B 4E82
F91C 5375
F91D 6B04
F91E 721B
F91F 862D
F920 9E1E
F921 5D50
F922 6FEB
F923 85CD
F924 8964
F925 62C9
F926 81D8
F927 881F
F928 5ECA
F929 6717
F92A 6D6A
F92B 72FC
F92C 90CE
F92D 4F86
F92E 51B7
F92F 52DE
F930 64C4
F931 6AD3
F932 7210
F933 76E7
F934 8001
F935 8606
F936 865C
F937 8DEF
F938 9732
F939 9B6F
F93A 9DFA
F93B 788C
F93C 797F
F93D 7DA0
F93E 83C9
F93F 9304
F940 9E7F
F941 8AD6
F942 58DF
F943 5F04
F944 7C60
F945 807E
F946 7262
F947 78CA
F948 8CC2
F949 96F7
F94A 58D8
F94B 5C62
F94C 6A13
F94D 6DDA
F94E 6F0F
F94F 7D2F
F950 7E37
F951 964B
F952 52D2
F953 808B
F954 51DC
F955 51CC
F956 7A1C
F957 7DBE
F958 83F1
F959 9675
F95A 8B80
F95B 62CF
F95C 6A02
F95D 8AFE
F95E 4E39
F95F 5BE7
F960 6012
F961 7387
F962 7570
F963 5317
F964 78FB
F965 4FBF
F966 5FA9
F967 4E0D
F968 6CCC
F969 6578
F96A 7D22
F96B 53C3
F96C 585E
F96D 7701
F96E 8449
F96F 8AAA
F970 6BBA
F971 8FB0
F972 6C88
F973 62FE
F974 82E5
F975 63A0
F976 7565
F977 4EAE
F978 5169
F979 51C9
F97A 6881
F97B 7CE7
F97C 826F
F97D 8AD2
F97E 91CF
F97F 52F5
F980 5442
F981 5973
F982 5EEC
F983 65C5
F984 6FFE
F985 792A
F986 95AD
F987 9A6A
F988 9E97
F989 9ECE
F98A 529B
F98B 66C6
F98C 6B77
F98D 8F62
F98E 5E74
F98F 6190
F990 6200
F991 649A
F992 6F23
F993 7149
F994 7489
F995 79CA
F996 7DF4
F997 806F
F998 8F26
F999 84EE
F99A 9023
F99B 934A
F99C 5217
F99D 52A3
F99E 54BD
F99F 70C8
F9A0 88C2
F9A1 8AAA
F9A2 5EC9
F9A3 5FF5
F9A4 637B
F9A5 6BAE
F9A6 7C3E
F9A7 7375
F9A8 4EE4
F9A9 56F9
F9AA 5BE7
F9AB 5DBA
F9AC 601C
F9AD 73B2
F9AE 7469
F9AF 7F9A
F9B0 8046
F9B1 9234
F9B2 96F6
F9B3 9748
F9B4 9818
F9B5 4F8B
F9B6 79AE
F9B7 91B4
F9B8 96B8
F9B9 60E1
F9BA 4E86
F9BB 50DA
F9BC 5BEE
F9BD 5C3F
F9BE 6599
F9BF 6A02
F9C0 71CE
F9C1 7642
F9C2 84FC
F9C3 907C
F9C4 9F8D
F9C5 6688
F9C6 962E
F9C7 5289
F9C8 677B
F9C9 67F3
F9CA 6D41
F9CB 6E9C
F9CC 7409
F9CD 7559
F9CE 786B
F9CF 7D10
F9D0 985E
F9D1 516D
F9D2 622E
F9D3 9678
F9D4 502B
F9D5 5D19
F9D6 6DEA
F9D7 8F2A
F9D8 5F8B
F9D9 6144
F9DA 6817
F9DB 7387
F9DC 9686
F9DD 5229
F9DE 540F
F9DF 5C65
F9E0 6613
F9E1 674E
F9E2 68A8
F9E3 6CE5
F9E4 7406
F9E5 75E2
F9E6 7F79
F9E7 88CF
F9E8 88E1
F9E9 91CC
F9EA 96E2
F9EB 533F
F9EC 6EBA
F9ED 541D
F9EE 71D0
F9EF 7498
F9F0 85FA
F9F1 96A3
F9F2 9C57
F9F3 9E9F
F9F4 6797
F9F5 6DCB
F9F6 81E8
F9F7 7ACB
F9F8 7B20
F9F9 7C92
F9FA 72C0
F9FB 7099
F9FC 8B58
F9FD 4EC0
F9FE 8336
F9FF 523A
FA00 5207
FA01 5EA6
FA02 62D3
FA03 7CD6
FA04 5B85
FA05 6D1E
FA06 66B4
FA07 8F3B
FA08 884C
FA09 964D
FA0A 898B
FA0B 5ED3
FA0C 5140
FA0D 55C0
FA10 585A
FA12 6674
FA15 51DE
FA16 732A
FA17 76CA
FA18 793C
FA19 795E
FA1A 7965
FA1B 798F
FA1C 9756
FA1D 7CBE
FA1E 7FBD
FA20 8612
FA22 8AF8
FA25 9038
FA26 90FD
FA2A 98EF
FA2B 98FC
FA2C 9928
FA2D 9DB4
FA2E 90DE
FA2F 96B7
FA30 4FAE
FA31 50E7
FA32 514D
FA33 52C9
FA34 52E4
FA35 5351
FA36 559D
FA37 5606
FA38 5668
FA39 5840
FA3A 58A8
FA3B 5C64
FA3C 5C6E
FA3D 6094
FA3E 6168
FA3F 618E
FA40 61F2
FA41 654F
FA42 65E2
FA43 6691
FA44 6885
FA45 6D77
FA46 6E1A
FA47 6F22
FA48 716E
FA49 722B
FA4A 7422
FA4B 7891
FA4C 793E
FA4D 7949
FA4E 7948
FA4F 7950
FA50 7956
FA51 795D
FA52 798D
FA53 798E
FA54 7A40
FA55 7A81
FA56 7BC0
FA57 7DF4
FA58 7E09
FA59 7E41
FA5A 7F72
FA5B 8005
FA5C 81ED
FA5D 8279
FA5E 8279
FA5F 8457
FA60 8910
FA61 8996
FA62 8B01
FA63 8B39
FA64 8CD3
FA65 8D08
FA66 8FB6
FA67 9038
FA68 96E3
FA69 97FF
FA6A 983B
FA6B 6075
FA6C 242EE
FA6D 8218
FA70 4E26
FA71 51B5
FA72 5168
FA73 4F80
FA74 5145
FA75 5180
FA76 52C7
FA77 52FA
FA78 559D
FA79 5555
FA7A 5599
FA7B 55E2
FA7C 585A
FA7D 58B3
FA7E 5944
FA7F 5954
FA80 5A62
FA81 5B28
FA82 5ED2
FA83 5ED9
FA84 5F69
FA85 5FAD
FA86 60D8
FA87 614E
FA88 6108
FA89 618E
FA8A 6160
FA8B 61F2
FA8C 6234
FA8D 63C4
FA8E 641C
FA8F 6452
FA90 6556
FA91 6674
FA92 6717
FA93 671B
FA94 6756
FA95 6B79
FA96 6BBA
FA97 6D41
FA98 6EDB
FA99 6ECB
FA9A 6F22
FA9B 701E
FA9C 716E
FA9D 77A7
FA9E 7235
FA9F 72AF
FAA0 732A
FAA1 7471
FAA2 7506
FAA3 753B
FAA4 761D
FAA5 761F
FAA6 76CA
FAA7 76DB
FAA8 76F4
FAA9 774A
FAAA 7740
FAAB 78CC
FAAC 7AB1
FAAD 7BC0
FAAE 7C7B
FAAF 7D5B
FAB0 7DF4
FAB1 7F3E
FAB2 8005
FAB3 8352
FAB4 83EF
FAB5 8779
FAB6 8941
FAB7 8986
FAB8 8996
FAB9 8ABF
FABA 8AF8
FABB 8ACB
FABC 8B01
FABD 8AFE
FABE 8AED
FABF 8B39
FAC0 8B8A
FAC1 8D08
FAC2 8F38
FAC3 9072
FAC4 9199
FAC5 9276
FAC6 967C
FAC7 96E3
FAC8 9756
FAC9 97DB
FACA 97FF
FACB 980B
FACC 983B
FACD 9B12
FACE 9F9C
FACF 2284A
FAD0 22844
FAD1 233D5
FAD2 3B9D
FAD3 4018
FAD4 4039
FAD5 25249
FAD6 25CD0
FAD7 27ED3
FAD8 9F43
FAD9 9F8E
FB20 05E2
FB21 05D0
FB22 05D3
FB23 05D4
FB24 05DB
FB25 05DC
FB26 05DD
FB27 05E8
FB28 05EA
FB29 002B
FB50 0671
FB51 0671
FB52 067B
FB53 067B
FB54 067B
FB55 067B
FB56 067E
FB57 067E
FB58 067E
FB59 067E
FB5A 0680
FB5B 0680
FB5C 0680
FB5D 0680
FB5E 067A
FB5F 067A
FB60 067A
FB61 067A
FB62 067F
FB63 067F
FB64 067F
FB65 067F
FB66 0679
FB67 0679
FB68 0679
FB69 0679
FB6A 06A4
FB6B 06A4
FB6C 06A4
FB6D 06A4
FB6E 06A6
FB6F 06A6
FB70 06A6
FB71 06A6
FB72 0684
FB73 0684
FB74 0684
FB75 0684
FB76 0683
FB77 0683
FB78 0683
FB79 0683
FB7A 0686
FB7B 0686
FB7C 0686
FB7D 0686
FB7E 0687
FB7F 0687
FB80 0687
FB81 0687
FB82 068D
FB83 068D
FB84 068C
FB85 068C
FB86 068E
FB87 068E
FB88 0688
FB89 0688
FB8A 0698
FB8B 0698
FB8C 0691
FB8D 0691
FB8E 06A9
FB8F 06A9
FB90 06A9
FB91 06A9
FB92 06AF
FB93 06AF
FB94 06AF
FB95 06AF
FB96 06B3
FB97 06B3
FB98 06B3
FB99 06B3
FB9A 06B1
FB9B 06B1
FB9C 06B1
FB9D 06B1
FB9E 06BA
FB9F 06BA
FBA0 06BB
FBA1 06BB
FBA2 06BB
FBA3 06BB
FBA4 06C0
FBA5 06C0
FBA6 06C1
FBA7 06C1
FBA8 06C1
FBA9 06C1
FBAA 06BE
FBAB 06BE
FBAC 06BE
FBAD 06BE
FBAE 06D2
FBAF 06D2
FBB0 06D3
FBB1 06D3
FBD3 06AD
FBD4 06AD
FBD5 06AD
FBD6 06AD
FBD7 06C7
FBD8 06C7
FBD9 06C6
FBDA 06C6
FBDB 06C8
FBDC 06C8
FBDE 06CB
FBDF 06CB
FBE0 06C5
FBE1 06C5
FBE2 06C9
FBE3 06C9
FBE4 06D0
FBE5 06D0
FBE6 06D0
FBE7 06D0
FBE8 0649
FBE9 0649
FBFC 06CC
FBFD 06CC
FBFE 06CC
FBFF 06CC
FE10 002C
FE11 3001
FE12 3002
FE13 003A
FE14 003B
FE15 0021
FE16 003F
FE17 3016
FE18 3017
FE31 2014
FE32 2013
FE33 005F
FE34 005F
FE35 0028
FE36 0029
FE37 007B
FE38 007D
FE39 3014
FE3A 3015
FE3B 3010
FE3C 3011
FE3D 300A
FE3E 300B
FE3F 3008
FE40 3009
FE41 300C
FE42 300D
FE43 300E
FE44 300F
FE47 005B
FE48 005D
FE4D 005F
FE4E 005F
FE4F 005F
FE50 002C
FE51 3001
FE52 002E
FE54 003B
FE55 003A
FE56 003F
FE57 0021
FE58 2014
FE59 0028
FE5A 0029
FE5B 007B
FE5C 007D
FE5D 3014
FE5E 3015
FE5F 0023
FE60 0026
FE61 002A
FE62 002B
FE63 002D
FE64 003C
FE65 003E
FE66 003D
FE68 005C
FE69 0024
FE6A 0025
FE6B 0040
FE80 0621
FE81 0622
FE82 0622
FE83 0623
FE84 0623
FE85 0624
FE86 0624
FE87 0625
FE88 0625
FE89 0626
FE8A 0626
FE8B 0626
FE8C 0626
FE8D 0627
FE8E 0627
FE8F 0628
FE90 0628
FE91 0628
FE92 0628
FE93 0629
FE94 0629
FE95 062A
FE96 062A
FE97 062A
FE98 062A
FE99 062B
FE9A 062B
FE9B 062B
FE9C 062B
FE9D 062C
FE9E 062C
FE9F 062C
FEA0 062C
FEA1 062D
FEA2 062D
FEA3 062D
FEA4 062D
FEA5 062E
FEA6 062E
FEA7 062E
FEA8 062E
FEA9 062F
FEAA 062F
FEAB 0630
FEAC 0630
FEAD 0631
FEAE 0631
FEAF 0632
FEB0 0632
FEB1 0633
FEB2 0633
FEB3 0633
FEB4 0633
FEB5 0634
FEB6 0634
FEB7 0634
FEB8 0634
FEB9 0635
FEBA 0635
FEBB 0635
FEBC 0635
FEBD 0636
FEBE 0636
FEBF 0636
FEC0 0636
FEC1 0637
FEC2 0637
FEC3 0637
FEC4 0637
FEC5 0638
FEC6 0638
FEC7 0638
FEC8 0638
FEC9 0639
FECA 0639
FECB 0639
FECC 0639
FECD 063A
FECE 063A
FECF 063A
FED0 063A
FED1 0641
FED2 0641
FED3 0641
FED4 0641
FED5 0642
FED6 0642
FED7 0642
FED8 0642
FED9 0643
FEDA 0643
FEDB 0643
FEDC 0643
FEDD 0644
FEDE 0644
FEDF 0644
FEE0 0644
FEE1 0645
FEE2 0645
FEE3 0645
FEE4 0645
FEE5 0646
FEE6 0646
FEE7 0646
FEE8 0646
FEE9 0647
FEEA 0647
FEEB 0647
FEEC 0647
FEED 0648
FEEE 0648
FEEF 0649
FEF0 0649
FEF1 064A
FEF2 064A
FEF3 064A
FEF4 064A
FF01 0021
FF02 0022
FF03 0023
FF04 0024
FF05 0025
FF06 0026
FF07 0027
FF08 0028
FF09 0029
FF0A 002A
FF0B 002B
FF0C 002C
FF0D 002D
FF0E 002E
FF0F 002F
FF10 0030
FF11 0031
FF12 0032
FF13 0033
FF14 0034
FF15 0035
FF16 0036
FF17 0037
FF18 0038
FF19 0039
FF1A 003A
FF1B 003B
FF1C 003C
FF1D 003D
FF1E 003E
FF1F 003F
FF20 0040
FF21 0061
FF22 0062
FF23 0063
FF24 0064
FF25 0065
FF26 0066
FF27 0067
FF28 0068
FF29 0069
FF2A 006A
FF2B 006B
FF2C 006C
FF2D 006D
FF2E 006E
FF2F 006F
FF30 0070
FF31 0071
FF32 0072
FF33 0073
FF34 0074
FF35 0075
FF36 0076
FF37 0077
FF38 0078
FF39 0079
FF3A 007A
FF3B 005B
FF3C 005C
FF3D 005D
FF3E 005E
FF3F 005F
FF40 0060
FF41 0061
FF42 0062
FF43 0063
FF44 0064
FF45 0065
FF46 0066
FF47 0067
FF48 0068
FF49 0069
FF4A 006A
FF4B 006B
FF4C 006C
FF4D 006D
FF4E 006E
FF4F 006F
FF50 0070
FF51 0071
FF52 0072
FF53 0073
FF54 0074
FF55 0075
FF56 0076
FF57 0077
FF58 0078
FF59 0079
FF5A 007A
FF5B 007B
FF5C 007C
FF5D 007D
FF5E 007E
FF5F 2985
FF60 2986
FF61 3002
FF62 300C
FF63 300D
FF64 3001
FF65 30FB
FF66 30F2
FF67 30A1
FF68 30A3
FF69 30A5
FF6A 30A7
FF6B 30A9
FF6C 30E3
FF6D 30E5
FF6E 30E7
FF6F 30C3
FF70 30FC
FF71 30A2
FF72 30A4
FF73 30A6
FF74 30A8
FF75 30AA
FF76 30AB
FF77 30AD
FF78 30AF
FF79 30B1
FF7A 30B3
FF7B 30B5
FF7C 30B7
FF7D 30B9
FF7E 30BB
FF7F 30BD
FF80 30BF
FF81 30C1
FF82 30C4
FF83 30C6
FF84 30C8
FF85 30CA
FF86 30CB
FF87 30CC
FF88 30CD
FF89 30CE
FF8A 30CF
FF8B 30D2
FF8C 30D5
FF8D 30D8
FF8E 30DB
FF8F 30DE
FF90 30DF
FF91 30E0
FF92 30E1
FF93 30E2
FF94 30E4
FF95 30E6
FF96 30E8
FF97 30E9
FF98 30EA
FF99 30EB
FF9A 30EC
FF9B 30ED
FF9C 30EF
FF9D 30F3
FF9E 3099
FF9F 309A
FFA1 1100
FFA2 1101
FFA3 11AA
FFA4 1102
FFA5 11AC
FFA6 11AD
FFA7 1103
FFA8 1104
FFA9 1105
FFAA 11B0
FFAB 11B1
FFAC 11B2
FFAD 11B3
FFAE 11B4
FFAF 11B5
FFB0 111A
FFB1 1106
FFB2 1107
FFB3 1108
FFB4 1121
FFB5 1109
FFB6 110A
FFB7 110B
FFB8 110C
FFB9 110D
FFBA 110E
FFBB 110F
FFBC 1110
FFBD 1111
FFBE 1112
FFC2 1161
FFC3 1162
FFC4 1163
FFC5 1164
FFC6 1165
FFC7 1166
FFCA 1167
FFCB 1168
FFCC 1169
FFCD 116A
FFCE 116B
FFCF 116C
FFD2 116D
FFD3 116E
FFD4 116F
FFD5 1170
FFD6 1171
FFD7 1172
FFDA 1173
FFDB 1174
FFDC 1175
FFE0 00A2
FFE1 00A3
FFE2 00AC
FFE4 00A6
FFE5 00A5
FFE6 20A9
FFE8 2502
FFE9 2190
FFEA 2191
FFEB 2192
FFEC 2193
FFED 25A0
FFEE 25CB
10400 10428
10401 10429
10402 1042A
10403 1042B
10404 1042C
10405 1042D
10406 1042E
10407 1042F
10408 10430
10409 10431
1040A 10432
1040B 10433
1040C 10434
1040D 10435
1040E 10436
1040F 10437
10410 10438
10411 10439
10412 1043A
10413 1043B
10414 1043C
10415 1043D
10416 1043E
10417 1043F
10418 10440
10419 10441
1041A 10442
1041B 10443
1041C 10444
1041D 10445
1041E 10446
1041F 10447
10420 10448
10421 10449
10422 1044A
10423 1044B
10424 1044C
10425 1044D
10426 1044E
10427 1044F
1D400 0061
1D401 0062
1D402 0063
1D403 0064
1D404 0065
1D405 0066
1D406 0067
1D407 0068
1D408 0069
1D409 006A
1D40A 006B
1D40B 006C
1D40C 006D
1D40D 006E
1D40E 006F
1D40F 0070
1D410 0071
1D411 0072
1D412 0073
1D413 0074
1D414 0075
1D415 0076
1D416 0077
1D417 0078
1D418 0079
1D419 007A
1D41A 0061
1D41B 0062
1D41C 0063
1D41D 0064
1D41E 0065
1D41F 0066
1D420 0067
1D421 0068
1D422 0069
1D423 006A
1D424 006B
1D425 006C
1D426 006D
1D427 006E
1D428 006F
1D429 0070
1D42A 0071
1D42B 0072
1D42C 0073
1D42D 0074
1D42E 0075
1D42F 0076
1D430 0077
1D431 0078
1D432 0079
1D433 007A
1D434 0061
1D435 0062
1D436 0063
1D437 0064
1D438 0065
1D439 0066
1D43A 0067
1D43B 0068
1D43C 0069
1D43D 006A
1D43E 006B
1D43F 006C
1D440 006D
1D441 006E
1D442 006F
1D443 0070
1D444 0071
1D445 0072
1D446 0073
1D447 0074
1D448 0075
1D449 0076
1D44A 0077
1D44B 0078
1D44C 0079
1D44D 007A
1D44E 0061
1D44F 0062
1D450 0063
1D451 0064
1D452 0065
1D453 0066
1D454 0067
1D456 0069
1D457 006A
1D458 006B
1D459 006C
1D45A 006D
1D45B 006E
1D45C 006F
1D45D 0070
1D45E 0071
1D45F 0072
1D460 0073
1D461 0074
1D462 0075
1D463 0076
1D464 0077
1D465 0078
1D466 0079
1D467 007A
1D468 0061
1D469 0062
1D46A 0063
1D46B 0064
1D46C 0065
1D46D 0066
1D46E 0067
1D46F 0068
1D470 0069
1D471 006A
1D472 006B
1D473 006C
1D474 006D
1D475 006E
1D476 006F
1D477 0070
1D478 0071
1D479 0072
1D47A 0073
1D47B 0074
1D47C 0075
1D47D 0076
1D47E 0077
1D47F 0078
1D480 0079
1D481 007A
1D482 0061
1D483 0062
1D484 0063
1D485 0064
1D486 0065
1D487 0066
1D488 0067
1D489 0068
1D48A 0069
1D48B 006A
1D48C 006B
1D48D 006C
1D48E 006D
1D48F 006E
1D490 006F
1D491 0070
1D492 0071
1D493 0072
1D494 0073
1D495 0074
1D496 0075
1D497 0076
1D498 0077
1D499 0078
1D49A 0079
1D49B 007A
1D49C 0061
1D49E 0063
1D49F 0064
1D4A2 0067
1D4A5 006A
1D4A6 006B
1D4A9 006E
1D4AA 006F
1D4AB 0070
1D4AC 0071
1D4AE 0073
1D4AF 0074
1D4B0 0075
1D4B1 0076
1D4B2 0077
1D4B3 0078
1D4B4 0079
1D4B5 007A
1D4B6 0061
1D4B7 0062
1D4B8 0063
1D4B9 0064
1D4BB 0066
1D4BD 0068
1D4BE 0069
1D4BF 006A
1D4C0 006B
1D4C1 006C
1D4C2 006D
1D4C3 006E
1D4C5 0070
1D4C6 0071
1D4C7 0072
1D4C8 0073
1D4C9 0074
1D4CA 0075
1D4CB 0076
1D4CC 0077
1D4CD 0078
1D4CE 0079
1D4CF 007A
1D4D0 0061
1D4D1 0062
1D4D2 0063
1D4D3 0064
1D4D4 0065
1D4D5 0066
1D4D6 0067
1D4D7 0068
1D4D8 0069
1D4D9 006A
1D4DA 006B
1D4DB 006C
1D4DC 006D
1D4DD 006E
1D4DE 006F
1D4DF 0070
1D4E0 0071
1D4E1 0072
1D4E2 0073
1D4E3 0074
1D4E4 0075
1D4E5 0076
1D4E6 0077
1D4E7 0078
1D4E8 0079
1D4E9 007A
1D4EA 0061
1D4EB 0062
1D4EC 0063
1D4ED 0064
1D4EE 0065
1D4EF 0066
1D4F0 0067
1D4F1 0068
1D4F2 0069
1D4F3 006A
1D4F4 006B
1D4F5 006C
1D4F6 006D
1D4F7 006E
1D4F8 006F
1D4F9 0070
1D4FA 0071
1D4FB 0072
1D4FC 0073
1D4FD 0074
1D4FE 0075
1D4FF 0076
1D500 0077
1D501 0078
1D502 0079
1D503 007A
1D504 0061
1D505 0062
1D507 0064
1D508 0065
1D509 0066
1D50A 0067
1D50D 006A
1D50E 006B
1D50F 006C
1D510 006D
1D511 006E
1D512 006F
1D513 0070
1D514 0071
1D516 0073
1D517 0074
1D518 0075
1D519 0076
1D51A 0077
1D51B 0078
1D51C 0079
1D51E 0061
1D51F 0062
1D520 0063
1D521 0064
1D522 0065
1D523 0066
1D524 0067
1D525 0068
1D526 0069
1D527 006A
1D528 006B
1D529 006C
1D52A 006D
1D52B 006E
1D52C 006F
1D52D 0070
1D52E 0071
1D52F 0072
1D530 0073
1D531 0074
1D532 0075
1D533 0076
1D534 0077
1D535 0078
1D536 0079
1D537 007A
1D538 0061
1D539 0062
1D53B 0064
1D53C 0065
1D53D 0066
1D53E 0067
1D540 0069
1D541 006A
1D542 006B
1D543 006C
1D544 006D
1D546 006F
1D54A 0073
1D54B 0074
1D54C 0075
1D54D 0076
1D54E 0077
1D54F 0078
1D550 0079
1D552 0061
1D553 0062
1D554 0063
1D555 0064
1D556 0065
1D557 0066
1D558 0067
1D559 0068
1D55A 0069
1D55B 006A
1D55C 006B
1D55D 006C
1D55E 006D
1D55F 006E
1D560 006F
1D561 0070
1D562 0071
1D563 0072
1D564 0073
1D565 0074
1D566 0075
1D567 0076
1D568 0077
1D569 0078
1D56A 0079
1D56B 007A
1D56C 0061
1D56D 0062
1D56E 0063
