hexsha
stringlengths
40
40
size
int64
3
1.05M
ext
stringclasses
163 values
lang
stringclasses
53 values
max_stars_repo_path
stringlengths
3
945
max_stars_repo_name
stringlengths
4
112
max_stars_repo_head_hexsha
stringlengths
40
78
max_stars_repo_licenses
listlengths
1
10
max_stars_count
float64
1
191k
max_stars_repo_stars_event_min_datetime
stringlengths
24
24
max_stars_repo_stars_event_max_datetime
stringlengths
24
24
max_issues_repo_path
stringlengths
3
945
max_issues_repo_name
stringlengths
4
113
max_issues_repo_head_hexsha
stringlengths
40
78
max_issues_repo_licenses
listlengths
1
10
max_issues_count
float64
1
116k
max_issues_repo_issues_event_min_datetime
stringlengths
24
24
max_issues_repo_issues_event_max_datetime
stringlengths
24
24
max_forks_repo_path
stringlengths
3
945
max_forks_repo_name
stringlengths
4
113
max_forks_repo_head_hexsha
stringlengths
40
78
max_forks_repo_licenses
listlengths
1
10
max_forks_count
float64
1
105k
max_forks_repo_forks_event_min_datetime
stringlengths
24
24
max_forks_repo_forks_event_max_datetime
stringlengths
24
24
content
stringlengths
3
1.05M
avg_line_length
float64
1
966k
max_line_length
int64
1
977k
alphanum_fraction
float64
0
1
ed2d735f27eb4cc5db0db6b4976dacd25afefaba
1,232
t
Perl
cgview_comparison_tool/lib/bioperl-1.2.3/t/MicrosatelliteMarker.t
kellyhuang21/CircularGenomeVizApp
4f241aded41258285c7b063cb9728fea459f6400
[ "MIT" ]
1
2021-04-27T18:17:33.000Z
2021-04-27T18:17:33.000Z
cgview_comparison_tool/lib/bioperl-1.2.3/t/MicrosatelliteMarker.t
kellyhuang21/CircularGenomeVizApp
4f241aded41258285c7b063cb9728fea459f6400
[ "MIT" ]
2
2020-06-20T15:59:50.000Z
2021-04-25T17:50:35.000Z
cgview_comparison_tool/lib/bioperl-1.2.3/t/MicrosatelliteMarker.t
kellyhuang21/CircularGenomeVizApp
4f241aded41258285c7b063cb9728fea459f6400
[ "MIT" ]
null
null
null
# -*-Perl-*- ## Bioperl Test Harness Script for Modules ## $Id: MicrosatelliteMarker.t,v 1.1 2002/02/11 09:31:34 heikki Exp $ # use strict; BEGIN { use vars qw($DEBUG); $DEBUG = $ENV{'BIOPERLDEBUG'}; # to handle systems with no installed Test module # we include the t dir (where a copy of Test.pm is located) # as a fallback eval { require Test; }; if( $@ ) { use lib 't'; } use Test; plan tests => 6; } END { } require 'dumpvar.pl'; use Bio::Map::SimpleMap; use Bio::Map::Position; use Bio::Map::Microsatellite; ok(1); my $map = new Bio::Map::SimpleMap(-units => 'MB', -type => 'oo-121'); my $position = new Bio::Map::Position(-map => $map, -value => 20 ); my $o_usat = new Bio::Map::Microsatellite (-name=>'Chad Super Marker 2', -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtgatttt', -motif => 'at', -repeats => 15, -repeat_start_position => 12, -position => $position, ); ok($o_usat->get_leading_flank(), "gctgactgatc"); ok($o_usat->get_trailing_flank(), "cgcgatcgtgatttt"); ok($o_usat->motif(), 'at'); ok($o_usat->repeats(), 15); ok($o_usat->repeat_start_position, 12); #dumpValue($o_usat);
22.814815
77
0.612013
ed12a251ab639633b5d6c7ed65c130a724612396
841
pm
Perl
lib/EpiRR/Model/Sample.pm
EMBL-EBI-GCA/EpiRR
e231f27b33a27ec15e37a75e61f36a4af7be9302
[ "Apache-2.0" ]
5
2018-02-27T22:29:48.000Z
2021-04-08T10:59:16.000Z
lib/EpiRR/Model/Sample.pm
Ensembl/EpiRR
e231f27b33a27ec15e37a75e61f36a4af7be9302
[ "Apache-2.0" ]
null
null
null
lib/EpiRR/Model/Sample.pm
Ensembl/EpiRR
e231f27b33a27ec15e37a75e61f36a4af7be9302
[ "Apache-2.0" ]
1
2016-08-25T16:49:08.000Z
2016-08-25T16:49:08.000Z
# Copyright 2013 European Molecular Biology Laboratory - European Bioinformatics Institute # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. package EpiRR::Model::Sample; use Moose; use namespace::autoclean; with 'EpiRR::Roles::HasMetaData'; has 'sample_id' => (is => 'rw', isa => 'Str'); __PACKAGE__->meta->make_immutable; 1;
36.565217
90
0.740785
ed8714afe74c75c0ff1808963face8603813cb7f
7,391
pm
Perl
framework/core/Coverage.pm
dericp/defects4j
252f7b0e259678dfd1074679c7974c6eb384ad02
[ "MIT" ]
null
null
null
framework/core/Coverage.pm
dericp/defects4j
252f7b0e259678dfd1074679c7974c6eb384ad02
[ "MIT" ]
null
null
null
framework/core/Coverage.pm
dericp/defects4j
252f7b0e259678dfd1074679c7974c6eb384ad02
[ "MIT" ]
null
null
null
#------------------------------------------------------------------------------- # Copyright (c) 2014-2015 René Just, Darioush Jalali, and Defects4J contributors. # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. #------------------------------------------------------------------------------- =pod =head1 NAME Coverage.pm -- helper subroutines for code coverage analysis. =head1 DESCRIPTION This module provides helper subroutines for code coverage analysis using Cobertura. =cut # TODO: Clean up this module and provide a ".ser" parser for Cobertura's coverage results. package Coverage; use warnings; use strict; use Constants; use Utils; use DB; # Cache column names for table coverage my @COLS = DB::get_tab_columns($TAB_COVERAGE) or die "Cannot obtain table columns!"; # Default paths my $SER_FILE = "cobertura.ser"; my $XML_FILE = "coverage.xml"; # Corbetura scripts my $CORBETURA_MERGE = "$SCRIPT_DIR/projects/lib/cobertura-merge.sh"; my $CORBETURA_REPORT = "$SCRIPT_DIR/projects/lib/cobertura-report.sh"; =pod =head2 Static subroutines Coverage::coverage(project_ref, instrument_classes, src_dir, log_file, relevant_tests, [single_test, [merge_with]]) Measures code coverage for a provided L<Project> reference. F<instrument_classes> is the name of a file that lists all the classes which should be instrumented. F<src_dir> provides the root directory of the source code, which is necessary to generate reports. The test results are written to F<log_file>, and the boolean parameter C<relevant_tests> indicates whether only relevant test cases are executed. If C<single_test> is specified, only that test is run. This is meant to be used in conjunction with C<merge_with>, which is the path to another .ser file obtained by running coverage. This enables incremental analyses. =cut sub coverage { @_ >= 5 or die $ARG_ERROR; my ($project, $instrument_classes, $src_dir, $log_file, $relevant_tests, $single_test, $merge_with) = @_; my $root = $project->{prog_root}; my $datafile = "$root/datafile"; my $xmlfile = "$root/$XML_FILE"; my $serfile = "$root/$SER_FILE"; # Remove stale data file system("rm -f $serfile"); # Instrument all classes provided $project->coverage_instrument($instrument_classes) or return undef; # Execute test suite if ($relevant_tests) { $project->run_relevant_tests($log_file) or return undef; } else { $project->run_tests($log_file, $single_test) or return undef; } # Generate coverage report my $result_xml; if (defined $merge_with) { print(STDERR "Merging & creating new report via shell script..\n"); # Remove stale data files system("rm -f $datafile") if -e $datafile; system("rm -f $xmlfile") if -e $xmlfile ; system("sh $CORBETURA_MERGE --datafile $datafile $merge_with $serfile >/dev/null 2>&1") == 0 or die "could not merge results"; system("sh $CORBETURA_REPORT --format xml --datafile $datafile --destination $root >/dev/null 2>&1") == 0 or die "could not create report"; } else { # Generate XML directly if merge is not needed. $project->coverage_report($src_dir) or die "Could not create coverage report"; } return _get_info_from_xml($xmlfile); } =pod Coverage::coverage_ext(project, instrument_classes, src_dir, test_dir, include_pattern, log_file) Determines code coverage for an external test suite. F<instrument_classes> is the name of a file that lists all the classes which should be instrumented. C<src_dir> provides the root directory of the source code, which is necessary to generate reports. =cut sub coverage_ext { @_ == 6 or die $ARG_ERROR; my ($project, $instrument_classes, $src_dir, $test_dir, $include, $log_file) = @_; # Instrument all classes provided $project->coverage_instrument($instrument_classes) or return undef; # Execute test suite $project->run_ext_tests($test_dir, $include, $log_file) or die "Could not run test suite"; # Generate coverage report $project->coverage_report($src_dir) or die "Could not create report"; # Parse xml output and return coverage ratios my $xmlfile = "$project->{prog_root}/$XML_FILE"; return _get_info_from_xml($xmlfile); } =pod Coverage::insert_row(hashref, [out_dir]) Insert a row into the database table L<TAB_COVERAGE|DB>. C<hashref> points to a hash holding all key-value pairs of the data row. F<out_dir> is the optional alternative database directory to use. =cut sub insert_row { my ($data, $out_dir) = @_; # Get proper output db handle: check whether a different output directory is provided my $dbh; if (defined $out_dir) { $dbh = DB::get_db_handle($TAB_COVERAGE, $out_dir); } else { $dbh = DB::get_db_handle($TAB_COVERAGE); } my @tmp; foreach (@COLS) { push (@tmp, $dbh->quote((defined $data->{$_} ? $data->{$_} : "-"))); } my $row = join(",", @tmp); $dbh->do("INSERT INTO $TAB_COVERAGE VALUES ($row)"); } =pod Coverage::copy_coverage_logs(project, vid, suite, test_id, log_dir) Copies the coverage log files to a permanent directory F<log_dir>. C<project> is the reference to a L<Project>, C<vid> is the version id, C<suite> specifies the suite tag (e.g., manual, randoop, evosuite-branch), and C<test_id> provides the id of the test suite. =cut sub copy_coverage_logs { my ($project, $vid, $suite, $test_id, $log_dir) = @_; # Copy coverage log files to log directory system("cp $project->{prog_root}/$SER_FILE $log_dir/$suite/$vid.$test_id.ser") == 0 or die "Cannot copy .ser file"; system("cp $project->{prog_root}/$XML_FILE $log_dir/$suite/$vid.$test_id.xml") == 0 or die "Cannot copy .xml file"; } # # Parse coverage log file and return reference to a hash that holds all results # sub _get_info_from_xml { my ($xml, ) = @_; my ($lt, $lc, $bt, $bc); -e $xml or die "Result xml file does not exist: $xml!"; # Parse XML file open FH, $xml; while (<FH>) { if (/lines-covered="(\d+)" lines-valid="(\d+)" branches-covered="(\d+)" branches-valid="(\d+)"/) { ($lc, $lt, $bc, $bt) = ($1, $2, $3, $4); } } close FH; die "values not set" unless defined $lt; # Set all values and return hash reference return { $LINES_TOTAL => $lt, $LINES_COVERED => $lc, $BRANCHES_TOTAL => $bt, $BRANCHES_COVERED => $bc, }; } 1;
33.292793
141
0.690976
ed8aef90d54ae2617ade9b11240412a8b520c359
7,262
pm
Perl
apps/cisco/ssms/restapi/mode/licenses.pm
centreon-lab/centreon-plugins
68096c697a9e1baf89a712674a193d9a9321503c
[ "Apache-2.0" ]
null
null
null
apps/cisco/ssms/restapi/mode/licenses.pm
centreon-lab/centreon-plugins
68096c697a9e1baf89a712674a193d9a9321503c
[ "Apache-2.0" ]
null
null
null
apps/cisco/ssms/restapi/mode/licenses.pm
centreon-lab/centreon-plugins
68096c697a9e1baf89a712674a193d9a9321503c
[ "Apache-2.0" ]
null
null
null
# # Copyright 2022 Centreon (http://www.centreon.com/) # # Centreon is a full-fledged industry-strength solution that meets # the needs in IT infrastructure and application monitoring for # service performance. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # package apps::cisco::ssms::restapi::mode::licenses; use base qw(centreon::plugins::templates::counter); use strict; use warnings; use centreon::plugins::templates::catalog_functions qw(catalog_status_threshold_ng); sub custom_status_output { my ($self, %options) = @_; return sprintf( "status: '%s'", $self->{result_values}->{status} ); } sub custom_license_output { my ($self, %options) = @_; return sprintf( "usage total: %s used: %s (%.2f%%) free: %s (%.2f%%)", $self->{result_values}->{total}, $self->{result_values}->{used}, $self->{result_values}->{prct_used}, $self->{result_values}->{free}, $self->{result_values}->{prct_free} ); } sub account_long_output { my ($self, %options) = @_; return "checking account '" . $options{instance_value}->{display} . "'"; } sub prefix_account_output { my ($self, %options) = @_; return "account '" . $options{instance_value}->{display} . "' "; } sub prefix_license_output { my ($self, %options) = @_; return "license '" . $options{instance_value}->{display} . "' "; } sub set_counters { my ($self, %options) = @_; $self->{maps_counters_type} = [ { name => 'accounts', type => 3, cb_prefix_output => 'prefix_account_output', cb_long_output => 'account_long_output', indent_long_output => ' ', message_multiple => 'All accounts are ok', group => [ { name => 'licenses', display_long => 1, cb_prefix_output => 'prefix_license_output', message_multiple => 'licenses are ok', type => 1, skipped_code => { -10 => 1 } } ] } ]; $self->{maps_counters}->{licenses} = [ { label => 'license-status', type => 2, critical_default => '%{status} !~ /in compliance/i', set => { key_values => [ { name => 'status' }, { name => 'display' } ], closure_custom_output => $self->can('custom_status_output'), closure_custom_perfdata => sub { return 0; }, closure_custom_threshold_check => \&catalog_status_threshold_ng } }, { label => 'usage', nlabel => 'licenses.usage.count', set => { key_values => [ { name => 'used' }, { name => 'free' }, { name => 'prct_used' }, { name => 'prct_free' }, { name => 'total' } ], closure_custom_output => $self->can('custom_license_output'), perfdatas => [ { template => '%d', min => 0, max => 'total', label_extra_instance => 1 } ] } }, { label => 'usage-free', display_ok => 0, nlabel => 'licenses.free.count', set => { key_values => [ { name => 'free' }, { name => 'used' }, { name => 'prct_used' }, { name => 'prct_free' }, { name => 'total' } ], closure_custom_output => $self->can('custom_license_output'), perfdatas => [ { template => '%d', min => 0, max => 'total', label_extra_instance => 1 } ] } }, { label => 'usage-prct', display_ok => 0, nlabel => 'licenses.usage.percentage', set => { key_values => [ { name => 'prct_used' }, { name => 'used' }, { name => 'free' }, { name => 'prct_free' }, { name => 'total' } ], closure_custom_output => $self->can('custom_license_output'), perfdatas => [ { template => '%d', min => 0, max => 'total', label_extra_instance => 1 } ] } } ]; } sub new { my ($class, %options) = @_; my $self = $class->SUPER::new(package => __PACKAGE__, %options, force_new_perfdata => 1); bless $self, $class; $options{options}->add_options(arguments => { 'account:s@' => { name => 'account' }, 'filter-license-name:s' => { name => 'filter_license_name' } }); return $self; } sub check_options { my ($self, %options) = @_; $self->SUPER::check_options(%options); $self->{account_names} = []; if (defined($self->{option_results}->{account})) { foreach my $account (@{$self->{option_results}->{account}}) { push @{$self->{account_names}}, $account if ($account ne ''); } } if (scalar(@{$self->{account_names}}) <= 0) { $self->{output}->add_option_msg(short_msg => 'need to specify --account option.'); $self->{output}->option_exit(); } } sub manage_selection { my ($self, %options) = @_; $self->{accounts} = {}; foreach my $account (@{$self->{account_names}}) { my $results = $options{custom}->get_licenses( account => $account ); next if (!defined($results->{licenses})); $self->{accounts}->{$account} = { display => $account, licenses => {} }; foreach (@{$results->{licenses}}) { next if (defined($self->{option_results}->{filter_license_name}) && $self->{option_results}->{filter_license_name} ne '' && $_->{license} !~ /$self->{option_results}->{filter_license_name}/); $self->{accounts}->{$account}->{licenses}->{ $_->{license} } = { display => $_->{license}, status => $_->{status}, used => $_->{inUse}, free => $_->{available}, total => $_->{quantity}, prct_used => $_->{quantity} > 0 ? ($_->{inUse} * 100 / $_->{quantity}) : undef, prct_free => $_->{quantity} > 0 ? ($_->{available} * 100 / $_->{quantity}) : undef }; } } } 1; __END__ =head1 MODE Check licenses. =over 8 =item B<--filter-counters> Only display some counters (regexp can be used). Example: --filter-counters='status' =item B<--account> Check account name (Required. Multiple option). =item B<--filter-license-name> Filter license name (can be a regexp). =item B<--unknown-license-status> Set unknown threshold for status. Can used special variables like: %{status}, %{display} =item B<--warning-license-status> Set warning threshold for status. Can used special variables like: %{status}, %{display} =item B<--critical-license-status> Set critical threshold for status (Default: '%{status} !~ /in compliance/i'). Can used special variables like: %{status}, %{display} =item B<--warning-*> B<--critical-*> Thresholds. Can be: 'usage' (B), 'usage-free' (B), 'usage-prct' (%). =back =cut
32.711712
199
0.56293
ed42a3e1bd3351504bcf3d266d7c0e7753f28aff
645
pl
Perl
src/main/resources/project/collaborator_management.pl
electric-cloud-community/EC-Heroku
9b7db03f76df63a5523514cd7a2aecdbfc3288c9
[ "Apache-2.0" ]
null
null
null
src/main/resources/project/collaborator_management.pl
electric-cloud-community/EC-Heroku
9b7db03f76df63a5523514cd7a2aecdbfc3288c9
[ "Apache-2.0" ]
null
null
null
src/main/resources/project/collaborator_management.pl
electric-cloud-community/EC-Heroku
9b7db03f76df63a5523514cd7a2aecdbfc3288c9
[ "Apache-2.0" ]
null
null
null
use ElectricCommander; my $ec = new ElectricCommander(); my $code = $ec->getProperty("/myProject/Heroku")->findvalue("//value")->value(); eval($code) or die("Error loading Heroku library code: $@\n"); my $ConfigName = ($ec->getProperty("ConfigName"))->findvalue('//value')->string_value; my $Action = ($ec->getProperty("Action"))->findvalue('//value')->string_value; my $AppName = ($ec->getProperty("AppName"))->findvalue('//value')->string_value; my $EmailAccount = ($ec->getProperty("EmailAccount"))->findvalue('//value')->string_value; plugin_info(); collaborator_management($ConfigName, $Action, $AppName, $EmailAccount);
43
90
0.686822
ed88b07a926be87edd9091ece332dca833de4dd6
9,083
t
Perl
t/15-request.t
killerfish/duckduckgo
173f91a9a0b3834d2eee48a0bf0e29492040f63b
[ "Apache-2.0" ]
2
2019-05-23T20:37:06.000Z
2019-05-24T14:10:56.000Z
t/15-request.t
killerfish/duckduckgo
173f91a9a0b3834d2eee48a0bf0e29492040f63b
[ "Apache-2.0" ]
null
null
null
t/15-request.t
killerfish/duckduckgo
173f91a9a0b3834d2eee48a0bf0e29492040f63b
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env perl use strict; use warnings; use Test::More; use utf8; use DDG::Request; BEGIN { my @t = ( '' => { query_raw => '', query => '', query_lc => '', query_nowhitespace => '', query_nowhitespace_nodash => '', query_clean => '', wordcount => 0, query_raw_parts => [], query_parts => [], words => [], triggers => {}, }, ' !bang test' => { query_raw => ' !bang test', query => '!bang test', query_lc => '!bang test', query_nowhitespace => '!bangtest', query_nowhitespace_nodash => '!bangtest', query_clean => 'bang test', wordcount => 2, query_raw_parts => ['',' ','!bang',' ','test'], query_parts => [qw( !bang test )], words => [qw( bang test )], triggers => { 2 => [qw( !bang bang )], 4 => [qw( test )], }, }, '!bang test-test' => { query_raw => '!bang test-test', query => '!bang test-test', query_lc => '!bang test-test', query_nowhitespace => '!bangtest-test', query_nowhitespace_nodash => '!bangtesttest', query_clean => 'bang testtest', wordcount => 2, query_raw_parts => ['!bang',' ','test-test'], query_parts => [qw( !bang test-test )], words => [qw( bang test-test )], triggers => { 0 => [qw( !bang bang )], 2 => ["test", "test test", "test-test", "testtest"], }, }, 'other !bang test' => { query_raw => 'other !bang test', query => 'other !bang test', query_lc => 'other !bang test', query_nowhitespace => 'other!bangtest', query_nowhitespace_nodash => 'other!bangtest', query_clean => 'other bang test', wordcount => 3, query_raw_parts => ['other',' ','!bang',' ','test'], query_parts => [qw( other !bang test )], words => [qw( other bang test )], triggers => { 0 => [qw( other )], 2 => [qw( !bang bang )], 4 => [qw( test )], }, }, '%"test %)()%!%§ +##+tesfsd' => { query_raw => '%"test %)()%!%§ +##+tesfsd', query => '%"test %)()%!%§ +##+tesfsd', query_lc => '%"test %)()%!%§ +##+tesfsd', query_nowhitespace => '%"test%)()%!%§+##+tesfsd', query_nowhitespace_nodash => '%"test%)()%!%§+##+tesfsd', query_clean => 'test tesfsd', wordcount => 2, query_parts => ['%"test',qq{%\)\(\)%!%§},'+##+tesfsd'], words => [qw( test tesfsd )], triggers => { 0 => ['', ' test', '%"test', 'test'], 2 => ['', '%)()%!%§'], 4 => ['', ' tesfsd', '+##+tesfsd', 'tesfsd' ], }, }, 'test...test test...Test?' => { query_raw => 'test...test test...Test?', query => 'test...test test...Test?', query_lc => 'test...test test...test?', query_nowhitespace => 'test...testtest...Test?', query_nowhitespace_nodash => 'test...testtest...Test?', query_clean => 'testtest testtest', wordcount => 2, query_parts => [qw( test...test test...Test? )], words => [qw( test test test Test )], }, ' %%test %%%%% %%%TeSFsd%%% ' => { query_raw => ' %%test %%%%% %%%TeSFsd%%% ', query => '%%test %%%%% %%%TeSFsd%%%', query_lc => '%%test %%%%% %%%tesfsd%%%', query_nowhitespace => '%%test%%%%%%%%TeSFsd%%%', query_nowhitespace_nodash => '%%test%%%%%%%%TeSFsd%%%', query_clean => 'test tesfsd', wordcount => 2, query_parts => [qw( %%test %%%%% %%%TeSFsd%%% )], words => [qw( test tesfsd )], }, 'reverse bla' => { query_raw => 'reverse bla', query => 'reverse bla', query_lc => 'reverse bla', query_nowhitespace => 'reversebla', query_nowhitespace_nodash => 'reversebla', query_clean => 'reverse bla', wordcount => 2, query_parts => [qw( reverse bla )], words => [qw( reverse bla )], }, ' !reverse bla ' => { query_raw => ' !reverse bla ', query => '!reverse bla', query_lc => '!reverse bla', query_nowhitespace => '!reversebla', query_nowhitespace_nodash => '!reversebla', query_clean => 'reverse bla', wordcount => 2, query_parts => [qw( !reverse bla )], query_raw_parts => ['',' ','!reverse',' ','bla',' '], words => [qw( reverse bla )], }, ' !REVerse BLA ' => { query_raw => ' !REVerse BLA ', query => '!REVerse BLA', query_lc => '!reverse bla', query_nowhitespace => '!REVerseBLA', query_nowhitespace_nodash => '!REVerseBLA', query_clean => 'reverse bla', wordcount => 2, query_parts => [qw( !REVerse BLA )], words => [qw( reverse bla )], }, 'a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789' => { query_raw => 'a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789', query => 'a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789', query_lc => 'a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789abcdefghijklmnopqrstuvwxyz0123456789', query_nowhitespace => 'areallyveryveryveryveryverylongquery0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789', query_nowhitespace_nodash => 'areallyveryveryveryveryverylongquery0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789', query_clean => 'a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789abcdefghijklmnopqrstuvwxyz0123456789', wordcount => 10, query_raw_parts => [ 'a', ' ', 'really', ' ', 'very', ' ', 'very', ' ', 'very', ' ', 'very', ' ', 'very', ' ', 'long', ' ', 'query', ' ', '0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789' ], query_parts => [qw( a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789)], words => [qw( a really very very very very very long query 0123456789abcdefghijklmnopqrstuvwxyz0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZ0123456789)], triggers => { 0 => ["a"], 2 => ["really"], 4 => ["very"], 6 => ["very"], 8 => ["very"], 10 => ["very"], 12 => ["very"], 14 => ["long"], 16 => ["query"], 18 => ["0123456789abcdefghijklmnopqrstuvwxyz0123456789abcdefghijklmnopqrstuvwxyz0123456789"], } }, ); while (@t) { my $query = shift @t; my %result = %{shift @t}; my %args; %args = $result{args} if defined $result{args}; my $req = DDG::Request->new({ query_raw => $query, %args }); isa_ok($req,'DDG::Request'); is($req->query_raw,$query,'Testing query_raw of "'.$query.'"'); for (qw/ query_raw query query_lc query_nowhitespace query_nowhitespace_nodash query_clean wordcount /) { is($req->$_,$result{$_},'Testing '.$_.' of "'.$query.'"') if defined $result{$_}; } for (qw/ query_parts query_raw_parts /) { is_deeply($req->$_,$result{$_},'Testing '.$_.' of "'.$query.'"') if defined $result{$_}; } for (qw/ combined_lc_words_2 /) { my $result_key = $_; my ( $param ) = $_ =~ m/_(\w)+$/; is_deeply($req->combined_lc_words($param),$result{$result_key},'Testing '.$result_key.' of "'.$query.'"') if defined $result{$result_key}; } if (defined $result{triggers}) { is_deeply($req->triggers,$result{triggers},'Test trigger of "'.$query.'"'); } } } done_testing;
45.189055
167
0.479577
ed0efc938622dc06672700ab343fae62a3531d95
3,108
pm
Perl
lib/Crypt/PKCS11/Attribute/AttributeArray.pm
dotse/p5-Crypt-PKCS11
19398fb1a11bf818370334b5ffee7708f97288cf
[ "BSD-2-Clause" ]
2
2015-01-22T15:49:00.000Z
2015-09-01T07:48:23.000Z
lib/Crypt/PKCS11/Attribute/AttributeArray.pm
jelu/p5-Crypt-PKCS11
19398fb1a11bf818370334b5ffee7708f97288cf
[ "BSD-2-Clause" ]
4
2016-06-21T08:53:49.000Z
2019-09-09T18:00:11.000Z
lib/Crypt/PKCS11/Attribute/AttributeArray.pm
jelu/p5-Crypt-PKCS11
19398fb1a11bf818370334b5ffee7708f97288cf
[ "BSD-2-Clause" ]
2
2015-01-22T15:13:11.000Z
2015-01-27T08:31:38.000Z
# Copyright (c) 2015-2016 Jerry Lundström <lundstrom.jerry@gmail.com> # Copyright (c) 2016 make install AB # Copyright (c) 2015 .SE (The Internet Infrastructure Foundation) # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions # are met: # 1. Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # 2. Redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. package Crypt::PKCS11::Attribute::AttributeArray; use common::sense; use Carp; use Scalar::Util qw(blessed); use base qw(Crypt::PKCS11::Attribute); sub push { my ($self) = CORE::shift; CORE::foreach (@_) { unless (blessed($_) and $_->isa('Crypt::PKCS11::Attribute')) { confess 'Value to push is not a Crypt::PKCS11::Attribute object'; } } CORE::push(@{$self->{attributes}}, @_); return $self; } sub pop { return CORE::pop(@{$_[0]->{attributes}}); } sub shift { return CORE::shift(@{$_[0]->{attributes}}); } sub unshift { my ($self) = CORE::shift; CORE::foreach (@_) { unless (blessed($_) and $_->isa('Crypt::PKCS11::Attribute')) { confess 'Value to unshift is not a Crypt::PKCS11::Attribute object'; } } CORE::unshift(@{$self->{attributes}}, @_); return $self; } sub foreach { my ($self, $cb) = @_; unless (ref($cb) eq 'CODE') { confess '$cb argument is not CODE'; } CORE::foreach (@{$self->{attributes}}) { $cb->($_); } return $self; } sub toArray { my ($self) = @_; my @array; CORE::foreach (@{$self->{attributes}}) { CORE::push(@array, { type => $_->type, pValue => $_->pValue }); } return \@array; } sub set { my $self = CORE::shift; foreach (@_) { unless (blessed($_) and $_->isa('Crypt::PKCS11::Attribute')) { confess 'Value to set is not a Crypt::PKCS11::Attribute object'; } } $self->{attributes} = [ @_ ]; return $self; } sub pValue { return $_[0]->toArray; } 1; __END__
27.263158
80
0.655084
ed5e6b5efe12532b06598641130bb9d18ba6667b
426
t
Perl
perl/src/ext/IO-Compress/t/108anyunc-deflate.t
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
2,293
2015-01-02T12:46:10.000Z
2022-03-29T09:45:43.000Z
perl/src/ext/IO-Compress/t/108anyunc-deflate.t
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
315
2015-05-31T11:55:46.000Z
2022-01-12T08:36:37.000Z
perl/src/ext/IO-Compress/t/108anyunc-deflate.t
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
1,033
2015-01-04T07:48:40.000Z
2022-03-24T09:34:37.000Z
BEGIN { if ($ENV{PERL_CORE}) { chdir 't' if -d 't'; @INC = ("../lib", "lib/compress"); } } use lib qw(t t/compress); use strict; use warnings; use IO::Uncompress::AnyUncompress qw($AnyUncompressError) ; use IO::Compress::Deflate qw($DeflateError) ; use IO::Uncompress::Inflate qw($InflateError) ; sub getClass { 'AnyUncompress'; } sub identify { 'IO::Compress::Deflate'; } require "any.pl" ; run();
14.2
59
0.631455
ed843f3342a652bf90c2d1c65b072bb203071b7e
2,500
pm
Perl
lib/HTML/Mason/Component/Subcomponent.pm
rentrak/HTML-Mason
fe5b918ecea137768de750b0d24703ec06d66e09
[ "Artistic-1.0-cl8" ]
null
null
null
lib/HTML/Mason/Component/Subcomponent.pm
rentrak/HTML-Mason
fe5b918ecea137768de750b0d24703ec06d66e09
[ "Artistic-1.0-cl8" ]
null
null
null
lib/HTML/Mason/Component/Subcomponent.pm
rentrak/HTML-Mason
fe5b918ecea137768de750b0d24703ec06d66e09
[ "Artistic-1.0-cl8" ]
null
null
null
# Copyright (c) 1998-2005 by Jonathan Swartz. All rights reserved. # This program is free software; you can redistribute it and/or modify # it under the same terms as Perl itself. package HTML::Mason::Component::Subcomponent; use strict; use warnings; use HTML::Mason::Component; use vars qw(@ISA); @ISA = qw(HTML::Mason::Component); use HTML::Mason::MethodMaker ( read_only => [ qw( comp_id is_method name owner path ) ] ); # # Assign parent, name, and is_method flag when owner component is created. # sub assign_subcomponent_properties { my $self = shift; ($self->{owner}, $self->{name}, $self->{is_method}) = @_; } # # Override path that would be set by parent's version of method. # sub assign_runtime_properties { my ($self, $interp, $source) = @_; $self->SUPER::assign_runtime_properties($interp, $source); $self->{comp_id} = sprintf("[%s '%s' of %s]", $self->{is_method} ? 'method' : 'subcomponent', $self->name, $self->owner->comp_id); $self->{path} = $self->owner->path . ":" . $self->name; } sub cache_file { return $_[0]->owner->cache_file } sub load_time { return $_[0]->owner->load_time } sub compiler_id { return $_[0]->owner->compilation_params } sub dir_path { return $_[0]->owner->dir_path } sub is_subcomp { 1 } sub object_file { return $_[0]->owner->object_file } sub parent { return $_[0]->owner->parent } sub persistent { return $_[0]->owner->persistent } sub title { return $_[0]->owner->title . ":" . $_[0]->name } 1; __END__ =head1 NAME HTML::Mason::Component::Subcomponent - Mason Subcomponent Class =head1 DESCRIPTION This is a subclass of L<HTML::Mason::Component|HTML::Mason::Component>. Mason uses it to implement both subcomponents (defined by C<< <%def> >>) and methods (defined by C<< <%method> >>). A subcomponent/method gets most of its properties from its owner. Note that the link from the subcomponent to its owner is a weak reference (to prevent circular references), so if you grab a subcomponent/method object, you should also grab and hold a reference to its owner. If the owner goes out of scope, the subcomponent/method object will become unusable. =head1 METHODS =over 4 =item is_method Returns 1 if this is a method (declared by C<< <%method> >>), 0 if it is a subcomponent (defined by c<< <%def> >>). =item owner Returns the component object within which this subcomponent or method was defined. =back =head1 SEE ALSO L<HTML::Mason::Component|HTML::Mason::Component> =cut
28.089888
97
0.6952
ed8e7fcc493e4dfc8e8c4dd381758eb83deba3de
3,942
t
Perl
modules/t/syntenyRegion.t
manuelcarbajo/ensembl-compara
0ffe653215a20e6921c5f4983ea9e4755593a491
[ "Apache-2.0" ]
null
null
null
modules/t/syntenyRegion.t
manuelcarbajo/ensembl-compara
0ffe653215a20e6921c5f4983ea9e4755593a491
[ "Apache-2.0" ]
null
null
null
modules/t/syntenyRegion.t
manuelcarbajo/ensembl-compara
0ffe653215a20e6921c5f4983ea9e4755593a491
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env perl # Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute # Copyright [2016-2020] EMBL-European Bioinformatics Institute # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. use strict; use warnings; use Test::More; use Test::Exception; use Bio::EnsEMBL::Utils::Exception qw (warning verbose); use Bio::EnsEMBL::Test::MultiTestDB; use Bio::EnsEMBL::Test::TestUtils; use Bio::EnsEMBL::Compara::SyntenyRegion; my $multi = Bio::EnsEMBL::Test::MultiTestDB->new( "multi" ); my $compara_db_adaptor = $multi->get_DBAdaptor( "compara" ); my $synteny_region_adaptor = $compara_db_adaptor->get_SyntenyRegionAdaptor(); my $dnafrag_region_adaptor = $compara_db_adaptor->get_DnaFragRegionAdaptor(); my $sth = $compara_db_adaptor->dbc->prepare("SELECT synteny_region_id, method_link_species_set_id FROM synteny_region LIMIT 1"); $sth->execute(); my ($synteny_region_id, $method_link_species_set_id) = $sth->fetchrow_array(); $sth->finish(); # # 1 # subtest "Test Bio::EnsEMBL::Compara::SytenyRegion new(void) method", sub { my $synteny_region = new Bio::EnsEMBL::Compara::SyntenyRegion(); isa_ok($synteny_region, "Bio::EnsEMBL::Compara::SyntenyRegion", "check object"); done_testing(); }; subtest "Test Bio::EnsEMBL::Compara::SyntenyRegion new(ALL) method", sub { my $synteny_region = new Bio::EnsEMBL::Compara::SyntenyRegion(-adaptor => $synteny_region_adaptor, -dbID => $synteny_region_id, -method_link_species_set_id => $method_link_species_set_id); isa_ok($synteny_region, "Bio::EnsEMBL::Compara::SyntenyRegion", "check object"); is($synteny_region->adaptor, $synteny_region_adaptor, "adaptor"); is($synteny_region->dbID, $synteny_region_id, "synteny_region_id"); is($synteny_region->method_link_species_set_id, $method_link_species_set_id, "method_link_species_set_id"); done_testing(); }; subtest "Test getter/setter Bio::EnsEMBL::Compara::SyntenyRegion methods", sub { my $synteny_region = new Bio::EnsEMBL::Compara::SyntenyRegion(); ok(test_getter_setter($synteny_region, "adaptor", $synteny_region_adaptor)); ok(test_getter_setter($synteny_region, "dbID", $synteny_region_id)); ok(test_getter_setter($synteny_region, "method_link_species_set_id", $method_link_species_set_id)); my $regions = $dnafrag_region_adaptor->fetch_all_by_synteny_region_id($synteny_region_id); ok(test_getter_setter($synteny_region, "_regions", $regions)); done_testing(); }; subtest "Test Bio::EnsEMBL::Compara::SyntenyRegion::get_all_DnaFragRegions method", sub { my $regions = $dnafrag_region_adaptor->fetch_all_by_synteny_region_id($synteny_region_id); my $synteny_region = new Bio::EnsEMBL::Compara::SyntenyRegion(-adaptor => $synteny_region_adaptor, -dbID => $synteny_region_id, -regions => $regions); my $dnafrag_regions = $synteny_region->get_all_DnaFragRegions(); foreach my $dnafrag_region (@$dnafrag_regions) { foreach my $region (@$regions) { if ($dnafrag_region->dnafrag_id == $region->dnafrag_id) { is_deeply($dnafrag_region, $region); } } } done_testing(); }; done_testing();
40.22449
128
0.693303
ed7594696e7c3240a1bf534be089f8149d2fe632
2,669
pl
Perl
protein/protein_batch_compute_pI.pl
shenwei356/bio_scripts
703cec8d21903516346e2aae4d77d23385c30905
[ "MIT" ]
94
2015-03-26T04:32:29.000Z
2022-03-22T13:44:11.000Z
protein/protein_batch_compute_pI.pl
xinwang-bio/bio_scripts
64fda3a72ba14edf87952a809c3d52871f155cca
[ "MIT" ]
null
null
null
protein/protein_batch_compute_pI.pl
xinwang-bio/bio_scripts
64fda3a72ba14edf87952a809c3d52871f155cca
[ "MIT" ]
70
2015-04-01T10:27:05.000Z
2021-11-08T01:46:39.000Z
#!/usr/bin/env perl # Function: Batch compute pI (isoelectric point) and Mw (molecular weight) # via submiting sequences to Compute pI/Mw tool at ExPASy. # Author : Wei Shen <shenwei356#gmail.com> http://shenwei.me # Date : 2013-10-16 # Update : 2014-07-29 use strict; use BioUtil::Seq; my $usage = <<"USAGE"; Function: Batch compute pI (isoelectric point) and Mw (molecular weight) via submiting sequences to Compute pI/Mw tool at ExPASy Contact: Wei Shen <shenwei356#gmail.com> Usage: $0 amino_acid_fasta_file USAGE die $usage unless @ARGV == 1; my $aa_file = shift @ARGV; # initialize fasta file parser my $next_seq = FastaReader($aa_file); # initialize pI request my $PI = &compute_pi(); my ( $head, $seq ); my ( $success, $pi, $mw ); my $out_file = "$aa_file.result.txt"; open OUT, ">", $out_file or die "fail to write file $out_file\n"; while ( my $fa = &$next_seq() ) { my ( $header, $seq ) = @$fa; ( $success, $pi, $mw ) = &$PI($seq); unless ($success) { print "$pi. Please check whether the amino acid sequence contains illegal characters.\r\n" ; # here $pi is the status_line of response next; } print "$header\t$pi\t$mw\r\n"; print OUT "$header\t$pi\t$mw\r\n"; } close OUT; # Compute pI/Mw via submiting sequence to Compute pI/Mw tool at ExPASy. # # See more: http://web.expasy.org/compute_pi/ # # Example: # # my @proteins = qw/AYYAYYAYAYAY ACACAGACG ---/; # my $PI = &compute_pi(); # my ( $success, $pi, $mw ); # for my $protein (@proteins) { # ( $success, $pi, $mw ) = &$PI($protein, "average"); # # ( $success, $pi, $mw ) = &$PI($protein, "monoisotopic"); # unless ($success) { # print "$pi\n"; # here $pi is the status_line of response # next; # } # print "($pi, $mw)\n"; # } sub compute_pi() { use LWP::UserAgent; my $ua = LWP::UserAgent->new; my $url = "http://web.expasy.org/cgi-bin/compute_pi/pi_tool"; my ( $res, $formdata, $result ); return sub($$) { my ( $protein, $resolution ) = @_; $resolution = "average" unless defined $resolution; # or monoisotopic $formdata = [ protein => $protein, resolution => $resolution, file => "" ]; $res = $ua->post( $url, $formdata ); # 0 means failed return ( 0, $res->status_line ) unless $res->is_success; $result = $res->content; $result =~ /Theoretical pI\/Mw: ([\d\.]+)\s\/\s([\d\.]+)/; # 1 means success return ( 1, $1, $2 ); } }
26.959596
96
0.56051
ed4ba88b8dac212528cf4e682d7bf1372f77398f
1,914
t
Perl
t/04-possible.t
vrurg/p6-Game-Sudoku
fbc1768eea68c09f0cf554d3a0a962ec87ee713a
[ "Artistic-2.0" ]
null
null
null
t/04-possible.t
vrurg/p6-Game-Sudoku
fbc1768eea68c09f0cf554d3a0a962ec87ee713a
[ "Artistic-2.0" ]
1
2019-10-03T19:34:13.000Z
2019-10-03T19:34:13.000Z
t/04-possible.t
vrurg/p6-Game-Sudoku
fbc1768eea68c09f0cf554d3a0a962ec87ee713a
[ "Artistic-2.0" ]
1
2019-10-03T19:03:19.000Z
2019-10-03T19:03:19.000Z
use v6.c; use Test; use Game::Sudoku; my $game = Game::Sudoku.new(); is $game.Str,( "0" x 81 ), "Nothing to see here"; is $game.possible(0,0).sort,(1...9),"Everything is possible"; is $game.cell(0,0,1).Str,"1" ~ ( "0" x 80 ), "Setting returns the updated object"; is $game.cell(0,0),1,"Can also get a cells current value"; is $game.cell(0,1),Nil,"Requesting an unset cell returns Nil"; is $game.possible(0,0).sort,(),"We have no options"; is $game.possible(0,1).sort,(2...9),"We have options"; is $game.possible(0,1).WHAT,Seq,"We have a sequence"; is $game.possible(0,1,:set).WHAT,Set,"We have a set"; is $game.possible(0,0).WHAT,List,"We have a list when there's no options"; is $game.possible(0,0,:set).WHAT,Set,"We have a set"; is $game.valid, True, "Game state is valid"; is $game.cell(0,0,2).Str,"2" ~ ( "0" x 80 ), "Now we have a cell"; is $game.possible(0,0).sort,(),"We have no options"; is $game.possible(0,1).sort,(1,3,4,5,6,7,8,9),"We have options"; is $game.valid, True, "Game state is valid"; is $game.cell(1,0,2).Str,"22" ~ ( 0 x 79 ), "Still getting games"; is $game.valid, False, "Game state is invalid as we have 2 2's"; my $code = "003020600900305001001806400008102900700000008006708200002609500800203009005010300", $game = Game::Sudoku.new( :code($code) ); is $game.Str, $code, "Game as expected"; is $game.cell(2,0,5).Str, $code, "Can't modify initial values"; is $game.possible(5,0),(1,4,7),"Got expected possibilites"; while [+] (^9 X ^9).map( -> ($x,$y) { ($x,$y) => $game.possible($x,$y) } ).grep( *.value.elems == 1 ).map( -> $p { my ( $x, $y ) = $p.key; $game.cell($x,$y,$p.value[0]); 1; } ) { ok $game.valid, "Game is valid" } ok $game.complete, "Game is complete"; ok $game.valid, "Game is valid"; ok $game.full, "Game is full"; is $game.Str, "483921657967345821251876493548132976729564138136798245372689514814253769695417382", "Got expected solution"; done-testing;
44.511628
178
0.655695
ed3c02a6eefe73e50ab8ad7b38c301e869341bfc
13,243
pl
Perl
regular-expressions-for-asd-reviews.pl
djireland/ASDReviews
74d834530f11a3b130fca0e66207e16d1d578246
[ "MIT" ]
null
null
null
regular-expressions-for-asd-reviews.pl
djireland/ASDReviews
74d834530f11a3b130fca0e66207e16d1d578246
[ "MIT" ]
null
null
null
regular-expressions-for-asd-reviews.pl
djireland/ASDReviews
74d834530f11a3b130fca0e66207e16d1d578246
[ "MIT" ]
null
null
null
#!/usr/bin/env perl use strict; use DBI; use Lingua::Sentence; use Lingua::EN::Tagger qw(add_tags); use HTML::Restrict; use Data::Dumper; use constant ASD => "(asd|aspergers|aspie|autie|autistic|autism|on the spectrum)"; use constant HELPS => "(gets (so)? much out of it|helps|helped|assists|enables|engages)"; use constant LIKES => "(obesse(s|ed)|like(s|ed)|love(s|d)|interest(ed|s)|appeal(s|ing))"; use constant RELATIONSHIP => "(boy|girl|[0-9] *yearold|toddler|twins|[0-9] *yr|caregiver|kid|preschooler|school|" . "year old|[0-9] *y.o.|[0-9 ] *yo|my little one|I(m| am| have| suffer)|famil(ies|y)|" . "child|children|(god|grand)(son|daughter)|teen|adult|cuz|cousin|bro|brother|sis|" . "sister|son|daughter|niece|nephew|brother|sister|mother|father|student|classroom)"; use constant EVIDENCE_BASED => "(evidence( |-)based)|(research( |-)based)|developed|consulted|professional|pathologist|therapist"; # Specific ASD Information use constant FEEDBACK => "(feedback|results|graph|answers|response)"; use constant MOTIVATION => "(encourages|helps|incentive)"; use constant CUSTOM => "(customi(s|z)ation|custom|changing|adapting|personali(s|z)ation|personali(s|z)e)"; use constant INDEPENDENCE => "(by (him|her)self|on (his|her) own|independent|independence|victory|triumph)"; use constant TRIAL => "(part of a clinical trial)"; # Helps With -------- use constant HYGIENE => "(wash(ing)? hands|brush(ing)? (teeth)?|potty|toilet)"; use constant BEHAVIOR => "(compliant|calm down|meltdown|emotion|tantrum|attention|behavior|behaved)"; use constant TRACKER => "(monitor|tracker|track|diary|log)"; use constant LANGUAGE => "(augmentative communication|words|(sounds|sound) out|language|speak|speaking|talk|speech|" . "aac|picture exchange|words|communicating|communicate|pecs|communication|vocabulary)"; use constant EDUCATION => "((match|matching) (shapes|learning|objects|items|colors)|concepts|animals|alphabet|education|" . "colors|count|colours|learning|spelling|maths|letters|arithmetic|multiplication|addition|" . "mathematics|numbers|reading|read|grammar|history|" . "english|books|maths|sentence)"; use constant ATTENTION => "(engage(s|d)|focuse(d|s)|keeps (his|her) focus|concentration|attention|focus)"; use constant MOTOR => "((fine|gross)? motor|coordination|hand eye coordination|motor skills)"; use constant FOOD => "(eating|eats|food|eaten|diet)"; use constant IMAGINATION => "(writing|imagine|visualize|creating|visualise|story sequencing|imagining|imagination|story telling|comics)"; use constant SENSORY => "(block(s)? (out)? (external|outside)? noise(s)?|visual|sensor|sensory|music|sound|image|touch|" . "haptic|backgrounds distracting)"; use constant EYE_CONTACT => "(eye contact)"; use constant SOCIAL => "(interact|social|social(ize|ise)|friend(s)?|participate|join in)"; use constant SLEEP => "(sleep|bedtime|nap|bed time)"; use constant EMOTION => "(feelings|calm down|anxieties|anxiety|decrease(s)? (stress(ful)?|anger|depression|sadness|" . "anxiety)|control(s)? (his|her)? emotion(s)?|clear (his|her) mind)"; # Bad Reviews use constant ADS => "(ads|advertisement)"; use constant COST => "(price|cost|(waste of|not worth) (the)? money|ripped off|expensive| (can not|can t|cant) (afford|pricey))"; use constant FUNCTION => "((isn t|is not) (opening|working)|broken|bugs|needs fixing|frozen|freezes|confusing|crash(es)?|" . "crashed|shuts off|bad design|not user friendly)"; use constant CONSIST => "(drama|frustrat(ion|ed)|tantrum(s)?|scream(s|ing))"; use constant MONTHS => "(jan|feb|mar|apr|may|jun|jul|aug|sep|oct|nov|dec)"; use constant YEARS => "(2008|2009|2010|2011|2012|2013|2014|2015|2016)"; sub st # Speech Tagger { my $postagger = new Lingua::EN::Tagger; my $tag = $postagger->add_tags($_[0]); return $tag; } sub sp # splits sentence { my $splitter = Lingua::Sentence->new("en"); my $text = $_[0]; my $res = $splitter->split($text); my @t = split /\n/, $res; return @t; } sub openDatabase { # define database name and driver my $driver = "SQLite"; my $db_name = $_[0]; # Database name my $dbd = "DBI:$driver:dbname=$db_name"; # sqlite does not have a notion of username/password my $username = ""; my $password = ""; print STDERR "Openning $db_name\n"; # create and connect to the database. my $dbh = DBI->connect($dbd, $username, $password, { RaiseError => 0 }) or die $DBI::errstr; print STDERR "Database opened successfully\n"; return $dbh } sub wc # word count { my $str = shift; return 1 + ($str =~ tr{ }{ }); } sub findApps { my $hr = HTML::Restrict->new(); # Removes unwanted HTML my $dbh = $_[0]; # Database handler my $dbn = $_[1]; # Databasename my $stmt = ($dbn =~ m/apple/) ? qq(SELECT AppleID, Description,Price, HasInAppPurchases from Details;) : qq(SELECT AppID, Long, Hash, Price, InAppPurchases from Details;); my $obj = $dbh->prepare($stmt); my $ret = $obj->execute() or die $DBI::errstr; my %apps; while(my @row = $obj->fetchrow_array()) { my $appID = $row[0]; my $des = $row[1]; my $price = $row[2]; my $inapp = $row[3]; my $hash = $appID . $des; $des = $hr->process($des); $des =~ s/[^[a-zA-Z0-9 -!.$]]//g; my $keywords = ASD; if ($des =~ /\b$keywords\b/i) { # Match words and be case insensitive $apps{$appID} = $des . "|" . $price . "|" . $inapp; } } my $size = keys %apps; print "Found " . $size . " apps" . "\n"; return %apps; } sub findEvidenceBased { my ($dbh, $dbn) = @_; my %apps = findApps($dbh, $dbn); my %eb; foreach my $key (keys %apps) { my $app = $apps{$key}; $eb{$key} = $app if match($app, EVIDENCE_BASED); } return %eb; } sub printHashSize { my %hash = @_; my $size = keys %hash; print "Hash Size " . $size . "\n"; } sub findReviews_forApps # Finds the reviews only for apps given { my ($dbh, $dbn, %apps) = @_; my %reviews = findReviews($dbh, $dbn); my %filtered; foreach my $key (keys %reviews) { my ($appID, $title, $body, $rating) = split(/\|/, $reviews{$key}); $filtered{$key} = $reviews{$key} if exists $apps{$appID}; } printHashSize(%filtered); return %filtered; } sub findReviews_ByAuthor { my $dbh = $_[0]; # Database handler my $dbn = $_[1]; # Databasename my $aut = $_[2]; my $stmt = $dbn eq "apple.db" ? qq(SELECT AppleID, Subject,Body,Hash,Rating,Date,AuthorID from Reviews;) : qq(SELECT AppID, ReviewTitle, Comments, Hash, Rating,Date,UserName from Reviews;); my $obj = $dbh->prepare($stmt); my $ret = $obj->execute() or die $DBI::errstr; my %appData; while(my @row = $obj->fetchrow_array()) { my $appID = $row[0]; my $title = lc $row[1]; my $body = lc $row[2]; my $hash = $row[3]; my $rating = $row[4]; my $date = $row[5]; my $authid = $row[6]; $title =~ s/[^[a-zA-Z0-9 !.$]]//g; $body =~ s/[^[a-zA-Z0-9 !.$]]//g; my $keywords = ASD; if ($authid eq $aut) { # Match words and be case insensitive $keywords = RELATIONSHIP; my $data= $appID . "|" . $title . "|" . $body . "|" . $rating . "|" . $date . "|" . $authid; if ($body =~ /\b$keywords\b/i) { next if wc($body) < 3; $appData{$hash} = $data; # print $date . "\n"; } else { #print $data; } } } return %appData; } sub findReviews { my $dbh = $_[0]; # Database handler my $dbn = $_[1]; # Databasename my $stmt = $dbn eq "apple.db" ? qq(SELECT AppleID, Subject,Body,Hash,Rating,Date,AuthorID from Reviews;) : qq(SELECT AppID, ReviewTitle, Comments, Hash, Rating,Date,UserName from Reviews;); my $obj = $dbh->prepare($stmt); my $ret = $obj->execute() or die $DBI::errstr; my %appData; while(my @row = $obj->fetchrow_array()) { my $appID = $row[0]; my $title = lc $row[1]; my $body = lc $row[2]; my $hash = $row[3]; my $rating = $row[4]; my $date = $row[5]; my $authid = $row[6]; $title =~ s/[^[a-zA-Z0-9 !.