1D56F 0064
1D570 0065
1D571 0066
1D572 0067
1D573 0068
1D574 0069
1D575 006A
1D576 006B
1D577 006C
1D578 006D
1D579 006E
1D57A 006F
1D57B 0070
1D57C 0071
1D57D 0072
1D57E 0073
1D57F 0074
1D580 0075
1D581 0076
1D582 0077
1D583 0078
1D584 0079
1D585 007A
1D586 0061
1D587 0062
1D588 0063
1D589 0064
1D58A 0065
1D58B 0066
1D58C 0067
1D58D 0068
1D58E 0069
1D58F 006A
1D590 006B
1D591 006C
1D592 006D
1D593 006E
1D594 006F
1D595 0070
1D596 0071
1D597 0072
1D598 0073
1D599 0074
1D59A 0075
1D59B 0076
1D59C 0077
1D59D 0078
1D59E 0079
1D59F 007A
1D5A0 0061
1D5A1 0062
1D5A2 0063
1D5A3 0064
1D5A4 0065
1D5A5 0066
1D5A6 0067
1D5A7 0068
1D5A8 0069
1D5A9 006A
1D5AA 006B
1D5AB 006C
1D5AC 006D
1D5AD 006E
1D5AE 006F
1D5AF 0070
1D5B0 0071
1D5B1 0072
1D5B2 0073
1D5B3 0074
1D5B4 0075
1D5B5 0076
1D5B6 0077
1D5B7 0078
1D5B8 0079
1D5B9 007A
1D5BA 0061
1D5BB 0062
1D5BC 0063
1D5BD 0064
1D5BE 0065
1D5BF 0066
1D5C0 0067
1D5C1 0068
1D5C2 0069
1D5C3 006A
1D5C4 006B
1D5C5 006C
1D5C6 006D
1D5C7 006E
1D5C8 006F
1D5C9 0070
1D5CA 0071
1D5CB 0072
1D5CC 0073
1D5CD 0074
1D5CE 0075
1D5CF 0076
1D5D0 0077
1D5D1 0078
1D5D2 0079
1D5D3 007A
1D5D4 0061
1D5D5 0062
1D5D6 0063
1D5D7 0064
1D5D8 0065
1D5D9 0066
1D5DA 0067
1D5DB 0068
1D5DC 0069
1D5DD 006A
1D5DE 006B
1D5DF 006C
1D5E0 006D
1D5E1 006E
1D5E2 006F
1D5E3 0070
1D5E4 0071
1D5E5 0072
1D5E6 0073
1D5E7 0074
1D5E8 0075
1D5E9 0076
1D5EA 0077
1D5EB 0078
1D5EC 0079
1D5ED 007A
1D5EE 0061
1D5EF 0062
1D5F0 0063
1D5F1 0064
1D5F2 0065
1D5F3 0066
1D5F4 0067
1D5F5 0068
1D5F6 0069
1D5F7 006A
1D5F8 006B
1D5F9 006C
1D5FA 006D
1D5FB 006E
1D5FC 006F
1D5FD 0070
1D5FE 0071
1D5FF 0072
1D600 0073
1D601 0074
1D602 0075
1D603 0076
1D604 0077
1D605 0078
1D606 0079
1D607 007A
1D608 0061
1D609 0062
1D60A 0063
1D60B 0064
1D60C 0065
1D60D 0066
1D60E 0067
1D60F 0068
1D610 0069
1D611 006A
1D612 006B
1D613 006C
1D614 006D
1D615 006E
1D616 006F
1D617 0070
1D618 0071
1D619 0072
1D61A 0073
1D61B 0074
1D61C 0075
1D61D 0076
1D61E 0077
1D61F 0078
1D620 0079
1D621 007A
1D622 0061
1D623 0062
1D624 0063
1D625 0064
1D626 0065
1D627 0066
1D628 0067
1D629 0068
1D62A 0069
1D62B 006A
1D62C 006B
1D62D 006C
1D62E 006D
1D62F 006E
1D630 006F
1D631 0070
1D632 0071
1D633 0072
1D634 0073
1D635 0074
1D636 0075
1D637 0076
1D638 0077
1D639 0078
1D63A 0079
1D63B 007A
1D63C 0061
1D63D 0062
1D63E 0063
1D63F 0064
1D640 0065
1D641 0066
1D642 0067
1D643 0068
1D644 0069
1D645 006A
1D646 006B
1D647 006C
1D648 006D
1D649 006E
1D64A 006F
1D64B 0070
1D64C 0071
1D64D 0072
1D64E 0073
1D64F 0074
1D650 0075
1D651 0076
1D652 0077
1D653 0078
1D654 0079
1D655 007A
1D656 0061
1D657 0062
1D658 0063
1D659 0064
1D65A 0065
1D65B 0066
1D65C 0067
1D65D 0068
1D65E 0069
1D65F 006A
1D660 006B
1D661 006C
1D662 006D
1D663 006E
1D664 006F
1D665 0070
1D666 0071
1D667 0072
1D668 0073
1D669 0074
1D66A 0075
1D66B 0076
1D66C 0077
1D66D 0078
1D66E 0079
1D66F 007A
1D670 0061
1D671 0062
1D672 0063
1D673 0064
1D674 0065
1D675 0066
1D676 0067
1D677 0068
1D678 0069
1D679 006A
1D67A 006B
1D67B 006C
1D67C 006D
1D67D 006E
1D67E 006F
1D67F 0070
1D680 0071
1D681 0072
1D682 0073
1D683 0074
1D684 0075
1D685 0076
1D686 0077
1D687 0078
1D688 0079
1D689 007A
1D68A 0061
1D68B 0062
1D68C 0063
1D68D 0064
1D68E 0065
1D68F 0066
1D690 0067
1D691 0068
1D692 0069
1D693 006A
1D694 006B
1D695 006C
1D696 006D
1D697 006E
1D698 006F
1D699 0070
1D69A 0071
1D69B 0072
1D69C 0073
1D69D 0074
1D69E 0075
1D69F 0076
1D6A0 0077
1D6A1 0078
1D6A2 0079
1D6A3 007A
1D6A4 0131
1D6A5 0237
1D6A8 03B1
1D6A9 03B2
1D6AA 03B3
1D6AB 03B4
1D6AC 03B5
1D6AD 03B6
1D6AE 03B7
1D6AF 03B8
1D6B0 03B9
1D6B1 03BA
1D6B2 03BB
1D6B3 03BC
1D6B4 03BD
1D6B5 03BE
1D6B6 03BF
1D6B7 03C0
1D6B8 03C1
1D6B9 03B8
1D6BA 03C3
1D6BB 03C4
1D6BC 03C5
1D6BD 03C6
1D6BE 03C7
1D6BF 03C8
1D6C0 03C9
1D6C1 2207
1D6C2 03B1
1D6C3 03B2
1D6C4 03B3
1D6C5 03B4
1D6C6 03B5
1D6C7 03B6
1D6C8 03B7
1D6C9 03B8
1D6CA 03B9
1D6CB 03BA
1D6CC 03BB
1D6CD 03BC
1D6CE 03BD
1D6CF 03BE
1D6D0 03BF
1D6D1 03C0
1D6D2 03C1
1D6D3 03C3
1D6D4 03C3
1D6D5 03C4
1D6D6 03C5
1D6D7 03C6
1D6D8 03C7
1D6D9 03C8
1D6DA 03C9
1D6DB 2202
1D6DC 03B5
1D6DD 03B8
1D6DE 03BA
1D6DF 03C6
1D6E0 03C1
1D6E1 03C0
1D6E2 03B1
1D6E3 03B2
1D6E4 03B3
1D6E5 03B4
1D6E6 03B5
1D6E7 03B6
1D6E8 03B7
1D6E9 03B8
1D6EA 03B9
1D6EB 03BA
1D6EC 03BB
1D6ED 03BC
1D6EE 03BD
1D6EF 03BE
1D6F0 03BF
1D6F1 03C0
1D6F2 03C1
1D6F3 03B8
1D6F4 03C3
1D6F5 03C4
1D6F6 03C5
1D6F7 03C6
1D6F8 03C7
1D6F9 03C8
1D6FA 03C9
1D6FB 2207
1D6FC 03B1
1D6FD 03B2
1D6FE 03B3
1D6FF 03B4
1D700 03B5
1D701 03B6
1D702 03B7
1D703 03B8
1D704 03B9
1D705 03BA
1D706 03BB
1D707 03BC
1D708 03BD
1D709 03BE
1D70A 03BF
1D70B 03C0
1D70C 03C1
1D70D 03C3
1D70E 03C3
1D70F 03C4
1D710 03C5
1D711 03C6
1D712 03C7
1D713 03C8
1D714 03C9
1D715 2202
1D716 03B5
1D717 03B8
1D718 03BA
1D719 03C6
1D71A 03C1
1D71B 03C0
1D71C 03B1
1D71D 03B2
1D71E 03B3
1D71F 03B4
1D720 03B5
1D721 03B6
1D722 03B7
1D723 03B8
1D724 03B9
1D725 03BA
1D726 03BB
1D727 03BC
1D728 03BD
1D729 03BE
1D72A 03BF
1D72B 03C0
1D72C 03C1
1D72D 03B8
1D72E 03C3
1D72F 03C4
1D730 03C5
1D731 03C6
1D732 03C7
1D733 03C8
1D734 03C9
1D735 2207
1D736 03B1
1D737 03B2
1D738 03B3
1D739 03B4
1D73A 03B5
1D73B 03B6
1D73C 03B7
1D73D 03B8
1D73E 03B9
1D73F 03BA
1D740 03BB
1D741 03BC
1D742 03BD
1D743 03BE
1D744 03BF
1D745 03C0
1D746 03C1
1D747 03C3
1D748 03C3
1D749 03C4
1D74A 03C5
1D74B 03C6
1D74C 03C7
1D74D 03C8
1D74E 03C9
1D74F 2202
1D750 03B5
1D751 03B8
1D752 03BA
1D753 03C6
1D754 03C1
1D755 03C0
1D756 03B1
1D757 03B2
1D758 03B3
1D759 03B4
1D75A 03B5
1D75B 03B6
1D75C 03B7
1D75D 03B8
1D75E 03B9
1D75F 03BA
1D760 03BB
1D761 03BC
1D762 03BD
1D763 03BE
1D764 03BF
1D765 03C0
1D766 03C1
1D767 03B8
1D768 03C3
1D769 03C4
1D76A 03C5
1D76B 03C6
1D76C 03C7
1D76D 03C8
1D76E 03C9
1D76F 2207
1D770 03B1
1D771 03B2
1D772 03B3
1D773 03B4
1D774 03B5
1D775 03B6
1D776 03B7
1D777 03B8
1D778 03B9
1D779 03BA
1D77A 03BB
1D77B 03BC
1D77C 03BD
1D77D 03BE
1D77E 03BF
1D77F 03C0
1D780 03C1
1D781 03C3
1D782 03C3
1D783 03C4
1D784 03C5
1D785 03C6
1D786 03C7
1D787 03C8
1D788 03C9
1D789 2202
1D78A 03B5
1D78B 03B8
1D78C 03BA
1D78D 03C6
1D78E 03C1
1D78F 03C0
1D790 03B1
1D791 03B2
1D792 03B3
1D793 03B4
1D794 03B5
1D795 03B6
1D796 03B7
1D797 03B8
1D798 03B9
1D799 03BA
1D79A 03BB
1D79B 03BC
1D79C 03BD
1D79D 03BE
1D79E 03BF
1D79F 03C0
1D7A0 03C1
1D7A1 03B8
1D7A2 03C3
1D7A3 03C4
1D7A4 03C5
1D7A5 03C6
1D7A6 03C7
1D7A7 03C8
1D7A8 03C9
1D7A9 2207
1D7AA 03B1
1D7AB 03B2
1D7AC 03B3
1D7AD 03B4
1D7AE 03B5
1D7AF 03B6
1D7B0 03B7
1D7B1 03B8
1D7B2 03B9
1D7B3 03BA
1D7B4 03BB
1D7B5 03BC
1D7B6 03BD
1D7B7 03BE
1D7B8 03BF
1D7B9 03C0
1D7BA 03C1
1D7BB 03C3
1D7BC 03C3
1D7BD 03C4
1D7BE 03C5
1D7BF 03C6
1D7C0 03C7
1D7C1 03C8
1D7C2 03C9
1D7C3 2202
1D7C4 03B5
1D7C5 03B8
1D7C6 03BA
1D7C7 03C6
1D7C8 03C1
1D7C9 03C0
1D7CA 03DD
1D7CB 03DD
1D7CE 0030
1D7CF 0031
1D7D0 0032
1D7D1 0033
1D7D2 0034
1D7D3 0035
1D7D4 0036
1D7D5 0037
1D7D6 0038
1D7D7 0039
1D7D8 0030
1D7D9 0031
1D7DA 0032
1D7DB 0033
1D7DC 0034
1D7DD 0035
1D7DE 0036
1D7DF 0037
1D7E0 0038
1D7E1 0039
1D7E2 0030
1D7E3 0031
1D7E4 0032
1D7E5 0033
1D7E6 0034
1D7E7 0035
1D7E8 0036
1D7E9 0037
1D7EA 0038
1D7EB 0039
1D7EC 0030
1D7ED 0031
1D7EE 0032
1D7EF 0033
1D7F0 0034
1D7F1 0035
1D7F2 0036
1D7F3 0037
1D7F4 0038
1D7F5 0039
1D7F6 0030
1D7F7 0031
1D7F8 0032
1D7F9 0033
1D7FA 0034
1D7FB 0035
1D7FC 0036
1D7FD 0037
1D7FE 0038
1D7FF 0039
1EE00 0627
1EE01 0628
1EE02 062C
1EE03 062F
1EE05 0648
1EE06 0632
1EE07 062D
1EE08 0637
1EE09 064A
1EE0A 0643
1EE0B 0644
1EE0C 0645
1EE0D 0646
1EE0E 0633
1EE0F 0639
1EE10 0641
1EE11 0635
1EE12 0642
1EE13 0631
1EE14 0634
1EE15 062A
1EE16 062B
1EE17 062E
1EE18 0630
1EE19 0636
1EE1A 0638
1EE1B 063A
1EE1C 066E
1EE1D 06BA
1EE1E 06A1
1EE1F 066F
1EE21 0628
1EE22 062C
1EE24 0647
1EE27 062D
1EE29 064A
1EE2A 0643
1EE2B 0644
1EE2C 0645
1EE2D 0646
1EE2E 0633
1EE2F 0639
1EE30 0641
1EE31 0635
1EE32 0642
1EE34 0634
1EE35 062A
1EE36 062B
1EE37 062E
1EE39 0636
1EE3B 063A
1EE42 062C
1EE47 062D
1EE49 064A
1EE4B 0644
1EE4D 0646
1EE4E 0633
1EE4F 0639
1EE51 0635
1EE52 0642
1EE54 0634
1EE57 062E
1EE59 0636
1EE5B 063A
1EE5D 06BA
1EE5F 066F
1EE61 0628
1EE62 062C
1EE64 0647
1EE67 062D
1EE68 0637
1EE69 064A
1EE6A 0643
1EE6C 0645
1EE6D 0646
1EE6E 0633
1EE6F 0639
1EE70 0641
1EE71 0635
1EE72 0642
1EE74 0634
1EE75 062A
1EE76 062B
1EE77 062E
1EE79 0636
1EE7A 0638
1EE7B 063A
1EE7C 066E
1EE7E 06A1
1EE80 0627
1EE81 0628
1EE82 062C
1EE83 062F
1EE84 0647
1EE85 0648
1EE86 0632
1EE87 062D
1EE88 0637
1EE89 064A
1EE8B 0644
1EE8C 0645
1EE8D 0646
1EE8E 0633
1EE8F 0639
1EE90 0641
1EE91 0635
1EE92 0642
1EE93 0631
1EE94 0634
1EE95 062A
1EE96 062B
1EE97 062E
1EE98 0630
1EE99 0636
1EE9A 0638
1EE9B 063A
1EEA1 0628
1EEA2 062C
1EEA3 062F
1EEA5 0648
1EEA6 0632
1EEA7 062D
1EEA8 0637
1EEA9 064A
1EEAB 0644
1EEAC 0645
1EEAD 0646
1EEAE 0633
1EEAF 0639
1EEB0 0641
1EEB1 0635
1EEB2 0642
1EEB3 0631
1EEB4 0634
1EEB5 062A
1EEB6 062B
1EEB7 062E
1EEB8 0630
1EEB9 0636
1EEBA 0638
1EEBB 063A
1F12B 0063
1F12C 0072
1F130 0061
1F131 0062
1F132 0063
1F133 0064
1F134 0065
1F135 0066
1F136 0067
1F137 0068
1F138 0069
1F139 006A
1F13A 006B
1F13B 006C
1F13C 006D
1F13D 006E
1F13E 006F
1F13F 0070
1F140 0071
1F141 0072
1F142 0073
1F143 0074
1F144 0075
1F145 0076
1F146 0077
1F147 0078
1F148 0079
1F149 007A
1F202 30B5
1F210 624B
1F211 5B57
1F212 53CC
1F213 30C7
1F214 4E8C
1F215 591A
1F216 89E3
1F217 5929
1F218 4EA4
1F219 6620
1F21A 7121
1F21B 6599
1F21C 524D
1F21D 5F8C
1F21E 518D
1F21F 65B0
1F220 521D
1F221 7D42
1F222 751F
1F223 8CA9
1F224 58F0
1F225 5439
1F226 6F14
1F227 6295
1F228 6355
1F229 4E00
1F22A 4E09
1F22B 904A
1F22C 5DE6
1F22D 4E2D
1F22E 53F3
1F22F 6307
1F230 8D70
1F231 6253
1F232 7981
1F233 7A7A
1F234 5408
1F235 6E80
1F236 6709
1F237 6708
1F238 7533
1F239 5272
1F23A 55B6
1F250 5F97
1F251 53EF
2F800 4E3D
2F801 4E38
2F802 4E41
2F803 20122
2F804 4F60
2F805 4FAE
2F806 4FBB
2F807 5002
2F808 507A
2F809 5099
2F80A 50E7
2F80B 50CF
2F80C 349E
2F80D 2063A
2F80E 514D
2F80F 5154
2F810 5164
2F811 5177
2F812 2051C
2F813 34B9
2F814 5167
2F815 518D
2F816 2054B
2F817 5197
2F818 51A4
2F819 4ECC
2F81A 51AC
2F81B 51B5
2F81C 291DF
2F81D 51F5
2F81E 5203
2F81F 34DF
2F820 523B
2F821 5246
2F822 5272
2F823 5277
2F824 3515
2F825 52C7
2F826 52C9
2F827 52E4
2F828 52FA
2F829 5305
2F82A 5306
2F82B 5317
2F82C 5349
2F82D 5351
2F82E 535A
2F82F 5373
2F830 537D
2F831 537F
2F832 537F
2F833 537F
2F834 20A2C
2F835 7070
2F836 53CA
2F837 53DF
2F838 20B63
2F839 53EB
2F83A 53F1
2F83B 5406
2F83C 549E
2F83D 5438
2F83E 5448
2F83F 5468
2F840 54A2
2F841 54F6
2F842 5510
2F843 5553
2F844 5563
2F845 5584
2F846 5584
2F847 5599
2F848 55AB
2F849 55B3
2F84A 55C2
2F84B 5716
2F84C 5606
2F84D 5717
2F84E 5651
2F84F 5674
2F850 5207
2F851 58EE
2F852 57CE
2F853 57F4
2F854 580D
2F855 578B
2F856 5832
2F857 5831
2F858 58AC
2F859 214E4
2F85A 58F2
2F85B 58F7
2F85C 5906
2F85D 591A
2F85E 5922
2F85F 5962
2F860 216A8
2F861 216EA
2F862 59EC
2F863 5A1B
2F864 5A27
2F865 59D8
2F866 5A66
2F867 36EE
2F868 36FC
2F869 5B08
2F86A 5B3E
2F86B 5B3E
2F86C 219C8
2F86D 5BC3
2F86E 5BD8
2F86F 5BE7
2F870 5BF3
2F871 21B18
2F872 5BFF
2F873 5C06
2F874 5F53
2F875 5C22
2F876 3781
2F877 5C60
2F878 5C6E
2F879 5CC0
2F87A 5C8D
2F87B 21DE4
2F87C 5D43
2F87D 21DE6
2F87E 5D6E
2F87F 5D6B
2F880 5D7C
2F881 5DE1
2F882 5DE2
2F883 382F
2F884 5DFD
2F885 5E28
2F886 5E3D
2F887 5E69
2F888 3862
2F889 22183
2F88A 387C
2F88B 5EB0
2F88C 5EB3
2F88D 5EB6
2F88E 5ECA
2F88F 2A392
2F890 5EFE
2F891 22331
2F892 22331
2F893 8201
2F894 5F22
2F895 5F22
2F896 38C7
2F897 232B8
2F898 261DA
2F899 5F62
2F89A 5F6B
2F89B 38E3
2F89C 5F9A
2F89D 5FCD
2F89E 5FD7
2F89F 5FF9
2F8A0 6081
2F8A1 393A
2F8A2 391C
2F8A3 6094
2F8A4 226D4
2F8A5 60C7
2F8A6 6148
2F8A7 614C
2F8A8 614E
2F8A9 614C
2F8AA 617A
2F8AB 618E
2F8AC 61B2
2F8AD 61A4
2F8AE 61AF
2F8AF 61DE
2F8B0 61F2
2F8B1 61F6
2F8B2 6210
2F8B3 621B
2F8B4 625D
2F8B5 62B1
2F8B6 62D4
2F8B7 6350
2F8B8 22B0C
2F8B9 633D
2F8BA 62FC
2F8BB 6368
2F8BC 6383
2F8BD 63E4
2F8BE 22BF1
2F8BF 6422
2F8C0 63C5
2F8C1 63A9
2F8C2 3A2E
2F8C3 6469
2F8C4 647E
2F8C5 649D
2F8C6 6477
2F8C7 3A6C
2F8C8 654F
2F8C9 656C
2F8CA 2300A
2F8CB 65E3
2F8CC 66F8
2F8CD 6649
2F8CE 3B19
2F8CF 6691
2F8D0 3B08
2F8D1 3AE4
2F8D2 5192
2F8D3 5195
2F8D4 6700
2F8D5 669C
2F8D6 80AD
2F8D7 43D9
2F8D8 6717
2F8D9 671B
2F8DA 6721
2F8DB 675E
2F8DC 6753
2F8DD 233C3
2F8DE 3B49
2F8DF 67FA
2F8E0 6785
2F8E1 6852
2F8E2 6885
2F8E3 2346D
2F8E4 688E
2F8E5 681F
2F8E6 6914
2F8E7 3B9D
2F8E8 6942
2F8E9 69A3
2F8EA 69EA
2F8EB 6AA8
2F8EC 236A3
2F8ED 6ADB
2F8EE 3C18
2F8EF 6B21
2F8F0 238A7
2F8F1 6B54
2F8F2 3C4E
2F8F3 6B72
2F8F4 6B9F
2F8F5 6BBA
2F8F6 6BBB
2F8F7 23A8D
2F8F8 21D0B
2F8F9 23AFA
2F8FA 6C4E
2F8FB 23CBC
2F8FC 6CBF
2F8FD 6CCD
2F8FE 6C67
2F8FF 6D16
2F900 6D3E
2F901 6D77
2F902 6D41
2F903 6D69
2F904 6D78
2F905 6D85
2F906 23D1E
2F907 6D34
2F908 6E2F
2F909 6E6E
2F90A 3D33
2F90B 6ECB
2F90C 6EC7
2F90D 23ED1
2F90E 6DF9
2F90F 6F6E
2F910 23F5E
2F911 23F8E
2F912 6FC6
2F913 7039
2F914 701E
2F915 701B
2F916 3D96
2F917 704A
2F918 707D
2F919 7077
2F91A 70AD
2F91B 20525
2F91C 7145
2F91D 24263
2F91E 719C
2F91F 243AB
2F920 7228
2F921 7235
2F922 7250
2F923 24608
2F924 7280
2F925 7295
2F926 24735
2F927 24814
2F928 737A
2F929 738B
2F92A 3EAC
2F92B 73A5
2F92C 3EB8
2F92D 3EB8
2F92E 7447
2F92F 745C
2F930 7471
2F931 7485
2F932 74CA
2F933 3F1B
2F934 7524
2F935 24C36
2F936 753E
2F937 24C92
2F938 7570
2F939 2219F
2F93A 7610
2F93B 24FA1
2F93C 24FB8
2F93D 25044
2F93E 3FFC
2F93F 4008
2F940 76F4
2F941 250F3
2F942 250F2
2F943 25119
2F944 25133
2F945 771E
2F946 771F
2F947 771F
2F948 774A
2F949 4039
2F94A 778B
2F94B 4046
2F94C 4096
2F94D 2541D
2F94E 784E
2F94F 788C
2F950 78CC
2F951 40E3
2F952 25626
2F953 7956
2F954 2569A
2F955 256C5
2F956 798F
2F957 79EB
2F958 412F
2F959 7A40
2F95A 7A4A
2F95B 7A4F
2F95C 2597C
2F95D 25AA7
2F95E 25AA7
2F95F 7AEE
2F960 4202
2F961 25BAB
2F962 7BC6
2F963 7BC9
2F964 4227
2F965 25C80
2F966 7CD2
2F967 42A0
2F968 7CE8
2F969 7CE3
2F96A 7D00
2F96B 25F86
2F96C 7D63
2F96D 4301
2F96E 7DC7
2F96F 7E02
2F970 7E45
2F971 4334
2F972 26228
2F973 26247
2F974 4359
2F975 262D9
2F976 7F7A
2F977 2633E
2F978 7F95
2F979 7FFA
2F97A 8005
2F97B 264DA
2F97C 26523
2F97D 8060
2F97E 265A8
2F97F 8070
2F980 2335F
2F981 43D5
2F982 80B2
2F983 8103
2F984 440B
2F985 813E
2F986 5AB5
2F987 267A7