$]]//g; $body =~ s/[^[a-zA-Z0-9 !.$]]//g; my $keywords = ASD; if ($body =~ /\b$keywords/i) { # Match words and be case insensitive $keywords = RELATIONSHIP; my $data= $appID . "|" . $title . "|" . $body . "|" . $rating . "|" . $date . "|" . $authid; if ($body =~ /\b$keywords\b/i) { next if wc($body) < 3; $appData{$hash} = $data; # print $date . "\n"; } else { #print $data; } } } return %appData; } sub printRatings { my %data = @_; foreach my $key (keys %data) { my $row = $data{$key}; my @t = split /\|/, $row; print $t[3]; } } sub dates { my %data = @_; my %years; foreach my $key (keys %data) { my $review = $data{$key}; my ($id, $title, $body, $rating, $date) = split(/\|/, $review); my $regx = YEARS; if ($date =~ /$regx/i) { my $ye = $1; $regx = MONTHS; if ($date =~ /$regx/i) { my $mo = $1; my $key = "01/" . $mo . "/" . $ye; $years{$key}++; } } } return %years; } sub badReviews { my ($max, %data) = @_; my %bad; my $cnt = 0; foreach my $key ( keys %data ) { my $review = $data{$key}; my ($id, $title, $body, $rating) = split(/\|/, $review); if ($rating le $max) { $cnt++; #print $review . " -> " . $rating . "->" . $max . "\n"; $bad{"ADS"}++ if match($review, ADS); $bad{"CONSIST"}++ if match($review, FUNCTION) && match($review, CONSIST); $bad{"COST"}++ if match($review, COST); $bad{"FUNCTION"}++ if match($review, FUNCTION); } } print STDERR "Found " . $cnt . "\n"; return %bad; } sub printBody { my %data = @_; foreach my $key (keys %data) { my $row = $data{$key}; my @t = split /\|/, $row; print $t[2]; } } sub match { my $line = $_[0]; my $regx = $_[1]; return $line =~ /\b$regx\b/i; } sub helpsWith { my %data = @_; my $size = keys %data; my %helps; my $cnt = 0; foreach my $key ( keys %data ) { my $in = $data{$key}; my $review = $in; my $regx = HELPS; if ($review =~ /$regx/i) { $cnt++; $review = substr($review, $-[0]); $helps{"SOCIAL"}++ if match($review, SOCIAL); $helps{"SLEEP"}++ if match($review, SLEEP); $helps{"HYGIENE"}++ if match($review, HYGIENE); $helps{"BEHAVIOR"}++ if match($review, BEHAVIOR); $helps{"TRACKER"}++ if match($review, TRACKER); $helps{"LANGUAGE"}++ if match($review, LANGUAGE); $helps{"EDUCATION"}++ if match($review, EDUCATION); $helps{"ATTENTION"}++ if match($review, ATTENTION); $helps{"MOTOR"}++ if match($review, MOTOR); $helps{"FOOD"}++ if match($review, FOOD); $helps{"IMAGINATION"}++ if match($review, IMAGINATION); $helps{"SENSORY"}++ if match($review, SENSORY); $helps{"EYE_CONTACT"}++ if match($review, EYE_CONTACT); $helps{"EMOTION"}++ if match($review, EMOTION); } } print STDERR "Found " . $cnt . "\n"; return %helps; } sub main { my $dbn = $ARGV[0]; my $dbh = openDatabase($dbn); # my %data = findReviews($dbh, $dbn); #my %data = findReviews_ByAuthor($dbh, $dbn, "184066223"); #my %reviews = findReviews($dbh, $dbn); #my %data = dates(%reviews); #my %data = badReviews(5, %reviews); #my %data = helpsWith(%reviews); my %data = findEvidenceBased($dbh, $dbn); #my %apps = findApps($dbh, $dbn); #my %data = findReviews_forApps($dbh, $dbn, %apps); # %data = helpsWith(%data); my @keys = keys %data; for my $key (@keys) { print $key . "|" . $data{$key}. "\n"; } my $size = keys %data; #print "Size: " . $size . "\n"; $dbh->disconnect(); } # MAIN ENTRY main();
32.458333
137
0.527146
ed8f6f00495f6616b27e179e404385cd4d77068a
729
pm
Perl
lib/BTDT/IM/Command/Tags.pm
whitten/hiveminder
85f63d2a37e035f1400178990d7759a4885bad06
[ "Artistic-1.0-Perl" ]
34
2015-05-01T13:40:57.000Z
2021-12-21T13:01:25.000Z
lib/BTDT/IM/Command/Tags.pm
whitten/hiveminder
85f63d2a37e035f1400178990d7759a4885bad06
[ "Artistic-1.0-Perl" ]
1
2021-03-03T18:41:07.000Z
2021-03-03T18:41:07.000Z
lib/BTDT/IM/Command/Tags.pm
whitten/hiveminder
85f63d2a37e035f1400178990d7759a4885bad06
[ "Artistic-1.0-Perl" ]
20
2015-05-01T13:39:53.000Z
2021-12-21T13:02:10.000Z
package BTDT::IM::Command::Tags; use strict; use warnings; use base 'BTDT::IM::Command'; =head2 run Runs the 'tags' command, which displays tags. =cut sub run { my $self = shift; my %args = @_; my $tasks = BTDT::Model::TaskCollection->new; $tasks->from_tokens(qw(owner me not complete)); $self->apply_filters($tasks, %args); $tasks->smart_search($args{message}) if $args{message} ne ''; $tasks->columns('tags', 'owner_id', 'requestor_id', 'group_id'); my $tag_count = $tasks->tags; delete $tag_count->{''}; # untagged tasks if (keys %$tag_count == 0) { return "You have no tags."; } return "Tags: " . join ', ', sort { lc($a) cmp lc($b) } keys %$tag_count; } 1;
20.828571
77
0.603567
ed52bcd7f470c6d03027d4d8209832802ca9a3ca
3,010
pm
Perl
auto-lib/Paws/S3/CopyObjectOutput.pm
shogo82148/aws-sdk-perl
a87555a9d30dd1415235ebacd2715b2f7e5163c7
[ "Apache-2.0" ]
null
null
null
auto-lib/Paws/S3/CopyObjectOutput.pm
shogo82148/aws-sdk-perl
a87555a9d30dd1415235ebacd2715b2f7e5163c7
[ "Apache-2.0" ]
null
null
null
auto-lib/Paws/S3/CopyObjectOutput.pm
shogo82148/aws-sdk-perl
a87555a9d30dd1415235ebacd2715b2f7e5163c7
[ "Apache-2.0" ]
null
null
null
package Paws::S3::CopyObjectOutput; use Moose; has CopyObjectResult => (is => 'ro', isa => 'Paws::S3::CopyObjectResult', traits => ['ParamInBody']); has CopySourceVersionId => (is => 'ro', isa => 'Str', header_name => 'x-amz-copy-source-version-id', traits => ['ParamInHeader']); has Expiration => (is => 'ro', isa => 'Str', header_name => 'x-amz-expiration', traits => ['ParamInHeader']); has RequestCharged => (is => 'ro', isa => 'Str', header_name => 'x-amz-request-charged', traits => ['ParamInHeader']); has ServerSideEncryption => (is => 'ro', isa => 'Str', header_name => 'x-amz-server-side-encryption', traits => ['ParamInHeader']); has SSECustomerAlgorithm => (is => 'ro', isa => 'Str', header_name => 'x-amz-server-side-encryption-customer-algorithm', traits => ['ParamInHeader']); has SSECustomerKeyMD5 => (is => 'ro', isa => 'Str', header_name => 'x-amz-server-side-encryption-customer-key-MD5', traits => ['ParamInHeader']); has SSEKMSEncryptionContext => (is => 'ro', isa => 'Str', header_name => 'x-amz-server-side-encryption-context', traits => ['ParamInHeader']); has SSEKMSKeyId => (is => 'ro', isa => 'Str', header_name => 'x-amz-server-side-encryption-aws-kms-key-id', traits => ['ParamInHeader']); has VersionId => (is => 'ro', isa => 'Str', header_name => 'x-amz-version-id', traits => ['ParamInHeader']); has _request_id => (is => 'ro', isa => 'Str'); 1; ### main pod documentation begin ### =head1 NAME Paws::S3::CopyObjectOutput =head1 ATTRIBUTES =head2 CopyObjectResult => L<Paws::S3::CopyObjectResult> Container for all response elements. =head2 CopySourceVersionId => Str Version of the copied object in the destination bucket. =head2 Expiration => Str If the object expiration is configured, the response includes this header. =head2 RequestCharged => Str Valid values are: C<"requester"> =head2 ServerSideEncryption => Str The server-side encryption algorithm used when storing this object in Amazon S3 (for example, AES256, aws:kms). Valid values are: C<"AES256">, C<"aws:kms"> =head2 SSECustomerAlgorithm => Str If server-side encryption with a customer-provided encryption key was requested, the response will include this header confirming the encryption algorithm used. =head2 SSECustomerKeyMD5 => Str If server-side encryption with a customer-provided encryption key was requested, the response will include this header to provide round-trip message integrity verification of the customer-provided encryption key. =head2 SSEKMSEncryptionContext => Str If present, specifies the AWS KMS Encryption Context to use for object encryption. The value of this header is a base64-encoded UTF-8 string holding JSON with the encryption context key-value pairs. =head2 SSEKMSKeyId => Str If present, specifies the ID of the AWS Key Management Service (AWS KMS) symmetric customer managed customer master key (CMK) that was used for the object. =head2 VersionId => Str Version ID of the newly created copy. =cut
29.80198
152
0.710631
ed93314bf6cffc3a626f59f7f4c01347e2ebcf9b
2,284
pl
Perl
release/src/btools/uversion.pl
ghsecuritylab/tomato-sabai
9027a38297d32e97dd386499cca4a583e25d1f9d
[ "Apache-2.0" ]
null
null
null
release/src/btools/uversion.pl
ghsecuritylab/tomato-sabai
9027a38297d32e97dd386499cca4a583e25d1f9d
[ "Apache-2.0" ]
null
null
null
release/src/btools/uversion.pl
ghsecuritylab/tomato-sabai
9027a38297d32e97dd386499cca4a583e25d1f9d
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/perl # # uversion.pl # Copyright (C) 2006 Jonathan Zarate # # - update the build number for Tomato # !!TB - Added version suffix # use POSIX qw(strftime); sub error { print "\nuversion error: $_\n"; exit(1); } sub help { print "Usage: uversion --bump|--gen\n"; exit(1); } # # if ($#ARGV < 0) { help(); } $path = "router/shared"; $major = 0; $minor = 0; $build = 0; $space = ""; $suffix = ""; open(F, "$path/tomato_version") || error("opening tomato_version: $!"); $_ = <F>; if (!(($major, $minor, $build, $space, $suffix) = /^(\d+)\.(\d+)\.(\d+)(\s+)?(.+)?$/)) { error("Invalid version: '$_'"); } close(F); if ($ARGV[0] eq "--bump") { ++$build; open(F, ">$path/tomato_version.~") || error("creating temp file: $!"); printf F "%d.%02d.%04d %s", $major, $minor, $build, $suffix; close(F); rename("$path/tomato_version.~", "$path/tomato_version") || error("renaming: $!"); exit(0); } if ($ARGV[0] ne "--gen") { help(); } $time = strftime("%a, %d %b %Y %H:%M:%S %z", localtime()); $minor = sprintf("%02d", $minor); $build = sprintf("%04d", $build); # read the build number from the command line if ($#ARGV > 0) { if ($ARGV[1] ne "--def") { $build = sprintf("%04d", $ARGV[1]); } } # read the version suffix from the command line if ($#ARGV > 1) { $start = 2; $stop = $#ARGV; $suffix = ""; for ($i=$start; $i <= $stop; $i++) { if ($suffix eq "") { $suffix = $ARGV[$i]; } elsif ($ARGV[$i] ne "") { $suffix = sprintf("%s %s", $suffix, $ARGV[$i]); } } } open(F, ">$path/tomato_version.h~") || error("creating temp file: $!"); print F <<"END"; #ifndef __TOMATO_VERSION_H__ #define __TOMATO_VERSION_H__ #define TOMATO_MAJOR "$major" #define TOMATO_MINOR "$minor" #define TOMATO_BUILD "$build" #define TOMATO_BUILDTIME "$time" #define TOMATO_VERSION "$major.$minor.$build $suffix" #define TOMATO_SHORTVER "$major.$minor" #endif END close(F); rename("$path/tomato_version.h~", "$path/tomato_version.h") || error("renaming: $!"); open(F, ">$path/tomato_version.~") || error("creating temp file: $!"); printf F "%d.%02d.%04d %s", $major, $minor, $build, $suffix; close(F); rename("$path/tomato_version.~", "$path/tomato_version") || error("renaming: $!"); print "Version: $major.$minor.$build $suffix ($time)\n"; exit(0);
21.54717
88
0.588004
ed87edb4823bd72af3f9cf9447064ee1f5bfcf07
7,190
pm
Perl
perl/lib/WWW/OpenAPIClientcom.spoonacular.client.model/InlineResponse20016.pm
ddsky/spoonacular-api-clients
63f955ceb2c356fefdd48ec634deb3c3e16a6ae7
[ "MIT" ]
21
2019-08-09T18:53:26.000Z
2022-03-14T22:10:10.000Z
perl/lib/WWW/OpenAPIClientcom.spoonacular.client.model/InlineResponse20016.pm
ddsky/spoonacular-api-clients
63f955ceb2c356fefdd48ec634deb3c3e16a6ae7
[ "MIT" ]
null
null
null
perl/lib/WWW/OpenAPIClientcom.spoonacular.client.model/InlineResponse20016.pm
ddsky/spoonacular-api-clients
63f955ceb2c356fefdd48ec634deb3c3e16a6ae7
[ "MIT" ]
55
2019-08-13T17:52:47.000Z
2022-03-27T04:29:34.000Z
=begin comment spoonacular API The spoonacular Nutrition, Recipe, and Food API allows you to access over 380,000 recipes, thousands of ingredients, 800,000 food products, and 100,000 menu items. Our food ontology and semantic recipe search engine makes it possible to search for recipes using natural language queries, such as \"gluten free brownies without sugar\" or \"low fat vegan cupcakes.\" You can automatically calculate the nutritional information for any recipe, analyze recipe costs, visualize ingredient lists, find recipes for what's in your fridge, find recipes based on special diets, nutritional requirements, or favorite ingredients, classify recipes into types and cuisines, convert ingredient amounts, or even compute an entire meal plan. With our powerful API, you can create many kinds of food and especially nutrition apps. Special diets/dietary requirements currently available include: vegan, vegetarian, pescetarian, gluten free, grain free, dairy free, high protein, whole 30, low sodium, low carb, Paleo, ketogenic, FODMAP, and Primal. The version of the OpenAPI document: 1.0 Contact: mail@spoonacular.com Generated by: https://openapi-generator.tech =end comment =cut # # NOTE: This class is auto generated by OpenAPI Generator (https://openapi-generator.tech). # Do not edit the class manually. # Ref: https://openapi-generator.tech # package WWW::OpenAPIClient::Object::InlineResponse20016; require 5.6.0; use strict; use warnings; use utf8; use JSON qw(decode_json); use Data::Dumper; use Module::Runtime qw(use_module); use Log::Any qw($log); use Date::Parse; use DateTime; use base ("Class::Accessor", "Class::Data::Inheritable"); # # # # NOTE: This class is auto generated by OpenAPI Generator (https://openapi-generator.tech). Do not edit the class manually. # REF: https://openapi-generator.tech # =begin comment spoonacular API The spoonacular Nutrition, Recipe, and Food API allows you to access over 380,000 recipes, thousands of ingredients, 800,000 food products, and 100,000 menu items. Our food ontology and semantic recipe search engine makes it possible to search for recipes using natural language queries, such as \"gluten free brownies without sugar\" or \"low fat vegan cupcakes.\" You can automatically calculate the nutritional information for any recipe, analyze recipe costs, visualize ingredient lists, find recipes for what's in your fridge, find recipes based on special diets, nutritional requirements, or favorite ingredients, classify recipes into types and cuisines, convert ingredient amounts, or even compute an entire meal plan. With our powerful API, you can create many kinds of food and especially nutrition apps. Special diets/dietary requirements currently available include: vegan, vegetarian, pescetarian, gluten free, grain free, dairy free, high protein, whole 30, low sodium, low carb, Paleo, ketogenic, FODMAP, and Primal. The version of the OpenAPI document: 1.0 Contact: mail@spoonacular.com Generated by: https://openapi-generator.tech =end comment =cut # # NOTE: This class is auto generated by OpenAPI Generator (https://openapi-generator.tech). # Do not edit the class manually. # Ref: https://openapi-generator.tech # __PACKAGE__->mk_classdata('attribute_map' => {}); __PACKAGE__->mk_classdata('openapi_types' => {}); __PACKAGE__->mk_classdata('method_documentation' => {}); __PACKAGE__->mk_classdata('class_documentation' => {}); # new plain object sub new { my ($class, %args) = @_; my $self = bless {}, $class; $self->init(%args); return $self; } # initialize the object sub init { my ($self, %args) = @_; foreach my $attribute (keys %{$self->attribute_map}) { my $args_key = $self->attribute_map->{$attribute}; $self->$attribute( $args{ $args_key } ); } } # return perl hash sub to_hash { my $self = shift; my $_hash = decode_json(JSON->new->convert_blessed->encode($self)); return $_hash; } # used by JSON for serialization sub TO_JSON { my $self = shift; my $_data = {}; foreach my $_key (keys %{$self->attribute_map}) { if (defined $self->{$_key}) { $_data->{$self->attribute_map->{$_key}} = $self->{$_key}; } } return $_data; } # from Perl hashref sub from_hash { my ($self, $hash) = @_; # loop through attributes and use openapi_types to deserialize the data while ( my ($_key, $_type) = each %{$self->openapi_types} ) { my $_json_attribute = $self->attribute_map->{$_key}; if ($_type =~ /^array\[(.+)\]$/i) { # array my $_subclass = $1; my @_array = (); foreach my $_element (@{$hash->{$_json_attribute}}) { push @_array, $self->_deserialize($_subclass, $_element); } $self->{$_key} = \@_array; } elsif ($_type =~ /^hash\[string,(.+)\]$/i) { # hash my $_subclass = $1; my %_hash = (); while (my($_key, $_element) = each %{$hash->{$_json_attribute}}) { $_hash{$_key} = $self->_deserialize($_subclass, $_element); } $self->{$_key} = \%_hash; } elsif (exists $hash->{$_json_attribute}) { #hash(model), primitive, datetime $self->{$_key} = $self->_deserialize($_type, $hash->{$_json_attribute}); } else { $log->debugf("Warning: %s (%s) does not exist in input hash\n", $_key, $_json_attribute); } } return $self; } # deserialize non-array data sub _deserialize { my ($self, $type, $data) = @_; $log->debugf("deserializing %s with %s",Dumper($data), $type); if ($type eq 'DateTime') { return DateTime->from_epoch(epoch => str2time($data)); } elsif ( grep( /^$type$/, ('int', 'double', 'string', 'boolean'))) { return $data; } else { # hash(model) my $_instance = eval "WWW::OpenAPIClient::Object::$type->new()"; return $_instance->from_hash($data); } } __PACKAGE__->class_documentation({description => '', class => 'InlineResponse20016', required => [], # TODO } ); __PACKAGE__->method_documentation({ 'parsed_instructions' => { datatype => 'ARRAY[object]', base_name => 'parsedInstructions', description => '', format => '', read_only => '', }, 'ingredients' => { datatype => 'ARRAY[object]', base_name => 'ingredients', description => '', format => '', read_only => '', }, 'equipment' => { datatype => 'ARRAY[object]', base_name => 'equipment', description => '', format => '', read_only => '', }, }); __PACKAGE__->openapi_types( { 'parsed_instructions' => 'ARRAY[object]', 'ingredients' => 'ARRAY[object]', 'equipment' => 'ARRAY[object]' } ); __PACKAGE__->attribute_map( { 'parsed_instructions' => 'parsedInstructions', 'ingredients' => 'ingredients', 'equipment' => 'equipment' } ); __PACKAGE__->mk_accessors(keys %{__PACKAGE__->attribute_map}); 1;
35.418719
1,032
0.645758
ed69205ff3af61436dfeaa8e103c3ca6cd04b7e5
4,226
pl
Perl
webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/vo.pl
tomoyanp/isucon9-qualify-20210912
f84b5d1c82f9d41bbba02422c1a6acd358d9c41a
[ "MIT" ]
null
null
null
webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/vo.pl
tomoyanp/isucon9-qualify-20210912
f84b5d1c82f9d41bbba02422c1a6acd358d9c41a
[ "MIT" ]
5
2021-05-20T04:16:14.000Z
2022-02-12T01:40:02.000Z
webapp/perl/local/lib/perl5/auto/share/dist/DateTime-Locale/vo.pl
matsubara0507/isucon9-kansousen
77b19085d76add98a3ce7370063a8636cde62499
[ "MIT" ]
null
null
null
{ am_pm_abbreviated => [ "AM", "PM", ], available_formats => { Bh => "h B", Bhm => "h:mm B", Bhms => "h:mm:ss B", E => "ccc", EBhm => "E h:mm B", EBhms => "E h:mm:ss B", EHm => "E HH:mm", EHms => "E HH:mm:ss", Ed => "d, E", Ehm => "E h:mm a", Ehms => "E h:mm:ss a", Gy => "G y", GyMMM => "G y MMM", GyMMMEd => "G y MMM d, E", GyMMMd => "G y MMM d", H => "HH", Hm => "HH:mm", Hms => "HH:mm:ss", Hmsv => "HH:mm:ss v", Hmv => "HH:mm v", M => "L", MEd => "MM-dd, E", MMM => "LLL", MMMEd => "MMM d, E", "MMMMW-count-other" => "'week' W 'of' MMMM", MMMMd => "MMMM d", MMMd => "MMM d", Md => "MM-dd", d => "d", h => "h a", hm => "h:mm a", hms => "h:mm:ss a", hmsv => "h:mm:ss a v", hmv => "h:mm a v", ms => "mm:ss", y => "y", yM => "y-MM", yMEd => "y-MM-dd, E", yMMM => "y MMM", yMMMEd => "y MMM d, E", yMMMM => "y MMMM", yMMMd => "y MMM d", yMd => "y-MM-dd", yQQQ => "y QQQ", yQQQQ => "y QQQQ", "yw-count-other" => "'week' w 'of' Y", }, code => "vo", date_format_full => "y MMMM d, EEEE", date_format_long => "y MMMM d", date_format_medium => "y MMM d", date_format_short => "y-MM-dd", datetime_format_full => "{1} {0}", datetime_format_long => "{1} {0}", datetime_format_medium => "{1} {0}", datetime_format_short => "{1} {0}", day_format_abbreviated => [ "Mon", "Tue", "Wed", "Thu", "Fri", "Sat", "Sun", ], day_format_narrow => [ "M", "T", "W", "T", "F", "S", "S", ], day_format_wide => [ "Mon", "Tue", "Wed", "Thu", "Fri", "Sat", "Sun", ], day_stand_alone_abbreviated => [ "Mon", "Tue", "Wed", "Thu", "Fri", "Sat", "Sun", ], day_stand_alone_narrow => [ "M", "T", "W", "T", "F", "S", "S", ], day_stand_alone_wide => [ "Mon", "Tue", "Wed", "Thu", "Fri", "Sat", "Sun", ], era_abbreviated => [ "BCE", "CE", ], era_narrow => [ "BCE", "CE", ], era_wide => [ "BCE", "CE", ], first_day_of_week => 1, glibc_date_1_format => "%a %b %e %H:%M:%S %Z %Y", glibc_date_format => "%m/%d/%y", glibc_datetime_format => "%a %b %e %H:%M:%S %Y", glibc_time_12_format => "%I:%M:%S %p", glibc_time_format => "%H:%M:%S", language => "Volap\N{U+00fc}k", month_format_abbreviated => [ "M01", "M02", "M03", "M04", "M05", "M06", "M07", "M08", "M09", "M10", "M11", "M12", ], month_format_narrow => [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, ], month_format_wide => [ "M01", "M02", "M03", "M04", "M05", "M06", "M07", "M08", "M09", "M10", "M11", "M12", ], month_stand_alone_abbreviated => [ "M01", "M02", "M03", "M04", "M05", "M06", "M07", "M08", "M09", "M10", "M11", "M12", ], month_stand_alone_narrow => [ 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, ], month_stand_alone_wide => [ "M01", "M02", "M03", "M04", "M05", "M06", "M07", "M08", "M09", "M10", "M11", "M12", ], name => "Volap\N{U+00fc}k", native_language => "vo", native_name => "vo", native_script => undef, native_territory => undef, native_variant => undef, quarter_format_abbreviated => [ "Q1", "Q2", "Q3", "Q4", ], quarter_format_narrow => [ 1, 2, 3, 4, ], quarter_format_wide => [ "Q1", "Q2", "Q3", "Q4", ], quarter_stand_alone_abbreviated => [ "Q1", "Q2", "Q3", "Q4", ], quarter_stand_alone_narrow => [ 1, 2, 3, 4, ], quarter_stand_alone_wide => [ "Q1", "Q2", "Q3", "Q4", ], script => undef, territory => undef, time_format_full => "HH:mm:ss zzzz", time_format_long => "HH:mm:ss z", time_format_medium => "HH:mm:ss", time_format_short => "HH:mm", variant => undef, version => 35, }
15.594096
51
0.421912
ed7ca4555d863b39538a9d5bf06667411a8ceb4c
1,849
pl
Perl
flow/main.pl
necavit/li-sat-encoded
cf15a0acc580ae4feaeb3ac03268269fd44c1add
[ "MIT" ]
null
null
null
flow/main.pl
necavit/li-sat-encoded
cf15a0acc580ae4feaeb3ac03268269fd44c1add
[ "MIT" ]
null
null
null
flow/main.pl
necavit/li-sat-encoded
cf15a0acc580ae4feaeb3ac03268269fd44c1add
[ "MIT" ]
null
null
null
:-dynamic(varNumber/3). % ========== No need to change the following: ===================================== main:- symbolicOutput(1), !, writeClauses, halt. % escribir bonito, no ejecutar main:- assert(numClauses(0)), assert(numVars(0)), tell(clauses), writeClauses, told, tell(header), writeHeader, told, unix('cat header clauses > infile.cnf'), unix('picosat -v -o model infile.cnf'), unix('rm header'), unix('rm clauses'), unix('rm infile.cnf'), see(model), readModel(M), seen, unix('rm model'), displaySol(M), halt. var2num(T,N):- hash_term(T,Key), varNumber(Key,T,N),!. var2num(T,N):- retract(numVars(N0)), N is N0+1, assert(numVars(N)), hash_term(T,Key), assert(varNumber(Key,T,N)), assert( num2var(N,T) ), !. writeHeader:- numVars(N),numClauses(C),write('p cnf '),write(N), write(' '),write(C),nl. countClause:- retract(numClauses(N)), N1 is N+1, assert(numClauses(N1)),!. writeClause([]):- symbolicOutput(1),!, nl. writeClause([]):- countClause, write(0), nl. writeClause([Lit|C]):- w(Lit), writeClause(C),!. w( Lit ):- symbolicOutput(1), write(Lit), write(' '),!. w(\+Var):- var2num(Var,N), write(-), write(N), write(' '),!. w( Var):- var2num(Var,N), write(N), write(' '),!. unix(Comando):-shell(Comando),!. unix(_). readModel(L):- get_code(Char), readWord(Char,W), readModel(L1), addIfPositiveInt(W,L1,L),!. readModel([]). addIfPositiveInt(W,L,[N|L]):- W = [C|_], between(48,57,C), number_codes(N,W), N>0, !. addIfPositiveInt(_,L,L). readWord(99,W):- repeat, get_code(Ch), member(Ch,[-1,10]), !, get_code(Ch1), readWord(Ch1,W),!. readWord(-1,_):-!, fail. %end of file readWord(C,[]):- member(C,[10,32]), !. % newline or white space marks end of word readWord(Char,[Char|W]):- get_code(Char1), readWord(Char1,W), !. %========================================================================================
41.088889
95
0.59762
ed0a68271d49500f30cfa87c9be8b3bb5116f70b
8,770
pm
Perl
tools/scitools/bin/linux64/Perl/Module/Build/Platform/VMS.pm
brucegua/moocos
575c161cfa35e220f10d042e2e5ca18773691695
[ "Apache-2.0" ]
1
2020-01-20T21:26:46.000Z
2020-01-20T21:26:46.000Z
tools/scitools/bin/linux64/Perl/Module/Build/Platform/VMS.pm
brucegua/moocos
575c161cfa35e220f10d042e2e5ca18773691695
[ "Apache-2.0" ]
null
null
null
tools/scitools/bin/linux64/Perl/Module/Build/Platform/VMS.pm
brucegua/moocos
575c161cfa35e220f10d042e2e5ca18773691695
[ "Apache-2.0" ]
null
null
null
package Module::Build::Platform::VMS; use strict; use vars qw($VERSION); $VERSION = '0.2808_01'; $VERSION = eval $VERSION; use Module::Build::Base; use vars qw(@ISA); @ISA = qw(Module::Build::Base); =head1 NAME Module::Build::Platform::VMS - Builder class for VMS platforms =head1 DESCRIPTION This module inherits from C<Module::Build::Base> and alters a few minor details of its functionality. Please see L<Module::Build> for the general docs. =head2 Overridden Methods =over 4 =item _set_defaults Change $self->{build_script} to 'Build.com' so @Build works. =cut sub _set_defaults { my $self = shift; $self->SUPER::_set_defaults(@_); $self->{properties}{build_script} = 'Build.com'; } =item cull_args '@Build foo' on VMS will not preserve the case of 'foo'. Rather than forcing people to write '@Build "foo"' we'll dispatch case-insensitively. =cut sub cull_args { my $self = shift; my($action, $args) = $self->SUPER::cull_args(@_); my @possible_actions = grep { lc $_ eq lc $action } $self->known_actions; die "Ambiguous action '$action'. Could be one of @possible_actions" if @possible_actions > 1; return ($possible_actions[0], $args); } =item manpage_separator Use '__' instead of '::'. =cut sub manpage_separator { return '__'; } =item prefixify Prefixify taking into account VMS' filepath syntax. =cut # Translated from ExtUtils::MM_VMS::prefixify() sub _prefixify { my($self, $path, $sprefix, $type) = @_; my $rprefix = $self->prefix; $self->log_verbose(" prefixify $path from $sprefix to $rprefix\n"); # Translate $(PERLPREFIX) to a real path. $rprefix = VMS::Filespec::vmspath($rprefix) if $rprefix; $sprefix = VMS::Filespec::vmspath($sprefix) if $sprefix; $self->log_verbose(" rprefix translated to $rprefix\n". " sprefix translated to $sprefix\n"); if( length $path == 0 ) { $self->log_verbose(" no path to prefixify.\n") } elsif( !File::Spec->file_name_is_absolute($path) ) { $self->log_verbose(" path is relative, not prefixifying.\n"); } elsif( $sprefix eq $rprefix ) { $self->log_verbose(" no new prefix.\n"); } else { my($path_vol, $path_dirs) = File::Spec->splitpath( $path ); my $vms_prefix = $self->config('vms_prefix'); if( $path_vol eq $vms_prefix.':' ) { $self->log_verbose(" $vms_prefix: seen\n"); $path_dirs =~ s{^\[}{\[.} unless $path_dirs =~ m{^\[\.}; $path = $self->_catprefix($rprefix, $path_dirs); } else { $self->log_verbose(" cannot prefixify.\n"); return $self->prefix_relpaths($self->installdirs, $type); } } $self->log_verbose(" now $path\n"); return $path; } =item _quote_args Command-line arguments (but not the command itself) must be quoted to ensure case preservation. =cut sub _quote_args { # Returns a string that can become [part of] a command line with # proper quoting so that the subprocess sees this same list of args, # or if we get a single arg that is an array reference, quote the # elements of it and return the reference. my ($self, @args) = @_; my $got_arrayref = (scalar(@args) == 1 && UNIVERSAL::isa($args[0], 'ARRAY')) ? 1 : 0; map { $_ = q(").$_.q(") if !/^\"/ && length($_) > 0 } ($got_arrayref ? @{$args[0]} : @args ); return $got_arrayref ? $args[0] : join(' ', @args); } =item have_forkpipe There is no native fork(), so some constructs depending on it are not available. =cut sub have_forkpipe { 0 } =item _backticks Override to ensure that we quote the arguments but not the command. =cut sub _backticks { # The command must not be quoted but the arguments to it must be. my ($self, @cmd) = @_; my $cmd = shift @cmd; my $args = $self->_quote_args(@cmd); return `$cmd $args`; } =item do_system Override to ensure that we quote the arguments but not the command. =cut sub do_system { # The command must not be quoted but the arguments to it must be. my ($self, @cmd) = @_; $self->log_info("@cmd\n"); my $cmd = shift @cmd; my $args = $self->_quote_args(@cmd); return !system("$cmd $args"); } =item _infer_xs_spec Inherit the standard version but tweak the library file name to be something Dynaloader can find. =cut sub _infer_xs_spec { my $self = shift; my $file = shift; my $spec = $self->SUPER::_infer_xs_spec($file); # Need to create with the same name as DynaLoader will load with. if (defined &DynaLoader::mod2fname) { my $file = $$spec{module_name} . '.' . $self->{config}->get('dlext'); $file =~ tr/:/_/; $file = DynaLoader::mod2fname([$file]); $$spec{lib_file} = File::Spec->catfile($$spec{archdir}, $file); } return $spec; } =item rscan_dir Inherit the standard version but remove dots at end of name. This may not be necessary if File::Find has been fixed or DECC$FILENAME_UNIX_REPORT is in effect. =cut sub rscan_dir { my ($self, $dir, $pattern) = @_; my $result = $self->SUPER::rscan_dir( $dir, $pattern ); for my $file (@$result) { $file =~ s/\.$//; } return $result; } =item dist_dir Inherit the standard version but replace embedded dots with underscores because a dot is the directory delimiter on VMS. =cut sub dist_dir { my $self = shift; my $dist_dir = $self->SUPER::dist_dir; $dist_dir =~ s/\./_/g; return $dist_dir; } =item man3page_name Inherit the standard version but chop the extra manpage delimiter off the front if there is one. The VMS version of splitdir('[.foo]') returns '', 'foo'. =cut sub man3page_name { my $self = shift; my $mpname = $self->SUPER::man3page_name( shift ); my $sep = $self->manpage_separator; $mpname =~ s/^$sep//; return $mpname; } =item expand_test_dir Inherit the standard version but relativize the paths as the native glob() doesn't do that for us. =cut sub expand_test_dir { my ($self, $dir) = @_; my @reldirs = $self->SUPER::expand_test_dir( $dir ); for my $eachdir (@reldirs) { my ($v,$d,$f) = File::Spec->splitpath( $eachdir ); my $reldir = File::Spec->abs2rel( File::Spec->catpath( $v, $d, '' ) ); $eachdir = File::Spec->catfile( $reldir, $f ); } return @reldirs; } =item _detildefy The home-grown glob() does not currently handle tildes, so provide limited support here. Expect only UNIX format file specifications for now. =cut sub _detildefy { my ($self, $arg) = @_; # Apparently double ~ are not translated. return $arg if ($arg =~ /^~~/); # Apparently ~ followed by whitespace are not translated. return $arg if ($arg =~ /^~ /); if ($arg =~ /^~/) { my $spec = $arg; # Remove the tilde $spec =~ s/^~//; # Remove any slash folloing the tilde if present. $spec =~ s#^/##; # break up the paths for the merge my $home = VMS::Filespec::unixify($ENV{HOME}); # Trivial case of just ~ by it self if ($spec eq '') { return $home; } my ($hvol, $hdir, $hfile) = File::Spec::Unix->splitpath($home); if ($hdir eq '') { # Someone has tampered with $ENV{HOME} # So hfile is probably the directory since this should be # a path. $hdir = $hfile; } my ($vol, $dir, $file) = File::Spec::Unix->splitpath($spec); my @hdirs = File::Spec::Unix->splitdir($hdir); my @dirs = File::Spec::Unix->splitdir($dir); my $newdirs; # Two cases of tilde handling if ($arg =~ m#^~/#) { # Simple case, just merge together $newdirs = File::Spec::Unix->catdir(@hdirs, @dirs); } else { # Complex case, need to add an updir - No delimiters my @backup = File::Spec::Unix->splitdir(File::Spec::Unix->updir); $newdirs = File::Spec::Unix->catdir(@hdirs, @backup, @dirs); } # Now put the two cases back together $arg = File::Spec::Unix->catpath($hvol, $newdirs, $file); } else { return $arg; } } =item find_perl_interpreter On VMS, $^X returns the fully qualified absolute path including version number. It's logically impossible to improve on it for getting the perl we're currently running, and attempting to manipulate it is usually lossy. =cut sub find_perl_interpreter { return $^X; } =back =head1 AUTHOR Michael G Schwern <schwern@pobox.com> Ken Williams <kwilliams@cpan.org> Craig A. Berry <craigberry@mac.com> =head1 SEE ALSO perl(1), Module::Build(3), ExtUtils::MakeMaker(3) =cut 1; __END__
23.324468
83
0.616648
ed3802b8813474d28927aeca040c1502433c5d2c
2,008
t
Perl
test/pull.t
jameswalmsley/git-subrepo
678c8dcde1061f5f32753662b13fc915ae7f62fa
[ "MIT" ]
2,695
2015-01-07T06:59:42.000Z
2022-03-30T08:50:21.000Z
test/pull.t
jameswalmsley/git-subrepo
678c8dcde1061f5f32753662b13fc915ae7f62fa
[ "MIT" ]
506
2015-01-06T19:43:16.000Z
2022-03-24T15:12:54.000Z
test/pull.t
jameswalmsley/git-subrepo
678c8dcde1061f5f32753662b13fc915ae7f62fa
[ "MIT" ]
285
2015-01-26T22:46:43.000Z
2022-03-29T16:03:22.000Z
#!/usr/bin/env bash set -e source test/setup use Test::More clone-foo-and-bar subrepo-clone-bar-into-foo ( cd "$OWNER/bar" add-new-files Bar2 git push ) &> /dev/null || die # Do the pull and check output: { is "$( cd "$OWNER/foo" git subrepo pull bar )" \ "Subrepo 'bar' pulled from '$UPSTREAM/bar' (master)." \ 'subrepo pull command output is correct' } # Test subrepo file content: gitrepo=$OWNER/foo/bar/.gitrepo { test-exists \ "$OWNER/foo/bar/Bar2" \ "$gitrepo" } # Test foo/bar/.gitrepo file contents: { foo_pull_commit=$(cd "$OWNER/foo"; git rev-parse HEAD^) bar_head_commit=$(cd "$OWNER/bar"; git rev-parse HEAD) test-gitrepo-comment-block test-gitrepo-field "remote" "$UPSTREAM/bar" test-gitrepo-field "branch" "master" test-gitrepo-field "commit" "$bar_head_commit" test-gitrepo-field "parent" "$foo_pull_commit" test-gitrepo-field "cmdver" "$(git subrepo --version)" } # Check commit messages { foo_new_commit_message=$(cd "$OWNER/foo"; git log --format=%B -n 1) like "$foo_new_commit_message" \ "git subrepo pull bar" \ "Subrepo pull commit message OK" bar_commit_short=$(git rev-parse --short "$bar_head_commit") like "$foo_new_commit_message" \ "merged: \"$bar_commit_short" \ "Pull commit contains merged" } # Check that we detect that we don't need to pull { is "$( cd "$OWNER/foo" git subrepo pull bar )" \ "Subrepo 'bar' is up to date." \ 'subrepo detects that we dont need to pull' } # Test pull if we have rebased the original subrepo so that our clone # commit is no longer present in the history ( cd "$OWNER/bar" git reset --hard master^^ add-new-files Bar3 git push --force ) &> /dev/null || die { test-exists \ !"$OWNER/foo/pull_failed" } ( cd "$OWNER/foo" git subrepo pull bar || touch pull_failed ) &> /dev/null || die # We check that the control file was created { test-exists \ "$OWNER/foo/pull_failed" } done_testing # 9 teardown
20.08
69
0.659363
ed911528ac476cd62fc8b8b9de829a42ffbb8902
3,846
pm
Perl
lib/MooseX/Storage/Basic.pm
git-the-cpan/MooseX-Storage
5b2e16f8f92c4c4f5e5fa6fe66fb01eeb18a2627
[ "Artistic-1.0" ]
null
null
null
lib/MooseX/Storage/Basic.pm
git-the-cpan/MooseX-Storage
5b2e16f8f92c4c4f5e5fa6fe66fb01eeb18a2627
[ "Artistic-1.0" ]
null
null
null
lib/MooseX/Storage/Basic.pm
git-the-cpan/MooseX-Storage
5b2e16f8f92c4c4f5e5fa6fe66fb01eeb18a2627
[ "Artistic-1.0" ]
null
null
null
package MooseX::Storage::Basic; # ABSTRACT: The simplest level of serialization our $VERSION = '0.51'; # TRIAL use Moose::Role; use MooseX::Storage::Engine; use String::RewritePrefix; use namespace::autoclean; sub pack { my ( $self, %args ) = @_; my $e = $self->_storage_get_engine_class(%args)->new( object => $self ); $e->collapse_object(%args); } sub unpack { my ($class, $data, %args) = @_; my $e = $class->_storage_get_engine_class(%args)->new(class => $class); $class->_storage_construct_instance( $e->expand_object($data, %args), \%args ); } sub _storage_get_engine_class { my ($self, %args) = @_; return 'MooseX::Storage::Engine' unless ( exists $args{engine_traits} && ref($args{engine_traits}) eq 'ARRAY' && scalar(@{$args{engine_traits}}) ); my @roles = String::RewritePrefix->rewrite( { '' => 'MooseX::Storage::Engine::Trait::', '+' => '', }, @{$args{engine_traits}} ); Moose::Meta::Class->create_anon_class( superclasses => ['MooseX::Storage::Engine'], roles => [ @roles ], cache => 1, )->name; } sub _storage_construct_instance { my ($class, $args, $opts) = @_; my %i = defined $opts->{'inject'} ? %{ $opts->{'inject'} } : (); $class->new( %$args, %i ); } no Moose::Role; 1; __END__ =pod =encoding UTF-8 =head1 NAME MooseX::Storage::Basic - The simplest level of serialization =head1 VERSION version 0.51 =head1 SYNOPSIS package Point; use Moose; use MooseX::Storage; with Storage; has 'x' => (is => 'rw', isa => 'Int'); has 'y' => (is => 'rw', isa => 'Int'); 1; my $p = Point->new(x => 10, y => 10); ## methods to pack/unpack an ## object in perl data structures # pack the class into a hash $p->pack(); # { __CLASS__ => 'Point-0.01', x => 10, y => 10 } # unpack the hash into a class my $p2 = Point->unpack({ __CLASS__ => 'Point-0.01', x => 10, y => 10 }); # unpack the hash, with injection of additional paramaters my $p3 = Point->unpack( $p->pack, inject => { x => 11 } ); =head1 DESCRIPTION This is the most basic form of serialization. This is used by default but the exported C<Storage> function. =head1 METHODS =over 4 =item B<pack ([ disable_cycle_check => 1])> Providing the C<disable_cycle_check> argument disables checks for any cyclical references. The current implementation for this check is rather naive, so if you know what you are doing, you can bypass this check. This trait is applied on a perl-case basis. To set this flag for all objects that inherit from this role, see L<MooseX::Storage::Traits::DisableCycleDetection>. =item B<unpack ($data [, inject => { key => val, ... } ] )> Providing the C<inject> argument lets you supply additional arguments to the class' C<new> function, or override ones from the serialized data. =back =head1 SUPPORT Bugs may be submitted through L<the RT bug tracker|https://rt.cpan.org/Public/Dist/Display.html?Name=MooseX-Storage> (or L<bug-MooseX-Storage@rt.cpan.org|mailto:bug-MooseX-Storage@rt.cpan.org>). There is also a mailing list available for users of this distribution, at L<http://lists.perl.org/list/moose.html>. There is also an irc channel available for users of this distribution, at L<C<#moose> on C<irc.perl.org>|irc://irc.perl.org/#moose>. =head1 AUTHORS =over 4 =item * Chris Prather <chris.prather@iinteractive.com> =item * Stevan Little <stevan.little@iinteractive.com> =item * יובל קוג'מן (Yuval Kogman) <nothingmuch@woobling.org> =back =head1 COPYRIGHT AND LICENSE This software is copyright (c) 2007 by Infinity Interactive, Inc. This is free software; you can redistribute it and/or modify it under the same terms as the Perl 5 programming language system itself. =cut
23.168675
116
0.652626
ed7ea979a5c55ba489bb8e2df7ee57dc50c203e5
1,243
t
Perl
_build/debian/perl-framework/t/modules/proxy_websockets.t
pkgstore/linux-deb-apache2
ae53a72b87adfeb59815cbbd9ef7291699689a04
[ "Apache-2.0" ]
5
2020-06-20T03:50:03.000Z
2021-11-16T10:57:30.000Z
_build/debian/perl-framework/t/modules/proxy_websockets.t
pkgstore/linux-deb-apache2
ae53a72b87adfeb59815cbbd9ef7291699689a04
[ "Apache-2.0" ]
null
null
null
_build/debian/perl-framework/t/modules/proxy_websockets.t
pkgstore/linux-deb-apache2
ae53a72b87adfeb59815cbbd9ef7291699689a04
[ "Apache-2.0" ]
4
2020-04-10T21:16:56.000Z
2021-12-24T04:10:12.000Z
use strict; use warnings FATAL => 'all'; use Apache::Test; use Apache::TestRequest; use Apache::TestUtil; use Apache::TestConfig (); my $total_tests = 1; plan tests => $total_tests, need 'AnyEvent::WebSocket::Client', need_module('proxy_http', 'lua'), need_min_apache_version('2.4.47'); require AnyEvent; require AnyEvent::WebSocket::Client; my $config = Apache::Test::config(); my $hostport = Apache::TestRequest::hostport(); my $client = AnyEvent::WebSocket::Client->new(timeout => 5); my $quit_program = AnyEvent->condvar; my $pingok = 0; $client->connect("ws://$hostport/proxy/wsoc")->cb(sub { our $connection = eval { shift->recv }; t_debug("wsoc connected"); if($@) { # handle error... warn $@; $quit_program->send(); return; } $connection->send('ping'); # recieve message from the websocket... $connection->on(each_message => sub { # $connection is the same connection object # $message isa AnyEvent::WebSocket::Message my($connection, $message) = @_; t_debug("wsoc msg received: " . $message->body); if ("ping" eq $message->body) { $pingok = 1; } $connection->send('quit'); $quit_program->send(); }); }); $quit_program->recv; ok t_cmp($pingok, 1);
23.018519
72
0.645213
73ef6451e57c9c206271ec0e36c36f5ce99147cc
6,674
pl
Perl
zxidnewuser.pl
marek-knappe/zxid-ubuntu
7f7de3f0d1f7e97ef58e6738d33a53b06c584d76
[ "curl", "Apache-2.0", "OpenSSL", "ECL-2.0" ]
null
null
null
zxidnewuser.pl
marek-knappe/zxid-ubuntu
7f7de3f0d1f7e97ef58e6738d33a53b06c584d76
[ "curl", "Apache-2.0", "OpenSSL", "ECL-2.0" ]
null
null
null
zxidnewuser.pl
marek-knappe/zxid-ubuntu
7f7de3f0d1f7e97ef58e6738d33a53b06c584d76
[ "curl", "Apache-2.0", "OpenSSL", "ECL-2.0" ]
1
2019-01-27T14:40:41.000Z
2019-01-27T14:40:41.000Z
#!/usr/bin/perl # Copyright (c) 2012-2014 Synergetics SA (sampo@synergetics.be), All Rights Reserved. # Copyright (c) 2010 Sampo Kellomaki (sampo@iki.fi), All Rights Reserved. # This is confidential unpublished proprietary source code of the author. # NO WARRANTY, not even implied warranties. Contains trade secrets. # Distribution prohibited unless authorized in writing. # Licensed under Apache License 2.0, see file COPYING. # $Id$ # # 8.3.2010, created --Sampo # 5.2.2012, changed zxpasswd to use -n instead of -c --Sampo # 9.2.2014, changed to use zxpasswd -new # # Web GUI for creating new user, possibly in middle of login sequence. # The AuthnRequest is preserved through new user creation by passing ar. $from = 'sampo-pwbot-noreply@zxid.org'; $admin_mail = 'sampo-pwadm@zxid.org'; $dir = '/var/zxid/idp'; $usage = <<USAGE; Web GUI for creating new user, possibly in middle of login sequence. Usage: http://localhost:8081/zxidnewuser.pl?QUERY_STRING ./zxidnewuser.pl -a QUERY_STRING -a Ascii mode -t Test mode USAGE ; die $usage if $ARGV[0] =~ /^-[Hh?]/; if ($ARGV[0] eq '-t') { warn "Sending..."; send_detail("Test $$"); exit; } use Data::Dumper; use MIME::Base64; close STDERR; open STDERR, ">>/var/tmp/zxid.stderr" or die "Cant open error log: $!"; select STDERR; $|=1; select STDOUT; ($sec,$min,$hour,$mday,$mon,$year) = gmtime(time); $ts = sprintf "%04d%02d%02d-%02d%02d%02d", $year+1900, $mon+1, $mday, $hour, $min, $sec; #warn "$$: START env: " . Dumper(\%ENV); $ENV{QUERY_STRING} ||= shift; cgidec($ENV{QUERY_STRING}); if ($ENV{CONTENT_LENGTH}) { sysread STDIN, $data, $ENV{CONTENT_LENGTH}; #warn "GOT($data) $ENV{CONTENT_LENGTH}"; cgidec($data); } warn "$$: cgi: " . Dumper(\%cgi); sub uridec { my ($val) = @_; $val =~ s/\+/ /g; $val =~ s/%([0-9a-f]{2})/chr(hex($1))/gsexi; # URI decode return $val; } sub urienc { my ($val) = @_; $val =~ s/([^A-Za-z0-9.,_-])/sprintf("%%%02x",ord($1))/gsex; # URI enc return $val; } sub cgidec { my ($d) = @_; for $nv (split '&', $d) { ($n, $v) = split '=', $nv, 2; $cgi{$n} = uridec($v); } } sub readall { my ($f) = @_; my ($pkg, $srcfile, $line) = caller; undef $/; # Read all in, without breaking on lines open F, "<$f" or die "$srcfile:$line: Cant read($f): $!"; binmode F; my $x = <F>; close F; return $x; } sub show_templ { my ($templ, $hr) = @_; $templ = readall($templ); $templ =~ s/!!(\w+)/$$hr{$1}/gs; my $len = length $templ; syswrite STDOUT, "Content-Type: text/html\r\nContent-Length: $len\r\n\r\n$templ"; exit; } sub redirect { my ($url) = @_; syswrite STDOUT, "Location: $url\r\n\r\n"; exit; } sub send_mail { my ($to, $subj, $body) = @_; open S, "|/usr/sbin/sendmail -i -B 8BITMIME -t" or die "No sendmail in path: $! $?"; $msg = <<MAIL; From: $from To: $to Subject: $subj MIME-Version: 1.0 Content-Type: text/plain; charset=ISO-8859-1 Content-Transfer-Encoding: 8bit $body MAIL ; warn "msr($msg)"; print S $msg; close S; } sub send_detail { my ($subj) = @_; send_mail($admin_mail, $subj, <<BODY); uid: $cgi{'au'} ip: $ENV{REMOTE_ADDR} title: $cgi{'title'} o: $cgi{'o'} ou: $cgi{'ou'} email: $cgi{'email'} im: $cgi{'im'} tel: $cgi{'tel'} tag: $cgi{'tag'} Comments or special requests: $cgi{'comment'} BODY ; } if (length $cgi{'continue'}) { if ($cgi{'zxidpurl'} && $cgi{'zxrfr'} && $cgi{'ar'}) { warn "Redirecting back to IdP"; redirect("$cgi{'zxidpurl'}?o=$cgi{'zxrfr'}&ar=$cgi{'ar'}"); } else { warn "Redirecting back to index page."; redirect("/"); } } ### MAIN if (length $cgi{'ok'}) { if (length $cgi{'au'} < 3 || length $cgi{'au'} > 40) { $cgi{'ERR'} = "Username must be at least 3 characters long (and no longer than 40 chars)."; } elsif ($cgi{'au'} !~ /^[A-Za-z0-9_-]+$/s) { $cgi{'ERR'} = "Username can only contain characters [A-Za-z0-9_-]"; } elsif (length $cgi{'ap'} < 5 || length $cgi{'ap'} > 80) { $cgi{'ERR'} = "Password must be at least 5 characters long (and no longer than 80 chars)."; } elsif (-e "${dir}uid/$cgi{'au'}") { $cgi{'ERR'} = "Username already taken."; } else { warn "Creating new user($cgi{'au'})"; open P, "|./zxpasswd -new $cgi{'au'} ${dir}uid" or die "Cant open pipe to zxpasswd: $! $?"; print P $cgi{'ap'}; close P; warn "Populating user($cgi{'au'})"; if (-e "${dir}uid/$cgi{'au'}") { open LOG, ">${dir}uid/$cgi{'au'}/.log" or die "Cant open write .log: $!"; print LOG "$ts Created $cgi{'au'} ip=$ENV{REMOTE_ADDR}\n" or die "Cant write .log: $!"; close LOG or die "Cant close write .log: $!"; open IP, ">${dir}uid/$cgi{'au'}/.regip" or die "Cant open write .regip: $!"; print IP $ENV{REMOTE_ADDR} or die "Cant write .regip: $!"; close IP or die "Cant close write .regip: $!"; if ($cgi{'humanintervention'} > 0) { open HUMAN, ">${dir}uid/$cgi{'au'}/.human" or die "Cant open write .human: $!"; print HUMAN $cgi{'humanintervention'} or die "Cant write .human: $!"; close HUMAN or die "Cant close write .human: $!"; } #mkdir "${dir}uid/$cgi{'au'}/.bs" or warn "Cant mkdir .bs: $!"; zxpasswd creates .bs open AT, ">${dir}uid/$cgi{'au'}/.bs/.at" or die "Cant write .bs/.at: $!"; open OPTAT, ">${dir}uid/$cgi{'au'}/.bs/.optat" or die "Cant write .bs/.optat: $!"; for $at (qw(cn title taxno o ou street citystc email im tel lang tag)) { $val = $cgi{$at}; $val =~ s/[\r\n]//g; next if !length $val; if ($cgi{"${at}share"}) { print AT "$at: $val\n"; } else { print OPTAT "$at: $val\n"; } } close AT; close OPTAT; send_detail("New User $cgi{'au'}"); if ($cgi{'zxidpurl'} && $cgi{'zxrfr'} && $cgi{'ar'}) { warn "Created user($cgi{'au'})"; $cgi{MSG} = "Success! Created user $cgi{'au'}. Click Continue to get back to IdP login."; show_templ("newuser-status.html", \%cgi); } else { warn "Created user($cgi{'au'})"; $cgi{MSG} = "Success! Created user $cgi{'au'}. Click Continue to get back to top."; show_templ("newuser-status.html", \%cgi); } } else { $cgi{'ERR'} = "User creation failed. System error (${dir}uid/$cgi{'au'})."; } } } $cgi{'humaninterventionchecked'} = $cgi{'humanintervention'} eq '1' ? ' checked':''; $cgi{'ip'} = $ENV{REMOTE_ADDR}; if (!length $cgi{'ap'}) { open R, "</dev/urandom" or die "Cant open read /dev/urandom: $!"; sysread R, $pw, 9; close R; $cgi{'ap'} = encode_base64($pw,''); # Just a suggestion } show_templ("newuser-main.html", \%cgi); __END__