2F988 267B5
2F989 23393
2F98A 2339C
2F98B 8201
2F98C 8204
2F98D 8F9E
2F98E 446B
2F98F 8291
2F990 828B
2F991 829D
2F992 52B3
2F993 82B1
2F994 82B3
2F995 82BD
2F996 82E6
2F997 26B3C
2F998 82E5
2F999 831D
2F99A 8363
2F99B 83AD
2F99C 8323
2F99D 83BD
2F99E 83E7
2F99F 8457
2F9A0 8353
2F9A1 83CA
2F9A2 83CC
2F9A3 83DC
2F9A4 26C36
2F9A5 26D6B
2F9A6 26CD5
2F9A7 452B
2F9A8 84F1
2F9A9 84F3
2F9AA 8516
2F9AB 273CA
2F9AC 8564
2F9AD 26F2C
2F9AE 455D
2F9AF 4561
2F9B0 26FB1
2F9B1 270D2
2F9B2 456B
2F9B3 8650
2F9B4 865C
2F9B5 8667
2F9B6 8669
2F9B7 86A9
2F9B8 8688
2F9B9 870E
2F9BA 86E2
2F9BB 8779
2F9BC 8728
2F9BD 876B
2F9BE 8786
2F9BF 45D7
2F9C0 87E1
2F9C1 8801
2F9C2 45F9
2F9C3 8860
2F9C4 8863
2F9C5 27667
2F9C6 88D7
2F9C7 88DE
2F9C8 4635
2F9C9 88FA
2F9CA 34BB
2F9CB 278AE
2F9CC 27966
2F9CD 46BE
2F9CE 46C7
2F9CF 8AA0
2F9D0 8AED
2F9D1 8B8A
2F9D2 8C55
2F9D3 27CA8
2F9D4 8CAB
2F9D5 8CC1
2F9D6 8D1B
2F9D7 8D77
2F9D8 27F2F
2F9D9 20804
2F9DA 8DCB
2F9DB 8DBC
2F9DC 8DF0
2F9DD 208DE
2F9DE 8ED4
2F9DF 8F38
2F9E0 285D2
2F9E1 285ED
2F9E2 9094
2F9E3 90F1
2F9E4 9111
2F9E5 2872E
2F9E6 911B
2F9E7 9238
2F9E8 92D7
2F9E9 92D8
2F9EA 927C
2F9EB 93F9
2F9EC 9415
2F9ED 28BFA
2F9EE 958B
2F9EF 4995
2F9F0 95B7
2F9F1 28D77
2F9F2 49E6
2F9F3 96C3
2F9F4 5DB2
2F9F5 9723
2F9F6 29145
2F9F7 2921A
2F9F8 4A6E
2F9F9 4A76
2F9FA 97E0
2F9FB 2940A
2F9FC 4AB2
2F9FD 29496
2F9FE 980B
2F9FF 980B
2FA00 9829
2FA01 295B6
2FA02 98E2
2FA03 4B33
2FA04 9929
2FA05 99A7
2FA06 99C2
2FA07 99FE
2FA08 4BCE
2FA09 29B30
2FA0A 9B12
2FA0B 9C40
2FA0C 9CFD
2FA0D 4CCE
2FA0E 4CED
2FA0F 9D67
2FA10 2A0CE
2FA11 4CF8
2FA12 2A105
2FA13 2A20E
2FA14 2A291
2FA15 9EBB
2FA16 4D56
2FA17 9EF9
2FA18 9EFE
2FA19 9F05
2FA1A 9F0F
2FA1B 9F16
2FA1C 9F3B
2FA1D 2A600
END
| 39.635935 | 267 | 0.407512 |
ed89a74257f31696d45cb5030715966ffb90506b | 1,680 | t | Perl | t/320_range.t | mika-sandbox/p5-List-Linq | 353812c49d632d4a78fc40a7e32ee43e3b5213de | [
"Artistic-1.0"
] | 8 | 2020-12-09T06:47:17.000Z | 2020-12-10T11:26:56.000Z | t/320_range.t | mika-sandbox/p5-List-Linq | 353812c49d632d4a78fc40a7e32ee43e3b5213de | [
"Artistic-1.0"
] | null | null | null | t/320_range.t | mika-sandbox/p5-List-Linq | 353812c49d632d4a78fc40a7e32ee43e3b5213de | [
"Artistic-1.0"
] | 1 | 2020-12-11T07:27:21.000Z | 2020-12-11T07:27:21.000Z | use strict;
use warnings;
use Test::Spec;
use Test::Deep;
use Test::Exception;
use List::Linq;
describe 'Enumerable#range' => sub {
my ($got, $expected);
before each => sub {
$got = ();
};
context 'range starts 0 with 0 elements' => sub {
before all => sub {
$expected = [qw//];
my $enumerable = List::Linq->range(0, 0);
while ($enumerable->move_next) {
push @{$got}, $enumerable->current;
}
};
it 'successful' => sub {
cmp_deeply $got, undef;
};
};
context 'range starts 0 with 10 elements' => sub {
before all => sub {
$expected = [qw/0 1 2 3 4 5 6 7 8 9/];
my $enumerable = List::Linq->range(0, 10);
while ($enumerable->move_next) {
push @{$got}, $enumerable->current;
}
};
it 'successful' => sub {
cmp_deeply $got, $expected;
};
};
context 'range starts 0 with infinity elements but take 10 items' => sub {
before all => sub {
$expected = [qw/0 1 2 3 4 5 6 7 8 9/];
my $enumerable = List::Linq->range(0, "inf")->take(10);
while ($enumerable->move_next) {
push @{$got}, $enumerable->current;
}
};
it 'successful' => sub {
cmp_deeply $got, $expected;
};
};
context 'pass count to -1' => sub {
it 'throw exception' => sub {
throws_ok {
List::Linq->range(0, -1);
} qr/ArgumentOutOfRangeException/;
};
};
};
runtests unless caller; | 22.702703 | 78 | 0.470238 |
ed3182a361c261e25407c8acdef7e35614c1ce1a | 3,149 | t | Perl | modules/t/sample.t | fergalmartin/ensembl-variation | 858de3ee083fd066bc0b8a78e8a449176dd51bce | [
"Apache-2.0"
] | null | null | null | modules/t/sample.t | fergalmartin/ensembl-variation | 858de3ee083fd066bc0b8a78e8a449176dd51bce | [
"Apache-2.0"
] | 1 | 2020-04-20T12:11:56.000Z | 2020-04-20T12:11:56.000Z | modules/t/sample.t | dglemos/ensembl-variation | 7cd20531835b45b1842476606b4fd0856e3843e0 | [
"Apache-2.0"
] | null | null | null | # Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
# Copyright [2016-2018] EMBL-European Bioinformatics Institute
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
use strict;
use warnings;
use Test::More;
use Test::Exception;
use Bio::EnsEMBL::Variation::Individual;
use Bio::EnsEMBL::Variation::Sample;
use Bio::EnsEMBL::Test::MultiTestDB;
my $multi = Bio::EnsEMBL::Test::MultiTestDB->new('homo_sapiens');
my $vdb = $multi->get_DBAdaptor('variation');
my $sample_adaptor = $vdb->get_SampleAdaptor;
my $name = 'ind name';
my $description = 'african';
my $gender = 'Male';
my $type = "Outbred";
# test constructor
my $ind = Bio::EnsEMBL::Variation::Individual->new(
-name => $name,
-description => $description,
-gender => $gender,
-type_individual => $type
);
my $sample_name = 'sample name';
my $sample_description = 'sample desc';
my $display = "DEFAULT";
my $new_display = "DISPLAYABLE";
my $sample = Bio::EnsEMBL::Variation::Sample->new(
-name => $sample_name,
-description => $sample_description,
-display => $display,
-individual => $ind,
-adaptor => $sample_adaptor,
);
ok($sample->name() eq $sample_name, "sample name");
ok($sample->description() eq $sample_description, "sample description");
ok($sample->individual->gender() eq $gender, "gender" );
ok($sample->display() eq $display, "display");
ok($sample->display($new_display) eq $new_display, "display updated (with argument)");
ok($sample->individual->type_individual() eq $type, "type");
ok($sample->has_coverage() == 0, "default coverage");
$sample->has_coverage(1);
ok($sample->has_coverage() == 1, "coverage update");
throws_ok { $sample->display('WRONG_DISPLAY_VALUE'); } qr/Display flag must be one of/, 'Die on wrong value for display';
throws_ok { $sample->individual('individual'); } qr/Individual argument expected/, 'Die on wrong individual argument';
throws_ok { $sample->study('study'); } qr/Study argument expected/, 'Die on wrong study argument';
$sample->{'study_id'} = 4237;
my $study = $sample->study();
ok($study->name eq 'estd1', 'getter for study');
$study = Bio::EnsEMBL::Variation::Study->new(
-name => 'study_name',
);
$sample->study($study);
$study = $sample->study();
ok($study->name eq 'study_name', 'getter and setter study');
$sample = $sample_adaptor->fetch_by_dbID(101549);
my $populations = $sample->get_all_Populations();
my $concat_populations = join(',', sort map {$_->name} @$populations);
ok($concat_populations eq '1000GENOMES:phase_1_ALL,1000GENOMES:phase_1_CEU,1000GENOMES:phase_1_EUR', 'get_all_Populations');
done_testing();
| 35.382022 | 124 | 0.710702 |
73d7169481c27a18e803dd00d0faeb06993af00b | 840 | pm | Perl | lib/Catalyst/Controller/RequestToken/Action/RemoveToken.pm | bobtfish/Catalyst-Controller-RequestToken | 1838294dfc42a25a5e66d3f6241f6621aecfc853 | [
"Artistic-1.0-cl8"
] | 1 | 2018-08-27T14:44:56.000Z | 2018-08-27T14:44:56.000Z | lib/Catalyst/Controller/RequestToken/Action/RemoveToken.pm | bobtfish/Catalyst-Controller-RequestToken | 1838294dfc42a25a5e66d3f6241f6621aecfc853 | [
"Artistic-1.0-cl8"
] | 1 | 2016-08-05T14:15:06.000Z | 2016-08-05T14:15:06.000Z | lib/Catalyst/Controller/RequestToken/Action/RemoveToken.pm | bobtfish/Catalyst-Controller-RequestToken | 1838294dfc42a25a5e66d3f6241f6621aecfc853 | [
"Artistic-1.0-cl8"
] | null | null | null | package Catalyst::Controller::RequestToken::Action::RemoveToken;
use strict;
use warnings;
use base qw(Catalyst::Action);
use MRO::Compat;
sub execute {
my $self = shift;
my ( $controller, $c, @args ) = @_;
$controller->remove_token($c);
return $self->next::method(@_);
}
1;
__END__
=head1 NAME
Catalyst::Controller::RequestToken::Action::RemoveToken
=head1 SYNOPSIS
=head1 DESCRIPTION
=head1 INTERNAL METHODS
=over 4
=item execute
=back
=head1 SEE ALSO
L<Catalyst::Controller::RequestToken>
L<Catalyst>
L<Catalyst::Action>
=head1 AUTHOR
Hideo Kimura C<< <<hide<at>hide-k.net>> >>
=head1 COPYRIGHT
This program is free software; you can redistribute
it and/or modify it under the same terms as Perl itself.
The full text of the license can be found in the
LICENSE file included with this module.
=cut
| 14.736842 | 64 | 0.719048 |
ed8607eff0c7be4c95e147c97adf34eb8268400b | 10,317 | t | Perl | example-perl-psgi/.cpanm/work/1459817744.11/DateTime-1.26/t/06add.t | NINGONDA/apcera | 60ccb872a56566bde41594546ba4e97e0d73eae0 | [
"MIT"
] | null | null | null | example-perl-psgi/.cpanm/work/1459817744.11/DateTime-1.26/t/06add.t | NINGONDA/apcera | 60ccb872a56566bde41594546ba4e97e0d73eae0 | [
"MIT"
] | null | null | null | example-perl-psgi/.cpanm/work/1459817744.11/DateTime-1.26/t/06add.t | NINGONDA/apcera | 60ccb872a56566bde41594546ba4e97e0d73eae0 | [
"MIT"
] | null | null | null | use strict;
use warnings;
use Test::More;
use Test::Fatal;
use DateTime;
my $dt = DateTime->new(
year => 1996, month => 11, day => 22,
hour => 18, minute => 30, second => 20,
time_zone => 'UTC',
);
$dt->add( weeks => 8 );
is( $dt->year, 1997, "year rollover" );
is( $dt->month, 1, "month set on year rollover" );
is( $dt->datetime, '1997-01-17T18:30:20', 'okay on year rollover' );
$dt->add( weeks => 2 );
is( $dt->datetime, '1997-01-31T18:30:20', 'Adding weeks' );
$dt->add( seconds => 15 );
is( $dt->datetime, '1997-01-31T18:30:35', 'Adding seconds' );
$dt->add( minutes => 12 );
is( $dt->datetime, '1997-01-31T18:42:35', 'Adding minutes' );
$dt->add( minutes => 25, hours => 3, seconds => 7 );
is( $dt->datetime, '1997-01-31T22:07:42', 'Adding h,m,s' );
# Now, test the adding of durations
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( minutes => 1, seconds => 12 );
is(
$dt->datetime, '1986-01-28T16:39:12',
"Adding durations with minutes and seconds works"
);
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( seconds => 30 );
is(
$dt->datetime, '1986-01-28T16:38:30',
"Adding durations with seconds only works"
);
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( hours => 1, minutes => 10 );
is(
$dt->datetime, '1986-01-28T17:48:00',
"Adding durations with hours and minutes works"
);
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( days => 3 );
is(
$dt->datetime, '1986-01-31T16:38:00',
"Adding durations with days only works"
);
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( days => 3, hours => 2 );
is(
$dt->datetime, '1986-01-31T18:38:00',
"Adding durations with days and hours works"
);
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( days => 3, hours => 2, minutes => 20, seconds => 15 );
is(
$dt->datetime, '1986-01-31T18:58:15',
"Adding durations with days, hours, minutes, and seconds works"
);
# Add 15M - this test failed at one point in N::I::Time
$dt = DateTime->new(
year => 2001, month => 4, day => 5,
hour => 16,
time_zone => 'UTC'
);
$dt->add( minutes => 15 );
is(
$dt->datetime, '2001-04-05T16:15:00',
"Adding minutes to an ical string"
);
# Subtract a duration
$dt->add( minutes => -15 );
is( $dt->datetime, '2001-04-05T16:00:00', "Back where we started" );
undef $dt;
$dt = DateTime->new(
year => 1986, month => 1, day => 28,
hour => 16, minute => 38,
time_zone => 'UTC'
);
$dt->add( seconds => 60 );
is(
$dt->datetime, "1986-01-28T16:39:00",
"adding positive seconds with seconds works"
);
$dt->add( seconds => -120 );
is(
$dt->datetime, "1986-01-28T16:37:00",
"adding negative seconds with seconds works"
);
# test sub months
$dt = DateTime->new(
year => 2001, month => 1, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-02-01', 'february 1st' );
$dt = DateTime->new(
year => 2001, month => 2, day => 28,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-03-01', 'march 1st' );
$dt = DateTime->new(
year => 2001, month => 3, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-04-01', 'april 1st' );
$dt = DateTime->new(
year => 2001, month => 4, day => 30,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-05-01', 'may 1st' );
$dt = DateTime->new(
year => 2001, month => 5, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-06-01', 'june 1st' );
$dt = DateTime->new(
year => 2001, month => 6, day => 30,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-07-01', 'july 1st' );
$dt = DateTime->new(
year => 2001, month => 7, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-08-01', 'august 1st' );
$dt = DateTime->new(
year => 2001, month => 8, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-09-01', 'september 1st' );
$dt = DateTime->new(
year => 2001, month => 9, day => 30,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-10-01', 'october 1st' );
$dt = DateTime->new(
year => 2001, month => 10, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-11-01', 'november 1st' );
$dt = DateTime->new(
year => 2001, month => 11, day => 30,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2001-12-01', 'december 1st' );
$dt = DateTime->new(
year => 2001, month => 12, day => 31,
time_zone => 'UTC',
);
$dt->add( days => 1 );
is( $dt->date, '2002-01-01', 'january 1st' );
# Adding years
# Before leap day, not a leap year ...
$dt = DateTime->new(
year => 2001, month => 2, day => 28,
time_zone => 'UTC',
);
$dt->add( years => 1 );
is( $dt->date, '2002-02-28', 'Adding a year' );
$dt->add( years => 17 );
is( $dt->date, '2019-02-28', 'Adding 17 years' );
# After leap day, not a leap year ...
$dt = DateTime->new(
year => 2001, month => 3, day => 28,
time_zone => 'UTC',
);
$dt->add( years => 1 );
is( $dt->date, '2002-03-28', 'Adding a year' );
$dt->add( years => 17 );
is( $dt->date, '2019-03-28', 'Adding 17 years' );
# On leap day, in a leap year ...
$dt = DateTime->new(
year => 2000, month => 2, day => 29,
time_zone => 'UTC',
);
$dt->add( years => 1 );
is( $dt->date, '2001-03-01', 'Adding a year' );
$dt->add( years => 17 );
is( $dt->date, '2018-03-01', 'Adding 17 years' );
# Before leap day, in a leap year ...
$dt = DateTime->new(
year => 2000, month => 2, day => 28,
time_zone => 'UTC',
);
$dt->add( years => 1 );
is( $dt->date, '2001-02-28', 'Adding a year' );
$dt->add( years => 17 );
is( $dt->date, '2018-02-28', 'Adding 17 years' );