29.144105
92
0.578214
ed928212bb7a9ed2df614cb929f1c5aaddf078a0
13,448
pm
Perl
Website/workshop/slides/pinney/LoadSageResults.pm
EuPathDB-Infra/GusAppFramework
f9ad75276f3314fc310f8047b9a769eb75f63fca
[ "Apache-2.0" ]
null
null
null
Website/workshop/slides/pinney/LoadSageResults.pm
EuPathDB-Infra/GusAppFramework
f9ad75276f3314fc310f8047b9a769eb75f63fca
[ "Apache-2.0" ]
null
null
null
Website/workshop/slides/pinney/LoadSageResults.pm
EuPathDB-Infra/GusAppFramework
f9ad75276f3314fc310f8047b9a769eb75f63fca
[ "Apache-2.0" ]
1
2020-11-10T15:43:42.000Z
2020-11-10T15:43:42.000Z
# $Id: LoadSageResults.pm 3041 2005-06-24 21:56:03Z pinney $ package GUS::Community::Plugin::LoadSageResults; @ISA = qw(GUS::PluginMgr::Plugin); use strict; use GUS::PluginMgr::Plugin; use GUS::Model::Study::Study; use GUS::Model::RAD::ArrayDesign; use GUS::Model::RAD::Acquisition; use GUS::Model::RAD::Assay; use GUS::Model::RAD::StudyAssay; use GUS::Model::RAD::Quantification; use GUS::Model::RAD::SAGETag; use GUS::Model::RAD::SAGETagResult; use GUS::Model::SRes::Contact; $| = 1; # --------------------------------------------------------------------------- # Load Arguments # --------------------------------------------------------------------------- sub getArgumentsDeclaration{ my $argsDeclaration = [ stringArg({name => 'contact', descr => 'name,first,last as they should appear in sres.contact', constraintFunc => undef, reqd => 1, isList => 1 }), stringArg({name => 'arrayDesignName', descr => 'rad.ArrayDesign.name used for this set of sage tags', constraintFunc => undef, reqd => 1, isList => 0 }), stringArg({name => 'arrayDesignVersion', descr => 'rad.ArrayDesign.version used for this set of sage tags', constraintFunc => undef, reqd => 1, isList => 0 }), stringArg({name => 'studyName', descr => 'value for study.name', constraintFunc => undef, reqd => 1, isList => 0 }), stringArg({name => 'studyDescription', descr => 'value for study.description', constraintFunc => undef, reqd => 0, isList => 0 }), fileArg({name => 'freqFile', descr => 'full path of the sage tag frequency filw, tab delimited with tissue/strains as tab delimite header.', constraintFunc=> undef, reqd => 1, isList => 0, mustExist => 1, format => 'tab delimited, first column contains tag sequences, first row contains the label tag followed by sample source names' }), integerArg({name => 'testnum', descr => 'The number of data lines to read when testing this plugin. Not to be used in commit mode.', constraintFunc=> undef, reqd => 0, isList => 0 }) ]; return $argsDeclaration; } # -------------------------------------------------------------------------- # Documentation # -------------------------------------------------------------------------- sub getDocumentation { my $purposeBrief = <<PURPOSEBRIEF; Plug_in to populate RAD.SAGETagResult. PURPOSEBRIEF my $purpose = <<PLUGIN_PURPOSE; plug_in that inserts frequency results into RAD.SAGETagResult and retrieves or creates supporting objects. PLUGIN_PURPOSE my $syntax = <<SYNTAX; Standard plugin syntax. SYNTAX #check the documentation for this my $tablesAffected = [['GUS::Model::Study::Study', 'inserts a single row for entire set of results'],['GUS::Model::RAD::Assay', 'inserts a row for each tissue/organism source included in result file'],['GUS::Model::RAD::StudyAssay','inserts a linking row for each Assay row'],['GUS::Model::RAD::Acquisition','inserts a single row for each Assay'],['GUS::Model::RAD::Quantification','inserts a single row for each Assay row'],['GUS::Model::RAD::SAGETagResult','inserts frequencies from input file'],['GUS::Model::SRes::Contact','inserts a row if row cannot be retrieved using contact arg']]; my $tablesDependedOn = [['GUS::Model::RAD::ArrayDesign', 'Gets an existing ArrayDesign row'],['GUS::Model::RAD::SAGETag', 'Gets existing sage tag rows for each row in the input file']]; my $howToRestart = <<PLUGIN_RESTART; Explicit restart is not needed as frequency files are relatively short and rows in the db will not be clobbered. PLUGIN_RESTART my $failureCases = <<PLUGIN_FAILURE_CASES; no ArrayDesign or SAGETag rows corresponding to previously entered and required tags. PLUGIN_FAILURE_CASES my $notes = <<PLUGIN_NOTES; SAGETag with tag sequences must have been previously entered along with the required ArrayDesign row. Input file must be in the correct tab delimited format. First row must contain a beginning label called tag followed by the names of the frequency sources. Subsequent rows must start with the tag sequence followed by the integers representing the frequencies in each of the data sources. PLUGIN_NOTES my $documentation = {purposeBrief => $purposeBrief, purpose => $purpose, syntax => $syntax, tablesAffected => $tablesAffected, tablesDependedOn => $tablesDependedOn, howToRestart => $howToRestart, failureCases => $failureCases, notes => $notes }; return ($documentation); } ############################################################################# # Create a new instance of a SageResultLoader object ############################################################################# sub new { my ($class) = @_; my $self = {}; bless($self,$class); my $documentation = &getDocumentation(); my $arguments = &getArgumentsDeclaration(); my $configuration = {requiredDbVersion => 3.5, cvsRevision => '$Revision: 3041 $', # cvs fills this in! name => ref($self), revisionNotes => 'make consistent with GUS 3.5', argsDeclaration => $arguments, documentation => $documentation }; $self->initialize($configuration); return $self; } ######################################################################## # Main Program ######################################################################## sub run { my ($self) = @_; $self->logArgs(); $self->logAlgInvocationId(); $self->logCommit(); $self->checkFileFormat(); my $contact = $self->getContact(); my $study = $self->getStudy($contact); my $assayNames = $self->getAssayNames(); my $arrayDesign = $self->getArrayDesign(); my $quantificationIds = $self->getQuantificationIds($assayNames,$study,$contact,$arrayDesign); my $numFreqsInserted = $self->insertSageTagResults($quantificationIds, $arrayDesign); my $resultDescrip = "$$numFreqsInserted rows inserted into SageTageResults"; $self->setResultDescr($resultDescrip); $self->logData($resultDescrip); } sub checkFileFormat { my ($self) = @_; my $file = $self->getArg('freqFile'); open(FILE,$file); my $assayNum; while(<FILE>) { chomp; my @assays = split (/\t/,$_); if ($. == 1) { $self->userError("Frequency file does not contain a well formatted heading, tab delimited, 'tag' followed by sources of RNA \n") unless ($_ =~ /^tag/ && @assays > 1); $assayNum = @assays; } if ($. != 1) { $self->userError("Frequency file does not contain the correct number of columns\n") unless (@assays == $assayNum); $self->userError("The first column of the frequency file does not contain a tag sequence\n") unless ($assays[0] =~ /[ACTGNactgn]+/); for (my $i=1;$i<$assayNum;$i++) { $self->userError("At least one frequency in the frequency file does not contain an integer\n") unless ($assays[$i] =~ /\d*/); } } } $self->log("Frequency file format is correct\n"); close (FILE); } sub getContact { my ($self) = @_; my $contactHash; if(defined $self->getArg('contact')->[0]) { $contactHash->{name}=$self->getArg('contact')->[0];} if(defined $self->getArg('contact')->[1]) { $contactHash->{first}=$self->getArg('contact')->[1];} if(defined $self->getArg('contact')->[2]) { $contactHash->{last}=$self->getArg('contact')->[2];} my $contact = GUS::Model::SRes::Contact->new($contactHash); if ($contact) { $self->log("Obtained contact object\n"); } else { $self->userError("Unable to obtain contact object\n"); } if (! $contact->retrieveFromDB()) { $contact->submit(); } return $contact } sub getStudy { my ($self, $contact) = @_; my $study = GUS::Model::Study::Study->new({'name'=>$self->getArg('studyName')}); $study->retrieveFromDB(); if ($self->getArg('studyDescription') && ($study->getDescription() ne $self->getArg('studyDescription'))) { $study->setDescription($self->getArg('studyDescription')); } $study->setParent($contact); my $subNum = $study->submit(); $self->log("$subNum rows submitted with study\n"); return $study; } sub getAssayNames{ my ($self) = @_; my $file = $self->getArg('freqFile'); open(FILE,$file); my @assayNames; while(<FILE>) { if ($_ =~ /tag/) { @assayNames = split (/\t/,$_); } } my $num = @assayNames; $self->log("$num assay names found\n"); close (FILE); return \@assayNames; } sub getArrayDesign { my ($self) = @_; my $arrayDesign = GUS::Model::RAD::ArrayDesign->new({'name'=>$self->getArg('arrayDesignName'),'version'=>$self->getArg('arrayDesignVersion')}); if (! $arrayDesign->retrieveFromDB()) { $self->userError("--arrayDesignName " . $self->getArg('arrayDesignName') . "and --arrayDesignVersion " . $self->getArg('arrayDesignVersion') . " do not return a valid ArrayDesign object\n"); } else { $self->log("ArrayDesign row located\n"); } return $arrayDesign; } sub getQuantificationIds { my ($self,$assayNames,$study,$contact,$arrayDesign) = @_; my $tableId = $self->getTableId(); my @quantificationIds; for (my $i = 1;$i < @$assayNames;$i++) { my $assayName = $assayNames->[$i]; my $assay = $self->getAssay($assayName,$arrayDesign,$contact); $assay->getChild('GUS::Model::RAD::StudyAssay',1) ? $assay->getChild('GUS::Model::RAD::StudyAssay') : $self->makeStudyAssay($assay,$study); my $acquisition = $assay->getChild('GUS::Model::RAD::Acquisition',1) ? $assay->getChild('GUS::Model::RAD::Acquisition') : $self->makeAcquisition($assay,$assayName); my $quantification = $acquisition->getChild('GUS::Model::RAD::Quantification',1) ? $acquisition->getChild('GUS::Model::RAD::Quantification') : $self->makeQuantification($acquisition,$assayName,$tableId); $assay->submit(); my $quantificationId = $quantification->getId(); $quantificationIds[$i] = $quantificationId; } my $num = @quantificationIds; $self->log("$num quantification_ids obtained\n"); $self->undefPointerCache(); return \@quantificationIds; } sub getAssay { my ($self,$assayName,$arrayDesign,$contact) = @_; my $assay = GUS::Model::RAD::Assay->new({'name' => $assayName}); $assay->retrieveFromDB(); $assay->setParent($arrayDesign); $assay->setParent($contact); return $assay; } sub makeStudyAssay { my ($self,$assay,$study) = @_; my $studyAssay = GUS::Model::RAD::StudyAssay->new(); if ($studyAssay) { $self->log("Obtained StudyAssay object\n"); } else { $self->userError("Unable to obtain StudyAssay object\n"); } $studyAssay->setParent($assay); $studyAssay->setParent($study); } sub makeAcquisition { my ($self,$assay,$assayName) = @_; my $acquisition = GUS::Model::RAD::Acquisition->new({'name'=>$assayName}); if ($acquisition) { $self->log("Obtained acquisition object\n"); } else { $self->userError("Unable to obtain acquisition object\n"); } $acquisition->setParent($assay); return $acquisition; } sub makeQuantification { my ($self,$acquisition,$assayName,$tableId) = @_; my $quantification = GUS::Model::RAD::Quantification->new({'name'=>$assayName,'uri'=>$self->getArg('freqFile'),'result_table_id'=>$tableId}); if ($quantification) { $self->log("Obtained quantification object\n"); } else { $self->userError("Unable to obtain quantification object\n"); } $quantification->setParent($acquisition); return $quantification; } sub getTableId { my ($self) = @_; my $query="select t.table_id from core.tableinfo t, core.databaseinfo d where t.name='SAGETagResult' and d.name = 'RAD' and t.database_id = d.database_id"; my $dbh = $self->getQueryHandle(); my $sth = $dbh->prepare($query); $sth->execute(); my ($id) = $sth->fetchrow_array(); $sth->finish(); if (defined $id) { return $id; } else { $self->log("Can't retrieve table_id for SAGETagResult\n"); } } sub insertSageTagResults { my ($self,$quantificationIds, $arrayDesign) = @_; my $file = $self->getArg('freqFile'); my $num; open(FILE,$file); my $linenum = 0; while(<FILE>) { chomp; if ($_ =~ /tag/) { next; } if ($self->getArg('testnum') && $linenum >= $self->getArg('testnum')) { return \$num; } my @line = split(/\t/, $_); $self->processLine(\@line,$arrayDesign,$quantificationIds,\$num); $linenum++; $self->log("$linenum lines from the frequency file have been processed\n") if $linenum % 1000 == 0; } $self->log("$linenum lines from the frequency file have been processed\n"); return \$num; } sub processLine { my ($self,$line,$arrayDesign,$quantificationIds,$num) = @_; my $numQ = @$quantificationIds; my $arrayDesignId = $arrayDesign->get('array_design_id'); for (my $i=1;$i < @$line;$i++) { my $sageTag = GUS::Model::RAD::SAGETag->new({'tag'=>$line->[0], 'array_design_id'=>$arrayDesignId}); if (! $sageTag->retrieveFromDB()) { $self->userError("SAGE tag $line->[0] with array_design_id = $arrayDesignId not in db\n"); } my $sageTagResult = GUS::Model::RAD::SAGETagResult->new({'subclass_view'=>"SAGETagResult", 'quantification_id'=>$quantificationIds->[$i],'tag_count'=>$line->[$i]}); $sageTagResult->setParent($sageTag); $$num += $sageTagResult->submit(); } $self->undefPointerCache(); }
27.004016
590
0.621133
ed4646a7b5d90b1e0147c71702481e62b9c1a277
11,582
al
Perl
Apps/DK/OIOUBL/app/src/Reminder/ExportIssuedReminder.Codeunit.al
manjulchauhan/ALAppExtensions
3f2f1d6e5337188b1af9c0275420f1c1de036a7f
[ "MIT" ]
127
2018-04-17T18:03:03.000Z
2019-05-06T18:54:17.000Z
Apps/DK/OIOUBL/app/src/Reminder/ExportIssuedReminder.Codeunit.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
2,279
2018-09-12T12:01:49.000Z
2019-05-06T13:59:35.000Z
Apps/DK/OIOUBL/app/src/Reminder/ExportIssuedReminder.Codeunit.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
41
2018-05-17T11:19:52.000Z
2019-04-30T17:30:38.000Z
// ------------------------------------------------------------------------------------------------ // Copyright (c) Microsoft Corporation. All rights reserved. // Licensed under the MIT License. See License.txt in the project root for license information. // ------------------------------------------------------------------------------------------------ codeunit 13639 "OIOUBL-Export Issued Reminder" { TableNo = "Issued Reminder Header"; Permissions = tabledata "Issued Reminder Header" = rm; var GLSetup: Record "General Ledger Setup"; CompanyInfo: Record "Company Information"; IssuedReminder: Record "Issued Reminder Header"; IssuedReminderLine: Record "Issued Reminder Line"; SalesSetup: Record "Sales & Receivables Setup"; OIOUBLDocumentEncode: Codeunit "OIOUBL-Document Encode"; OIOUBLCommonLogic: Codeunit "OIOUBL-Common Logic"; DocNameSpace: Text[250]; DocNameSpace2: Text[250]; local procedure InsertReminderTaxTotal(var ReminderElement: XmlElement; var IssuedReminderLine: Record "Issued Reminder Line"; TotalTaxAmount: Decimal; CurrencyCode: Code[10]); var TaxTotalElement: XmlElement; TaxableAmount: Decimal; TaxAmount: Decimal; VATPercentage: Decimal; begin TaxTotalElement := XmlElement.Create('TaxTotal', DocNameSpace2); TaxTotalElement.Add( XmlElement.Create('TaxAmount', DocNameSpace, XmlAttribute.Create('currencyID', CurrencyCode), OIOUBLDocumentEncode.DecimalToText(TotalTaxAmount))); // Invoice->TaxTotal (for ("Normal VAT" AND "VAT %" <> 0) OR "Full VAT") IssuedReminderLine.SETFILTER( "VAT Calculation Type", '%1|%2', IssuedReminderLine."VAT Calculation Type"::"Normal VAT", IssuedReminderLine."VAT Calculation Type"::"Full VAT"); if IssuedReminderLine.FINDFIRST() then begin TaxableAmount := 0; TaxAmount := 0; IssuedReminderLine.SETFILTER("VAT %", '<>0'); if IssuedReminderLine.FINDSET() then begin VATPercentage := IssuedReminderLine."VAT %"; repeat UpdateTaxAmtAndTaxableAmt(IssuedReminderLine.Amount, IssuedReminderLine."VAT Amount", TaxableAmount, TaxAmount); until IssuedReminderLine.NEXT() = 0; OIOUBLCommonLogic.InsertTaxSubtotal( TaxTotalElement, IssuedReminderLine."VAT Calculation Type".AsInteger(), TaxableAmount, TaxAmount, VATPercentage, CurrencyCode); end; TaxableAmount := 0; TaxAmount := 0; IssuedReminderLine.SETRANGE("VAT %", 0); IssuedReminderLine.SETRANGE("VAT Calculation Type", IssuedReminderLine."VAT Calculation Type"::"Normal VAT"); if IssuedReminderLine.FINDSET() then begin VATPercentage := IssuedReminderLine."VAT %"; repeat UpdateTaxAmtAndTaxableAmt(IssuedReminderLine.Amount, IssuedReminderLine."VAT Amount", TaxableAmount, TaxAmount); until IssuedReminderLine.NEXT() = 0; // Invoice->TaxTotal->TaxSubtotal OIOUBLCommonLogic.InsertTaxSubtotal( TaxTotalElement, IssuedReminderLine."VAT Calculation Type".AsInteger(), TaxableAmount, TaxAmount, VATPercentage, CurrencyCode); end; end; // Invoice->TaxTotal (for "Reverse Charge VAT") IssuedReminderLine.SETRANGE("VAT %"); IssuedReminderLine.SETRANGE("VAT Calculation Type", IssuedReminderLine."VAT Calculation Type"::"Reverse Charge VAT"); if IssuedReminderLine.FINDSET() then begin TaxableAmount := 0; TaxAmount := 0; VATPercentage := IssuedReminderLine."VAT %"; repeat UpdateTaxAmtAndTaxableAmt(IssuedReminderLine.Amount, IssuedReminderLine."VAT Amount", TaxableAmount, TaxAmount); until IssuedReminderLine.NEXT() = 0; OIOUBLCommonLogic.InsertTaxSubtotal( TaxTotalElement, IssuedReminderLine."VAT Calculation Type".AsInteger(), TaxableAmount, TaxAmount, VATPercentage, CurrencyCode); end; ReminderElement.Add(TaxTotalElement); end; trigger OnRun(); var IssuedReminderLine2: Record "Issued Reminder Line"; ContactStandardAddress: Record "Standard Address"; ContactInfo: Record Contact; OIOUBLManagement: Codeunit "OIOUBL-Management"; TempBlob: Codeunit "Temp Blob"; XMLdocOut: XmlDocument; XMLCurrNode: XmlElement; CurrencyCode: Code[10]; TaxableAmount: Decimal; TaxAmount: Decimal; TotalTaxAmount: Decimal; TotalAmount: Decimal; FileOutstream: Outstream; begin CODEUNIT.RUN(CODEUNIT::"OIOUBL-Check Issued Reminder", Rec); GLSetup.GET(); CompanyInfo.GET(); if "Currency Code" = '' then CurrencyCode := GLSetup."LCY Code" else CurrencyCode := "Currency Code"; IssuedReminderLine.SETRANGE("Reminder No.", "No."); IssuedReminderLine.SETFILTER(Type, '>%1', 0); IssuedReminderLine.SETFILTER("No.", '<>%1', ' '); if NOT IssuedReminderLine.FINDSET() then EXIT; // Reminder XmlDocument.ReadFrom(OIOUBLCommonLogic.GetReminderHeader(), XMLdocOut); XMLdocOut.GetRoot(XMLCurrNode); OIOUBLCommonLogic.init(DocNameSpace, DocNameSpace2); XMLCurrNode.Add(XmlElement.Create('UBLVersionID', DocNameSpace, '2.0')); XMLCurrNode.Add(XmlElement.Create('CustomizationID', DocNameSpace, 'OIOUBL-2.02')); XMLCurrNode.Add( XmlElement.Create('ProfileID', DocNameSpace, XmlAttribute.Create('schemeID', 'urn:oioubl:id:profileid-1.2'), XmlAttribute.Create('schemeAgencyID', '320'), 'Procurement-BilSim-1.0')); XMLCurrNode.Add(XmlElement.Create('ID', DocNameSpace, "No.")); XMLCurrNode.Add(XmlElement.Create('CopyIndicator', DocNameSpace, OIOUBLDocumentEncode.BooleanToText("OIOUBL-Electronic Reminder Created"))); XMLCurrNode.Add(XmlElement.Create('IssueDate', DocNameSpace, OIOUBLDocumentEncode.DateToText("Posting Date"))); XMLCurrNode.Add( XmlElement.Create('ReminderTypeCode', DocNameSpace, XmlAttribute.Create('listID', 'urn:oioubl.codelist:remindertypecode-1.1'), XmlAttribute.Create('listAgencyID', '320'), 'Advis')); XMLCurrNode.Add(XmlElement.Create('ReminderSequenceNumeric', DocNameSpace, '1')); XMLCurrNode.Add(XmlElement.Create('DocumentCurrencyCode', DocNameSpace, CurrencyCode)); XMLCurrNode.Add(XmlElement.Create('AccountingCostCode', DocNameSpace, "OIOUBL-Account Code")); // Reminder->AccountingSupplierParty OIOUBLCommonLogic.InsertAccountingSupplierParty(XMLCurrNode, ''); // Reminder->AccountingCustomerParty ContactStandardAddress.Address := "Address"; ContactStandardAddress."Address 2" := "Address 2"; ContactStandardAddress.City := "City"; ContactStandardAddress."Post Code" := "Post Code"; ContactStandardAddress."Country/Region Code" := "Country/Region Code"; ContactInfo.Name := "Contact"; ContactInfo."Phone No." := "OIOUBL-Contact Phone No."; ContactInfo."Fax No." := "OIOUBL-Contact Fax No."; ContactInfo."E-Mail" := "OIOUBL-Contact E-Mail"; OIOUBLCommonLogic.InsertAccountingCustomerParty(XMLCurrNode, "OIOUBL-GLN", "VAT Registration No.", "Name", ContactStandardAddress, ContactInfo); // Reminder->PaymentMeans OIOUBLCommonLogic.InsertPaymentMeans(XMLCurrNode, "Due Date"); // Reminder->PaymentTerms TotalAmount := 0; IssuedReminderLine2.RESET(); IssuedReminderLine2.COPY(IssuedReminderLine); if IssuedReminderLine2.FINDSET() then repeat TotalAmount := TotalAmount + IssuedReminderLine2.Amount + IssuedReminderLine2."VAT Amount"; until IssuedReminderLine2.NEXT() = 0; OIOUBLCommonLogic.InsertPaymentTerms(XMLCurrNode, '', 0, CurrencyCode, CalcDate('<0D>'), "Due Date", TotalAmount); // Reminder->TaxTotal (for ("Normal VAT" AND "VAT %" <> 0) OR "Full VAT") IssuedReminderLine2.RESET(); IssuedReminderLine2.COPY(IssuedReminderLine); IssuedReminderLine2.SETFILTER( "VAT Calculation Type", '%1|%2|%3', IssuedReminderLine2."VAT Calculation Type"::"Normal VAT", IssuedReminderLine2."VAT Calculation Type"::"Full VAT", IssuedReminderLine2."VAT Calculation Type"::"Reverse Charge VAT"); if IssuedReminderLine2.FINDFIRST() then begin TotalTaxAmount := 0; IssuedReminderLine2.CALCSUMS(Amount, Amount); TotalTaxAmount := IssuedReminderLine2.Amount - IssuedReminderLine2.Amount; InsertReminderTaxTotal(XMLCurrNode, IssuedReminderLine2, TotalTaxAmount, CurrencyCode); end; // Reminder->LegalMonetaryTotal TaxableAmount := 0; TaxAmount := 0; IssuedReminderLine2.RESET(); IssuedReminderLine2.COPY(IssuedReminderLine); if IssuedReminderLine2.FINDSET() then repeat TaxableAmount := TaxableAmount + IssuedReminderLine2.Amount; TaxAmount := TaxAmount + IssuedReminderLine2."VAT Amount"; until IssuedReminderLine2.NEXT() = 0; OIOUBLCommonLogic.InsertLegalMonetaryTotal(XMLCurrNode, TaxableAmount, TaxAmount, TotalAmount, 0, CurrencyCode); // Reminder->ReminderLine repeat if IssuedReminderLine.Amount <> 0 then begin IssuedReminderLine.TESTFIELD(Description); OIOUBLCommonLogic.InsertReminderLine(XMLCurrNode, IssuedReminderLine."Line No.", IssuedReminderLine.Description, IssuedReminderLine.Amount, CurrencyCode, IssuedReminderLine."OIOUBL-Account Code"); end; until IssuedReminderLine.NEXT() = 0; SalesSetup.GET(); TempBlob.CreateOutStream(FileOutstream); OnRunOnBeforeXmlDocumentWriteToFileStream(XMLdocOut, Rec, DocNameSpace, DocNameSpace2); XMLdocOut.WriteTo(FileOutstream); OIOUBLManagement.ExportXMLFile("No.", TempBlob, SalesSetup."OIOUBL-Reminder Path", ''); IssuedReminder.GET("No."); IssuedReminder."OIOUBL-Electronic Reminder Created" := TRUE; IssuedReminder.MODIFY(); end; procedure UpdateTaxAmtAndTaxableAmt(Amount: Decimal; VATAmount: Decimal; var TaxableAmountParam: Decimal; var TaxAmountParam: Decimal); begin TaxableAmountParam := TaxableAmountParam + Amount; TaxAmountParam := TaxAmountParam + VATAmount end; [IntegrationEvent(false, false)] local procedure OnRunOnBeforeXmlDocumentWriteToFileStream(var XMLdocOut: XmlDocument; IssuedReminderHeader: Record "Issued Reminder Header"; DocNameSpace: Text[250]; DocNameSpace2: Text[250]) begin end; }