# After leap day, in a leap year ...
$dt = DateTime->new(
year => 2000, month => 3, day => 28,
time_zone => 'UTC',
);
$dt->add( years => 1 );
is( $dt->date, '2001-03-28', 'Adding a year' );
$dt->add( years => 17 );
is( $dt->date, '2018-03-28', 'Adding 17 years' );
# Test a bunch of years, before leap day
for ( 1 .. 99 ) {
$dt = DateTime->new(
year => 2000, month => 2, day => 28,
time_zone => 'UTC',
);
$dt->add( years => $_ );
my $x = sprintf '%02d', $_;
is( $dt->date, "20${x}-02-28", "Adding $_ years" );
}
# Test a bunch of years, after leap day
for ( 1 .. 99 ) {
$dt = DateTime->new(
year => 2000, month => 3, day => 28,
time_zone => 'UTC',
);
$dt->add( years => $_ );
my $x = sprintf '%02d', $_;
is( $dt->date, "20${x}-03-28", "Adding $_ years" );
}
# And more of the same, starting on a non-leap year
# Test a bunch of years, before leap day
for ( 1 .. 97 ) {
$dt = DateTime->new(
year => 2002, month => 2, day => 28,
time_zone => 'UTC',
);
$dt->add( years => $_ );
my $x = sprintf '%02d', $_ + 2;
is( $dt->date, "20${x}-02-28", "Adding $_ years" );
}
# Test a bunch of years, after leap day
for ( 1 .. 97 ) {
$dt = DateTime->new(
year => 2002, month => 3, day => 28,
time_zone => 'UTC',
);
$dt->add( years => $_ );
my $x = sprintf '%02d', $_ + 2;
is( $dt->date, "20${x}-03-28", "Adding $_ years" );
}
# subtract years
for ( 1 .. 97 ) {
$dt = DateTime->new(
year => 1999, month => 3, day => 1,
time_zone => 'UTC',
);
$dt->add( years => -$_ );
my $x = sprintf '%02d', 99 - $_;
is( $dt->date, "19${x}-03-01", "Subtracting $_ years" );
}
# test some old bugs
# bug adding months where current month + months added were > 25
$dt = DateTime->new(
year => 1997, month => 12, day => 1,
time_zone => 'UTC',
);
$dt->add( months => 14 );
is( $dt->date, '1999-02-01', 'Adding months--rollover year' );
# bug subtracting months with year rollover
$dt = DateTime->new(
year => 1997, month => 1, day => 1,
time_zone => 'UTC',
);
$dt->add( months => -1 );
is( $dt->date, '1996-12-01', 'Subtracting months--rollover year' );
my $new = $dt + DateTime::Duration->new( years => 2 );
is( $new->date, '1998-12-01', 'test + overloading' );
{
my $dt = DateTime->new(
year => 1997, month => 1, day => 1,
hour => 1, minute => 1, second => 59,
nanosecond => 500000000,
time_zone => 'UTC',
);
$dt->add( nanoseconds => 500000000 );
is( $dt->second, 0, 'fractional second rollover' );
$dt->add( nanoseconds => 123000000 );
is( $dt->fractional_second, 0.123, 'as fractional_second' );
}
{
my $dt = DateTime->new( year => 2003, month => 2, day => 28 );
$dt->add( months => 1, days => 1 );
is( $dt->ymd, '2003-04-01', 'order of units in date math' );
}
{
my $dt = DateTime->new( year => 2003, hour => 12, minute => 1 );
$dt->add( minutes => 30, seconds => -1 );
is( $dt->hour, 12, 'hour is 12' );
is( $dt->minute, 30, 'minute is 30' );
is( $dt->second, 59, 'second is 59' );
}
{
my $dt = DateTime->new(
year => 2014,
month => 7,
day => 1,
time_zone => 'floating',
);
$dt->add( days => 2 );
is( $dt->date, '2014-07-03', 'adding 2 days to a floating datetime' );
}
{
my $dt = DateTime->new( year => 0, month => 1, day => 1 );
my $dt2;
is(
exception { $dt2 = $dt->clone->add( days => 268_526_345 ) },
undef,
'no exception adding 268,526,345 days to 0000-01-01'
);
if ($dt2) {
is(
$dt2->ymd(),
'735200-02-29',
'adding 268,526,345 days produces 735200-02-29'
);
}
}
done_testing();
| 24.741007 | 74 | 0.51071 |
ed744d020d96a67b33ffb3bb70cd3e67da480a98 | 2,778 | t | Perl | test/diag.t | pa1gupta/taskwarrior | 7400e6ed6ba38358000fd5a30cc31db183294d74 | [
"MIT"
] | 2,527 | 2018-02-03T18:27:06.000Z | 2022-03-31T15:20:50.000Z | test/diag.t | pa1gupta/taskwarrior | 7400e6ed6ba38358000fd5a30cc31db183294d74 | [
"MIT"
] | 2,575 | 2018-02-04T22:17:19.000Z | 2022-03-26T18:54:36.000Z | test/diag.t | pa1gupta/taskwarrior | 7400e6ed6ba38358000fd5a30cc31db183294d74 | [
"MIT"
] | 263 | 2018-02-04T22:05:59.000Z | 2022-03-27T19:19:06.000Z | #!/usr/bin/env python3
# -*- coding: utf-8 -*-
###############################################################################
#
# Copyright 2006 - 2021, Tomas Babej, Paul Beckingham, Federico Hernandez.
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to deal
# in the Software without restriction, including without limitation the rights
# to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
# copies of the Software, and to permit persons to whom the Software is
# furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included
# in all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS
# OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL
# THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
# SOFTWARE.
#
# https://www.opensource.org/licenses/mit-license.php
#
###############################################################################
import sys
import os
import platform
import unittest
# Ensure python finds the local simpletap module
sys.path.append(os.path.dirname(os.path.abspath(__file__)))
from basetest import Task, TestCase
class TestDiagnostics(TestCase):
def setUp(self):
self.t = Task()
self.t.config("editor", "edlin")
self.t.config("taskd.ca", "/tmp/ca")
self.t.config("taskd.trust", "strict")
self.t.config("taskd.credentials", "us/me/xxx")
@unittest.skipIf(
getattr(platform, 'dist', None) == None or 'xenial' == platform.dist()[-1],
'Skipping diagnostics test on Ubuntu 16.04, as it lacks full C++17 support'
)
def test_diagnostics(self):
"""Task diag output, so we can monitor platforms"""
self.t.activate_hooks()
code, out, err = self.t.diag()
self.tap(out)
self.assertRegex(out, "Compliance:\s+C\+\+17")
self.assertRegex(out, "libgnutls:\s+\d+\.\d+\.\d+")
self.assertIn("edlin", out)
self.assertIn("strict", out)
def test_64bit_time_t(self):
"""Test that time_t has size of 64 bits"""
code, out, err = self.t.diag()
self.assertIn("+time_t64", out)
if __name__ == "__main__":
from simpletap import TAPTestRunner
unittest.main(testRunner=TAPTestRunner())
# vim: ai sts=4 et sw=4 ft=python
| 38.583333 | 83 | 0.649028 |
edad78e0c4406969cfdc164a38bea7b855ddc206 | 18,625 | pm | Perl | modules/EnsEMBL/Web/Component/Gene/ComparaOrthologs.pm | at7/backup-ensembl-webcode | 4c8c30f2ba9e0eebc3dd07e068fb6e02c388d086 | [
"Apache-2.0",
"MIT"
] | null | null | null | modules/EnsEMBL/Web/Component/Gene/ComparaOrthologs.pm | at7/backup-ensembl-webcode | 4c8c30f2ba9e0eebc3dd07e068fb6e02c388d086 | [
"Apache-2.0",
"MIT"
] | null | null | null | modules/EnsEMBL/Web/Component/Gene/ComparaOrthologs.pm | at7/backup-ensembl-webcode | 4c8c30f2ba9e0eebc3dd07e068fb6e02c388d086 | [
"Apache-2.0",
"MIT"
] | null | null | null | =head1 LICENSE
Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute
Copyright [2016-2017] EMBL-European Bioinformatics Institute
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
=cut
package EnsEMBL::Web::Component::Gene::ComparaOrthologs;
use strict;
use HTML::Entities qw(encode_entities);
use EnsEMBL::Web::Utils::FormatText qw(glossary_helptip get_glossary_entry);
use base qw(EnsEMBL::Web::Component::Gene);
sub _init {
my $self = shift;
$self->cacheable(1);
$self->ajaxable(1);
}
## Stub - implement in plugin if you want to display a summary table
## (see public-plugins/ensembl for an example data structure)
sub _species_sets {}
sub _get_all_analysed_species {
my ($self, $cdb) = @_;
if (!$self->{'_all_analysed_species'}) {
$self->{"_mlss_adaptor_$cdb"} ||= $self->hub->get_adaptor('get_MethodLinkSpeciesSetAdaptor', $cdb);
my $pt_mlsss = $self->{"_mlss_adaptor_$cdb"}->fetch_all_by_method_link_type('PROTEIN_TREES');
my $best_pt_mlss;
if (scalar(@$pt_mlsss) > 1) {
($best_pt_mlss) = grep {$_->species_set->name eq 'collection-default'} @$pt_mlsss;
} else {
$best_pt_mlss = $pt_mlsss->[0];
}
$self->{'_all_analysed_species'} = {map {ucfirst($_->name) => 1} @{$best_pt_mlss->species_set->genome_dbs}};
}
return %{$self->{'_all_analysed_species'}};
}
our %button_set = ('download' => 1, 'view' => 0);
sub content {
my $self = shift;
my $hub = $self->hub;
my $object = $self->object;
my $species_defs = $hub->species_defs;
my $cdb = shift || $self->param('cdb') || 'compara';
my $availability = $object->availability;
my $is_ncrna = ($object->Obj->biotype =~ /RNA/);
my $species_name = $species_defs->DISPLAY_NAME;
my $strain_url = $species_defs->IS_STRAIN_OF ? "Strain_" : "";
my $strain_param = ";strain=1" if($self->is_strain);
my @orthologues = (
$object->get_homology_matches('ENSEMBL_ORTHOLOGUES', undef, undef, $cdb),
);
my %orthologue_list;
my %skipped;
my %not_seen = $self->_get_all_analysed_species($cdb);
delete $not_seen{ucfirst($species_defs->get_config($hub->species, 'SPECIES_PRODUCTION_NAME'))}; #deleting current species
for (keys %not_seen) {
#do not show non-strain species on strain view
if ($self->is_strain && !$species_defs->get_config($species_defs->production_name_mapping($_), 'RELATED_TAXON')) { delete $not_seen{$_}; }
#do not show strain species on main species view
if(!$self->is_strain && $species_defs->get_config($species_defs->production_name_mapping($_), 'IS_STRAIN_OF')) { delete $not_seen{$_}; }
}
foreach my $homology_type (@orthologues) {
foreach (keys %$homology_type) {
(my $species = $_) =~ tr/ /_/;
#do not show strain species on main species view
if ((!$self->is_strain && $species_defs->get_config($species_defs->production_name_mapping($species), 'IS_STRAIN_OF')) || ($self->is_strain && !$species_defs->get_config($species_defs->production_name_mapping($species), 'RELATED_TAXON'))) {
delete $not_seen{$species};
next;
}
$orthologue_list{$species} = {%{$orthologue_list{$species}||{}}, %{$homology_type->{$_}}};
$skipped{$species} += keys %{$homology_type->{$_}} if $self->param('species_' . lc $species) eq 'off';
delete $not_seen{$species};
}
}
return '<p>No orthologues have been identified for this gene</p>' unless keys %orthologue_list;
my %orthologue_map = qw(SEED BRH PIP RHS);
my $alignview = 0;
my ($html, $columns, @rows);
##--------------------------- SUMMARY TABLE ----------------------------------------
my ($species_sets, $sets_by_species, $set_order) = $self->_species_sets(\%orthologue_list, \%skipped, \%orthologue_map, $cdb);
if ($species_sets) {
$html .= qq{
<h3>
Summary of orthologues of this gene
<a title="Click to show or hide the table" rel="orthologues_summary_table" href="#" class="toggle_link toggle new_icon open _slide_toggle">Hide</a>
</h3>
<div class="toggleable orthologues_summary_table">
<p class="space-below">Click on 'Show details' to display the orthologues for one or more groups of species. Alternatively, click on 'Configure this page' to choose a custom list of species.</p>
};
$columns = [
{ key => 'set', title => 'Species set', align => 'left', width => '26%' },
{ key => 'show', title => 'Show details', align => 'center', width => '10%' },
{ key => '1:1', title => 'With 1:1 orthologues', align => 'center', width => '16%', help => 'Number of species with 1:1 orthologues<em>'.get_glossary_entry($hub, '1-to-1 orthologues').'</em>' },
{ key => '1:many', title => 'With 1:many orthologues', align => 'center', width => '16%', help => 'Number of species with 1:many orthologues<em>'.get_glossary_entry($hub, '1-to-many orthologues').'</em>' },
{ key => 'many:many', title => 'With many:many orthologues', align => 'center', width => '16%', help => 'Number of species with many:many orthologues<em>'.get_glossary_entry($hub, 'Many-to-many orthologues').'</em>' },
{ key => 'none', title => 'Without orthologues', align => 'center', width => '16%', help => 'Number of species without orthologues' },
];
foreach my $set (@$set_order) {
my $set_info = $species_sets->{$set};
my $none_title = $set_info->{'none'} ? sprintf('<a href="#list_no_ortho">%d</a>', $set_info->{'none'}) : 0;
push @rows, {
'set' => "<strong>$set_info->{'title'}</strong> (<i>$set_info->{'all'} species</i>)<br />$set_info->{'desc'}",
'show' => qq{<input type="checkbox" class="table_filter" title="Check to show these species in table below" name="orthologues" value="$set" />},
'1:1' => $set_info->{'1-to-1'} || 0,
'1:many' => $set_info->{'1-to-many'} || 0,
'many:many' => $set_info->{'Many-to-many'} || 0,
'none' => $none_title,
};
}
$html .= $self->new_table($columns, \@rows)->render;
$html .= "</div>"; # Closing toggleable div
}
##----------------------------- FULL TABLE -----------------------------------------
if ($species_sets) {
$html .= '<h3>
Selected orthologues
<a title="Click to show or hide the table" rel="selected_orthologues_table" href="#" class="toggle_link toggle new_icon open _slide_toggle">Hide</a>
</h3>';
}
$columns = [
{ key => 'Species', align => 'left', width => '10%', sort => 'html' },
{ key => 'Type', align => 'left', width => '10%', sort => 'html' },
{ key => 'identifier', align => 'left', width => '15%', sort => 'none', title => 'Orthologue'},
{ key => 'dN/dS', align => 'left', width => '5%', sort => 'html' },
{ key => 'Target %id', align => 'left', width => '5%', sort => 'position_html', label => 'Target %id', help => "Percentage of the orthologous sequence matching the $species_name sequence" },
{ key => 'Query %id', align => 'left', width => '5%', sort => 'position_html', label => 'Query %id', help => "Percentage of the $species_name sequence matching the sequence of the orthologue" },
{ key => 'goc_score', align => 'left', width => '5%', sort => 'position_html', label => 'GOC Score', help => "<a href='/info/genome/compara/Ortholog_qc_manual.html/#goc'>Gene Order Conservation Score (values are 0-100)</a>" },
{ key => 'wgac', align => 'left', width => '5%', sort => 'position_html', label => 'WGA Coverage', help => "<a href='/info/genome/compara/Ortholog_qc_manual.html/#wga'>Whole Genome Alignment Coverage (values are 0-100)</a>" },
{ key => 'confidence', align => 'left', width => '5%', sort => 'html', label => 'High Confidence', help => "<a href='/info/genome/compara/Ortholog_qc_manual.html/#hc'>Homology with high %identity and high GOC score or WGA coverage (as available), Yes or No.</a>"},
];
push @$columns, { key => 'Gene name(Xref)', align => 'left', width => '15%', sort => 'html', title => 'Gene name(Xref)'} if(!$self->html_format);
@rows = ();
foreach my $species (sort { ($a =~ /^<.*?>(.+)/ ? $1 : $a) cmp ($b =~ /^<.*?>(.+)/ ? $1 : $b) } keys %orthologue_list) {
next if $skipped{$species};
foreach my $stable_id (sort keys %{$orthologue_list{$species}}) {
my $orthologue = $orthologue_list{$species}{$stable_id};
my ($target, $query);
# Add in Orthologue description
my $orthologue_desc = $orthologue_map{$orthologue->{'homology_desc'}} || $orthologue->{'homology_desc'};
# Add in the dN/dS ratio
my $orthologue_dnds_ratio = $orthologue->{'homology_dnds_ratio'} || 'n/a';
my $dnds_class = ($orthologue_dnds_ratio ne "n/a" && $orthologue_dnds_ratio >= 1) ? "box-highlight" : "";
# GOC Score, wgac and high confidence
my $goc_score = (defined $orthologue->{'goc_score'} && $orthologue->{'goc_score'} >= 0) ? $orthologue->{'goc_score'} : 'n/a';
my $wgac = (defined $orthologue->{'wgac'} && $orthologue->{'wgac'} >= 0) ? $orthologue->{'wgac'} : 'n/a';
my $confidence = $orthologue->{'highconfidence'} eq '1' ? 'Yes' : $orthologue->{'highconfidence'} eq '0' ? 'No' : 'n/a';
my $goc_class = ($goc_score ne "n/a" && $goc_score >= $orthologue->{goc_threshold}) ? "box-highlight" : "";
my $wga_class = ($wgac ne "n/a" && $wgac >= $orthologue->{wga_threshold}) ? "box-highlight" : "";
(my $spp = $orthologue->{'spp'}) =~ tr/ /_/;
$spp = $species_defs->production_name_mapping($spp);
my $link_url = $hub->url({
species => $spp,
action => 'Summary',
g => $stable_id,
__clear => 1
});
# Check the target species are on the same portal - otherwise the multispecies link does not make sense
my $region_link = ($link_url =~ /^\//
&& $cdb eq 'compara'
&& $availability->{'has_pairwise_alignments'}
&& !$self->is_strain
) ?
sprintf('<a href="%s">Compare Regions</a> ('.$orthologue->{'location'}.')',
$hub->url({
type => 'Location',
action => 'Multi',
g1 => $stable_id,
s1 => $spp,
r => $hub->create_padded_region()->{'r'} || $self->param('r'),
config => 'opt_join_genes_bottom=on',
})
) : $orthologue->{'location'};
my ($alignment_link, $target_class, $query_class);
if ($orthologue_desc ne 'DWGA') {
($target, $query) = ($orthologue->{'target_perc_id'}, $orthologue->{'query_perc_id'});
$target_class = ($target && $target <= 10) ? "bold red" : "";
$query_class = ($query && $query <= 10) ? "bold red" : "";
my $page_url = $hub->url({
type => 'Gene',
action => $hub->action,
g => $self->param('g'),
});
my $zmenu_url = $hub->url({
type => 'ZMenu',
action => 'ComparaOrthologs',
g1 => $stable_id,
dbID => $orthologue->{'dbID'},
cdb => $cdb,
});
if ($is_ncrna) {
$alignment_link .= sprintf '<li><a href="%s" class="notext">Alignment</a></li>', $hub->url({action => $strain_url.'Compara_Ortholog', function => 'Alignment' . ($cdb =~ /pan/ ? '_pan_compara' : ''), hom_id => $orthologue->{'dbID'}, g1 => $stable_id});
} else {
$alignment_link .= sprintf '<a href="%s" class="_zmenu">View Sequence Alignments</a><a class="hidden _zmenu_link" href="%s%s"></a>', $page_url ,$zmenu_url, $strain_param;
}
$alignview = 1;
}
my $tree_url = $hub->url({
type => 'Gene',
action => $strain_url.'Compara_Tree' . ($cdb =~ /pan/ ? '/pan_compara' : ''),
g1 => $stable_id,
anc => $orthologue->{'gene_tree_node_id'},
r => undef
});
# External ref and description
my $description = encode_entities($orthologue->{'description'});
$description = 'No description' if $description eq 'NULL';
if ($description =~ s/\[\w+:([-\/\w]+)\;\w+:(\w+)\]//g) {
my ($edb, $acc) = ($1, $2);
$description .= sprintf '[Source: %s; acc: %s]', $edb, $hub->get_ExtURL_link($acc, $edb, $acc) if $acc;
}
my $id_info;
if ($orthologue->{'display_id'}) {
if ($orthologue->{'display_id'} eq 'Novel Ensembl prediction') {
$id_info = qq{<p class="space-below"><a href="$link_url">$stable_id</a></p>};
} else {
$id_info = qq{<p class="space-below">$orthologue->{'display_id'} <a href="$link_url">($stable_id)</a></p>};
}
} else {
$id_info = qq{<p class="space-below"><a href="$link_url">$stable_id</a></p>};
}
$id_info .= qq{<p class="space-below">$region_link</p><p class="space-below">$alignment_link</p>};
##Location - split into elements to reduce horizonal space
my $location_link = $hub->url({
species => $spp,
type => 'Location',
action => 'View',
r => $orthologue->{'location'},
g => $stable_id,
__clear => 1
});
my $table_details = {
'Species' => join('<br />(', split /\s*\(/, $species_defs->species_label($species_defs->production_name_mapping($species))),
'Type' => $self->html_format ? glossary_helptip($hub, ucfirst $orthologue_desc, ucfirst "$orthologue_desc orthologues").qq{<p class="top-margin"><a href="$tree_url">View Gene Tree</a></p>} : glossary_helptip($hub, ucfirst $orthologue_desc, ucfirst "$orthologue_desc orthologues") ,
'dN/dS' => qq{<span class="$dnds_class">$orthologue_dnds_ratio</span>},
'identifier' => $self->html_format ? $id_info : $stable_id,
'Target %id' => qq{<span class="$target_class">}.sprintf('%.2f %%', $target).qq{</span>},
'Query %id' => qq{<span class="$query_class">}.sprintf('%.2f %%', $query).qq{</span>},
'goc_score' => qq{<span class="$goc_class">$goc_score</span>},
'wgac' => qq{<span class="$wga_class">$wgac</span>},
'confidence' => $confidence,
'options' => { class => join(' ', @{$sets_by_species->{$species} || []}) }
};
$table_details->{'Gene name(Xref)'}=$orthologue->{'display_id'} if(!$self->html_format);
push @rows, $table_details;
}
}
my $table = $self->new_table($columns, \@rows, { data_table => 1, sorting => [ 'Species asc', 'Type asc' ], id => 'orthologues' });
if ($alignview && keys %orthologue_list) {
$button_set{'view'} = 1;
}
$html .= '<div class="toggleable selected_orthologues_table">' . $table->render . '</div>';
if (scalar keys %skipped) {
my $count;
$count += $_ for values %skipped;
$html .= '<br />' . $self->_info(
'Orthologues hidden by configuration',
sprintf(
'<p>%d orthologues not shown in the table above from the following species. Use the "<strong>Configure this page</strong>" on the left to show them.<ul><li>%s</li></ul></p>',
$count,
join "</li>\n<li>", sort map {$species_defs->species_label($species_defs->production_name_mapping($_))." ($skipped{$_})"} keys %skipped
)
);
}
if (%not_seen) {
$html .= '<br /><a name="list_no_ortho"/>' . $self->_info(
'Species without orthologues',
sprintf(
'<p>%d species are not shown in the table above because they don\'t have any orthologue with %s.<ul><li>%s</li></ul></p>',
scalar(keys %not_seen),
$self->object->Obj->stable_id,
join "</li>\n<li>", sort map {$species_defs->species_label($species_defs->production_name_mapping($_))} keys %not_seen,
)
);
}
return $html;
}
sub export_options { return {'action' => 'Orthologs'}; }
sub get_export_data {
## Get data for export
my ($self, $flag) = @_;
my $hub = $self->hub;
my $object = $self->object || $hub->core_object('gene');
if ($flag eq 'sequence') {
return $object->get_homologue_alignments;
}
else {
my $cdb = $flag || $self->param('cdb') || 'compara';
my ($homologies) = $object->get_homologies('ENSEMBL_ORTHOLOGUES', undef, undef, $cdb);
my %ok_species;
foreach (grep { /species_/ } $self->param) {
(my $sp = $_) =~ s/species_//;
$ok_species{$sp} = 1 if $self->param($_) eq 'yes';
}
if (keys %ok_species) {
# It's the lower case species url name which is passed through the data export URL
return [grep {$ok_species{lc($hub->species_defs->production_name_mapping($_->get_all_Members->[1]->genome_db->name))}} @$homologies];
}
else {
return $homologies;
}
}
}
sub buttons {
my $self = shift;
my $hub = $self->hub;
my @buttons;
if ($button_set{'download'}) {
my $gene = $self->object->Obj;
my $dxr = $gene->can('display_xref') ? $gene->display_xref : undef;
my $name = $dxr ? $dxr->display_id : $gene->stable_id;
my $params = {
'type' => 'DataExport',
'action' => 'Orthologs',
'data_type' => 'Gene',
'component' => 'ComparaOrthologs',
'data_action' => $hub->action,
'gene_name' => $name,
};
## Add any species settings
foreach (grep { /^species_/ } $self->param) {
$params->{$_} = $self->param($_);
}
push @buttons, {
'url' => $hub->url($params),
'caption' => 'Download orthologues',
'class' => 'export',
'modal' => 1
};
}
return @buttons;
}
1;
| 44.557416 | 295 | 0.565745 |
ed7e28b28da997631c919ca582a301c63d220ef0 | 5,367 | pm | Perl | x64/Release/slic3r_130/local-lib/lib/perl5/LWP/Authen/Ntlm.pm | aacitelli/OASIS-Challenge-Baseline-Code-and-Models | f1847c4a5c3d33ad3d05a41a5c5caf0d383faac1 | [
"BSD-2-Clause"
] | null | null | null | x64/Release/slic3r_130/local-lib/lib/perl5/LWP/Authen/Ntlm.pm | aacitelli/OASIS-Challenge-Baseline-Code-and-Models | f1847c4a5c3d33ad3d05a41a5c5caf0d383faac1 | [
"BSD-2-Clause"
] | null | null | null | x64/Release/slic3r_130/local-lib/lib/perl5/LWP/Authen/Ntlm.pm | aacitelli/OASIS-Challenge-Baseline-Code-and-Models | f1847c4a5c3d33ad3d05a41a5c5caf0d383faac1 | [
"BSD-2-Clause"
] | null | null | null | package LWP::Authen::Ntlm;
use strict;
our $VERSION = '6.26';
use Authen::NTLM "1.02";
use MIME::Base64 "2.12";
sub authenticate {
my($class, $ua, $proxy, $auth_param, $response,
$request, $arg, $size) = @_;
my($user, $pass) = $ua->get_basic_credentials($auth_param->{realm},
$request->uri, $proxy);
unless(defined $user and defined $pass) {
return $response;
}
if (!$ua->conn_cache()) {
warn "The keep_alive option must be enabled for NTLM authentication to work. NTLM authentication aborted.\n";
return $response;
}
my($domain, $username) = split(/\\/, $user);
ntlm_domain($domain);
ntlm_user($username);
ntlm_password($pass);
my $auth_header = $proxy ? "Proxy-Authorization" : "Authorization";
# my ($challenge) = $response->header('WWW-Authenticate');
my $challenge;
foreach ($response->header('WWW-Authenticate')) {
last if /^NTLM/ && ($challenge=$_);
}
if ($challenge eq 'NTLM') {
# First phase, send handshake
my $auth_value = "NTLM " . ntlm();
ntlm_reset();
# Need to check this isn't a repeated fail!
my $r = $response;
my $retry_count = 0;
while ($r) {
my $auth = $r->request->header($auth_header);
++$retry_count if ($auth && $auth eq $auth_value);
if ($retry_count > 2) {
# here we know this failed before
$response->header("Client-Warning" =>
"Credentials for '$user' failed before");
return $response;
}
$r = $r->previous;
}
my $referral = $request->clone;
$referral->header($auth_header => $auth_value);
return $ua->request($referral, $arg, $size, $response);
}
else {
# Second phase, use the response challenge (unless non-401 code
# was returned, in which case, we just send back the response
# object, as is
my $auth_value;
if ($response->code ne '401') {
return $response;
}
else {
my $challenge;
foreach ($response->header('WWW-Authenticate')) {
last if /^NTLM/ && ($challenge=$_);
}
$challenge =~ s/^NTLM //;
ntlm();
$auth_value = "NTLM " . ntlm($challenge);
ntlm_reset();
}
my $referral = $request->clone;
$referral->header($auth_header => $auth_value);
my $response2 = $ua->request($referral, $arg, $size, $response);
return $response2;
}
}
1;
__END__
=pod
=head1 NAME
LWP::Authen::Ntlm - Library for enabling NTLM authentication (Microsoft) in LWP
=head1 SYNOPSIS
use LWP::UserAgent;
use HTTP::Request::Common;
my $url = 'http://www.company.com/protected_page.html';
# Set up the ntlm client and then the base64 encoded ntlm handshake message
my $ua = LWP::UserAgent->new(keep_alive=>1);
$ua->credentials('www.company.com:80', '', "MyDomain\\MyUserCode", 'MyPassword');
$request = GET $url;
print "--Performing request now...-----------\n";
$response = $ua->request($request);
print "--Done with request-------------------\n";
if ($response->is_success) {print "It worked!->" . $response->code . "\n"}
else {print "It didn't work!->" . $response->code . "\n"}
=head1 DESCRIPTION
L<LWP::Authen::Ntlm> allows LWP to authenticate against servers that are using the
NTLM authentication scheme popularized by Microsoft. This type of authentication is
common on intranets of Microsoft-centric organizations.
The module takes advantage of the Authen::NTLM module by Mark Bush. Since there
is also another Authen::NTLM module available from CPAN by Yee Man Chan with an
entirely different interface, it is necessary to ensure that you have the correct
NTLM module.
In addition, there have been problems with incompatibilities between different
versions of Mime::Base64, which Bush's Authen::NTLM makes use of. Therefore, it is
necessary to ensure that your Mime::Base64 module supports exporting of the
encode_base64 and decode_base64 functions.
=head1 USAGE
The module is used indirectly through LWP, rather than including it directly in your
code. The LWP system will invoke the NTLM authentication when it encounters the
authentication scheme while attempting to retrieve a URL from a server. In order
for the NTLM authentication to work, you must have a few things set up in your
code prior to attempting to retrieve the URL:
=over 4
=item *
Enable persistent HTTP connections
To do this, pass the "keep_alive=>1" option to the LWP::UserAgent when creating it, like this:
my $ua = LWP::UserAgent->new(keep_alive=>1);
=item *
Set the credentials on the UserAgent object
The credentials must be set like this:
$ua->credentials('www.company.com:80', '', "MyDomain\\MyUserCode", 'MyPassword');
Note that you cannot use the HTTP::Request object's authorization_basic() method to set
the credentials. Note, too, that the 'www.company.com:80' portion only sets credentials
on the specified port AND it is case-sensitive (this is due to the way LWP is coded, and
has nothing to do with LWP::Authen::Ntlm)
=back
=head1 AVAILABILITY
General queries regarding LWP should be made to the LWP Mailing List.
Questions specific to LWP::Authen::Ntlm can be forwarded to jtillman@bigfoot.com
=head1 COPYRIGHT
Copyright (c) 2002 James Tillman. All rights reserved. This
program is free software; you can redistribute it and/or modify it
under the same terms as Perl itself.
=head1 SEE ALSO
L<LWP>, L<LWP::UserAgent>, L<lwpcook>.
=cut
| 29.168478 | 112 | 0.684181 |
73f61648e9b857b7573ae2907544d167064077cb | 4,815 | pl | Perl | multimedia/directx/dinput/dx7/dll/mkhdr.pl | npocmaka/Windows-Server-2003 | 5c6fe3db626b63a384230a1aa6b92ac416b0765f | [
"Unlicense"
] | 17 | 2020-11-13T13:42:52.000Z | 2021-09-16T09:13:13.000Z | multimedia/published/directx/dinput/mkhdr.pl | sancho1952007/Windows-Server-2003 | 5c6fe3db626b63a384230a1aa6b92ac416b0765f | [
"Unlicense"
] | 2 | 2020-10-19T08:02:06.000Z | 2020-10-19T08:23:18.000Z | multimedia/published/directx/dinput/mkhdr.pl | sancho1952007/Windows-Server-2003 | 5c6fe3db626b63a384230a1aa6b92ac416b0765f | [
"Unlicense"
] | 14 | 2020-11-14T09:43:20.000Z | 2021-08-28T08:59:57.000Z | #!perl
#
# hsplit is too lame to handle OLE interfaces, so I have to
# write this program myself. It only handles the OLE stuff;
# I leave hsplit to manage the regular % stuff.
#
# Makes it clearer what's going on when we pass it as a flag
$A = 0;
$W = 1;
#
# Dummy prototype gizmos for EmitWrapper.
#
@proto = (
"p",
"p,a",
"p,a,b",
"p,a,b,c",
"p,a,b,c,d",
"p,a,b,c,d,e",
"p,a,b,c,d,e,f",
"p,a,b,c,d,e,f,g",
"p,a,b,c,d,e,f,g,h",
);
##############################################################################
#
# Main loop
#
# Things between ";begin_doc" and ";end_doc" are ignored.
#
# Else, echo everything that isn't between ";begin_interface" and
# ";end_interface". For the stuff between, collect it. If the
# interface name contains a "%", then emit separate W and A versions.
#
##############################################################################
while (<>) {
if (/^;begin_doc$/) {
while (<>) {
last if $_ eq ";end_doc\n";
}
next;
}
($itf) = /^;begin_interface\s+(\S+)/;
unless ($itf) {
print;
next;
}
# Oh boy, we found the start of an interface.
# Collect the methods.
$_ = <>;
die ";begin_methods expected here" unless $_ eq ";begin_methods\n";
# An interface is an array of methods
# A method is an array, $m[0] is the method name, $m[1] is the arglist
@itf = ();
while (<>) {
last if $_ eq ";end_methods\n";
($m, $arg) = /^;method\s+(\S+)\s*\((.*)\)$/;
push(@itf, [ $m, $arg ]) if $m;
}
$_ = <>;
die ";end_interface expected here" unless $_ eq ";end_interface\n";
if ($itf =~ /%/) {
&DoItf($W, $itf, @itf);
&DoItf($A, $itf, @itf);
} else {
&DoItf($W, $itf, @itf);
}
&DoAfterItf($itf, @itf);
}
##############################################################################
#
# Given a line, remove percent signs, converting to W or A accordingly.
#
##############################################################################
sub DePercent {
my($fW, $line) = @_;
if ($fW) {
$line =~ s/STR%/WSTR/g;
$line =~ s/%/W/g;
} else {
$line =~ s/STR%/STR/g;
$line =~ s/%/A/g;
}
$line;
}
##############################################################################
#
# Emit the interface definition.
#
##############################################################################
sub DoItf {
my($fW, $itf, @itf) = @_;
$itf = &DePercent($fW, $itf);
print <<EOI;
#undef INTERFACE
#define INTERFACE $itf
DECLARE_INTERFACE_($itf, IUnknown)
{
/*** IUnknown methods ***/
STDMETHOD(QueryInterface)(THIS_ REFIID riid, LPVOID * ppvObj) PURE;
STDMETHOD_(ULONG,AddRef)(THIS) PURE;
STDMETHOD_(ULONG,Release)(THIS) PURE;
/*** $itf methods ***/
EOI
for (@itf) {
my($m, $arg) = @$_;
print " STDMETHOD($m)(THIS";
print "_ " if $arg;
print &DePercent($fW, $arg);
print ") PURE;\n";
}
print "};\n\n";
my($uc) = uc $itf;
$uc =~s/^I//;
print &DePercent($W, "typedef struct $itf *LP$uc;\n");
print "\n";
}
##############################################################################
#
# Emit the follow-up stuff that comes after an interface definition.
# If the interface name contains a percent sign, emit the appropriate
# mix.
#
##############################################################################
sub DoAfterItf {
my($itf, @itf) = @_;
my($uc) = uc $itf;
$uc =~s/^I//;
my($itfP) = $itf;
$itfP =~ s/%//;
my($ucP) = $uc;
$ucP =~ s/%//;
if ($itf =~ /%/) {
print "#ifdef UNICODE\n";
print &DePercent($W, "#define IID_$itfP IID_$itf\n");
print &DePercent($W, "typedef struct $itf $itfP;\n");
print &DePercent($W, "#define ${itfP}Vtbl ${itf}Vtbl\n");
print "#else\n";
print &DePercent($A, "#define IID_$itfP IID_$itf\n");
print &DePercent($A, "typedef struct $itf $itfP;\n");
print &DePercent($A, "#define ${itfP}Vtbl ${itf}Vtbl\n");
print "#endif\n";
print &DePercent($W, "typedef struct $itfP *LP$ucP;\n");
}
# Now the lame-o wrappers.
print "\n#if !defined(__cplusplus) || defined(CINTERFACE)\n";
&EmitWrapper($itfP, "QueryInterface", 2);
&EmitWrapper($itfP, "AddRef", 0);
&EmitWrapper($itfP, "Release", 0);
for (@itf) {
my($m, $arg, $arity) = @$_;
if ($arg) {
$arity = 1 + y/,/,/;
} else {
$arity = 0;
}
&EmitWrapper($itfP, $m, $arity);
}
print "#endif\n";
}
sub EmitWrapper {
my($itf, $m, $arity) = @_;
die "Need to add another arity" if $arity > $#proto;
print "#define ${itf}_$m($proto[$arity]) (p)->lpVtbl->$m($proto[$arity])\n";
}
| 25.611702 | 81 | 0.459605 |
ed8fa1d649df3e390aa91521184e4a834c23938c | 682 | t | Perl | tests/unit/mysql/statement/add-fk/030-success.alias.one.one.aa.t | Vovan-VE/lazymgen | 7968a1e9c24966eb38cab1e1f8d5b77f5bc6669b | [
"MIT"
] | null | null | null | tests/unit/mysql/statement/add-fk/030-success.alias.one.one.aa.t | Vovan-VE/lazymgen | 7968a1e9c24966eb38cab1e1f8d5b77f5bc6669b | [
"MIT"
] | null | null | null | tests/unit/mysql/statement/add-fk/030-success.alias.one.one.aa.t | Vovan-VE/lazymgen | 7968a1e9c24966eb38cab1e1f8d5b77f5bc6669b | [
"MIT"
] | null | null | null | ---- IN ----
+ FK @key-name %child ( parent_id ) => %parent ( id )
---- OUT ----
$> add_key-name
> Generated with lazymgen - Lazy Migration Generator
> Format: MySQL
>
> Source:
> + FK @key-name %child ( parent_id ) => %parent ( id )
UP:
`add_key-name` is-dml=False ⟨
ALTER TABLE `child`
ADD CONSTRAINT `key-name`
FOREIGN KEY (`parent_id`)
REFERENCES `parent` (`id`)
ON DELETE RESTRICT
ON UPDATE RESTRICT;
⟩
DOWN:
`drop_key-name` is-dml=False ⟨
ALTER TABLE `child`
DROP FOREIGN KEY `key-name`;
⟩
.
| 27.28 | 63 | 0.479472 |
73ffd0bb468e03ad82d758103e01a1f0d30a9e11 | 8,071 | pm | Perl | centreon/plugins/http.pm | aladdinchan/centreon-plugins | cf68e79983245f9aea510e155340020e4babd591 | [
"Apache-2.0"
] | null | null | null | centreon/plugins/http.pm | aladdinchan/centreon-plugins | cf68e79983245f9aea510e155340020e4babd591 | [
"Apache-2.0"
] | null | null | null | centreon/plugins/http.pm | aladdinchan/centreon-plugins | cf68e79983245f9aea510e155340020e4babd591 | [
"Apache-2.0"
] | null | null | null | #
# Copyright 2019 Centreon (http://www.centreon.com/)
#
# Centreon is a full-fledged industry-strength solution that meets
# the needs in IT infrastructure and application monitoring for
# service performance.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
#
package centreon::plugins::http;
use strict;
use warnings;
sub new {
my ($class, %options) = @_;
my $self = {};
bless $self, $class;
if (!defined($options{noptions}) || $options{noptions} != 1) {
$options{options}->add_options(arguments => {
'http-peer-addr:s' => { name => 'http_peer_addr' },
'proxyurl:s' => { name => 'proxyurl' },
'proxypac:s' => { name => 'proxypac' },
'http-backend:s' => { name => 'http_backend', default => 'lwp' },
});
$options{options}->add_help(package => __PACKAGE__, sections => 'HTTP GLOBAL OPTIONS');
}
centreon::plugins::misc::mymodule_load(
output => $options{output},
module => 'centreon::plugins::backend::http::lwp',
error_msg => "Cannot load module 'centreon::plugins::backend::http::lwp'."
);
$self->{backend_lwp} = centreon::plugins::backend::http::lwp->new(%options);
centreon::plugins::misc::mymodule_load(
output => $options{output},
module => 'centreon::plugins::backend::http::curl',
error_msg => "Cannot load module 'centreon::plugins::backend::http::curl'."
);
$self->{backend_curl} = centreon::plugins::backend::http::curl->new(%options);
$self->{output} = $options{output};
$self->{options} = {
proto => 'http',
url_path => '/',
timeout => 5,
method => 'GET',
unknown_status => '%{http_code} < 200 or %{http_code} >= 300',
warning_status => undef,
critical_status => undef,
};
$self->{add_headers} = {};
return $self;
}
sub set_options {
my ($self, %options) = @_;
$self->{options} = { %{$self->{options}} };
foreach (keys %options) {
$self->{options}->{$_} = $options{$_} if (defined($options{$_}));
}
}
sub add_header {
my ($self, %options) = @_;
$self->{add_headers}->{$options{key}} = $options{value};
}
sub check_options {
my ($self, %options) = @_;
$options{request}->{http_backend} = 'lwp'
if (!defined($options{request}->{http_backend}) || $options{request}->{http_backend} eq '');
$self->{http_backend} = $options{request}->{http_backend};
if ($self->{http_backend} !~ /^\s*lwp|curl\s*$/i) {
$self->{output}->add_option_msg(short_msg => "Unsupported http backend specified '" . $self->{http_backend} . "'.");
$self->{output}->option_exit();
}
if (defined($options{request}->{$self->{http_backend} . '_backend_options'})) {
foreach (keys %{$options{request}->{$self->{http_backend} . '_backend_options'}}) {
$options{request}->{$_} = $options{request}->{$self->{http_backend} . '_backend_options'}->{$_};
}
}
if (($options{request}->{proto} ne 'http') && ($options{request}->{proto} ne 'https')) {
$self->{output}->add_option_msg(short_msg => "Unsupported protocol specified '" . $self->{option_results}->{proto} . "'.");
$self->{output}->option_exit();
}
if (!defined($options{request}->{hostname})) {
$self->{output}->add_option_msg(short_msg => "Please set the hostname option");
$self->{output}->option_exit();
}
if ((defined($options{request}->{credentials})) && (!defined($options{request}->{username}) || !defined($options{request}->{password}))) {
$self->{output}->add_option_msg(short_msg => "You need to set --username= and --password= options when --credentials is used");
$self->{output}->option_exit();
}
if ((defined($options{request}->{cert_pkcs12})) && (!defined($options{request}->{cert_file}) && !defined($options{request}->{cert_pwd}))) {
$self->{output}->add_option_msg(short_msg => "You need to set --cert-file= and --cert-pwd= options when --pkcs12 is used");
$self->{output}->option_exit();
}
$options{request}->{port_force} = $self->get_port();
$options{request}->{headers} = {};
if (defined($options{request}->{header})) {
foreach (@{$options{request}->{header}}) {
if (/^(:.+?|.+?):(.*)/) {
$options{request}->{headers}->{$1} = $2;
}
}
}
foreach (keys %{$self->{add_headers}}) {
$options{request}->{headers}->{$_} = $self->{add_headers}->{$_};
}
foreach my $method (('get', 'post')) {
if (defined($options{request}->{$method . '_param'})) {
$options{request}->{$method . '_params'} = {};
foreach (@{$options{request}->{$method . '_param'}}) {
if (/^([^=]+)={0,1}(.*)$/) {
my $key = $1;
my $value = defined($2) ? $2 : 1;
if (defined($options{request}->{$method . '_params'}->{$key})) {
if (ref($options{request}->{$method . '_params'}->{$key}) ne 'ARRAY') {
$options{request}->{$method . '_params'}->{$key} = [ $options{request}->{$method . '_params'}->{$key} ];
}
push @{$options{request}->{$method . '_params'}->{$key}}, $value;
} else {
$options{request}->{$method . '_params'}->{$key} = $value;
}
}
}
}
}
$self->{'backend_' . $self->{http_backend}}->check_options(%options);
}
sub get_port {
my ($self, %options) = @_;
my $port = '';
if (defined($self->{options}->{port}) && $self->{options}->{port} ne '') {
$port = $self->{options}->{port};
} else {
$port = 80 if ($self->{options}->{proto} eq 'http');
$port = 443 if ($self->{options}->{proto} eq 'https');
}
return $port;
}
sub get_port_request {
my ($self, %options) = @_;
my $port = '';
if (defined($self->{options}->{port}) && $self->{options}->{port} ne '') {
$port = $self->{options}->{port};
}
return $port;
}
sub request {
my ($self, %options) = @_;
my $request_options = { %{$self->{options}} };
foreach (keys %options) {
$request_options->{$_} = $options{$_} if (defined($options{$_}));
}
$self->check_options(request => $request_options);
return $self->{'backend_' . $self->{http_backend}}->request(request => $request_options);
}
sub get_first_header {
my ($self, %options) = @_;
return $self->{'backend_' . $self->{http_backend}}->get_first_header(%options);
}
sub get_header {
my ($self, %options) = @_;
return $self->{'backend_' . $self->{http_backend}}->get_header(%options);
}
sub get_code {
my ($self, %options) = @_;
return $self->{'backend_' . $self->{http_backend}}->get_code();
}
sub get_message {
my ($self, %options) = @_;
return $self->{'backend_' . $self->{http_backend}}->get_message();
}
1;
__END__
=head1 NAME
HTTP abstraction layer.
=head1 SYNOPSIS
HTTP abstraction layer for lwp and curl backends
=head1 HTTP GLOBAL OPTIONS
=over 8
=item B<--http-peer-addr>
Set the address you want to connect (Useful if hostname is only a vhost. no ip resolve)
=item B<--proxyurl>
Proxy URL
=item B<--proxypac>
Proxy pac file (can be an url or local file)
=item B<--http-backend>
Set the backend used (Default: 'lwp')
For curl: --http-backend=curl
=back
=head1 DESCRIPTION
B<http>.
=cut
| 31.527344 | 143 | 0.565605 |
ed85fd144f2aa762c87caa03ced83b8e63042d1a | 21,295 | al | Perl | Apps/CH/SwissQRBill/app/src/core/Mgt.Codeunit.al | MiguelMercadoActual/ALAppExtensions | 97ee3823053eb32fa7e38dc3d1e7a89bdcca8d7b | [
"MIT"
] | 337 | 2019-05-07T06:04:40.000Z | 2022-03-31T10:07:42.000Z | Apps/CH/SwissQRBill/app/src/core/Mgt.Codeunit.al | MiguelMercadoActual/ALAppExtensions | 97ee3823053eb32fa7e38dc3d1e7a89bdcca8d7b | [
"MIT"
] | 14,850 | 2019-05-07T06:04:27.000Z | 2022-03-31T19:53:28.000Z | Apps/CH/SwissQRBill/app/src/core/Mgt.Codeunit.al | MiguelMercadoActual/ALAppExtensions | 97ee3823053eb32fa7e38dc3d1e7a89bdcca8d7b | [
"MIT"
] | 374 | 2019-05-09T10:08:14.000Z | 2022-03-31T17:48:32.000Z | codeunit 11518 "Swiss QR-Bill Mgt."