43.216418
195
0.626144
ed91bd0b04337828da90f5d16cbc262f1dbc47f5
23,908
pm
Perl
lib/Mail/SpamAssassin/ArchiveIterator.pm
yuvarajbora/demo
82edce9b2f40611e59207787fb71806c4e8a37fc
[ "Apache-2.0" ]
null
null
null
lib/Mail/SpamAssassin/ArchiveIterator.pm
yuvarajbora/demo
82edce9b2f40611e59207787fb71806c4e8a37fc
[ "Apache-2.0" ]
4
2021-04-28T20:02:39.000Z
2021-04-29T00:59:20.000Z
lib/Mail/SpamAssassin/ArchiveIterator.pm
yuvarajbora/demo
82edce9b2f40611e59207787fb71806c4e8a37fc
[ "Apache-2.0" ]
1
2021-07-05T18:55:19.000Z
2021-07-05T18:55:19.000Z
# iterate over mail archives, calling a function on each message. # # <@LICENSE> # Copyright 2004 Apache Software Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # </@LICENSE> package Mail::SpamAssassin::ArchiveIterator; use strict; use bytes; use IO::Select; use IO::Socket; use Mail::SpamAssassin::Util; use Mail::SpamAssassin::Constants qw(:sa); use constant BIG_BYTES => 256*1024; # 256k is a big email use constant BIG_LINES => BIG_BYTES/65; # 65 bytes/line is a good approximation my $no = 1; use vars qw { $MESSAGES }; my @ISA = qw($MESSAGES); =head1 NAME Mail::SpamAssassin::ArchiveIterator - find and process messages one at a time =head1 SYNOPSIS my $iter = new Mail::SpamAssassin::ArchiveIterator( { 'opt_j' => 0, 'opt_n' => 1, 'opt_all' => 1, } ); $iter->set_functions( \&wanted, sub { } ); eval { $iter->run(@ARGV); }; sub wanted { my($class, $filename, $recv_date, $msg_array) = @_; ... } =head1 DESCRIPTION The Mail::SpamAssassin::ArchiveIterator module will go through a set of mbox files, mbx files, and directories (with a single message per file) and generate a list of messages. It will then call the wanted and results functions appropriately per message. =head1 METHODS =over 4 =cut ########################################################################### =item $item = new Mail::SpamAssassin::ArchiveIterator( [ { opt => val, ... } ] ) Constructs a new C<Mail::SpamAssassin::ArchiveIterator> object. You may pass the following attribute-value pairs to the constructor. The pairs are optional unless otherwise noted. =over 4 =item opt_all Typically messages over 250k are skipped by ArchiveIterator. Use this option to keep from skipping messages based on size. =item opt_j (required) Specifies how many messages should be run at the same time, as well as the method with which to scan for the messages. If the value is 0, the list of messages to process will be kept in memory, and only 1 message at a time will be processed by the wanted subroutine. Restarting is not allowed. If the value is 1, the list of messages to process will be kept in a temporary file, and only 1 message at a time will be processed by the wanted subroutine. Restarting is not allowed. If the value is 2 or higher, the list of messages to process will be kept in a temporary file, and the process will split into a parent/child mode. The option value number of children will be forked off and each child will process messages via the wanted subroutine in parallel. Restarting is allowed. B<NOTE:> For C<opt_j> >= 1, an extra child process will be created to determine the list of messages, sort the list, everything as appropriate. This will keep the list in memory (possibly multiple copies) before writing the final list to a temporary file which will be used for processing. The list generation child will exit, freeing up the memory. =item opt_n ArchiveIterator is typically used to simulate ham and spam moving through SpamAssassin. By default, the list of messages is sorted by received date so that the mails can be passed through in order. If opt_n is true, the sorting will not occur. This is useful if you don't care about the order of the messages. =item opt_restart If set to a positive integer value, children processes (see opt_j w/ value 2 or higher above) will restart after the option value number of messages, in total, have been processed. =item opt_head Only use the first N ham and N spam (or if the value is -N, only use the first N total messages regardless of class). =item opt_tail Only use the last N ham and N spam (or if the value is -N, only use the last N total messages regardless of class). =item opt_before Only use messages which are received after the given time_t value. Negative values are an offset from the current time, e.g. -86400 = last 24 hours; or as parsed by Time::ParseDate (e.g. '-6 months') =item opt_after Same as opt_before, except the messages are only used if after the given time_t value. =item wanted_sub Reference to a subroutine which will process message data. Usually set via set_functions(). The routine will be passed 4 values: class (scalar), filename (scalar), received date (scalar), and message content (array reference, one message line per element). =item result_sub Reference to a subroutine which will process the results of the wanted_sub for each message processed. Usually set via set_functions(). The routine will be passed 3 values: class (scalar), result (scalar, returned from wanted_sub), and received date (scalar). =back =cut sub new { my $class = shift; $class = ref($class) || $class; my $self = shift; if (!defined $self) { $self = { }; } bless ($self, $class); $self->{s} = { }; # spam, of course $self->{h} = { }; # ham, as if you couldn't guess $self; } ########################################################################### =item set_functions( \&wanted_sub, \&result_sub ) Sets the subroutines used for message processing (wanted_sub), and result reporting. For more information, see I<new()> above. =cut sub set_functions { my ($self, $wanted, $result) = @_; $self->{wanted_sub} = $wanted; $self->{result_sub} = $result; } ########################################################################### =item run ( @target_paths ) Generates the list of messages to process, then runs each message through the configured wanted subroutine. Files which have a name ending in C<.gz> or C<.bz2> will be properly uncompressed via call to C<gzip -dc> and C<bzip2 -dc> respectively. The target_paths array is expected to be one element per path in the following format: class:format:raw_location =over 4 =item class Either 'h' for ham or 's' for spam. If the class is longer than 1 character, it will be truncated. If blank, 'h' is default. =item format Specifies the format of the raw_location. C<dir> is a directory whose files are individual messages, C<file> a file with a single message, C<mbox> an mbox formatted file, or C<mbx> for an mbx formatted directory. C<detect> can also be used; assumes C<file> for STDIN and anything that is not a directory, or C<directory> otherwise. =item raw_location Path to file or directory. Can be "-" for STDIN. File globbing is allowed using the standard csh-style globbing (see C<perldoc -f glob>). C<~> at the front of the value will be replaced by the C<HOME> environment variable. Escaped whitespace is protected as well. =back =cut sub run { my ($self, @targets) = @_; if (!defined $self->{wanted_sub}) { die "set_functions never called"; } # non-forking model (generally sa-learn), everything in a single process if ($self->{opt_j} == 0) { my $message; my $class; my $result; my $messages; # message-array ($MESSAGES, $messages) = $self->message_array(\@targets); while ($message = shift @{$messages}) { my ($class, undef, $date) = index_unpack($message); $result = $self->run_message($message); &{$self->{result_sub}}($class, $result, $date) if $result; } } # forking model (generally mass-check), avoid extended memory usage else { my $tmpf; ($tmpf, $self->{messageh}) = Mail::SpamAssassin::Util::secure_tmpfile(); unlink $tmpf; undef $tmpf; # forked child process scans messages if ($tmpf = fork()) { # parent waitpid($tmpf, 0); } elsif (defined $tmpf) { # child $self->message_array(\@targets, $self->{messageh}); exit; } else { die "cannot fork: $!"; } # we now have a temp file with the messages to process seek ($self->{messageh}, 0, 0); $MESSAGES = $self->next_message(); # only do 1 process, message list in a temp file, no restarting if ($self->{opt_j} == 1 && !defined $self->{opt_restart}) { my $message; my $class; my $result; my $messages; my $total_count = 0; while (($MESSAGES > $total_count) && ($message = $self->next_message())) { my ($class, undef, $date) = index_unpack($message); $result = $self->run_message($message); &{$self->{result_sub}}($class, $result, $date) if $result; $total_count++; } } # more than one process or one process with restarts else { my $select = IO::Select->new(); my $total_count = 0; my $needs_restart = 0; my @child = (); my @pid = (); my $messages; # start children processes $self->start_children($self->{opt_j}, \@child, \@pid, $select); # feed childen, make them work for it, repeat while ($select->count()) { foreach my $socket ($select->can_read()) { my $result = ''; my $line; while ($line = readline $socket) { if ($line =~ /^RESULT (.+)$/) { my ($class,$type,$date) = index_unpack($1); #warn ">> RESULT: $class, $type, $date\n"; if (defined $self->{opt_restart} && ($total_count % $self->{opt_restart}) == 0) { $needs_restart = 1; } # if messages remain, and we don't need to restart, send message if (($MESSAGES > $total_count) && !$needs_restart) { print { $socket } $self->next_message() . "\n"; $total_count++; #warn ">> recv: $MESSAGES $total_count\n"; } else { # stop listening on this child since we're done with it #warn ">> removeresult: $needs_restart $MESSAGES $total_count\n"; $select->remove($socket); } # deal with the result we received if ($result) { chop $result; # need to chop the \n before RESULT &{$self->{result_sub}}($class, $result, $date); } last; # this will avoid the read for this client } elsif ($line eq "START\n") { if ($MESSAGES > $total_count) { # we still have messages, send one to child print { $socket } $self->next_message() . "\n"; $total_count++; #warn ">> new: $MESSAGES $total_count\n"; } else { # no more messages, so stop listening on this child #warn ">> removestart: $needs_restart $MESSAGES $total_count\n"; $select->remove($socket); } last; # this will avoid the read for this client } else { # result line, remember it $result .= $line; } } # some error happened during the read! if (!defined $line || !$line) { $needs_restart = 1; warn "readline failed, attempting to recover\n"; $select->remove($socket); } } #warn ">> out of loop, $MESSAGES $total_count $needs_restart ".$select->count()."\n"; # If there are still messages to process, and we need to restart # the children, and all of the children are idle, let's go ahead. if ($needs_restart && $select->count == 0 && $MESSAGES > $total_count) { $needs_restart = 0; #warn "debug: Needs restart, $MESSAGES total, $total_count done.\n"; $self->reap_children($self->{opt_j}, \@child, \@pid); @child=(); @pid=(); $self->start_children($self->{opt_j}, \@child, \@pid, $select); } } # reap children $self->reap_children($self->{opt_j}, \@child, \@pid); } # close tempfile so it will be unlinked close($self->{messageh}); } } ############################################################################ sub message_array { my ($self, $targets, $fh) = @_; foreach my $target (@${targets}) { my ($class, $format, $rawloc) = split(/:/, $target, 3); # use ham by default, things like "spamassassin" can't specify the type $class = substr($class, 0, 1) || 'h'; my @locations = $self->fix_globs($rawloc); foreach my $location (@locations) { my $method; if ($format eq 'detect') { # detect the format if ($location eq '-' || !(-d $location)) { # stdin is considered a file if not passed as mbox $method = \&scan_file; } else { # it's a directory $method = \&scan_directory; } } else { if ($format eq "dir") { $method = \&scan_directory; } elsif ($format eq "file") { $method = \&scan_file; } elsif ($format eq "mbox") { $method = \&scan_mailbox; } elsif ($format eq "mbx") { $method = \&scan_mbx; } } if(defined($method)) { &{$method}($self, $class, $location); } else { warn "format $format unknown!"; } } } my @messages; if ($self->{opt_n}) { my %both = (%{ $self->{s} }, %{$self->{h}}); undef $self->{s}; undef $self->{h}; @messages = sort({ $both{$a} <=> $both{$b} } keys %both); splice(@messages, $self->{opt_head}) if $self->{opt_head}; splice(@messages, 0, -$self->{opt_tail}) if $self->{opt_tail}; } else { my @s = sort({ $self->{s}->{$a} <=> $self->{s}->{$b} } keys %{$self->{s}}); undef $self->{s}; my @h = sort({ $self->{h}->{$a} <=> $self->{h}->{$b} } keys %{$self->{h}}); undef $self->{h}; splice(@s, $self->{opt_head}) if $self->{opt_head}; splice(@s, 0, -$self->{opt_tail}) if $self->{opt_tail}; splice(@h, $self->{opt_head}) if $self->{opt_head}; splice(@h, 0, -$self->{opt_tail}) if $self->{opt_tail}; while (@s && @h) { push @messages, (shift @s); push @messages, (shift @h); } push @messages, (splice @s), (splice @h); } if (defined $fh) { print { $fh } map { "$_\n" } scalar(@messages), @messages; return; } return scalar(@messages), \@messages; } sub next_message { my ($self) = @_; my $line = readline $self->{messageh}; chomp $line if defined $line; return $line; } sub start_children { my ($self, $count, $child, $pid, $socket) = @_; my $io = IO::Socket->new(); my $parent; # create children for (my $i = 0; $i < $count; $i++) { ($child->[$i],$parent) = $io->socketpair(AF_UNIX,SOCK_STREAM,PF_UNSPEC) or die "socketpair failed: $!"; if ($pid->[$i] = fork) { close $parent; # disable caching for parent<->child relations my ($old) = select($child->[$i]); $|++; select($old); $socket->add($child->[$i]); #warn "debug: starting new child $i (pid ",$pid->[$i],")\n"; next; } elsif (defined $pid->[$i]) { my $result; my $line; close $self->{messageh} if defined $self->{messageh}; close $child->[$i]; select($parent); $| = 1; # print to parent by default, turn off buffering print "START\n"; while ($line = readline $parent) { chomp $line; if ($line eq "exit") { print "END\n"; close $parent; exit; } $result = $self->run_message($line); $result ||= ''; print "$result\nRESULT $line\n"; } exit; } else { die "cannot fork: $!"; } } } sub reap_children { my ($self, $count, $socket, $pid) = @_; # If the child died, sending it the exit will generate a SIGPIPE, but we # don't really care since the readline will go undef (which is fine), # then we do the waitpid which will finish it off. So we end up in the # right state, in theory. local $SIG{'PIPE'} = 'IGNORE'; for (my $i = 0; $i < $count; $i++) { #warn "debug: killing child $i (pid ",$pid->[$i],")\n"; print { $socket->[$i] } "exit\n"; # tell the child to die. my $line = readline $socket->[$i]; # read its END statement. close $socket->[$i]; waitpid($pid->[$i], 0); # wait for the signal ... } } sub mail_open { my ($file) = @_; my $expr; if ($file =~ /\.gz$/) { $expr = "gunzip -cd $file |"; } elsif ($file =~ /\.bz2$/) { $expr = "bzip2 -cd $file |"; } else { $expr = "$file"; } if (!open (INPUT, $expr)) { warn "Unable to open $file: $!\n"; return 0; } return 1; } ############################################################################ sub message_is_useful_by_date { my ($self, $date) = @_; return 0 unless $date; # undef or 0 date = unusable if (!$self->{opt_after} && !$self->{opt_before}) { # Not using the feature return 1; } elsif (!$self->{opt_before}) { # Just case about after return $date > $self->{opt_after}; } else { return (($date < $self->{opt_before}) && ($date > $self->{opt_after})); } } ############################################################################ sub index_pack { return join("\000", @_); } sub index_unpack { return split(/\000/, $_[0]); } sub scan_directory { my ($self, $class, $folder) = @_; my @files; opendir(DIR, $folder) || die "Can't open '$folder' dir: $!"; if (-f "$folder/cyrus.header") { # cyrus metadata: http://unix.lsa.umich.edu/docs/imap/imap-lsa-srv_3.html @files = grep { /^\S+$/ && !/^cyrus\.(?:index|header|cache|seen)/ } readdir(DIR); } else { # ignore ,234 (deleted or refiled messages) and MH metadata dotfiles @files = grep { !/^[,.]/ } readdir(DIR); } closedir(DIR); @files = grep { -f } map { "$folder/$_" } @files; foreach my $mail (@files) { if ($self->{opt_n}) { $self->{$class}->{index_pack($class, "f", $no, $mail)} = $no; $no++; next; } my $header; mail_open($mail) or next; while (<INPUT>) { last if /^$/; $header .= $_; } close(INPUT); my $date = Mail::SpamAssassin::Util::receive_date($header); next if !$self->message_is_useful_by_date($date); $self->{$class}->{index_pack($class, "f", $date, $mail)} = $date; } } sub scan_file { my ($self, $class, $mail) = @_; if ($self->{opt_n}) { $self->{$class}->{index_pack($class, "f", $no, $mail)} = $no; $no++; return; } my $header; mail_open($mail) or return; while (<INPUT>) { last if /^$/; $header .= $_; } close(INPUT); my $date = Mail::SpamAssassin::Util::receive_date($header); return if !$self->message_is_useful_by_date($date); $self->{$class}->{index_pack($class, "f", $date, $mail)} = $date; } sub scan_mailbox { my ($self, $class, $folder) = @_; my @files; if ($folder ne '-' && -d $folder) { # passed a directory of mboxes $folder =~ s/\/\s*$//; #Remove trailing slash, if there opendir(DIR, $folder) || die "Can't open '$folder' dir: $!"; while($_ = readdir(DIR)) { if(/^[^\.]\S*$/ && ! -d "$folder/$_") { push(@files, "$folder/$_"); } } closedir(DIR); } else { push(@files, $folder); } foreach my $file (@files) { if ($file =~ /\.(?:gz|bz2)$/) { die "compressed mbox folders are not supported at this time\n"; } mail_open($file) or return; my $start = 0; # start of a message my $where = 0; # current byte offset my $first = ''; # first line of message my $header = ''; # header text my $in_header = 0; # are in we a header? while (!eof INPUT) { my $offset = $start; # byte offset of this message my $header = $first; # remember first line while (<INPUT>) { if ($in_header) { if (/^$/) { $in_header = 0; } else { $header .= $_; } } if (substr($_,0,5) eq "From ") { $in_header = 1; $first = $_; $start = $where; $where = tell INPUT; last; } $where = tell INPUT; } if ($header) { my $t; if ($self->{opt_n}) { $t = $no++; } else { $t = Mail::SpamAssassin::Util::receive_date($header); next if !$self->message_is_useful_by_date($t); } $self->{$class}->{index_pack($class, "m", $t, "$file.$offset")} = $t; } } close INPUT; } } sub scan_mbx { my ($self, $class, $folder) = @_ ; my (@files, $fp) ; if ($folder ne '-' && -d $folder) { # got passed a directory full of mbx folders. $folder =~ s/\/\s*$//; # remove trailing slash, if there is one opendir(DIR, $folder) || die "Can't open '$folder' dir: $!" ; while($_ = readdir(DIR)) { if(/^[^\.]\S*$/ && ! -d "$folder/$_") { push(@files, "$folder/$_"); } } closedir(DIR); } else { push(@files, $folder) ; } foreach my $file (@files) { if ($folder =~ /\.(?:gz|bz2)$/) { die "compressed mbx folders are not supported at this time\n" ; } mail_open($file) or return ; # check the mailbox is in mbx format $fp = <INPUT> ; if ($fp !~ /\*mbx\*/) { die "Error, mailbox not in mbx format!\n" ; } # skip mbx headers to the first email... seek(INPUT, 2048, 0) ; my $sep = MBX_SEPARATOR; while (<INPUT>) { if ($_ =~ /$sep/) { my $offset = tell INPUT ; my $size = $2 ; # gather up the headers... my $header = '' ; while (<INPUT>) { last if (/^$/) ; $header .= $_ ; } my $t; if ($self->{opt_n}) { $t = $no++; } else { $t = Mail::SpamAssassin::Util::receive_date($header); next if !$self->message_is_useful_by_date($t); } $self->{$class}->{index_pack($class, "b", $t, "$file.$offset")} = $t; seek(INPUT, $offset + $size, 0) ; } else { die "Error, failure to read message body!\n" ; } } close INPUT; } } ############################################################################ sub run_message { my ($self, $msg) = @_; my ($class, $format, $date, $mail) = index_unpack($msg); if ($format eq "f") { return $self->run_file($class, $mail, $date); } elsif ($format eq "m") { return $self->run_mailbox($class, $mail, $date); } elsif ($format eq "b") { return $self->run_mbx($class, $mail, $date); } } sub run_file { my ($self, $class, $where, $date) = @_; mail_open($where) or return; # skip too-big mails if (! $self->{opt_all} && -s INPUT > BIG_BYTES) { close INPUT; return; } my @msg = (<INPUT>); close INPUT; &{$self->{wanted_sub}}($class, $where, $date, \@msg); } sub run_mailbox { my ($self, $class, $where, $date) = @_; my ($file, $offset) = ($where =~ m/(.*)\.(\d+)$/); my @msg; mail_open($file) or return; seek(INPUT,$offset,0); my $past = 0; while (<INPUT>) { if ($past) { last if substr($_,0,5) eq "From "; } else { $past = 1; } # skip too-big mails if (! $self->{opt_all} && @msg > BIG_LINES) { close INPUT; return; } push (@msg, $_); } close INPUT; &{$self->{wanted_sub}}($class, $where, $date, \@msg); } sub run_mbx { my ($self, $class, $where, $date) = @_ ; my ($file, $offset) = ($where =~ m/(.*)\.(\d+)$/) ; my @msg ; mail_open($file) or return ; seek(INPUT, $offset, 0) ; while (<INPUT>) { last if ($_ =~ MBX_SEPARATOR) ; # skip mails that are too big if (! $self->{opt_all} && @msg > BIG_LINES) { close INPUT ; return ; } push (@msg, $_) ; } close INPUT ; &{$self->{wanted_sub}}($class, $where, $date, \@msg) ; } ############################################################################ sub fix_globs { my ($self, $path) = @_; # replace leading tilde with home dir: ~/abc => /home/jm/abc $path =~ s/^~/$ENV{'HOME'}/; # protect/escape spaces: ./Mail/My Letters => ./Mail/My\ Letters $path =~ s/([^\\])(\s)/$1\\$2/g; my @paths; # apply csh-style globs: ./corpus/*.mbox => er, you know what it does ;) @paths = glob $path; return @paths; } ############################################################################ 1; __END__ =back =head1 SEE ALSO C<Mail::SpamAssassin> C<spamassassin> C<mass-check>
25.986957
93
0.577296
ed7b7d47f4da0967b94194abbfb8026b07332c4b
2,381
pm
Perl
tests/installation/setup_zdup.pm
akedroutek/os-autoinst-distri-opensuse
ad49c51e979f5d2654d084b5c5ae0425da9a66c9
[ "FSFAP" ]
null
null
null
tests/installation/setup_zdup.pm
akedroutek/os-autoinst-distri-opensuse
ad49c51e979f5d2654d084b5c5ae0425da9a66c9
[ "FSFAP" ]
null
null
null
tests/installation/setup_zdup.pm
akedroutek/os-autoinst-distri-opensuse
ad49c51e979f5d2654d084b5c5ae0425da9a66c9
[ "FSFAP" ]
null
null
null
# SUSE's openQA tests # # Copyright © 2009-2013 Bernhard M. Wiedemann # Copyright © 2012-2017 SUSE LLC # # Copying and distribution of this file, with or without modification, # are permitted in any medium without royalty provided the copyright # notice and this notice are preserved. This file is offered as-is, # without any warranty. # Summary: Preparation step for zypper dup. Making sure that a console is available and selected. # Maintainer: Ludwig Nussel <lnussel@suse.com> use base "installbasetest"; use strict; use warnings; use testapi; use utils; use version_utils qw(is_jeos is_desktop_installed); use Utils::Backends 'is_pvm'; sub run { my ($self) = @_; $self->wait_boot(textmode => !is_desktop_installed(), bootloader_time => 300, ready_time => 600) unless is_jeos; if (get_var('ZDUP_IN_X')) { x11_start_program('xterm'); become_root; } else { # Remove the graphical stuff # This do not work in 13.2 # script_sudo "/sbin/init 3"; select_console('root-console'); # Create a snapshot with specified description to do snapper rollback # This action is concerned about following points: # 1. Source image could be original installation or updated # 2. Source image may apply patches before migration # 3. Hard to assert similar snapshots in grub2 # 4. Menu of each snapshot is long with openSUSE leap, use short and unique description # 5. Avoid rollback to snapshot without graphical target # snapper is not available at least on our version of openSUSE 13.1 # HDD used for upgrade. if (get_var('HDDVERSION', '') !~ /13.1/) { assert_script_run "snapper create --type pre --cleanup-algorithm=number --print-number --userdata important=yes --description 'b_zdup migration'"; } if (!is_jeos) { # Remove the --force when this is fixed: # https://bugzilla.redhat.com/show_bug.cgi?id=1075131 systemctl 'set-default --force multi-user.target'; # The CD was ejected in the bootloader test type_string("/sbin/reboot\n"); reset_consoles; reconnect_mgmt_console if is_pvm; $self->wait_boot(textmode => 1, bootloader_time => 200); select_console('root-console'); } } } 1;
35.014706