{
var
PaymentMethodsTxt: Label '%1 of %2 Payment Methods enabled with QR-Bill Layout', Comment = '%1, %2 - number of records';
DocumentTypesTxt: Label '%1 of %2 Document Types enabled for QR-Bills', Comment = '%1, %2 - number of records';
QRBillCaptionLbl: Label 'QR-Bill';
internal procedure GetQRBillCaption(): Text
begin
exit(QRBillCaptionLbl);
end;
internal procedure FindServiceInvoiceFromLedgerEntry(var ServiceInvoiceHeader: Record "Service Invoice Header"; CustLedgerEntry: Record "Cust. Ledger Entry"): Boolean
begin
CustLedgerEntry.TestField("Entry No.");
if CustLedgerEntry."Document Type" = CustLedgerEntry."Document Type"::Invoice then
with ServiceInvoiceHeader do begin
SetRange("No.", CustLedgerEntry."Document No.");
exit(FindFirst());
end;
end;
internal procedure FindIssuedReminderFromLedgerEntry(var IssuedReminderHeader: Record "Issued Reminder Header"; CustLedgerEntry: Record "Cust. Ledger Entry"): Boolean
begin
CustLedgerEntry.TestField("Entry No.");
if CustLedgerEntry."Document Type" = CustLedgerEntry."Document Type"::Reminder then
with IssuedReminderHeader do begin
SetRange("No.", CustLedgerEntry."Document No.");
SetRange("Posting Date", CustLedgerEntry."Posting Date");
SetRange("Customer No.", CustLedgerEntry."Customer No.");
exit(FindFirst());
end;
end;
internal procedure FindIssuedFinChargeMemoFromLedgerEntry(var IssuedFinChargeMemoHeader: Record "Issued Fin. Charge Memo Header"; CustLedgerEntry: Record "Cust. Ledger Entry"): Boolean
begin
CustLedgerEntry.TestField("Entry No.");
if CustLedgerEntry."Document Type" = CustLedgerEntry."Document Type"::"Finance Charge Memo" then
with IssuedFinChargeMemoHeader do begin
SetRange("No.", CustLedgerEntry."Document No.");
SetRange("Posting Date", CustLedgerEntry."Posting Date");
SetRange("Customer No.", CustLedgerEntry."Customer No.");
exit(FindFirst());
end;
end;
procedure FindCustLedgerEntry(var LedgerEntryNo: Integer; CustomerNo: Code[20]; DocumentType: Enum "Gen. Journal Document Type"; DocumentNo: Code[20]; PostingDate: Date) Found: Boolean
var
CustLedgerEntry: Record "Cust. Ledger Entry";
begin
FilterCustLedgerEntry(CustLedgerEntry, CustomerNo, DocumentType, DocumentNo, PostingDate);
Found := CustLedgerEntry.FindFirst();
LedgerEntryNo := CustLedgerEntry."Entry No.";
end;
procedure FilterCustLedgerEntry(var CustLedgerEntry: Record "Cust. Ledger Entry"; CustomerNo: Code[20]; DocumentType: Enum "Gen. Journal Document Type"; DocumentNo: Code[20]; PostingDate: Date): Boolean
begin
with CustLedgerEntry do begin
SetRange("Customer No.", CustomerNo);
SetRange("Document Type", DocumentType);
SetRange("Document No.", DocumentNo);
SetRange("Posting Date", PostingDate);
end;
end;
internal procedure FormatEnabledReportsCount(EnabledReportsCount: Integer): Text
begin
exit(StrSubstNo(DocumentTypesTxt, EnabledReportsCount, 2));
end;
internal procedure CalcEnabledReportsCount(): Integer
var
ReportSelections: Record "Report Selections";
begin
ReportSelections.SetRange("Report ID", Report::"Swiss QR-Bill Print");
exit(ReportSelections.Count());
end;
internal procedure FormatQRPaymentMethodsCount(QRPaymentMethods: Integer): Text
var
PaymentMethod: Record "Payment Method";
begin
exit(StrSubstNo(PaymentMethodsTxt, QRPaymentMethods, PaymentMethod.Count()));
end;
internal procedure CalcQRPaymentMethodsCount(): Integer
var
PaymentMethod: Record "Payment Method";
begin
PaymentMethod.SetFilter("Swiss QR-Bill Layout", '<>%1', '');
exit(PaymentMethod.Count());
end;
internal procedure PrintFromBuffer(var SwissQRBillBuffer: Record "Swiss QR-Bill Buffer")
var
FileMgt: Codeunit "File Management";
PDFFileTempBlob: Codeunit "Temp Blob";
PDFFileInStream: InStream;
begin
PDFFileTempBlob.CreateInStream(PDFFileInStream);
if ReportPrintToStream(SwissQRBillBuffer, PDFFileTempBlob) then
FileMgt.DownloadFromStreamHandler(PDFFileInStream, 'Save QR-Bill', '', 'pdf', SwissQRBillBuffer."File Name");
end;
local procedure ReportPrintToStream(var SwissQRBillBuffer: Record "Swiss QR-Bill Buffer"; var PDFFileTempBlob: Codeunit "Temp Blob"): Boolean
var
SwissQRBillPrint: Report "Swiss QR-Bill Print";
PDFFileOutStream: OutStream;
begin
SwissQRBillPrint.SetBuffer(SwissQRBillBuffer);
PDFFileTempBlob.CreateOutStream(PDFFileOutStream);
exit(SwissQRBillPrint.SaveAs('', ReportFormat::Pdf, PDFFileOutStream));
end;
procedure GenerateImage(var SwissQRBillBuffer: Record "Swiss QR-Bill Buffer")
var
TempBlob: Codeunit "Temp Blob";
SwissQRBillImageMgt: Codeunit "Swiss QR-Bill Image Mgt.";
SwissQRBillEncode: Codeunit "Swiss QR-Bill Encode";
QRCodeText: Text;
begin
QRCodeText := SwissQRBillEncode.GenerateQRCodeText(SwissQRBillBuffer);
if SwissQRBillImageMgt.GenerateSwissQRCodeImage(EncodeUmlautChars(QRCodeText), TempBlob) then
SwissQRBillBuffer.SetQRCodeImage(TempBlob);
end;
internal procedure GetCurrency(CurrencyCode: Code[10]): Code[10]
var
GLSetup: Record "General Ledger Setup";
begin
if CurrencyCode = '' then
with GLSetup do begin
Get();
exit("LCY Code");
end;
exit(CurrencyCode);
end;
procedure AllowedCurrencyCode(CurrencyCode: Code[10]): Boolean
begin
if CurrencyCode = '' then
CurrencyCode := '''''';
exit(GetAllowedCurrencyCodeFilter().Split('|').Contains(CurrencyCode));
end;
internal procedure AllowedISOCurrency(CurrencyText: Text): Boolean
begin
exit(CurrencyText in ['CHF', 'EUR']);
end;
internal procedure GetAllowedCurrencyCodeFilter() Result: Text
var
GLSetup: Record "General Ledger Setup";
Currency: Record Currency;
begin
GLSetup.Get();
if AllowedISOCurrency(GLSetup."LCY Code") then
Result += '''''';
with Currency do begin
SetFilter("ISO Code", '%1|%2', 'CHF', 'EUR');
if FindSet() then
repeat
if Result <> '' then
Result += '|';
Result += Code;
until Next() = 0;
end;
end;
internal procedure LookupFilteredSalesInvoices(): Code[20]
var
SalesInvoiceHeader: Record "Sales Invoice Header";
PostedSalesInvoices: Page "Posted Sales Invoices";
begin
SalesInvoiceHeader.SetFilter("Currency Code", GetAllowedCurrencyCodeFilter());
PostedSalesInvoices.LookupMode(true);
PostedSalesInvoices.SetTableView(SalesInvoiceHeader);
if PostedSalesInvoices.RunModal() = Action::LookupOK then begin
PostedSalesInvoices.GetRecord(SalesInvoiceHeader);
exit(SalesInvoiceHeader."No.");
end;
end;
internal procedure LookupFilteredServiceInvoices(): Code[20]
var
ServiceInvoiceHeader: Record "Service Invoice Header";
PostedServiceInvoices: Page "Posted Service Invoices";
begin
ServiceInvoiceHeader.SetFilter("Currency Code", GetAllowedCurrencyCodeFilter());
PostedServiceInvoices.LookupMode(true);
PostedServiceInvoices.SetTableView(ServiceInvoiceHeader);
if PostedServiceInvoices.RunModal() = Action::LookupOK then begin
PostedServiceInvoices.GetRecord(ServiceInvoiceHeader);
exit(ServiceInvoiceHeader."No.");
end;
end;
internal procedure LookupFilteredReminders(): Code[20]
var
IssuedReminderHeader: Record "Issued Reminder Header";
IssuedReminderList: Page "Issued Reminder List";
begin
IssuedReminderHeader.SetFilter("Currency Code", GetAllowedCurrencyCodeFilter());
IssuedReminderList.LookupMode(true);
IssuedReminderList.SetTableView(IssuedReminderHeader);
if IssuedReminderList.RunModal() = Action::LookupOK then begin
IssuedReminderList.GetRecord(IssuedReminderHeader);
exit(IssuedReminderHeader."No.");
end;
end;
internal procedure LookupFilteredFinChargeMemos(): Code[20]
var
IssuedFinChargeMemoHeader: Record "Issued Fin. Charge Memo Header";
IssuedFinChargeMemoList: Page "Issued Fin. Charge Memo List";
begin
IssuedFinChargeMemoHeader.SetFilter("Currency Code", GetAllowedCurrencyCodeFilter());
IssuedFinChargeMemoList.LookupMode(true);
IssuedFinChargeMemoList.SetTableView(IssuedFinChargeMemoHeader);
if IssuedFinChargeMemoList.RunModal() = Action::LookupOK then begin
IssuedFinChargeMemoList.GetRecord(IssuedFinChargeMemoHeader);
exit(IssuedFinChargeMemoHeader."No.");
end;
end;
internal procedure LookupFilteredCustLedgerEntries(): Integer
var
CustLedgerEntry: Record "Cust. Ledger Entry";
CustomerLedgerEntries: Page "Customer Ledger Entries";
DocumentType: Enum "Gen. Journal Document Type";
begin
CustLedgerEntry.SetFilter(
"Document Type",
StrSubstNo('%1|%2|%3', DocumentType::Invoice, DocumentType::Reminder, DocumentType::"Finance Charge Memo"));
CustLedgerEntry.SetFilter("Currency Code", GetAllowedCurrencyCodeFilter());
CustomerLedgerEntries.LookupMode(true);
CustomerLedgerEntries.SetTableView(CustLedgerEntry);
if CustomerLedgerEntries.RunModal() = Action::LookupOK then begin
CustomerLedgerEntries.GetRecord(CustLedgerEntry);
exit(CustLedgerEntry."Entry No.");
end;
end;
local procedure EncodeUmlautChars(InString: Text) OutString: Text
var
SwissQRBillSetup: Record "Swiss QR-Bill Setup";
GermanChars: Text;
GermanPrintable: Text;
FrenchItalianChars: Text;
FrenchItalianPrintable: Text;
i: Integer;
begin
GermanChars := 'ÄäÖöÜüẞß';
GermanPrintable := 'AaOoUuSs';
FrenchItalianChars := 'ÆÂÀæàâÉÈÊËéèêëÇçÙÛùûŸÿÏÎÌïîìŒÔÒÓœôòó';
FrenchItalianPrintable := 'AAAaaaEEEEeeeeCcUUuuYyIIIiiiOOOOoooo';
SwissQRBillSetup.Get();
case SwissQRBillSetup."Umlaut Chars Encode Mode" of
SwissQRBillSetup."Umlaut Chars Encode Mode"::Remove:
begin
OutString := DelChr(InString, '=', GermanChars);
OutString := DelChr(OutString, '=', FrenchItalianChars);
end;
SwissQRBillSetup."Umlaut Chars Encode Mode"::Single:
begin
OutString := ConvertStr(InString, GermanChars, GermanPrintable);
OutString := ConvertStr(OutString, FrenchItalianChars, FrenchItalianPrintable);
end;
SwissQRBillSetup."Umlaut Chars Encode Mode"::Double:
begin
for i := 1 to StrLen(InString) do
OutString += ConvertUmlautCharsToDoubleChars(InString[i]);
OutString := ConvertStr(OutString, FrenchItalianChars, FrenchItalianPrintable);
end;
end;
// special char convert
OutString := ConvertStr(OutString, '–—‘’“”«»„', '--''''"""""');
// remove remaining non-printable chars
exit(RemoveNonPrintableChars(OutString));
end;
local procedure ConvertUmlautCharsToDoubleChars(InChar: Char) ConvertedChar: Text
begin
case InChar of
'Ä':
ConvertedChar := 'Ae';
'ä':
ConvertedChar := 'ae';
'Ö':
ConvertedChar := 'Oe';
'ö':
ConvertedChar := 'oe';
'Ü':
ConvertedChar := 'Ue';
'ü':
ConvertedChar := 'ue';
'ẞ':
ConvertedChar := 'Ss';
'ß':
ConvertedChar := 'ss';
'Æ':
ConvertedChar := 'AE';
'æ':
ConvertedChar := 'ae';
'Œ':
ConvertedChar := 'OE';
'œ':
ConvertedChar := 'oe';
else
ConvertedChar := InChar;
end;
end;
local procedure RemoveNonPrintableChars(InText: Text) OutText: Text
var
i: Integer;
begin
for i := 1 to StrLen(InText) do
if InText[i] <= 126 then
OutText += InText[i];
end;
internal procedure GetNextReferenceNo(ReferenceType: Enum "Swiss QR-Bill Payment Reference Type"; UpdateLastUsed: Boolean): Code[50]
var
SwissQRBillSetup: Record "Swiss QR-Bill Setup";
TempReferenceNo: Text;
begin
with SwissQRBillSetup do begin
Get();
"Last Used Reference No." += 1;
if UpdateLastUsed then
Modify();
end;
case ReferenceType of
ReferenceType::"Creditor Reference (ISO 11649)":
begin
TempReferenceNo := Format(SwissQRBillSetup."Last Used Reference No.");
exit(CopyStr(StrSubstNo('RF%1%2', CalcCheckDigitForCreditorReference(TempReferenceNo), TempReferenceNo), 1, 25));
end;
ReferenceType::"QR Reference":
begin
TempReferenceNo := Format(SwissQRBillSetup."Last Used Reference No.", 0, '<Integer,26><Filler Character,0>');
exit(CopyStr(StrSubstNo('%1%2', TempReferenceNo, CalcCheckDigitForQRReference(TempReferenceNo)), 1, 27));
end;
end;
end;
local procedure CalcCheckDigitForCreditorReference(SourceReferenceNo: Text): Text[2]
var
Module97: Integer;
CheckDigit: Integer;
begin
SourceReferenceNo += 'RF00';
Module97 := CalcCreditorReferenceModule97(SourceReferenceNo);
CheckDigit := (98 - Module97) mod 97;
exit(CopyStr(Format(CheckDigit, 0, '<Integer,2><Filler Character,0>'), 1, 2));
end;
local procedure CalcCreditorReferenceModule97(SourceReferenceNo: Text): Integer
var
IntegerReferenceNoText: Text;
i: Integer;
begin
for i := 1 to StrLen(SourceReferenceNo) do
case true of
(SourceReferenceNo[i] >= '0') and (SourceReferenceNo[i] <= '9'):
IntegerReferenceNoText += SourceReferenceNo[i];
(SourceReferenceNo[i] >= 'a') and (SourceReferenceNo[i] <= 'z'):
IntegerReferenceNoText += Format(10 + SourceReferenceNo[i] - 'a');
(SourceReferenceNo[i] >= 'A') and (SourceReferenceNo[i] <= 'Z'):
IntegerReferenceNoText += Format(10 + SourceReferenceNo[i] - 'A');
end;
exit(RecursiveModule97(IntegerReferenceNoText));
end;
local procedure RecursiveModule97(BigIntegerText: Text): Integer
var
LeastMillion: Integer;
begin
if StrLen(BigIntegerText) < 7 then begin
Evaluate(LeastMillion, BigIntegerText);
exit(LeastMillion mod 97);
end;
Evaluate(LeastMillion, CopyStr(BigIntegerText, StrLen(BigIntegerText) - 5, 6));
exit(((LeastMillion mod 97) + 1000000 * RecursiveModule97(BigIntegerText.Remove(StrLen(BigIntegerText) - 5, 6))) mod 97);
end;
local procedure CalcCheckDigitForQRReference(PaymentReference: Text): Text[1]
var
BankMgt: Codeunit BankMgt;
begin
exit(BankMgt.CalcCheckDigit(CopyStr(PaymentReference, 1, 250)));
end;
internal procedure CheckDigitForQRReference(PaymentReference: Text): Boolean
begin
PaymentReference := DelChr(PaymentReference);
exit(CalcCheckDigitForQRReference(CopyStr(PaymentReference, 1, 26)) = PaymentReference[27]);
end;
internal procedure CheckDigitForCreditorReference(PaymentReference: Text): Boolean
begin
if ('RF' <> CopyStr(PaymentReference, 1, 2)) or (StrLen(PaymentReference) < 5) then
exit(false);
PaymentReference := CopyStr(StrSubstNo('%1%2', PaymentReference.Remove(1, 4), CopyStr(PaymentReference, 1, 4)), 1, 25);
exit(CalcCreditorReferenceModule97(PaymentReference) = 1);
end;
procedure FormatPaymentReference(ReferenceType: Enum "Swiss QR-Bill Payment Reference Type"; PaymentReference: Code[50]) Result: Code[50]
begin
PaymentReference := CopyStr(DelChr(PaymentReference), 1, MaxStrLen(PaymentReference));
case ReferenceType of
ReferenceType::"Creditor Reference (ISO 11649)":
if (StrLen(PaymentReference) > 4) and (StrLen(PaymentReference) < 26) then begin
while StrLen(PaymentReference) >= 4 do begin
if Result <> '' then
Result += StrSubstNo(' %1', CopyStr(PaymentReference, 1, 4))
else
Result := CopyStr(PaymentReference, 1, 4);
PaymentReference := DelStr(PaymentReference, 1, 4);
end;
if StrLen(PaymentReference) > 0 then
Result += StrSubstNo(' %1', CopyStr(PaymentReference, 1));
exit(Result);
end;
ReferenceType::"QR Reference":
if StrLen(PaymentReference) = 27 then
exit(
StrSubstNo(
'%1 %2 %3 %4 %5 %6',
CopyStr(PaymentReference, 1, 2),
CopyStr(PaymentReference, 3, 5),
CopyStr(PaymentReference, 8, 5),
CopyStr(PaymentReference, 13, 5),
CopyStr(PaymentReference, 18, 5),
CopyStr(PaymentReference, 23, 5)));
end;
exit(PaymentReference);
end;
procedure FormatIBAN(IBAN: Code[50]): Code[50]
begin
IBAN := CopyStr(DelChr(IBAN), 1, MaxStrLen(IBAN));
if StrLen(IBAN) = 21 then
exit(
CopyStr(
StrSubstNo(
'%1 %2 %3 %4 %5 %6',
CopyStr(IBAN, 1, 4),
CopyStr(IBAN, 5, 4),
CopyStr(IBAN, 9, 4),
CopyStr(IBAN, 13, 4),
CopyStr(IBAN, 17, 4),
CopyStr(IBAN, 21, 1)),
1, 50)
);
exit(IBAN);
end;
procedure AddLineIfNotBlanked(var TargetText: Text; LineText: Text)
begin
if LineText <> '' then
AddLine(TargetText, LineText);
end;
procedure AddLine(var TargetText: Text; LineText: Text)
var
CRLF: Text[2];
begin
CRLF[1] := 13;
CRLF[2] := 10;
if TargetText <> '' then
TargetText += CRLF;
TargetText += LineText;
end;
internal procedure GetLanguageIdENU(): Integer
begin
exit(1033); // en-us
end;
internal procedure GetLanguageIdDEU(): Integer
begin
exit(2055); // de-ch
end;
internal procedure GetLanguageIdFRA(): Integer
begin
exit(4108); // fr-ch
end;
internal procedure GetLanguageIdITA(): Integer
begin
exit(2064); // it-ch
end;
internal procedure GetLanguagesIdDEU(): Text
begin
exit('1031|3079|2055');
end;
internal procedure GetLanguagesIdFRA(): Text
begin
exit('1036|2060|3084|4108');
end;
internal procedure GetLanguagesIdITA(): Text
begin
exit('1040|2064');
end;
internal procedure GetLanguageCodeENU(): Code[10]
var
Language: Codeunit Language;
begin
exit(Language.GetLanguageCode(GetLanguageIdENU()));
end;
[EventSubscriber(ObjectType::Codeunit, Codeunit::"SEPA DD-Fill Export Buffer", 'OnBeforeInsertPaymentExportData', '', false, false)]
local procedure OnBeforeInsertPaymentExportDataForSEPADD(var PaymentExportData: Record "Payment Export Data"; var TempDirectDebitCollectionEntry: Record "Direct Debit Collection Entry")
begin
TempDirectDebitCollectionEntry.CalcFields("Payment Reference");
if TempDirectDebitCollectionEntry."Payment Reference" <> '' then
PaymentExportData."Message to Recipient 1" :=
CopyStr(
StrSubstNo(
'%1; %2',
TempDirectDebitCollectionEntry."Applies-to Entry Description",
TempDirectDebitCollectionEntry."Payment Reference"),
1, MaxStrLen(PaymentExportData."Message to Recipient 1"));
end;
}
| 39.145221 | 206 | 0.614604 |
ed99d92e6e7acf80a5c0b623213695958ecd5992 | 6,431 | t | Perl | dim-testsuite/t/zone-create-subzone.t | jaypeeteeB/dim | c38cf1ddc571e2f7000043172f4611770f288a53 | [
"MIT"
] | 37 | 2020-02-19T14:25:40.000Z | 2022-02-19T18:35:00.000Z | dim-testsuite/t/zone-create-subzone.t | jaypeeteeB/dim | c38cf1ddc571e2f7000043172f4611770f288a53 | [
"MIT"
] | 127 | 2020-03-09T12:29:24.000Z | 2022-03-30T10:56:19.000Z | dim-testsuite/t/zone-create-subzone.t | jaypeeteeB/dim | c38cf1ddc571e2f7000043172f4611770f288a53 | [
"MIT"
] | 26 | 2020-02-19T14:25:46.000Z | 2022-01-26T18:49:45.000Z | $ ndcli create zone example.net primary ns-example.company.org. mail hostmaster@example.net
WARNING - Creating zone example.net without profile
$ ndcli create rr example.net. ns ns-example.company.com.
INFO - Creating RR @ NS ns-example.company.com. in zone example.net
WARNING - ns-example.company.com. does not exist.
$ ndcli create rr example.net. ns ns-example.company.org.
WARNING - The name example.net. already existed, creating round robin record
INFO - Creating RR @ NS ns-example.company.org. in zone example.net
WARNING - ns-example.company.org. does not exist.
$ ndcli create rr example.net. ns ns-example.company.biz.
WARNING - The name example.net. already existed, creating round robin record
INFO - Creating RR @ NS ns-example.company.biz. in zone example.net
WARNING - ns-example.company.biz. does not exist.
$ ndcli create rr example.net. a 213.165.65.50
INFO - Marked IP 213.165.65.50 from layer3domain default as static
INFO - Creating RR @ A 213.165.65.50 in zone example.net
INFO - No zone found for 50.65.165.213.in-addr.arpa.
WARNING - No reverse zone found. Only creating forward entry.
$ ndcli create rr mx0.example.net. a 213.165.64.100
INFO - Marked IP 213.165.64.100 from layer3domain default as static
INFO - Creating RR mx0 A 213.165.64.100 in zone example.net
INFO - No zone found for 100.64.165.213.in-addr.arpa.
WARNING - No reverse zone found. Only creating forward entry.
$ ndcli create rr foo.example.net. a 10.99.1.13
INFO - Marked IP 10.99.1.13 from layer3domain default as static
INFO - Creating RR foo A 10.99.1.13 in zone example.net
INFO - No zone found for 13.1.99.10.in-addr.arpa.
WARNING - No reverse zone found. Only creating forward entry.
$ ndcli create rr bar.example.net. a 10.99.1.14
INFO - Marked IP 10.99.1.14 from layer3domain default as static
INFO - Creating RR bar A 10.99.1.14 in zone example.net
INFO - No zone found for 14.1.99.10.in-addr.arpa.
WARNING - No reverse zone found. Only creating forward entry.
$ ndcli create rr example.net. ttl 900 mx 10 mx0.example.net.
INFO - Creating RR @ 900 MX 10 mx0.example.net. in zone example.net
$ ndcli create rr v300.example.net. a 10.99.1.12
INFO - Marked IP 10.99.1.12 from layer3domain default as static
INFO - Creating RR v300 A 10.99.1.12 in zone example.net
INFO - No zone found for 12.1.99.10.in-addr.arpa.
WARNING - No reverse zone found. Only creating forward entry.
$ ndcli create rr foo.v300.example.net. cname foo
INFO - Creating RR foo.v300 CNAME foo in zone example.net
$ ndcli create rr bar.v300.example.net. cname bar.example.net.
INFO - Creating RR bar.v300 CNAME bar.example.net. in zone example.net
$ ndcli list zone v300.example.net
ERROR - Zone v300.example.net does not exist
$ ndcli list zone example.net
record zone ttl type value
@ example.net 86400 SOA ns-example.company.org. hostmaster.example.net. 2012102612 14400 3600 605000 86400
@ example.net NS ns-example.company.com.
@ example.net NS ns-example.company.org.
@ example.net NS ns-example.company.biz.