158
0.660227
ed6dabafc752ce685915115fe3c6013ea2757f6b
17,713
pm
Perl
tmac/tmac.pm
dnjp/plan9port
58b6cd89771303f5c49414b7dcef43883433a840
[ "MIT" ]
null
null
null
tmac/tmac.pm
dnjp/plan9port
58b6cd89771303f5c49414b7dcef43883433a840
[ "MIT" ]
null
null
null
tmac/tmac.pm
dnjp/plan9port
58b6cd89771303f5c49414b7dcef43883433a840
[ "MIT" ]
null
null
null
.\" 10/22/92 activate next line before installing .pi /Users/daniel/plan9/bin/auxpm . . \" IZ - initialization .de IZ .fp 10 S \" force a font out into prefix .nr PS 10 \" point size .nr VS 12 \" line spacing .ps \\n(PS .ie \\n(VS>=41 .vs \\n(VSu .el .vs \\n(VSp .nr LL 6i \" line length .ll \\n(LLu .nr LT \\n(.l \" title length .lt \\n(LTu .if !\\n(HM .nr HM 1i \" top of page .if !\\n(FM .nr FM 1i \" footer margin .if !\\n(FO .nr FO \\n(.p-\\n(FM \" bottom of page . \" to set text ht to N, set FO to N + \n(HM. default is 10i .pl 32767u \" safety first: big pages for pm .if !\\n(PO .nr PO \\n(.ou \" page offset .nr PI 5n \" .PP paragraph indent .nr QI 5n \" .QS indent .nr DI 5n \" .DS indent .nr PD 0.3v \" paragraph vertical separation .nr TS 0.5v \" space around tables .nr Kf 0.5v \" space around .KF/.KE .nr Ks 0.5v \" space around .KS/.KE . .nr P1 .4i \" indent for .P1/.P2 .nr dP 1 \" delta point size for programs in .P1/.P2 .nr dV 2p \" delta vertical for programs .nr dT 8 \" delta tab stop for programs .nr DV .5v \" space before start of program .nr IP 0 \" ? .nr IR 0 \" ? .nr I1 \\n(PIu .ev 1 .if !\\n(FL .nr FL \\n(LLu \" footnote length .ll \\n(FLu .ps 8 \" text size & leading in footnote .vs 10p .ev .if \\*(CH .ds CH "\(hy \\\\n(PN \(hy .ds # #\\\\n(.c \\\\n(.F . . .ME \" initialize date strings .rm ME . \" accents: \*'e \*`e \*:u \*^e \*~n \*va \*,c .ds ' \h'\w'e'u*4/10'\z\(aa\h'-\w'e'u*4/10' .ds ` \h'\w'e'u*4/10'\z\(ga\h'-\w'e'u*4/10' .ds : \\v'-0.6m'\\h'(1u-(\\\\n(.fu%2u))*0.13m+0.00m'\\z.\\h'0.2m'\\z.\\h'-((1u-(\\\\n(.fu%2u))*0.13m+0.20m)'\\v'0.6m' .ds ^ \\\\k:\\h'-\\\\n(.fu+1u/2u*2u+\\\\n(.fu-1u*0.13m+0.06m'\\z^\\h'|\\\\n:u' .ds ~ \\\\k:\\h'-\\\\n(.fu+1u/2u*2u+\\\\n(.fu-1u*0.13m+0.06m'\\z~\\h'|\\\\n:u' .ds v \\\\k:\\\\h'+\\\\w'e'u/4u'\\\\v'-0.6m'\\\\s6v\\\\s0\\\\v'0.6m'\\\\h'|\\\\n:u' .ds , \\\\k:\\\\h'\\\\w'c'u*0.4u'\\\\z,\\\\h'|\\\\n:u' .. . . . \" SP - generate paddable space .de SP .br .nr X 1v .if \\n(.$ .nr X \\$1v .ie '\\$2'exactly' \{\ \v'\\nXu'\ \h'-\w'\ 'u'\c .sp \\$1\} .el .X "SP \\nX \\$2" .. . \" NE - need space on this page .de NE .nr X 1v .if \\n(.$ .nr X \\$1v .X "NE \\nX \\$2" .. . \" BP, FL, FC - begin page, flush figures, flush column .de BP .br .X CMD BP .. .de FL .br .X CMD FL .. .de FC .br .X CMD FC .. . \" X - generate an x X ... command in the output .de X ....ie '\\n(.z'' \\!x X \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 \\$9 ....el \\!.X "\\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 \\$9 ... .if !'\\n(.z'' .if \\n(.$=1 \\!.X "\\$1 .if !'\\n(.z'' .if \\n(.$=2 \\!.X "\\$1 \\$2 .if !'\\n(.z'' .if \\n(.$=3 \\!.X "\\$1 \\$2 \\$3 .if !'\\n(.z'' .if \\n(.$>3 \\!.X "\\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 \\$9 .if '\\n(.z'' .if \\n(.$=1 \\!x X \\$1 \\*# .if '\\n(.z'' .if \\n(.$=2 \\!x X \\$1 \\$2 \\*# .if '\\n(.z'' .if \\n(.$=3 \\!x X \\$1 \\$2 \\$3 \\*# .if '\\n(.z'' .if \\n(.$=4 \\!x X \\$1 \\$2 \\$3 \\$4 \\*# .if '\\n(.z'' .if \\n(.$>4 \\!x X \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 \\$9 \\*# .. . \" DA - force date .de DA .if \\n(.$ .ds DY \\$1 \\$2 \\$3 \\$4 .ds CF \\*(DY .. . \" ND - set new or no date .de ND .ds DY \\$1 \\$2 \\$3 \\$4 .rm CF .. .de ME \" ME - set month strings .if \\n(mo-0 .ds MO January .if \\n(mo-1 .ds MO February .if \\n(mo-2 .ds MO March .if \\n(mo-3 .ds MO April .if \\n(mo-4 .ds MO May .if \\n(mo-5 .ds MO June .if \\n(mo-6 .ds MO July .if \\n(mo-7 .ds MO August .if \\n(mo-8 .ds MO September .if \\n(mo-9 .ds MO October .if \\n(mo-10 .ds MO November .if \\n(mo-11 .ds MO December .if \\n(dw-0 .ds DW Sunday .if \\n(dw-1 .ds DW Monday .if \\n(dw-2 .ds DW Tuesday .if \\n(dw-3 .ds DW Wednesday .if \\n(dw-4 .ds DW Thursday .if \\n(dw-5 .ds DW Friday .if \\n(dw-6 .ds DW Saturday .if "\\*(DY"" .ds DY \\*(MO \\n(dy, 19\\n(yr .. . \" FP - font position for a family .de FP .if '\\$1'palatino'\{\ . fp 1 PA . fp 2 PI . fp 3 PB . fp 4 PX\} .if '\\$1'lucidasans'\{\ . fp 1 R LucidaSans . fp 2 I LucidaSansI . fp 3 B LucidaSansB . fp 5 CW LucidaCW\} .if '\\$1'century'\{\ . ie '\\*(.T'202'\{\ . fp 1 NR Centsb . fp 2 NI CentI . fp 3 NB CentB . fp 4 NX CentBI\} . el \{\ . fp 1 NR . fp 2 NI . fp 3 NB . fp 4 NX\}\} .if '\\$1'helvetica'\{\ . fp 1 H . fp 2 HI . fp 3 HB . fp 4 HX\} .if '\\$1'bembo'\{\ . ie '\\*(.T'202'\{\ . fp 1 B1 Bembo . fp 2 B2 BemboI . fp 3 B3 BemboB . fp 4 B4 BemboBI\} . el \{\ . fp 1 B1 . fp 2 B2 . fp 3 B3 . fp 4 B4\}\} .if '\\$1'optima'\{\ . fp 1 R Optima . fp 2 I OptimaI . fp 3 B OptimaB . fp 4 BI OptimaBI\} .if '\\$1'souvenir'\{\ . fp 1 R Souvenir . fp 2 I SouvenirI . fp 3 B SouvenirB . fp 4 BI SouvenirBI\} .if '\\$1'melior'\{\ . fp 1 R Melior . fp 2 I MeliorI . fp 3 B MeliorB . fp 4 BI MeliorBI\} .if '\\$1'times'\{\ . fp 1 R . fp 2 I . fp 3 B . fp 4 BI\} .. . \" TL - title .de TL .br .if !\\n(1T .BG ....hy 0 .ft 3 .ps \\n(PS+2p .vs \\n(VS+2p .ll \\n(LLu .ce 100 \" turned off in .RT .sp .5i .. . \" AU - remember author(s) .de AU .ft 1 .ps \\n(PS .ie \\n(VS>=41 .vs \\n(VSu .el .vs \\n(VSp .SP .5 .. . \" AI - author's institution .de AI .SP .25 .ft 2 .. . \" AB - begin abstract .de AB .nr AB 1 \" we're in abstract .if !\\n(1T .BG .ft 1 .ps \\n(PS .vs \\n(VSp .ce .in +\\n(.lu/12u .ll -\\n(.lu/12u .SP 1 .ie \\n(.$ \\$1 .el ABSTRACT .SP .75 .RT .. . \" AE - end of abstract .de AE .br .nr AB 0 .in 0 .ll \\n(LLu .ps \\n(PS .ie \\n(VS>=41 .vs \\n(VSu .el .vs \\n(VSp .SP .. . \" 2C - 2 columns .de 2C .MC 2 .. . \" 1C - 1 column .de 1C .MC 1 .. . \" MC - multiple columns .de MC .br .if \\n(1T .RT .if \\n(1T .NP .if !\\n(OL .nr OL \\n(LL .if \\n(CW=0 .nr CW \\n(LL*7/15 .if \\n(GW=0 .nr GW \\n(LL-(2*\\n(CW) .nr x \\n(CW+\\n(GW .if "\\$1"" .MC 2 .if \\$1=1 \{\ . X MC 1 0 . nr LL \\n(OLu\} .if \\$1=2 \{\ . X MC 2 \\nx . nr LL \\n(CWu\} .ll \\n(LLu .if \\$1>2 .tm -mpm can't handle more than two columns .if \\n(1T .RT .. . \" TS - table start, TE - table end; also TC, TQ, TH .de TS .br .if !\\n(1T .RT .SP \\n(TSu TS .X "US TS .if \\$1H .TQ .nr IX 1 .. .de TC .nr TZ \\n(.lu .if \\n(.$ .nr TZ \\$1n .ta \\n(TZuR .. .de TD .LP .nr TZ 0 .. .de TQ .di TT .nr IT 1 .. .de TH .if \\n(.d>0.5v \{\ . nr T. 0 . T# 0\} .di .nr TQ \\n(.i .nr HT 1 .in 0 .mk #a .mk #b .mk #c .mk #d .mk #e .mk #f .TT .in \\n(TQu .mk #T .. . \" TE - table end .de TE .nr IX 0 .if \\n(IT .if !\\n(HT \{\ . di . nr EF \\n(.u . nf . TT . if \\n(EF .fi\} .nr IT 0 .nr HT 0 .rm a+ b+ c+ d+ e+ f+ g+ h+ i+ j+ k+ l+ n+ m+ .rr 32 33 34 35 36 37 38 40 79 80 81 82 .rr a| b| c| d| e| f| g| h| i| j| k| l| m| .rr a- b- c- d- e- f- g- h- i- j- k- l- m- .X "END US TE .SP \\n(TSu TE .bp .. . \" EQ - equation, breakout and display .de EQ .nr EF \\n(.u .rm EE .nr LE 1 \" 1 is center .ds EL \\$1 .if "\\$1"L" \{\ . ds EL \\$2 . nr LE 0\} .if "\\$1"C" .ds EL \\$2 .if "\\$1"R" \{\ . ds EL \\$2 \" 2 is right adjust . nr LE 2\} .if "\\$1"I" \{\ . nr LE 0 . if "\\$3"" .ds EE \\h'|10n' . el .ds EE \\h'\\$3' . ds EL \\$2\} .if \\n(YE .nf .di EZ .. . \" EN - end of equation .de EN .br .di .rm EZ .nr ZN \\n(dn .if \\n(ZN .if !\\n(YE .LP .if !\\n(ZN .if !"\\*(EL"" .nr ZN 1 .if \\n(ZN \{\ . SP .5v EQ . X "US EQ"\} 'pc .if \\n(BD .nr LE 0 \" don't center if block display or mark/lineup .if \\n(MK \{\ . if \\n(LE=1 .ds EE \\h'|10n' . nr LE 0\} 'lt \\n(.lu .if !\\n(EP .if \\n(ZN \{\ . if \\n(LE=1 .tl \(ts\(ts\\*(10\(ts\\*(EL\(ts . if \\n(LE=2 .tl \(ts\(ts\(ts\\*(10\\*(EL\(ts . if !\\n(LE \{\ . if !\\n(BD .tl \(ts\\*(EE\\*(10\(ts\(ts\\*(EL\(ts . if \\n(BD .if \\n(BD<\\w\(ts\\*(10\(ts .nr BD \\w\(ts\\*(10\(ts . if \\n(BD \!\\*(10\\t\\*(EL\}\} .if \\n(EP .if \\n(ZN \{\ . if \\n(LE=1 .tl \(ts\\*(EL\(ts\\*(10\(ts\(ts . if \\n(LE=2 .tl \(ts\\*(EL\(ts\(ts\\*(10\(ts . if !\\n(LE \{\ . if !\\n(BD .tl \(ts\\*(EL\\*(EE\\*(10\(ts\(ts\(ts . if \\n(BD .if \\n(BD<\\w\(ts\\*(10\(ts .nr BD \\w\(ts\\*(10\(ts . if \\n(BD \!\\h'-\\\\n(.iu'\\*(EL\\h'|0'\\*(10\}\} 'lt \\n(LLu 'pc % .if \\n(YE .if \\n(EF .fi .if \\n(ZN .X "END US EQ" .if \\n(ZN .SP .5v EN .if \\n(ZN .bp .. . \" PS - start picture .de PS \" $1 is height, $2 is width, in inches .br .nr X 0.35v .if \\$1>0 .X "SP \\nX PS" .ie \\$1>0 .nr $1 \\$1 .el .nr $1 0 .X "US PS \\$1 .in (\\n(.lu-\\$2)/2u .. . \" PE - end of picture .de PE .in .X "END US PE .nr X .65v .if \\n($1>0 .X "SP \\nX PE" .bp .. .de IS \" for -mpm only .KS .. .de IE .KE .bp .. . \" NP - new page .de NP .ev 2 .bp .if \\n(KF=0 \{\ . nr PX \\n(.s . nr PF \\n(.f . nr PV \\n(.v . lt \\n(LTu . ps \\n(PS . vs \\n(PS+2 . ft 1 . if \\n(PO .po \\n(POu \" why isn't this reset??? . PT \\$1 . bp . rs . BT . bp . nr %# +1 . ps \\n(PX . vs \\n(PVu . ft \\n(PF \} .ev .. . .ds %e .tl '\\*(LH'\\*(CH'\\*(RH' .ds %o .tl '\\*(LH'\\*(CH'\\*(RH' .ds %E .tl '\\*(LF'\\*(CF'\\*(RF' .ds %O .tl '\\*(LF'\\*(CF'\\*(RF' . . \" PT - page title .de PT .nr PN \\n(%# .X "PT \\n(%# .sp \\n(HMu/2u .if \\n(OL .lt \\n(OLu \" why isn't this reset??? .if \\n(BT>0 .if \\n(%#%2 \\*(%o .if \\n(BT>0 .if !\\n(%#%2 \\*(%e .if \\n(BT=0 .tl '\0''' \" put out something or spacing is curdled .X "END PT \\n(%# .. . \" BT - bottom title .de BT .X "BT \\n(%# .sp |\\n(FMu/2u+\\n(FOu-1v .if \\n(%#%2 \\*(%O .if !\\n(%#%2 \\*(%E .nr BT \\n(BT+1 .X "END BT \\n(%# .. . \" KS - non-floating keep .de KS .br .if "\\n(.z"" .NP \" defends poorly against including ht of page stuff in diversion for .B1 .X "US KS 0 .nr KS +1 .SP \\n(Ksu .. . \" KF - floating keep .de KF .ev 1 .br .if \\n(KS>0 .tm KF won't work inside KS, line \\n(.c, file \\n(.F .if \\n(KF>0 .tm KF won't work inside KF, line \\n(.c, file \\n(.F .nr KF 1 .nr 10 0 . if !'\\$1'' .nr 10 \\$1u . if '\\$1'bottom' .nr 10 \\n(FOu-1u . if '\\$1'top' .nr 10 \\n(HM . if \\n(10 .X "UF \\n(10 KF" . if !\\n(10 .X "UF \\n(HM KF" . nr X \\n(FOu-2u . if \\n(10 .X "UF \\n(10 KF" . if !\\n(10 .X "UF \\nX KF" .nr SJ \\n(.u .ps \\n(PS .if \\n(VS>40 .vs \\n(VSu .if \\n(VS<=39 .vs \\n(VSp .ll \\n(LLu .lt \\n(LTu .SP \\n(Kfu .. . \" KE - end of KS/KF .de KE .bp .ie \\n(KS>0 \{\ . SP \\n(Ksu . X "END US KS . nr KS -1 \} .el .ie \\n(KF>0 \{\ . SP \\n(Kfu . nr KF 0 . X "END UF KF" . if \\n(SJ .fi . ev \} .el .tm .KE without preceding .KS or .KF, line \\n(.c, file \\n(.F .. . . \" DS - display. .DS C center; L left-adjust; I indent (default) .de DS \" $2 = amount of indent .KS .nf .\\$1D \\$2 \\$1 .ft 1 .if !\\n(IF \{\ . ps \\n(PS . if \\n(VS>40 .vs \\n(VSu . if \\n(VS<=39 .vs \\n(VSp\} .. .de D .ID \\$1 .. .de CD .XD .ce 1000 .. .de ID .XD .if \\n(.$=0 .in +\\n(DIu .if \\n(.$=1 .if "\\$1"I" .in +\\n(DIu .if \\n(.$=1 .if !"\\$1"I" .in +\\$1n .if \\n(.$>1 .in +\\$2n .....in +0.5i .....if \\n(.$ .if !"\\$1"I" .if !"\\$1"" .in \\n(DIu .....if \\n(.$ .if !"\\$1"I" .if !"\\$1"" .in +\\$1n .. .de LD .XD .. .de XD .nf .nr OI \\n(.i .SP \\n(DVu .. . \" BD - block display: save everything, then center it. .de BD .XD .nr BD 1 .nf .in \\n(OIu .di DD .. . \" DE - display end .de DE .ce 0 .if \\n(BD>0 .XF .nr BD 0 .in \\n(OIu .SP \\n(DVu .KE .fi .. . \" XF - finish a block display to be recentered. .de XF .di .if \\n(dl>\\n(BD .nr BD \\n(dl .if \\n(BD<\\n(.l .in (\\n(.lu-\\n(BDu)/2u .nr EI \\n(.l-\\n(.i .ta \\n(EIuR .nf .DD .in \\n(OIu .. . . . \" SH - (unnumbered) section heading .de SH .RT .nr X 1v .nr Y 3v .if \\n(1T .NP .if \\n(1T .X "NE \\nY SH" \" should these be reversed, change Y to 4v .if \\n(1T .X "SP \\nX SH .ft 3 .. . \" NH - numbered heading .de NH .RT .nr X 1v .nr Y 3v .if \\n(1T .NP .if \\n(1T .X "NE \\nY NH" \" should these be reversed, change Y to 4v .if \\n(1T .X "SP \\nX NH .ft 3 .nr NS \\$1 .if !\\n(.$ .nr NS 1 .if !\\n(NS .nr NS 1 .nr H\\n(NS +1 .if !\\n(NS-4 .nr H5 0 .if !\\n(NS-3 .nr H4 0 .if !\\n(NS-2 .nr H3 0 .if !\\n(NS-1 .nr H2 0 .if !\\$1 .if \\n(.$ .nr H1 1 .ds SN \\n(H1. .if \\n(NS-1 .as SN \\n(H2. .if \\n(NS-2 .as SN \\n(H3. .if \\n(NS-3 .as SN \\n(H4. .if \\n(NS-4 .as SN \\n(H5. \\*(SN .. . \" RT - reset at beginning of each PP, LP, etc. .de RT .if !\\n(AB .if !\\n(1T .BG .ce 0 .if !\\n(AB .if !\\n(KF .if !\\n(IF .if !\\n(IX .if !\\n(BE .di .if \\n(QP \{\ . ll +\\n(QIu . in -\\n(QIu . nr QP -1\} .if !\\n(AB \{\ . ll \\n(LLu\} .if !\\n(IF .if !\\n(AB \{\ . ps \\n(PS . ie \\n(VS>=41 .vs \\n(VSu . el .vs \\n(VSp\} .ie \\n(IP \{\ . in \\n(I\\n(IRu . nr IP -1\} .el .if !\\n(IR \{\ . nr I1 \\n(PIu . nr I2 0 . nr I3 0 . nr I4 0 . nr I5 0\} .if !\\n(AB .ft 1 .ta 5n 10n 15n 20n 25n 30n 35n 40n 45n 50n 55n 60n 65n 70n 75n 80n .fi .. . \" BG - begin, execute at first TL, AB, NH, SH, PP, etc. .de BG \" IZ has been called, so registers have some value .br .if \\n(CW>0 .if \\n(LL=0 .nr LL \\n(CW+\\n(CW+\\n(GW .ll \\n(LLu .lt \\n(LLu .po \\n(POu .nr YE 1 \" ok to cause break in .EQ (earlier ones won't) .ev 0 .hy 14 .ev .ev 1 .hy 14 .ev .ev 2 .hy 14 .ev .nr 1T 1 .X "PARM NP \\n(HM .X "PARM FO \\n(FO .if !\\n(%# .nr %# 1 .. . \" PP - paragraph .de PP .RT .if \\n(1T .NP .if \\n(1T .X "SP \\n(PD PP" .if \\n(1T .X "BS 2 PP" .ti +\\n(PIu .. . \" LP - left aligned paragraph .de LP .RT .if \\n(1T .NP .if \\n(1T .X "SP \\n(PD LP" .if \\n(1T .X "BS 2 LP" .. . \" IP - indented paragraph .de IP .RT .if !\\n(IP .nr IP +1 .if \\n(1T .NP .if \\n(1T .X "SP \\n(PD PP" .if \\n(1T .X "BS 2 IP" .nr IU \\n(IR+1 .if \\n(.$>1 .nr I\\n(IU \\$2n+\\n(I\\n(IRu .if \\n(I\\n(IU=0 .nr I\\n(IU \\n(PIu+\\n(I\\n(IRu .in \\n(I\\n(IUu .nr TY \\n(TZ-\\n(.i .nr JQ \\n(I\\n(IU-\\n(I\\n(IR .ta \\n(JQu \\n(TYuR .if \\n(.$ \{\ .ti \\n(I\\n(IRu \&\\$1\t\c\} .. . \" QP - quoted paragraph (within IP) .de QP .RT .if \\n(1T .NP .if \\n(1T .X "SP \\n(PD QP" .if \\n(1T .X "BS 2 QP" .nr QP 1 .in +\\n(QIu .ll -\\n(QIu .ti \\n(.iu .. . \" RS - prepare for double indenting .de RS .nr IS \\n(IP .RT .nr IP \\n(IS .nr IU \\n(IR .nr IR +1 .if !\\n(I\\n(IR .nr I\\n(IR \\n(I\\n(IU+\\n(PIu .in \\n(I\\n(IRu .nr TY \\n(TZ-\\n(.i .ta \\n(TYuR .. . \" RE - retreat to the left .de RE .nr IS \\n(IP .RT .nr IP \\n(IS .if \\n(IR>0 .nr IR -1 .in \\n(I\\n(IRu .. . \" B - bold font .de B .nr PQ \\n(.f .ft 3 .if \\n(.$ \&\\$1\\f\\n(PQ\\$2 .. . \" BI - bold italic .de BI .nr PQ \\n(.f .ft 4 .if \\n(.$ \&\\$1\\f\\n(PQ\\$2 .. . \" R - Roman font .de R .nr PQ \\n(.f .ft 1 .if \\n(.$ \&\\$1\f\\n(PQ\\$2 .. . \" I - italic font .de I .nr PQ \\n(.f .ft 2 .if \\n(.$ \&\\$1\^\f\\n(PQ\\$2 .. . \" CW - constant width font from -ms .de CW .nr PQ \\n(.f .if \\n(.$=0 .ft CW .if \\n(.$>0 \%\&\\$3\f(CW\\$1\\f\\n(PQ\\$2 .. .de IT \" ditto to italicize argument .nr Sf \\n(.f \%\&\\$3\f2\\$1\f\\n(Sf\&\\$2 .. . \" TA - tabs set in ens or chars .de TA .ta \\$1n \\$2n \\$3n \\$4n \\$5n \\$6n \\$7n \\$8n \\$9n .. . \" SM - make smaller size .de SM .ie \\n(.$ \&\\$3\s-2\\$1\s0\\$2 .el .ps -2 .. . \" LG - make larger size .de LG .ie \\n(.$ \&\\$3\s+2\\$1\s0\\$2 .el .ps +2 .. . \" NL - return to normal size .de NL .ps \\n(PS .. . \" FS - begin footnote .de FS .if \\n(IF>0 .tm .FS within .FS/.FE, line \\n(.c, file \\n(.F .if \\n(KF>0 .tm .FS won't work inside .KF, line \\n(.c, file \\n(.F .if \\n(KS>0 .tm .FS won't work inside .KS, line \\n(.c, file \\n(.F .nr IF 1 .ev 1 .ps \\n(PS-2 .ie \\n(VS>=41 .vs \\n(VSu-2p .el .vs \\n(VSp-2p .ll \\n(LLu .br .nr X \\n(FOu .X "BF \\nX FS .SP .3v ....FA \" deleted by authority of cvw, 10/17/88 .. . \" FE - end footnote .de FE .if !\\n(IF .tm .FE without .FS, line \\n(.c, file \\n(.F .br .X "END BF FE .bp .ev .nr IF 0 .. . \" FA - the line for a footnote .de FA \l'1i' .br .. . \" Tm - message to be passed on .de Tm .ev 2 .if \\n(.$=1 .X "TM \\$1 .if \\n(.$=2 .X "TM \\$1 \\$2 .if \\n(.$=3 .X "TM \\$1 \\$2 \\$3 .if \\n(.$=4 .X "TM \\$1 \\$2 \\$3 \\$4 .if \\n(.$=5 .X "TM \\$1 \\$2 \\$3 \\$4 \\$5 .if \\n(.$=6 .X "TM \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 .if \\n(.$=7 .X "TM \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 .if \\n(.$=8 .X "TM \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 .if \\n(.$=9 .X "TM \\$1 \\$2 \\$3 \\$4 \\$5 \\$6 \\$7 \\$8 \\$9 .br .ev .. .de MH AT&T Bell Laboratories Murray Hill, New Jersey 07974 .. .de HO AT&T Bell Laboratories Holmdel, New Jersey 07733 .. .de WH AT&T Bell Laboratories Whippany, New Jersey 07981 .. .de IH AT&T Bell Laboratories Naperville, Illinois 60540 .. . \" UL - underline argument, don't italicize .de UL \\$1\l'|0\(ul'\\$2 .. . \" UX - print $2 UNIX $1 .de UX .ie \\n(UX \\$2\s-1UNIX\s0\\$1 .el \{\ \\$2\s-1UNIX\\s0\\$1\(rg .nr UX 1\} .. . \" QS - start quote .de QS .br .LP .in +\\n(QIu .ll -\\n(QIu .. . \" QE - end quote .de QE .br .ll +\\n(QIu .in -\\n(QIu .LP .. . \" B1 - begin boxed stuff .de B1 .br .di BB .nr BC 0 .if "\\$1"C" .nr BC 1 .nr BE 1 .. . \" B2 - end boxed stuff .de B2 .br .nr BI 1n .if \\n(.$>0 .nr BI \\$1n .di .nr BE 0 .nr BW \\n(dl .nr BH \\n(dn .ne \\n(BHu+\\n(.Vu .nr BQ \\n(.j .nf .ti 0 .if \\n(BC>0 .in +(\\n(.lu-\\n(BWu)/2u .in +\\n(BIu .ls 1 .BB .ls .in -\\n(BIu .nr BW +2*\\n(BI .sp -1 \l'\\n(BWu\(ul'\L'-\\n(BHu'\l'|0\(ul'\h'|0'\L'\\n(BHu' .if \\n(BC>0 .in -(\\n(.lu-\\n(BWu)/2u .if \\n(BQ .fi .br .. . \" BX - boxed stuff .de BX \(br\|\\$1\|\(br\l'|0\(rn'\l'|0\(ul' .. . . \" macros for programs, etc. . .ig programs are displayed between .P1/.P2 pairs default is to indent by 1/2 inch, nofill, dP smaller .P1 x causes an indent of x instead. .P3 can be used to specify optional page-break points inside .P1/.P2 .. . . \" P1 - start of program .de P1 .nr $1 \\n(P1 .if \\n(.$ .nr $1 \\$1n .br .X "SP \\n(DV P1" .X "US P1" .in \\n($1u .nf .nr v \\n(.v .ps -\\n(dP .vs -\\n(dVu .ft CW .nr t \\n(dT*\\w'x'u .ta 1u*\\ntu 2u*\\ntu 3u*\\ntu 4u*\\ntu 5u*\\ntu 6u*\\ntu 7u*\\ntu 8u*\\ntu 9u*\\ntu 10u*\\ntu 11u*\\ntu 12u*\\ntu 13u*\\ntu 14u*\\ntu .. . \" P2 - end of program .de P2 .br .ps \\n(PS .vs \\nvu .ft 1 .in .X "END US P1 .X "SP \\n(DV P2" .fi .. . \" P3 - provides optional unpadded break in P1/P2 .de P3 .nr x \\n(DV .nr DV 0 .P2 .P1 \\n($1u .nr DV \\nx .. .de [ [ .. .de ] ] .. .IZ .rm IZ .so /Users/daniel/plan9/tmac/tmac.srefs
18.317477
134
0.479648
ed7c10343f72055b19cf2e8bc17844ba9973ff43
317
t
Perl
lib/modernish/cap/ARITHPP.t
tabulon-ext/modernish
6a0382d02cb53ad9b4b65a1ae97007e117378eb3
[ "0BSD" ]
677
2016-02-22T04:11:07.000Z
2022-03-25T07:57:47.000Z
lib/modernish/cap/ARITHPP.t
tabulon-ext/modernish
6a0382d02cb53ad9b4b65a1ae97007e117378eb3
[ "0BSD" ]
13
2016-11-05T05:43:50.000Z
2022-02-17T16:58:35.000Z
lib/modernish/cap/ARITHPP.t
tabulon-ext/modernish
6a0382d02cb53ad9b4b65a1ae97007e117378eb3
[ "0BSD" ]
19
2017-04-17T15:21:13.000Z
2022-01-17T02:33:14.000Z
#! /shell/capability/test/for/moderni/sh # See the file LICENSE in the main modernish directory for the licence. # ARITHPP: shell arith supports the ++ and -- unary operators. # (Subshell needed because shells that don't support it exit.) ( : $((i=0)) $((i++)) $((++i)) $((i--)) $((--i)) ) 2>| /dev/null || return 1
39.625
71
0.637224
ed562291316054992d37001b170912010028a9e5
6,372
al
Perl
Apps/CZ/CoreLocalizationPack/app/Src/PageExtensions/AccountSchedule.PageExt.al
manjulchauhan/ALAppExtensions
3f2f1d6e5337188b1af9c0275420f1c1de036a7f
[ "MIT" ]
127
2018-04-17T18:03:03.000Z
2019-05-06T18:54:17.000Z
Apps/CZ/CoreLocalizationPack/app/Src/PageExtensions/AccountSchedule.PageExt.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
2,279
2018-09-12T12:01:49.000Z
2019-05-06T13:59:35.000Z
Apps/CZ/CoreLocalizationPack/app/Src/PageExtensions/AccountSchedule.PageExt.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
41
2018-05-17T11:19:52.000Z
2019-04-30T17:30:38.000Z
pageextension 11782 "Account Schedule CZL" extends "Account Schedule" { layout { addfirst(Control1) { field("Row Correction CZL"; Rec."Row Correction CZL") { ApplicationArea = Basic, Suite; ToolTip = 'Specifies the row code for the correction.'; Visible = false; trigger OnLookup(var Text: Text): Boolean var AccScheduleLine: Record "Acc. Schedule Line"; begin AccScheduleLine.SetRange("Schedule Name", Rec."Schedule Name"); AccScheduleLine.SetFilter("Row No.", '<>%1', Rec."Row No."); if Page.RunModal(Page::"Acc. Schedule Line List CZL", AccScheduleLine) = Action::LookupOK then Rec."Row Correction CZL" := AccScheduleLine."Row No."; end; } field("Source Table CZL"; Rec."Source Table CZL") { ApplicationArea = Basic, Suite; ToolTip = 'Specifies the selected source table (VAT entry, Value entry, Customer or vendor entry).'; } } addafter(Show) { field("Calc CZL"; Rec."Calc CZL") { ApplicationArea = Basic, Suite; ToolTip = 'Specifies when the value can be calculated in the Account Schedule - Always, Never, When Positive, When Negative.'; } } addlast(Control1) { field("Assets/Liabilities Type CZL"; Rec."Assets/Liabilities Type CZL") { ApplicationArea = Basic, Suite; ToolTip = 'Specifies the assets or liabilities type for the account schedule line.'; Visible = false; } } modify(Totaling) { trigger OnLookup(var Text: Text): Boolean var AccScheduleExtensionCZL: Record "Acc. Schedule Extension CZL"; AccSchedManagement: Codeunit "AccSchedManagement"; GLAccountList: Page "G/L Account List"; AccScheduleExtensionsCZL: Page "Acc. Schedule Extensions CZL"; begin if Rec."Totaling Type" in [Rec."Totaling Type"::"Posting Accounts", Rec."Totaling Type"::"Total Accounts"] then begin GLAccountList.LookupMode(true); if not (GLAccountList.RunModal() = Action::LookupOK) then exit(false); Text := GLAccountList.GetSelectionFilter(); exit(true); end; if Rec."Totaling Type" = Rec."Totaling Type"::"Custom CZL" then begin if Rec.Totaling <> '' then begin AccScheduleExtensionCZL.SetFilter(Code, Rec.Totaling); AccScheduleExtensionCZL.FindFirst(); AccScheduleExtensionsCZL.SetRecord(AccScheduleExtensionCZL); end; AccScheduleExtensionsCZL.SetLedgType(Rec."Source Table CZL"); AccScheduleExtensionsCZL.LookupMode(true); if not (AccScheduleExtensionsCZL.RunModal() = Action::LookupOK) then exit(false); AccScheduleExtensionsCZL.GetRecord(AccScheduleExtensionCZL); Text := AccScheduleExtensionCZL.Code; exit(true); end; Rec.LookupTotaling(); if Rec."Totaling Type" = Rec."Totaling Type"::"Account Category" then Text := AccSchedManagement.GLAccCategoryText(Rec) else Text := Rec.Totaling; exit(true); end; } } actions { #if CLEAN19 addafter("F&unctions") { group("Other CZL") { Caption = 'O&ther'; #else #pragma warning disable AL0432 addlast("O&ther") #pragma warning restore AL0432 { #endif action("Set up Custom Functions CZL") { ApplicationArea = Basic, Suite; Caption = 'Set up Custom Functions'; Ellipsis = true; Image = NewSum; RunObject = Page "Acc. Schedule Extensions CZL"; ToolTip = 'Specifies acc. schedule extensions page'; } action("File Mapping CZL") { ApplicationArea = Basic, Suite; Caption = 'File Mapping'; Image = ExportToExcel; ToolTip = 'File Mapping allows to set up export to Excel. You can see three dots next to the field with Amount.'; trigger OnAction() var AccScheuledFileMappingCZL: Page "Acc. Schedule File Mapping CZL"; begin AccScheuledFileMappingCZL.SetAccSchedName(Rec."Schedule Name"); AccScheuledFileMappingCZL.RunModal(); end; } } #if CLEAN19 } #endif addlast(processing) { group("Results Group CZL") { Caption = 'Results'; action("Save Results CZL") { ApplicationArea = Basic, Suite; Caption = 'Save Results'; Ellipsis = true; Image = Save; ToolTip = 'Opens window for saving results of acc. schedule'; trigger OnAction() var AccSchedExtensionMgtCZL: Codeunit "Acc. Sched. Extension Mgt. CZL"; begin AccSchedExtensionMgtCZL.CreateResults(Rec, '', false); end; } action("Results CZL") { ApplicationArea = Basic, Suite; Caption = 'Results'; Image = ViewDetails; RunObject = Page "Acc. Sched. Res. Hdr. List CZL"; RunPageLink = "Acc. Schedule Name" = field("Schedule Name"); ToolTip = 'Opens acc. schedule res. header list'; } } } } }