@ example.net A 213.165.65.50
@ example.net 900 MX 10 mx0.example.net.
bar example.net A 10.99.1.14
bar.v300 example.net CNAME bar.example.net.
foo example.net A 10.99.1.13
foo.v300 example.net CNAME foo
mx0 example.net A 213.165.64.100
v300 example.net A 10.99.1.12
$ ndcli dump zone v300.example.net
ERROR - Zone v300.example.net does not exist
$ ndcli dump zone example.net
example.net. 86400 IN SOA ns-example.company.org. hostmaster.example.net. 2012092000 600 7200 604800 3600
bar.example.net. 86400 IN A 10.99.1.14
bar.v300.example.net. 86400 IN CNAME bar.example.net.
example.net. 86400 IN NS ns-example.company.com.
example.net. 86400 IN NS ns-example.company.org.
example.net. 86400 IN NS ns-example.company.biz.
example.net. 86400 IN A 213.165.65.50
example.net. 900 IN MX 10 mx0.example.net.
foo.example.net. 86400 IN A 10.99.1.13
foo.v300.example.net. 86400 IN CNAME foo.example.net.
mx0.example.net. 86400 IN A 213.165.64.100
v300.example.net. 86400 IN A 10.99.1.12
$ ndcli create zone v300.example.net primary ins01.server.lan. mail dnsadmin@1und1.de
WARNING - Creating zone v300.example.net without profile
INFO - Creating views default for zone v300.example.net
INFO - Moving RR v300 A 10.99.1.12 in zone v300.example.net from zone example.net
INFO - Moving RR foo.v300 CNAME foo in zone v300.example.net from zone example.net
INFO - Moving RR bar.v300 CNAME bar.example.net. in zone v300.example.net from zone example.net
$ ndcli list zone v300.example.net
record zone ttl type value
@ v300.example.net 86400 SOA ins01.server.lan. dnsadmin.1und1.de. <YYYYMMDD01> 600 7200 604800 3600
@ v300.example.net A 10.99.1.12
bar v300.example.net CNAME bar.example.net.
foo v300.example.net CNAME foo.example.net.
$ ndcli dump zone v300.example.net
v300.example.net. 86400 IN SOA ins01.server.lan. dnsadmin.1und1.de. 2012092000 600 7200 604800 3600
bar.v300.example.net. 86400 IN CNAME bar.example.net.
foo.v300.example.net. 86400 IN CNAME foo.example.net.
v300.example.net. 86400 IN A 10.99.1.12
$ ndcli delete zone example.net --cleanup
INFO - Deleting RR @ NS ns-example.company.com. from zone example.net
INFO - Deleting RR @ NS ns-example.company.org. from zone example.net
INFO - Deleting RR @ NS ns-example.company.biz. from zone example.net
INFO - Deleting RR @ A 213.165.65.50 from zone example.net
INFO - Freeing IP 213.165.65.50 from layer3domain default
INFO - Deleting RR @ 900 MX 10 mx0.example.net. from zone example.net
WARNING - bar.example.net. is referenced by other records
INFO - Deleting RR bar A 10.99.1.14 from zone example.net
INFO - Freeing IP 10.99.1.14 from layer3domain default
WARNING - foo.example.net. is referenced by other records
INFO - Deleting RR foo A 10.99.1.13 from zone example.net
INFO - Freeing IP 10.99.1.13 from layer3domain default
INFO - Deleting RR mx0 A 213.165.64.100 from zone example.net
INFO - Freeing IP 213.165.64.100 from layer3domain default
$ ndcli delete zone v300.example.net --cleanup
INFO - Deleting RR @ A 10.99.1.12 from zone v300.example.net
INFO - Freeing IP 10.99.1.12 from layer3domain default
INFO - Deleting RR bar CNAME bar.example.net. from zone v300.example.net
INFO - Deleting RR foo CNAME foo.example.net. from zone v300.example.net
| 55.921739 | 115 | 0.739232 |
ed84863cd1f204b79530f6bded9369abdda47316 | 9,325 | pm | Perl | lib/OBO/Util/Map.pm | gitpan/ONTO-PERL | ff4cf6f480c7cd753303790c9e35f537bd3130dd | [
"Artistic-1.0-cl8"
] | null | null | null | lib/OBO/Util/Map.pm | gitpan/ONTO-PERL | ff4cf6f480c7cd753303790c9e35f537bd3130dd | [
"Artistic-1.0-cl8"
] | null | null | null | lib/OBO/Util/Map.pm | gitpan/ONTO-PERL | ff4cf6f480c7cd753303790c9e35f537bd3130dd | [
"Artistic-1.0-cl8"
] | null | null | null | # $Id: Map.pm 2014-06-06 erick.antezana $
#
# Module : Map.pm
# Purpose : An implementation of a Map. An object that maps keys to values.
# License : Copyright (c) 2006-2014 by Erick Antezana. All rights reserved.
# This program is free software; you can redistribute it and/or
# modify it under the same terms as Perl itself.
# Contact : Erick Antezana <erick.antezana -@- gmail.com>
#
package OBO::Util::Map;
use OBO::Util::Set;
use Carp;
use strict;
use warnings;
sub new {
my $class = shift;
my $self = {};
%{$self->{MAP}} = (); # key; value
bless ($self, $class);
return $self;
}
=head2 clear
Usage - $map->clear()
Returns - none
Args - none
Function - removes all mappings from this map
=cut
sub clear {
my $self = shift;
%{ $self->{MAP} } = ();
}
=head2 contains_key
Usage - $map->contains_key($key)
Returns - 1 (true) if this map contains a mapping for the specified key
Args - a key whose presence in this map is to be tested
Function - checks if this map contains a mapping for the specified key
=cut
sub contains_key {
my ($self, $key) = @_;
return ( defined $self->{MAP}->{$key} ) ? 1 : 0;
}
=head2 contains_value
Usage - $map->contains_value($value)
Returns - 1 (true) if this map maps one or more keys to the specified value
Args - a value whose presence in this map is to be tested
Function - checks if this map maps one or more keys to the specified value
=cut
sub contains_value {
my ($self, $value) = @_;
my $found = 0;
foreach my $key ( sort keys %{$self->{MAP}} ) {
if ($self->{MAP}->{$key} eq $value) {
$found = 1;
last;
}
}
return $found;
}
=head2 equals
Usage - $map->equals($another_map)
Returns - either 1 (true) or 0 (false)
Args - the map (OBO::Util::Map) to compare with
Function - tells whether this map is equal to the given one
=cut
sub equals {
my $self = shift;
my $result = 0; # I initially guess they're NOT identical
if (@_) {
my $other_map = shift;
if ($self->size() == $other_map->size()) {
my %cmp = map { $_ => 1 } sort keys %{$self->{MAP}};
for my $key ($other_map->key_set()->get_set()) {
last unless exists $cmp{$key};
last unless $self->{MAP}->{$key} eq $other_map->get($key);
delete $cmp{$key};
}
if (%cmp) {
#warn "they don't have the same keys or values\n";
$result = 0;
} else {
#warn "they have the same keys or values\n";
$result = 1;
}
} else {
$result = 0;
}
}
return $result;
}
=head2 get
Usage - $map->get($key)
Returns - the value to which this map maps the specified key
Args - a key whose associated value is to be returned
Function - gets the value to which this map maps the specified key
=cut
sub get {
my ($self, $key) = @_;
return (!$self->is_empty())?$self->{MAP}->{$key}:undef;
}
=head2 is_empty
Usage - $map->is_empty()
Returns - true if this map contains no key-value mappings
Args - none
Function - checks if this map contains no key-value mappings
=cut
sub is_empty {
my $self = shift;
return (scalar keys %{$self->{MAP}} == 0)?1:0;
}
=head2 key_set
Usage - $map->key_set()
Returns - a set (OBO::Util::Set) view of the keys contained in this map
Args - none
Function - gets a set view of the keys contained in this map
=cut
sub key_set {
my $self = shift;
my $set = OBO::Util::Set->new();
$set->add_all(sort keys %{$self->{MAP}});
return $set;
}
=head2 put
Usage - $map->put("GO", "Gene Ontology")
Returns - previous value associated with specified key, or undef if there was no mapping for key
Args - a key (string) with which the specified value is to be associated and a value to be associated with the specified key.
Function - associates the specified value with the specified key in this map (optional operation)
Remark - if the map previously contained a mapping for this key, the old value is replaced by the specified value
=cut
sub put {
my ( $self, $key, $value ) = @_;
my $old_value = undef;
if ( $key && $value ) {
my $has_key = $self->contains_key($key);
$old_value = $self->{MAP}->{$key} if ($has_key);
$self->{MAP}->{$key} = $value;
} else {
croak "You should provide both a key and value -> ('$key', '$value')\n";
}
return $old_value;
}
=head2 put_all
Usage - $map->put_all($my_other_map)
Returns - none
Args - a map (OBO::Util::Map) to be stored in this map
Function - copies all of the mappings from the specified map to this map (optional operation)
Remark - the effect of this call is equivalent to that of calling put(k, v) on this map once for each mapping from key k to value v in the specified map
=cut
sub put_all {
my ( $self, $my_other_map ) = @_;
if ( $my_other_map ) {
foreach my $key ($my_other_map->key_set()->get_set()) {
$self->{MAP}->{$key} = $my_other_map->get($key);
}
}
}
=head2 remove
Usage - $map->remove($key)
Returns - the previous value associated with specified key, or undef if there was no mapping for the given key
Args - a key whose mapping is to be removed from the map
Function - removes the mapping for this key from this map if it is present (optional operation)
=cut
sub remove {
my ($self, $key) = @_;
my $has_key = $self->contains_key($key);
my $old_value = undef;
$old_value = $self->{MAP}->{$key} if ($has_key);
delete $self->{MAP}->{$key};
return $old_value;
}
=head2 size
Usage - $map->size()
Returns - the size of this map
Args - none
Function - tells the number of elements held by this map
=cut
sub size {
my $self = shift;
my $s = 0;
$s += scalar keys %{$self->{MAP}};
return $s;
}
=head2 values
Usage - $map->values()
Returns - a collection view of the values contained in this map
Args - none
Function - gets a collection view of the values contained in this map
=cut
sub values {
my $self = shift;
my @collection = sort values %{$self->{MAP}};
return @collection;
}
1;
__END__
=head1 NAME
OBO::Util::Map - An implementation of a map (key -> value).
=head1 SYNOPSIS
use OBO::Util::Map;
use strict;
my $my_map = OBO::Util::Map->new();
if(!$my_map->contains_key("GO")) { print "doesn't contain key: GO"; }
if(!$my_map->contains_value("Gene Ontology")) { print "doesn't contain value: Gene Ontology"; }
if ($my_map->size() == 0) { print "empty map"; }
if ($my_map->is_empty()) { print "empty map"; }
$my_map->put("GO", "Gene Ontology");
if ($my_map->contains_key("GO")) { print "contains key: GO"; }
if ($my_map->contains_value("Gene Ontology")) { print "contains value: Gene Ontology"; }
if ($my_map->size() == 1) { print "map size is 1"; }
if (!$my_map->is_empty()) { print "map is not empty"; }
$my_map->put("APO", "Application Ontology");
$my_map->put("PO", "Plant Ontology");
$my_map->put("SO", "Sequence Ontology");
if ($my_map->size() == 4) { print "map size is 4"; }
if ($my_map->equals($my_map)) { print "my map is identical to itself"; }
my $my_map2 = OBO::Util::Map->new();
if (!$my_map->equals($my_map2)) { print "my map is not identical to map2"; }
if (!$my_map2->equals($my_map)) { print "map2 is not identical to my map"; }
$my_map2->put("APO", "Application Ontology");
$my_map2->put("PO", "Plant Ontology");
$my_map2->put("SO", "Sequence Ontology");
if (!$my_map2->equals($my_map)) { print "map2 is not identical to my map"; }
if (!$my_map->equals($my_map2)) { print "my map is not identical to map2"; }
$my_map2->put("GO", "Gene Ontology");
if ($my_map2->equals($my_map)) { print "map2 is not identical to my map"; }
if ($my_map->equals($my_map2)) { print "my map is not identical to map2"; }
if ($my_map2->get("GO") eq "Gene Ontology") { print "get GO"}
if ($my_map2->get("APO") eq "Application Ontology") { print "get APO"}
if ($my_map2->get("PO") eq "Plant Ontology") { print "get PO"}
if ($my_map2->get("SO") eq "Sequence Ontology") { print "get SO"}
$my_map2->put("TO", "Trait Ontology");
if (!$my_map->equals($my_map2)) { print "my map is not identical to map2"; }
if (!$my_map2->equals($my_map)) { print "map2 is not identical to my map"; }
if ($my_map2->size() == 5) { print "map size is 5"; }
$my_map->clear();
if ($my_map->size() == 0) { print "map size is 0"; }
$my_map->put_all($my_map2);
if ($my_map->equals($my_map2)) { print "my map is identical to map2"; }
if ($my_map2->equals($my_map)) { print "map2 is identical to my map"; }
if ($my_map->size() == 5) { print "map size is 5"; }
my $UD = $my_map->remove("XO");
my $GO = $my_map->remove("GO");
if (!$my_map->contains_key("GO") && !$my_map->contains_value("Gene Ontology")) { print "GO is gone"}
print $GO; # "Gene Ontology"
if ($my_map->size() == 4) { print "map size is 4"; }
=head1 DESCRIPTION
An object that maps keys to values. A map cannot contain duplicate keys;
each key can map to at most one value.
=head1 AUTHOR
Erick Antezana, E<lt>erick.antezana -@- gmail.comE<gt>
=head1 COPYRIGHT AND LICENSE
Copyright (c) 2006-2014 by Erick Antezana
This library is free software; you can redistribute it and/or modify
it under the same terms as Perl itself, either Perl version 5.8.7 or,
at your option, any later version of Perl 5 you may have available.
=cut | 23.910256 | 156 | 0.636997 |
eda1f25b251eec663cd47f54c8cd45cc9ad0b9a7 | 3,292 | t | Perl | t/filter-fun.t | huylvt/lua-resty-radixtree | 5e70b03440d53d55b9aa7eefbdde21369a16432e | [
"Apache-2.0"
] | null | null | null | t/filter-fun.t | huylvt/lua-resty-radixtree | 5e70b03440d53d55b9aa7eefbdde21369a16432e | [
"Apache-2.0"
] | null | null | null | t/filter-fun.t | huylvt/lua-resty-radixtree | 5e70b03440d53d55b9aa7eefbdde21369a16432e | [
"Apache-2.0"
] | null | null | null | # vim:set ft= ts=4 sw=4 et fdm=marker:
use t::RX 'no_plan';
repeat_each(1);
run_tests();
__DATA__
=== TEST 1: sanity
--- config
location /t {
content_by_lua_block {
local radix = require("resty.radixtree")
local rx = radix.new({
{
paths = "/aa",
metadata = "metadata /aa",
filter_fun = function(vars)
ngx.log(ngx.WARN, "start to filter")
return vars['arg_k'] == 'v'
end
}
})
ngx.say(rx:match("/aa", {vars = ngx.var}))
ngx.say(rx:match("/aa", {}))
}
}
--- request
GET /t?k=v
--- no_error_log
[error]
--- error_log
start to filter
--- response_body
metadata /aa
metadata /aa
=== TEST 2: not hit
--- config
location /t {
content_by_lua_block {
local radix = require("resty.radixtree")
local rx = radix.new({
{
paths = "/aa",
metadata = "metadata /aa",
filter_fun = function(vars)
ngx.log(ngx.WARN, "start to filter")
return vars['arg_k'] == 'v'
end
}
})
ngx.say(rx:match("/aa", {vars = ngx.var}))
ngx.say(rx:match("/aa", {}))
}
}
--- request
GET /t?k=not-hit
--- no_error_log
[error]
--- error_log
start to filter
--- response_body
nil
nil
=== TEST 3: match(path, opts)
--- config
location /t {
content_by_lua_block {
local opts = {vars = ngx.var}
local radix = require("resty.radixtree")
local rx = radix.new({
{
paths = "/aa",
metadata = "metadata /aa",
filter_fun = function(vars, opt, ...)
ngx.log(ngx.WARN, "start to filter, opt: ", opts == opt)
return vars['arg_k'] == 'v'
end
}
})
ngx.say(rx:match("/aa", opts))
ngx.say(rx:match("/aa", {}))
}
}
--- request
GET /t?k=v
--- no_error_log
[error]
--- error_log
start to filter, opt: true
start to filter, opt: false
--- response_body
metadata /aa
metadata /aa
=== TEST 4: dispatch(path, opt, ...)
--- config
location /t {
content_by_lua_block {
local opts = {vars = ngx.var}
local radix = require("resty.radixtree")
local rx = radix.new({
{
paths = "/aa",
filter_fun = function(vars, opt, ...)
ngx.log(ngx.WARN, "start to filter, opt: ", opt == opts)
return vars['arg_k'] == 'v'
end,
handler = function (...)
ngx.say("handler /aa")
end,
}
})
ngx.say(rx:dispatch("/aa", opts))
ngx.say(rx:dispatch("/aa", {}))
}
}
--- request
GET /t?k=v
--- no_error_log
[error]
--- error_log
start to filter, opt: true
start to filter, opt: false
--- response_body
handler /aa
true
handler /aa
true
| 23.020979 | 80 | 0.438943 |
ed9a6329e03b2e9a2b4cf84fc295fae3882be656 | 190 | t | Perl | S16-io/cwd.t | rurban/roast | 63540fe76bc9b060aedca20c010372ecf60c6233 | [
"Artistic-2.0"
] | null | null | null | S16-io/cwd.t | rurban/roast | 63540fe76bc9b060aedca20c010372ecf60c6233 | [
"Artistic-2.0"
] | null | null | null | S16-io/cwd.t | rurban/roast | 63540fe76bc9b060aedca20c010372ecf60c6233 | [
"Artistic-2.0"
] | 1 | 2019-10-08T10:15:36.000Z | 2019-10-08T10:15:36.000Z | use Test;
# L<S16/IO/$*CWD>
# see also S28-named-variables/cwd.t
plan 3;
isa_ok $*CWD, IO::Path;
lives_ok { $*CWD.perl }, '$*CWD.perl works';
lives_ok { $*CWD.gist }, '$*CWD.gist works';
| 17.272727 | 44 | 0.621053 |
ed515f8925027666a64d696029e5a206d06f403b | 1,750 | pm | Perl | lib/TauHead/Schema/Result/VendorItem.pm | taustation-fan/tauhead-server | 00802b51529d8043358a3e4dec9420314e48db19 | [
"MIT"
] | 1 | 2019-02-06T22:20:29.000Z | 2019-02-06T22:20:29.000Z | lib/TauHead/Schema/Result/VendorItem.pm | taustation-fan/tauhead-server | 00802b51529d8043358a3e4dec9420314e48db19 | [
"MIT"
] | 1 | 2018-10-25T21:58:42.000Z | 2018-10-25T21:58:42.000Z | lib/TauHead/Schema/Result/VendorItem.pm | taustation-fan/tauhead-server | 00802b51529d8043358a3e4dec9420314e48db19 | [
"MIT"
] | null | null | null | use utf8;
package TauHead::Schema::Result::VendorItem;
use strict;
use warnings;
use base 'DBIx::Class::Core';
__PACKAGE__->table("vendor_item");
__PACKAGE__->add_columns(
"id", # in-game `market_stall_item_id`
{ data_type => "integer",
is_nullable => 0,
},
"item_slug",
{
data_type => "character varying",
is_nullable => 0,
size => 128,
extra => {
th_export => 1,
},
},
"vendor_id",
{ data_type => "integer",
is_nullable => 0,
},
"max_quantity_that_can_be_sold_per_attempt",
{ data_type => "integer", is_nullable => 0 },
"default_quantity",
{ data_type => "integer", is_nullable => 0 },
"has_unlimited_quantity",
{ data_type => "boolean", is_nullable => 0, default_value => 0 },
"price",
{ data_type => "decimal",
size => [ 12, 2 ],
is_nullable => 0,
},
"price_unit",
{ data_type => "enum",
extra => { list => [qw( credits bonds )] },
is_nullable => 0,
},
);
__PACKAGE__->set_primary_key("id");
__PACKAGE__->add_unique_constraint( "item_slug_vendor_idx", ["item_slug", "vendor_id"] );
sub sqlt_deploy_hook {
my ($self, $sqlt_table) = @_;
$sqlt_table->add_index(fields => ['vendor_id']);
}
__PACKAGE__->belongs_to(
"item", "TauHead::Schema::Result::Item",
{ slug => "item_slug" },
{ is_deferrable => 1, on_delete => "CASCADE", on_update => "CASCADE" },
);
__PACKAGE__->belongs_to(
"vendor", "TauHead::Schema::Result::Vendor",
{ id => "vendor_id" },
{ is_deferrable => 1, on_delete => "CASCADE", on_update => "CASCADE" },
);
1;
| 23.333333 | 89 | 0.544571 |
ed6de456de95c3a29d9826e56257151f0cb5e794 | 25,291 | pm | Perl | lib/DateTime/TimeZone/America/Belize.pm | fossabot/DateTime-TimeZone | d0e4bba9fec5b9956317976250d01f6cc0044ce7 | [
"Artistic-1.0"
] | null | null | null | lib/DateTime/TimeZone/America/Belize.pm | fossabot/DateTime-TimeZone | d0e4bba9fec5b9956317976250d01f6cc0044ce7 | [
"Artistic-1.0"
] | null | null | null | lib/DateTime/TimeZone/America/Belize.pm | fossabot/DateTime-TimeZone | d0e4bba9fec5b9956317976250d01f6cc0044ce7 | [
"Artistic-1.0"
] | null | null | null | # This file is auto-generated by the Perl DateTime Suite time zone
# code generator (0.08) This code generator comes with the
# DateTime::TimeZone module distribution in the tools/ directory
#
# Generated from /tmp/M7TZl06VNc/northamerica. Olson data version 2021a
#
# Do not edit this file directly.
#
package DateTime::TimeZone::America::Belize;
use strict;
use warnings;
use namespace::autoclean;
our $VERSION = '2.48';
use Class::Singleton 1.03;
use DateTime::TimeZone;
use DateTime::TimeZone::OlsonDB;
@DateTime::TimeZone::America::Belize::ISA = ( 'Class::Singleton', 'DateTime::TimeZone' );
my $spans =
[
[
DateTime::TimeZone::NEG_INFINITY, # utc_start
60313182768, # utc_end 1912-04-01 05:52:48 (Mon)
DateTime::TimeZone::NEG_INFINITY, # local_start
60313161600, # local_end 1912-04-01 00:00:00 (Mon)
-21168,
0,
'LMT',
],
[
60313182768, # utc_start 1912-04-01 05:52:48 (Mon)
60518728800, # utc_end 1918-10-06 06:00:00 (Sun)
60313161168, # local_start 1912-03-31 23:52:48 (Sun)
60518707200, # local_end 1918-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60518728800, # utc_start 1918-10-06 06:00:00 (Sun)
60529613400, # utc_end 1919-02-09 05:30:00 (Sun)
60518709000, # local_start 1918-10-06 00:30:00 (Sun)
60529593600, # local_end 1919-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60529613400, # utc_start 1919-02-09 05:30:00 (Sun)
60550178400, # utc_end 1919-10-05 06:00:00 (Sun)
60529591800, # local_start 1919-02-08 23:30:00 (Sat)
60550156800, # local_end 1919-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60550178400, # utc_start 1919-10-05 06:00:00 (Sun)
60561667800, # utc_end 1920-02-15 05:30:00 (Sun)
60550158600, # local_start 1919-10-05 00:30:00 (Sun)
60561648000, # local_end 1920-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60561667800, # utc_start 1920-02-15 05:30:00 (Sun)
60581628000, # utc_end 1920-10-03 06:00:00 (Sun)
60561646200, # local_start 1920-02-14 23:30:00 (Sat)
60581606400, # local_end 1920-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60581628000, # utc_start 1920-10-03 06:00:00 (Sun)
60593117400, # utc_end 1921-02-13 05:30:00 (Sun)
60581608200, # local_start 1920-10-03 00:30:00 (Sun)
60593097600, # local_end 1921-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60593117400, # utc_start 1921-02-13 05:30:00 (Sun)
60613077600, # utc_end 1921-10-02 06:00:00 (Sun)
60593095800, # local_start 1921-02-12 23:30:00 (Sat)
60613056000, # local_end 1921-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60613077600, # utc_start 1921-10-02 06:00:00 (Sun)
60624567000, # utc_end 1922-02-12 05:30:00 (Sun)
60613057800, # local_start 1921-10-02 00:30:00 (Sun)
60624547200, # local_end 1922-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60624567000, # utc_start 1922-02-12 05:30:00 (Sun)
60645132000, # utc_end 1922-10-08 06:00:00 (Sun)
60624545400, # local_start 1922-02-11 23:30:00 (Sat)
60645110400, # local_end 1922-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60645132000, # utc_start 1922-10-08 06:00:00 (Sun)
60656016600, # utc_end 1923-02-11 05:30:00 (Sun)
60645112200, # local_start 1922-10-08 00:30:00 (Sun)
60655996800, # local_end 1923-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60656016600, # utc_start 1923-02-11 05:30:00 (Sun)
60676581600, # utc_end 1923-10-07 06:00:00 (Sun)
60655995000, # local_start 1923-02-10 23:30:00 (Sat)
60676560000, # local_end 1923-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60676581600, # utc_start 1923-10-07 06:00:00 (Sun)
60687466200, # utc_end 1924-02-10 05:30:00 (Sun)
60676561800, # local_start 1923-10-07 00:30:00 (Sun)
60687446400, # local_end 1924-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60687466200, # utc_start 1924-02-10 05:30:00 (Sun)
60708031200, # utc_end 1924-10-05 06:00:00 (Sun)
60687444600, # local_start 1924-02-09 23:30:00 (Sat)
60708009600, # local_end 1924-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60708031200, # utc_start 1924-10-05 06:00:00 (Sun)
60719520600, # utc_end 1925-02-15 05:30:00 (Sun)
60708011400, # local_start 1924-10-05 00:30:00 (Sun)
60719500800, # local_end 1925-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60719520600, # utc_start 1925-02-15 05:30:00 (Sun)
60739480800, # utc_end 1925-10-04 06:00:00 (Sun)
60719499000, # local_start 1925-02-14 23:30:00 (Sat)
60739459200, # local_end 1925-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60739480800, # utc_start 1925-10-04 06:00:00 (Sun)
60750970200, # utc_end 1926-02-14 05:30:00 (Sun)
60739461000, # local_start 1925-10-04 00:30:00 (Sun)
60750950400, # local_end 1926-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60750970200, # utc_start 1926-02-14 05:30:00 (Sun)
60770930400, # utc_end 1926-10-03 06:00:00 (Sun)
60750948600, # local_start 1926-02-13 23:30:00 (Sat)
60770908800, # local_end 1926-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60770930400, # utc_start 1926-10-03 06:00:00 (Sun)
60782419800, # utc_end 1927-02-13 05:30:00 (Sun)
60770910600, # local_start 1926-10-03 00:30:00 (Sun)
60782400000, # local_end 1927-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60782419800, # utc_start 1927-02-13 05:30:00 (Sun)
60802380000, # utc_end 1927-10-02 06:00:00 (Sun)
60782398200, # local_start 1927-02-12 23:30:00 (Sat)
60802358400, # local_end 1927-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60802380000, # utc_start 1927-10-02 06:00:00 (Sun)
60813869400, # utc_end 1928-02-12 05:30:00 (Sun)
60802360200, # local_start 1927-10-02 00:30:00 (Sun)
60813849600, # local_end 1928-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60813869400, # utc_start 1928-02-12 05:30:00 (Sun)
60834434400, # utc_end 1928-10-07 06:00:00 (Sun)
60813847800, # local_start 1928-02-11 23:30:00 (Sat)
60834412800, # local_end 1928-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60834434400, # utc_start 1928-10-07 06:00:00 (Sun)
60845319000, # utc_end 1929-02-10 05:30:00 (Sun)
60834414600, # local_start 1928-10-07 00:30:00 (Sun)
60845299200, # local_end 1929-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60845319000, # utc_start 1929-02-10 05:30:00 (Sun)
60865884000, # utc_end 1929-10-06 06:00:00 (Sun)
60845297400, # local_start 1929-02-09 23:30:00 (Sat)
60865862400, # local_end 1929-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60865884000, # utc_start 1929-10-06 06:00:00 (Sun)
60876768600, # utc_end 1930-02-09 05:30:00 (Sun)
60865864200, # local_start 1929-10-06 00:30:00 (Sun)
60876748800, # local_end 1930-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60876768600, # utc_start 1930-02-09 05:30:00 (Sun)
60897333600, # utc_end 1930-10-05 06:00:00 (Sun)
60876747000, # local_start 1930-02-08 23:30:00 (Sat)
60897312000, # local_end 1930-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60897333600, # utc_start 1930-10-05 06:00:00 (Sun)
60908823000, # utc_end 1931-02-15 05:30:00 (Sun)
60897313800, # local_start 1930-10-05 00:30:00 (Sun)
60908803200, # local_end 1931-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60908823000, # utc_start 1931-02-15 05:30:00 (Sun)
60928783200, # utc_end 1931-10-04 06:00:00 (Sun)
60908801400, # local_start 1931-02-14 23:30:00 (Sat)
60928761600, # local_end 1931-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60928783200, # utc_start 1931-10-04 06:00:00 (Sun)
60940272600, # utc_end 1932-02-14 05:30:00 (Sun)
60928763400, # local_start 1931-10-04 00:30:00 (Sun)
60940252800, # local_end 1932-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60940272600, # utc_start 1932-02-14 05:30:00 (Sun)
60960232800, # utc_end 1932-10-02 06:00:00 (Sun)
60940251000, # local_start 1932-02-13 23:30:00 (Sat)
60960211200, # local_end 1932-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60960232800, # utc_start 1932-10-02 06:00:00 (Sun)
60971722200, # utc_end 1933-02-12 05:30:00 (Sun)
60960213000, # local_start 1932-10-02 00:30:00 (Sun)
60971702400, # local_end 1933-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
60971722200, # utc_start 1933-02-12 05:30:00 (Sun)
60992287200, # utc_end 1933-10-08 06:00:00 (Sun)
60971700600, # local_start 1933-02-11 23:30:00 (Sat)
60992265600, # local_end 1933-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
60992287200, # utc_start 1933-10-08 06:00:00 (Sun)
61003171800, # utc_end 1934-02-11 05:30:00 (Sun)
60992267400, # local_start 1933-10-08 00:30:00 (Sun)
61003152000, # local_end 1934-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61003171800, # utc_start 1934-02-11 05:30:00 (Sun)
61023736800, # utc_end 1934-10-07 06:00:00 (Sun)
61003150200, # local_start 1934-02-10 23:30:00 (Sat)
61023715200, # local_end 1934-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61023736800, # utc_start 1934-10-07 06:00:00 (Sun)
61034621400, # utc_end 1935-02-10 05:30:00 (Sun)
61023717000, # local_start 1934-10-07 00:30:00 (Sun)
61034601600, # local_end 1935-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61034621400, # utc_start 1935-02-10 05:30:00 (Sun)
61055186400, # utc_end 1935-10-06 06:00:00 (Sun)
61034599800, # local_start 1935-02-09 23:30:00 (Sat)
61055164800, # local_end 1935-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61055186400, # utc_start 1935-10-06 06:00:00 (Sun)
61066071000, # utc_end 1936-02-09 05:30:00 (Sun)
61055166600, # local_start 1935-10-06 00:30:00 (Sun)
61066051200, # local_end 1936-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61066071000, # utc_start 1936-02-09 05:30:00 (Sun)
61086636000, # utc_end 1936-10-04 06:00:00 (Sun)
61066049400, # local_start 1936-02-08 23:30:00 (Sat)
61086614400, # local_end 1936-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61086636000, # utc_start 1936-10-04 06:00:00 (Sun)
61098125400, # utc_end 1937-02-14 05:30:00 (Sun)
61086616200, # local_start 1936-10-04 00:30:00 (Sun)
61098105600, # local_end 1937-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61098125400, # utc_start 1937-02-14 05:30:00 (Sun)
61118085600, # utc_end 1937-10-03 06:00:00 (Sun)
61098103800, # local_start 1937-02-13 23:30:00 (Sat)
61118064000, # local_end 1937-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61118085600, # utc_start 1937-10-03 06:00:00 (Sun)
61129575000, # utc_end 1938-02-13 05:30:00 (Sun)
61118065800, # local_start 1937-10-03 00:30:00 (Sun)
61129555200, # local_end 1938-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61129575000, # utc_start 1938-02-13 05:30:00 (Sun)
61149535200, # utc_end 1938-10-02 06:00:00 (Sun)
61129553400, # local_start 1938-02-12 23:30:00 (Sat)
61149513600, # local_end 1938-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61149535200, # utc_start 1938-10-02 06:00:00 (Sun)
61161024600, # utc_end 1939-02-12 05:30:00 (Sun)
61149515400, # local_start 1938-10-02 00:30:00 (Sun)
61161004800, # local_end 1939-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61161024600, # utc_start 1939-02-12 05:30:00 (Sun)
61181589600, # utc_end 1939-10-08 06:00:00 (Sun)
61161003000, # local_start 1939-02-11 23:30:00 (Sat)
61181568000, # local_end 1939-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61181589600, # utc_start 1939-10-08 06:00:00 (Sun)
61192474200, # utc_end 1940-02-11 05:30:00 (Sun)
61181569800, # local_start 1939-10-08 00:30:00 (Sun)
61192454400, # local_end 1940-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61192474200, # utc_start 1940-02-11 05:30:00 (Sun)
61213039200, # utc_end 1940-10-06 06:00:00 (Sun)
61192452600, # local_start 1940-02-10 23:30:00 (Sat)
61213017600, # local_end 1940-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61213039200, # utc_start 1940-10-06 06:00:00 (Sun)
61223923800, # utc_end 1941-02-09 05:30:00 (Sun)
61213019400, # local_start 1940-10-06 00:30:00 (Sun)
61223904000, # local_end 1941-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61223923800, # utc_start 1941-02-09 05:30:00 (Sun)
61244488800, # utc_end 1941-10-05 06:00:00 (Sun)
61223902200, # local_start 1941-02-08 23:30:00 (Sat)
61244467200, # local_end 1941-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61244488800, # utc_start 1941-10-05 06:00:00 (Sun)
61255978200, # utc_end 1942-02-15 05:30:00 (Sun)
61244469000, # local_start 1941-10-05 00:30:00 (Sun)
61255958400, # local_end 1942-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61255978200, # utc_start 1942-02-15 05:30:00 (Sun)
61267471200, # utc_end 1942-06-28 06:00:00 (Sun)
61255956600, # local_start 1942-02-14 23:30:00 (Sat)
61267449600, # local_end 1942-06-28 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61267471200, # utc_start 1942-06-28 06:00:00 (Sun)
61366287600, # utc_end 1945-08-14 23:00:00 (Tue)
61267453200, # local_start 1942-06-28 01:00:00 (Sun)
61366269600, # local_end 1945-08-14 18:00:00 (Tue)
-18000,
1,
'CWT',
],
[
61366287600, # utc_start 1945-08-14 23:00:00 (Tue)
61376936400, # utc_end 1945-12-16 05:00:00 (Sun)
61366269600, # local_start 1945-08-14 18:00:00 (Tue)
61376918400, # local_end 1945-12-16 00:00:00 (Sun)
-18000,
1,
'CPT',
],
[
61376936400, # utc_start 1945-12-16 05:00:00 (Sun)
61433791200, # utc_end 1947-10-05 06:00:00 (Sun)
61376914800, # local_start 1945-12-15 23:00:00 (Sat)
61433769600, # local_end 1947-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61433791200, # utc_start 1947-10-05 06:00:00 (Sun)
61445280600, # utc_end 1948-02-15 05:30:00 (Sun)
61433771400, # local_start 1947-10-05 00:30:00 (Sun)
61445260800, # local_end 1948-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61445280600, # utc_start 1948-02-15 05:30:00 (Sun)
61465240800, # utc_end 1948-10-03 06:00:00 (Sun)
61445259000, # local_start 1948-02-14 23:30:00 (Sat)
61465219200, # local_end 1948-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61465240800, # utc_start 1948-10-03 06:00:00 (Sun)
61476730200, # utc_end 1949-02-13 05:30:00 (Sun)
61465221000, # local_start 1948-10-03 00:30:00 (Sun)
61476710400, # local_end 1949-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61476730200, # utc_start 1949-02-13 05:30:00 (Sun)
61496690400, # utc_end 1949-10-02 06:00:00 (Sun)
61476708600, # local_start 1949-02-12 23:30:00 (Sat)
61496668800, # local_end 1949-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61496690400, # utc_start 1949-10-02 06:00:00 (Sun)
61508179800, # utc_end 1950-02-12 05:30:00 (Sun)
61496670600, # local_start 1949-10-02 00:30:00 (Sun)
61508160000, # local_end 1950-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61508179800, # utc_start 1950-02-12 05:30:00 (Sun)
61528744800, # utc_end 1950-10-08 06:00:00 (Sun)
61508158200, # local_start 1950-02-11 23:30:00 (Sat)
61528723200, # local_end 1950-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61528744800, # utc_start 1950-10-08 06:00:00 (Sun)
61539629400, # utc_end 1951-02-11 05:30:00 (Sun)
61528725000, # local_start 1950-10-08 00:30:00 (Sun)
61539609600, # local_end 1951-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61539629400, # utc_start 1951-02-11 05:30:00 (Sun)
61560194400, # utc_end 1951-10-07 06:00:00 (Sun)
61539607800, # local_start 1951-02-10 23:30:00 (Sat)
61560172800, # local_end 1951-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61560194400, # utc_start 1951-10-07 06:00:00 (Sun)
61571079000, # utc_end 1952-02-10 05:30:00 (Sun)
61560174600, # local_start 1951-10-07 00:30:00 (Sun)
61571059200, # local_end 1952-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61571079000, # utc_start 1952-02-10 05:30:00 (Sun)
61591644000, # utc_end 1952-10-05 06:00:00 (Sun)
61571057400, # local_start 1952-02-09 23:30:00 (Sat)
61591622400, # local_end 1952-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61591644000, # utc_start 1952-10-05 06:00:00 (Sun)
61603133400, # utc_end 1953-02-15 05:30:00 (Sun)
61591624200, # local_start 1952-10-05 00:30:00 (Sun)
61603113600, # local_end 1953-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61603133400, # utc_start 1953-02-15 05:30:00 (Sun)
61623093600, # utc_end 1953-10-04 06:00:00 (Sun)
61603111800, # local_start 1953-02-14 23:30:00 (Sat)
61623072000, # local_end 1953-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61623093600, # utc_start 1953-10-04 06:00:00 (Sun)
61634583000, # utc_end 1954-02-14 05:30:00 (Sun)
61623073800, # local_start 1953-10-04 00:30:00 (Sun)
61634563200, # local_end 1954-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61634583000, # utc_start 1954-02-14 05:30:00 (Sun)
61654543200, # utc_end 1954-10-03 06:00:00 (Sun)
61634561400, # local_start 1954-02-13 23:30:00 (Sat)
61654521600, # local_end 1954-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61654543200, # utc_start 1954-10-03 06:00:00 (Sun)
61666032600, # utc_end 1955-02-13 05:30:00 (Sun)
61654523400, # local_start 1954-10-03 00:30:00 (Sun)
61666012800, # local_end 1955-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61666032600, # utc_start 1955-02-13 05:30:00 (Sun)
61685992800, # utc_end 1955-10-02 06:00:00 (Sun)
61666011000, # local_start 1955-02-12 23:30:00 (Sat)
61685971200, # local_end 1955-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61685992800, # utc_start 1955-10-02 06:00:00 (Sun)
61697482200, # utc_end 1956-02-12 05:30:00 (Sun)
61685973000, # local_start 1955-10-02 00:30:00 (Sun)
61697462400, # local_end 1956-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61697482200, # utc_start 1956-02-12 05:30:00 (Sun)
61718047200, # utc_end 1956-10-07 06:00:00 (Sun)
61697460600, # local_start 1956-02-11 23:30:00 (Sat)
61718025600, # local_end 1956-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61718047200, # utc_start 1956-10-07 06:00:00 (Sun)
61728931800, # utc_end 1957-02-10 05:30:00 (Sun)
61718027400, # local_start 1956-10-07 00:30:00 (Sun)
61728912000, # local_end 1957-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61728931800, # utc_start 1957-02-10 05:30:00 (Sun)
61749496800, # utc_end 1957-10-06 06:00:00 (Sun)
61728910200, # local_start 1957-02-09 23:30:00 (Sat)
61749475200, # local_end 1957-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61749496800, # utc_start 1957-10-06 06:00:00 (Sun)
61760381400, # utc_end 1958-02-09 05:30:00 (Sun)
61749477000, # local_start 1957-10-06 00:30:00 (Sun)
61760361600, # local_end 1958-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61760381400, # utc_start 1958-02-09 05:30:00 (Sun)
61780946400, # utc_end 1958-10-05 06:00:00 (Sun)
61760359800, # local_start 1958-02-08 23:30:00 (Sat)
61780924800, # local_end 1958-10-05 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61780946400, # utc_start 1958-10-05 06:00:00 (Sun)
61792435800, # utc_end 1959-02-15 05:30:00 (Sun)
61780926600, # local_start 1958-10-05 00:30:00 (Sun)
61792416000, # local_end 1959-02-15 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61792435800, # utc_start 1959-02-15 05:30:00 (Sun)
61812396000, # utc_end 1959-10-04 06:00:00 (Sun)
61792414200, # local_start 1959-02-14 23:30:00 (Sat)
61812374400, # local_end 1959-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61812396000, # utc_start 1959-10-04 06:00:00 (Sun)
61823885400, # utc_end 1960-02-14 05:30:00 (Sun)
61812376200, # local_start 1959-10-04 00:30:00 (Sun)
61823865600, # local_end 1960-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61823885400, # utc_start 1960-02-14 05:30:00 (Sun)
61843845600, # utc_end 1960-10-02 06:00:00 (Sun)
61823863800, # local_start 1960-02-13 23:30:00 (Sat)
61843824000, # local_end 1960-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61843845600, # utc_start 1960-10-02 06:00:00 (Sun)
61855335000, # utc_end 1961-02-12 05:30:00 (Sun)
61843825800, # local_start 1960-10-02 00:30:00 (Sun)
61855315200, # local_end 1961-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61855335000, # utc_start 1961-02-12 05:30:00 (Sun)
61875900000, # utc_end 1961-10-08 06:00:00 (Sun)
61855313400, # local_start 1961-02-11 23:30:00 (Sat)
61875878400, # local_end 1961-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61875900000, # utc_start 1961-10-08 06:00:00 (Sun)
61886784600, # utc_end 1962-02-11 05:30:00 (Sun)
61875880200, # local_start 1961-10-08 00:30:00 (Sun)
61886764800, # local_end 1962-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61886784600, # utc_start 1962-02-11 05:30:00 (Sun)
61907349600, # utc_end 1962-10-07 06:00:00 (Sun)
61886763000, # local_start 1962-02-10 23:30:00 (Sat)
61907328000, # local_end 1962-10-07 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61907349600, # utc_start 1962-10-07 06:00:00 (Sun)
61918234200, # utc_end 1963-02-10 05:30:00 (Sun)
61907329800, # local_start 1962-10-07 00:30:00 (Sun)
61918214400, # local_end 1963-02-10 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61918234200, # utc_start 1963-02-10 05:30:00 (Sun)
61938799200, # utc_end 1963-10-06 06:00:00 (Sun)
61918212600, # local_start 1963-02-09 23:30:00 (Sat)
61938777600, # local_end 1963-10-06 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61938799200, # utc_start 1963-10-06 06:00:00 (Sun)
61949683800, # utc_end 1964-02-09 05:30:00 (Sun)
61938779400, # local_start 1963-10-06 00:30:00 (Sun)
61949664000, # local_end 1964-02-09 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61949683800, # utc_start 1964-02-09 05:30:00 (Sun)
61970248800, # utc_end 1964-10-04 06:00:00 (Sun)
61949662200, # local_start 1964-02-08 23:30:00 (Sat)
61970227200, # local_end 1964-10-04 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
61970248800, # utc_start 1964-10-04 06:00:00 (Sun)
61981738200, # utc_end 1965-02-14 05:30:00 (Sun)
61970229000, # local_start 1964-10-04 00:30:00 (Sun)
61981718400, # local_end 1965-02-14 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
61981738200, # utc_start 1965-02-14 05:30:00 (Sun)
62001698400, # utc_end 1965-10-03 06:00:00 (Sun)
61981716600, # local_start 1965-02-13 23:30:00 (Sat)
62001676800, # local_end 1965-10-03 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
62001698400, # utc_start 1965-10-03 06:00:00 (Sun)
62013187800, # utc_end 1966-02-13 05:30:00 (Sun)
62001678600, # local_start 1965-10-03 00:30:00 (Sun)
62013168000, # local_end 1966-02-13 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
62013187800, # utc_start 1966-02-13 05:30:00 (Sun)
62033148000, # utc_end 1966-10-02 06:00:00 (Sun)
62013166200, # local_start 1966-02-12 23:30:00 (Sat)
62033126400, # local_end 1966-10-02 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
62033148000, # utc_start 1966-10-02 06:00:00 (Sun)
62044637400, # utc_end 1967-02-12 05:30:00 (Sun)
62033128200, # local_start 1966-10-02 00:30:00 (Sun)
62044617600, # local_end 1967-02-12 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
62044637400, # utc_start 1967-02-12 05:30:00 (Sun)
62065202400, # utc_end 1967-10-08 06:00:00 (Sun)
62044615800, # local_start 1967-02-11 23:30:00 (Sat)
62065180800, # local_end 1967-10-08 00:00:00 (Sun)
-21600,
0,
'CST',
],
[
62065202400, # utc_start 1967-10-08 06:00:00 (Sun)
62076087000, # utc_end 1968-02-11 05:30:00 (Sun)
62065182600, # local_start 1967-10-08 00:30:00 (Sun)
62076067200, # local_end 1968-02-11 00:00:00 (Sun)
-19800,
1,
'-0530',
],
[
62076087000, # utc_start 1968-02-11 05:30:00 (Sun)
62259602400, # utc_end 1973-12-05 06:00:00 (Wed)
62076065400, # local_start 1968-02-10 23:30:00 (Sat)
62259580800, # local_end 1973-12-05 00:00:00 (Wed)
-21600,
0,
'CST',
],
[
62259602400, # utc_start 1973-12-05 06:00:00 (Wed)
62265301200, # utc_end 1974-02-09 05:00:00 (Sat)
62259584400, # local_start 1973-12-05 01:00:00 (Wed)
62265283200, # local_end 1974-02-09 00:00:00 (Sat)
-18000,
1,
'CDT',
],
[
62265301200, # utc_start 1974-02-09 05:00:00 (Sat)
62544722400, # utc_end 1982-12-18 06:00:00 (Sat)
62265279600, # local_start 1974-02-08 23:00:00 (Fri)
62544700800, # local_end 1982-12-18 00:00:00 (Sat)
-21600,
0,
'CST',
],
[
62544722400, # utc_start 1982-12-18 06:00:00 (Sat)
62549557200, # utc_end 1983-02-12 05:00:00 (Sat)
62544704400, # local_start 1982-12-18 01:00:00 (Sat)
62549539200, # local_end 1983-02-12 00:00:00 (Sat)
-18000,
1,
'CDT',
],
[
62549557200, # utc_start 1983-02-12 05:00:00 (Sat)
DateTime::TimeZone::INFINITY, # utc_end
62549535600, # local_start 1983-02-11 23:00:00 (Fri)
DateTime::TimeZone::INFINITY, # local_end
-21600,
0,
'CST',
],
];
sub olson_version {'2021a'}
sub has_dst_changes {49}
sub _max_year {2031}
sub _new_instance {
return shift->_init( @_, spans => $spans );
}
1;
| 27.107181 | 89 | 0.638172 |
Subsets and Splits