37.928571
142
0.494036
ed4676190c8d9355a03a40fdce869a1fb83ba756
63
t
Perl
fig/newkernelstack.t
pdav/xv6-book
3cb96cffcfe76f10b4fd8fc0d932ebbe66573198
[ "MIT" ]
206
2016-09-16T18:09:29.000Z
2022-03-26T20:15:51.000Z
fig/newkernelstack.t
pdav/xv6-book
3cb96cffcfe76f10b4fd8fc0d932ebbe66573198
[ "MIT" ]
11
2017-02-05T15:28:38.000Z
2020-04-09T16:19:37.000Z
fig/newkernelstack.t
pdav/xv6-book
3cb96cffcfe76f10b4fd8fc0d932ebbe66573198
[ "MIT" ]
85
2016-10-18T08:52:26.000Z
2022-03-25T12:43:36.000Z
.F1 .EPS fig/newkernelstack.eps 50 .F2 A new kernel stack. .F3
10.5
30
0.730159
ed8ec72b06baab6ce200091e487813586f9c330b
6,110
pm
Perl
modules/EnsEMBL/Web/Document/HTML/ToolsTable.pm
amonida/ensembl-webcode
284a8c633fdcf72575f18c11ac0657ee0919e270
[ "Apache-2.0", "MIT" ]
null
null
null
modules/EnsEMBL/Web/Document/HTML/ToolsTable.pm
amonida/ensembl-webcode
284a8c633fdcf72575f18c11ac0657ee0919e270
[ "Apache-2.0", "MIT" ]
null
null
null
modules/EnsEMBL/Web/Document/HTML/ToolsTable.pm
amonida/ensembl-webcode
284a8c633fdcf72575f18c11ac0657ee0919e270
[ "Apache-2.0", "MIT" ]
null
null
null
=head1 LICENSE Copyright [1999-2014] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. =cut package EnsEMBL::Web::Document::HTML::ToolsTable; ### Allows easy removal of items from template use strict; use EnsEMBL::Web::Document::Table; use base qw(EnsEMBL::Web::Document::HTML); sub render { my $self = shift; my $hub = EnsEMBL::Web::Hub->new; my $sd = $hub->species_defs; my $img_url = $sd->img_url; my $table = EnsEMBL::Web::Document::Table->new([ { key => 'name', title => 'Name', width => '20%', align => 'left' }, { key => 'desc', title => 'Description', width => '50%', align => 'left' }, { key => 'tool', title => 'Online tool', width => '10%', align => 'center' }, { key => 'code', title => 'Download code', width => '10%', align => 'center' }, { key => 'docs', title => 'Documentation', width => '10%', align => 'center' }, ], [], { cellpadding => 4 } ); ## VEP my $new_vep = $sd->ENSEMBL_VEP_ENABLED; my $vep_link = $hub->url({'species' => $sd->ENSEMBL_PRIMARY_SPECIES, $new_vep ? qw(type Tools action VEP) : qw(type UserData action UploadVariations)}); $table->add_row({ 'name' => sprintf('<a href="%s" class="%snodeco"><b>Variant Effect Predictor</b><br /><img src="%svep_logo_sm.png" alt="[logo]" /></a>', $vep_link, $new_vep ? '' : 'modal_link ', $img_url), 'desc' => 'Analyse your own variants and predict the functional consequences of known and unknown variants via our Variant Effect Predictor (VEP) tool.', 'tool' => sprintf('<a href="%s" class="%snodeco"><img src="%s16/tool.png" alt="Tool" title="Go to online tool" /></a>', $vep_link, $new_vep ? '' : 'modal_link ', $img_url), 'code' => sprintf('<a href="https://github.com/Ensembl/ensembl-tools/archive/release/%s.zip" rel="external" class="nodeco"><img src="%s16/download.png" alt="Download" title="Download Perl script" /></a>', $sd->ENSEMBL_VERSION, $img_url), 'docs' => sprintf('<a href="/info/docs/tools/vep/index.html"><img src="%s16/info.png" alt="Documentation" /></a>', $img_url) }); ## BLAST if ($sd->ENSEMBL_BLAST_ENABLED) { $table->add_row({ 'name' => '<b><a class="nodeco" href="/Multi/blastview">BLAST/BLAT</a></b>', 'desc' => 'Search our genomes for your DNA or protein sequence.', 'tool' => sprintf('<a href="/Multi/blastview" class="nodeco"><img src="%s16/tool.png" alt="Tool" title="Go to online tool" /></a>', $img_url), 'code' => '', 'docs' => sprintf('<a href="%s" class="popup"><img src="%s16/info.png" alt="Documentation" /></a>', $hub->url({'species' => '', 'type' => 'Help', 'action' => 'View', 'id' => { $sd->multiX('ENSEMBL_HELP') }->{'Multi/blastview'}}), $img_url) }); } ## BIOMART if ($sd->ENSEMBL_MART_ENABLED) { $table->add_row({ 'name' => '<b><a href="/biomart/martview">BioMart</a></b>', 'desc' => 'Use this data-mining tool to export custom datasets from Ensembl.', 'tool' => sprintf('<a href="/biomart/martview" class="nodeco"><img src="%s16/tool.png" alt="Tool" title="Go to online tool" /></a>', $img_url), 'code' => sprintf('<a href="http://biomart.org" rel="external" class="nodeco"><img src="%s16/download.png" alt="Download" title="Download code from biomart.org" /></a>', $img_url), 'docs' => sprintf('<a href="http://www.biomart.org/biomart/mview/help.html" class="popup"><img src="%s16/info.png" alt="Documentation" /></a>', $img_url) }); } ## ASSEMBLY CONVERTER $table->add_row({ 'name' => '<b>Assembly converter</b>', 'desc' => "Map (liftover) your data's coordinates to the current assembly.", 'tool' => sprintf('<a href="%s" class="modal_link nodeco"><img src="%s16/tool.png" alt="Tool" title="Go to online tool" /></a>', $hub->url({'species' => $sd->ENSEMBL_PRIMARY_SPECIES, 'type' => 'UserData', 'action' => 'SelectFeatures'}), $img_url), 'code' => sprintf('<a href="https://github.com/Ensembl/ensembl-tools/tree/release/%s/scripts/assembly_converter" rel="external" class="nodeco"><img src="%s16/download.png" alt="Download" title="Download Perl script" /></a>', $sd->ENSEMBL_VERSION, $img_url), 'docs' => '', }); ## ID HISTORY CONVERTER $table->add_row({ 'name' => '<b>ID History converter</b>', 'desc' => 'Convert a set of Ensembl IDs from a previous release into their current equivalents.', 'tool' => sprintf('<a href="%s" class="modal_link nodeco"><img src="%s16/tool.png" alt="Tool" title="Go to online tool" /></a>', $hub->url({'species' => $sd->ENSEMBL_PRIMARY_SPECIES, 'type' => 'UserData', 'action' => 'UploadStableIDs'}), $img_url), 'code' => sprintf('<a href="https://github.com/Ensembl/ensembl-tools/tree/release/%s/scripts/id_history_converter" rel="external" class="nodeco"><img src="%s16/download.png" alt="Download" title="Download Perl script" /></a>', $sd->ENSEMBL_VERSION, $img_url), 'docs' => '', }); ## VIRTUAL MACHINE $table->add_row({ 'name' => '<b>Ensembl Virtual Machine</b>', 'desc' => 'VirtualBox virtual Machine with Ubuntu desktop and pre-configured with the latest Ensembl API plus Variant Effect Predictor (VEP). <b>NB: download is >1 GB</b>', 'tool' => '-', 'code' => sprintf('<a href="ftp://ftp.ensembl.org/pub/current_virtual_machine" rel="external" class="nodeco"><img src="%s16/download.png" alt="Download" title="Download Virtual Machine" /></a>', $img_url), 'docs' => sprintf('<a href="/info/data/virtual_machine.html"><img src="%s16/info.png" alt="Documentation" /></a>', $img_url) }); return $table->render; } 1;
56.574074
263
0.639771
ed8bda43721f51da687624ff336c1a02e922fcf3
8,065
t
Perl
bundle/ngx_stream_lua-0.0.3/t/023-preread/tcp-socket.t
zyqCSL/openresty-1.13.6.1-instrumented
21be1c9e8e57a894a38865e34bccb2d3a97a6c18
[ "BSD-2-Clause" ]
null
null
null
bundle/ngx_stream_lua-0.0.3/t/023-preread/tcp-socket.t
zyqCSL/openresty-1.13.6.1-instrumented
21be1c9e8e57a894a38865e34bccb2d3a97a6c18
[ "BSD-2-Clause" ]
null
null
null
bundle/ngx_stream_lua-0.0.3/t/023-preread/tcp-socket.t
zyqCSL/openresty-1.13.6.1-instrumented
21be1c9e8e57a894a38865e34bccb2d3a97a6c18
[ "BSD-2-Clause" ]
null
null
null
# vim:set ft= ts=4 sw=4 et fdm=marker: use Test::Nginx::Socket::Lua::Stream; repeat_each(2); plan tests => repeat_each() * 24; our $HtmlDir = html_dir; $ENV{TEST_NGINX_MEMCACHED_PORT} ||= 11211; $ENV{TEST_NGINX_RESOLVER} ||= '8.8.8.8'; #log_level 'warn'; no_long_string(); #no_diff(); run_tests(); __DATA__ === TEST 1: sanity --- stream_config server { listen 127.0.0.1:9988; return testing\npreread\n; } --- stream_server_config preread_by_lua_block { local sock = ngx.socket.tcp() local port = 9988 local ok, err = sock:connect("127.0.0.1", port) if not ok then ngx.say("failed to connect: ", err) return end ngx.say("connected: ", ok) local req = "GET /foo HTTP/1.0\r\nHost: localhost\r\nConnection: close\r\n\r\n" -- req = "OK" local bytes, err = sock:send(req) if not bytes then ngx.say("failed to send request: ", err) return end ngx.say("request sent: ", bytes) while true do local line, err, part = sock:receive() if line then ngx.say("received: ", line) else ngx.say("failed to receive a line: ", err, " [", part, "]") break end end ok, err = sock:close() ngx.say("close: ", ok, " ", err) } content_by_lua return; --- stream_response connected: 1 request sent: 57 received: testing received: preread failed to receive a line: connection reset by peer [] close: 1 nil --- error_log recv() failed (104: Connection reset by peer === TEST 3: no resolver defined --- stream_server_config preread_by_lua_block { local sock = ngx.socket.tcp() local port = ngx.var.port local ok, err = sock:connect("agentzh.org", 1234) if not ok then ngx.say("failed to connect: ", err) end ngx.say("connected: ", ok) local req = "GET /foo HTTP/1.0\\r\\nHost: localhost\\r\\nConnection: close\\r\\n\\r\\n" -- req = "OK" local bytes, err = sock:send(req) if not bytes then ngx.say("failed to send request: ", err) return end ngx.say("request sent: ", bytes) } content_by_lua return; --- stream_response failed to connect: no resolver defined to resolve "agentzh.org" connected: nil failed to send request: closed --- error_log attempt to send data on a closed socket: === TEST 4: with resolver --- timeout: 10 --- stream_server_config resolver $TEST_NGINX_RESOLVER ipv6=off; resolver_timeout 3s; preread_by_lua_block { local sock = ngx.socket.tcp() local port = 80 local ok, err = sock:connect("agentzh.org", port) if not ok then ngx.say("failed to connect: ", err) return end ngx.say("connected: ", ok) local req = "GET / HTTP/1.0\r\nHost: agentzh.org\r\nConnection: close\r\n\r\n" -- req = "OK" local bytes, err = sock:send(req) if not bytes then ngx.say("failed to send request: ", err) return end ngx.say("request sent: ", bytes) local line, err = sock:receive() if line then ngx.say("first line received: ", line) else ngx.say("failed to receive the first line: ", err) end line, err = sock:receive() if line then ngx.say("second line received: ", line) else ngx.say("failed to receive the second line: ", err) end } content_by_lua return; --- stream_response connected: 1 request sent: 56 first line received: HTTP/1.1 200 OK second line received: Server: openresty --- no_error_log [error] === TEST 5: connection refused (tcp) --- stream_server_config preread_by_lua_block { local sock = ngx.socket.tcp() local ok, err = sock:connect("127.0.0.1", 16787) ngx.say("connect: ", ok, " ", err) local bytes bytes, err = sock:send("hello") ngx.say("send: ", bytes, " ", err) local line line, err = sock:receive() ngx.say("receive: ", line, " ", err) ok, err = sock:close() ngx.say("close: ", ok, " ", err) } content_by_lua return; --- stream_response connect: nil connection refused send: nil closed receive: nil closed close: nil closed --- error_log eval qr/connect\(\) failed \(\d+: Connection refused\)/ === TEST 6: connection timeout (tcp) --- stream_server_config resolver $TEST_NGINX_RESOLVER ipv6=off; lua_socket_connect_timeout 100ms; lua_socket_send_timeout 100ms; lua_socket_read_timeout 100ms; resolver_timeout 3s; preread_by_lua_block { local sock = ngx.socket.tcp() local ok, err = sock:connect("agentzh.org", 12345) ngx.say("connect: ", ok, " ", err) local bytes bytes, err = sock:send("hello") ngx.say("send: ", bytes, " ", err) local line line, err = sock:receive() ngx.say("receive: ", line, " ", err) ok, err = sock:close() ngx.say("close: ", ok, " ", err) } content_by_lua return; --- stream_response connect: nil timeout send: nil closed receive: nil closed close: nil closed --- error_log lua tcp socket connect timed out --- timeout: 10 === TEST 7: not closed manually --- stream_server_config preread_by_lua_block { local sock = ngx.socket.tcp() local port = $TEST_NGINX_SERVER_PORT local ok, err = sock:connect("127.0.0.1", port) if not ok then ngx.say("failed to connect: ", err) return end ngx.say("connected: ", ok) } content_by_lua return; --- stream_response connected: 1 --- no_error_log [error] === TEST 8: resolver error (host not found) --- stream_server_config resolver $TEST_NGINX_RESOLVER ipv6=off; resolver_timeout 3s; preread_by_lua_block { local sock = ngx.socket.tcp() local port = 80 local ok, err = sock:connect("blah-blah-not-found.agentzh.org", 1234) print("connected: ", ok, " ", err, " ", not ok) if not ok then ngx.say("failed to connect: ", err) end ngx.say("connected: ", ok) local req = "GET / HTTP/1.0\\r\\nHost: agentzh.org\\r\\nConnection: close\\r\\n\\r\\n" -- req = "OK" local bytes, err = sock:send(req) if not bytes then ngx.say("failed to send request: ", err) return end ngx.say("request sent: ", bytes) } content_by_lua return; --- stream_response_like ^failed to connect: blah-blah-not-found\.agentzh\.org could not be resolved(?: \(3: Host not found\))? connected: nil failed to send request: closed$ --- error_log attempt to send data on a closed socket --- timeout: 10 === TEST 9: resolver error (timeout) --- stream_server_config resolver $TEST_NGINX_RESOLVER ipv6=off; resolver_timeout 1ms; preread_by_lua_block { local sock = ngx.socket.tcp() local port = 80 local ok, err = sock:connect("blah-blah-not-found.agentzh.org", port) print("connected: ", ok, " ", err, " ", not ok) if not ok then ngx.say("failed to connect: ", err) end ngx.say("connected: ", ok) local req = "GET / HTTP/1.0\\r\\nHost: agentzh.org\\r\\nConnection: close\\r\\n\\r\\n" -- req = "OK" local bytes, err = sock:send(req) if not bytes then ngx.say("failed to send request: ", err) return end ngx.say("request sent: ", bytes) } content_by_lua return; --- stream_response_like ^failed to connect: blah-blah-not-found\.agentzh\.org could not be resolved(?: \(\d+: (?:Operation timed out|Host not found)\))? connected: nil failed to send request: closed$ --- error_log attempt to send data on a closed socket
24.292169
128
0.582021
ed559cff8b7a24cc2ffeb8199d9f0e5065ef85eb
1,131
pm
Perl
templates/Perl/Catalyst/Ufimisms/Member Site/Utils/Utils.pm
jmcveigh/p5-komodo-tools
e9ecfc9e3db2291530963257287ee44d3ce38435
[ "BSD-2-Clause" ]
1
2016-05-10T13:13:43.000Z
2016-05-10T13:13:43.000Z
templates/Perl/Catalyst/Ufimisms/Member Site/Utils/Utils.pm
jmcveigh/p5-komodo-tools
e9ecfc9e3db2291530963257287ee44d3ce38435
[ "BSD-2-Clause" ]
null
null
null
templates/Perl/Catalyst/Ufimisms/Member Site/Utils/Utils.pm
jmcveigh/p5-komodo-tools
e9ecfc9e3db2291530963257287ee44d3ce38435
[ "BSD-2-Clause" ]
null
null
null
package MemberSite::Model::Utils; use base 'Catalyst::Model::Adaptor'; __PACKAGE__->config({ class => 'MemberSite::Model::Utils' }); sub add_flag { my $self = shift; my $flagstr = shift; my $flag_to_add = shift; return(_add_letter($flag_to_add, $flagstr)); } sub add_achievment { my $self = shift; my $achievmentstr = shift; my $achievment_to_add = shift; return(_add_letter($achievment_to_add, $achievmentstr)); } sub del_flag { my $self = shift; my $flagstr = shift; my $flag_to_del = shift; return(_del_letter($flag_to_del, $flagstr)); } sub del_achievment { my $self = shift; my $achievmentstr = shift; my $achievment_to_del = shift; return(_del_letter($achievment_to_del, $achievmentstr)); } sub _add_letter { my $self = shift; my $atom_to_add = shift; my $atomstr = shift; @atoms = sort split(//, $atomstr . $atom_to_add); return "@atoms"; } sub _del_letter { my $self = shift; my $atom_to_del = shift; my $str = shift; my $ret = $str; $ret =~ s/$atom_to_del//; return $ret; } 1;
19.842105
61
0.617153
ed037725c269bac5aa12f8ede77a006d43c1c88b
7,112
pm
Perl
posda/posdatools/Posda/include/Posda/Rtog.pm
UAMS-DBMI/PosdaTools
7d33605da1b88e4787a1368dbecaffda1df95e5b
[ "Apache-2.0" ]
6
2019-01-17T15:47:44.000Z
2022-02-02T16:47:25.000Z
posda/posdatools/Posda/include/Posda/Rtog.pm
UAMS-DBMI/PosdaTools
7d33605da1b88e4787a1368dbecaffda1df95e5b
[ "Apache-2.0" ]
23
2016-06-08T21:51:36.000Z
2022-03-02T08:11:44.000Z
posda/posdatools/Posda/include/Posda/Rtog.pm
UAMS-DBMI/PosdaTools
7d33605da1b88e4787a1368dbecaffda1df95e5b
[ "Apache-2.0" ]
null
null
null
# #Copyright 2008, Bill Bennett # Part of the Posda package # Posda may be copied only under the terms of either the Artistic License or the # GNU General Public License, which may be found in the Posda Distribution, # or at http://posda.com/License.html # use strict; package Posda::Rtog; { package Posda::Rtog::FilesetDesc; sub NewFromFileSet{ my($class, $base_file, $image_dir, $tar_file_id) = @_; unless(-d $image_dir) { die "$image_dir is not a directory" }; open DIRFILE, "<", "$image_dir/${base_file}0000" or die "Can't find RTOG directory (${base_file}0000) file " . "in dir $image_dir"; my $this = { base_file => $base_file, storage_root => $image_dir, tar_file_id => $tar_file_id, }; my $currecord; while(my $line = <DIRFILE>){ $line =~ s/\r//g; $line =~ s/\0//g; chomp $line; # print "line: $line\n"; if($line =~ /^\s*$/) {next} unless($line =~ /^\s*(.*)\s*:=\s*(.*)\s*$/){ print "non matching: '$line'\n"; return undef; # next; } my $key = $1; my $value = $2; $key =~ s/\s//g; $key =~ s/#/number/g; $key =~ tr/a-z/A-Z/; # print "$key = $value\n"; if($key eq "IMAGENUMBER"){ if(defined $currecord){ push(@{$this->{records}}, $currecord); } $currecord = { IMAGENUMBER => $value, }; } else { if(defined $currecord){ $currecord->{$key} = $value; } else { $this->{$key} = $value; } } } push(@{$this->{records}}, $currecord); return bless $this, $class; } sub InstantiateFileSet{ my($this, $db) = @_; my $q = $db->prepare( "insert into rtog_fileset(rtog_tar_file_id, rtog_base_file) values (?, ?)" ); $q->execute($this->{tar_file_id}, $this->{base_file}); $q = $db->prepare( "select currval('rtog_fileset_rtog_fileset_id_seq') as id"); $q->execute(); my $h = $q->fetchrow_hashref(); $q->finish(); unless($h && ref($h) eq "HASH") { die "can't get fileset_id" } my $id = $h->{id}; $this->{fileset_id} = $id; { my $from_file = "$this->{base_file}0000"; unless(-f $from_file) { die "directory file disappeared"; } my $to_dir = "$this->{storage_root}/$id"; unless(-d $to_dir) { `mkdir $to_dir` } unless(-d $to_dir) { die "mkdir apparently failed" } my $to_file = "$to_dir/0000.dir"; `cp \"$from_file\" \"$to_file\"`; my $q = $db->prepare( "insert into rtog_dir_file(rtog_fileset_id, rd_path)\n" . "values (?, ?)" ); $q->execute($id, $to_file); } for my $i (keys %$this){ if(ref($this->{$i}) eq "ARRAY"){ unless($i eq "records") { die "key \"$i\" is ARRAY" } next; } $q = $db->prepare( "insert into rtog_fileset_attr(\n" . " rtog_fileset_id, fs_key, fs_value\n" . ") values (?, ?, ?)"); $q->execute($id, $i, $this->{$i}); } my $rec_num = 0; image: for my $r (@{$this->{records}}){ $rec_num += 1; unless($r->{IMAGENUMBER} eq $rec_num){ print STDERR "nonmatching image_number: $rec_num vs $r->{IMAGENUMBER}\n"; $rec_num = $r->{IMAGENUMBER}; } $q = $db->prepare( "insert into rtog_image(\n" . " rtog_fileset_id, image_number\n" . ")values(?, ?)" ); $q->execute($id, $rec_num); for my $i (keys %$r){ $q = $db->prepare( "insert into rtog_image_attr(\n" . " rtog_fileset_id, image_number, im_key, im_value\n" . ") values (?, ?, ?, ?)" ); $q->execute($id, $rec_num, $i, $r->{$i}); } my $from_file = sprintf("$this->{base_file}%04d", $rec_num); unless(-f $from_file) { print STDERR "non_existent image_file: $from_file\n"; next image; } my $to_dir = "$this->{storage_root}/$id"; unless(-d $to_dir) { `mkdir $to_dir` } unless(-d $to_dir) { die "mkdir apparently failed" } my $to_file = "$to_dir/$rec_num.img"; `cp \"$from_file\" \"$to_file\"`; $q = $db->prepare( "insert into rtog_image_file(\n " . " rtog_fileset_id, image_number, im_path\n" . ") values (?, ?, ?)" ); $q->execute($id, $rec_num, $to_file); } } } { package Posda::Rtog; sub NewFromDir{ my($class, $dir) = @_; my $base_file; opendir DIR, "$dir" or die "can't opendir $dir"; my $rf; my $this = {}; while(my $file = readdir(DIR)){ if($file =~ /^(.*)(\d\d\d\d)$/){ my $b_file = $1; my $index = $2; unless(defined $base_file){ $base_file = $b_file } if ($base_file ne $b_file) { die "Two potential basefiles:\n" . "\t\"${base_file}0000\" and\n" . "\t\"$file\""; } if($index == 0){ $rf = Posda::Rtog::FilesetDesc->NewFromFileSet("$base_file", $dir, 0); } else { my $i = $index + 0; $this->{image_file}->{$i} = "$dir/$file"; } } } unless($rf) { die "didn't find or parse basefile" } for my $i (keys %$rf){ unless($i eq "records"){ $this->{fileset_attr}->{$i} = $rf->{$i}; } } for my $r (@{$rf->{records}}){ my $fi = $r->{IMAGENUMBER}; $this->{image_attr}->{$fi} = $r; } $this->{dir_path} = ""; return bless $this, $class; } sub NewFromId{ my($class, $db, $id) = @_; my $q = $db->prepare( "select rd_path as dir_path from rtog_dir_file where rtog_fileset_id = ?" ); $q->execute($id); my $h = $q->fetchrow_hashref(); $q->finish(); unless($h && ref($h) eq "HASH") { die "couldn't get a dir file for id: $id" } my $dir_path = $q->{dir_path}; $q = $db->prepare( "select fs_key as key, fs_value as value from rtog_fileset_attr\n" . "where rtog_fileset_id = ?" ); my %fileset_attr; $q->execute($id); while (my $h = $q->fetchrow_hashref()){ $fileset_attr{$h->{key}} = $h->{value}; } my %image_attr; $q = $db->prepare( "select image_number, im_key as key, im_value as value\n" . "from rtog_image_attr\n" . "where rtog_fileset_id = ?" ); $q->execute($id); while (my $h = $q->fetchrow_hashref()){ $image_attr{$h->{image_number}}->{$h->{key}} = $h->{value}; } my %image_files; $q = $db->prepare( "select image_number, im_path as file_path\n" . "from rtog_image_file\n" . "where rtog_fileset_id = ?" ); $q->execute($id); while(my $h = $q->fetchrow_hashref()){ $image_files{$h->{image_number}} = $h->{file_path}; } my $this = { dir_path => $dir_path, fileset_attr => \%fileset_attr, image_attr => \%image_attr, image_file => \%image_files, }; for my $i (sort { $a <=> $b } keys %image_attr){ unless(exists ($image_files{$i})){ die "image %i has no file" } } return bless $this, $class; } } 1;
30.26383
81
0.512092
ed948073c2f51b590d5bf5235b10c3ce15653360
3,643
pl
Perl
included_software/KronaTools-2.5/scripts/ImportPhymmBL.pl
MetAnnotate/MetAnnotate
d8a68b3a135d7186f1f98fda43fcb8fac929c8a3
[ "Apache-2.0" ]
2
2021-03-26T11:31:12.000Z
2021-05-21T01:57:07.000Z
included_software/KronaTools-2.5/scripts/ImportPhymmBL.pl
Metannotate/Metannotate
d8a68b3a135d7186f1f98fda43fcb8fac929c8a3
[ "Apache-2.0" ]
34
2017-08-14T17:48:43.000Z
2018-04-07T02:38:38.000Z
included_software/KronaTools-2.5/scripts/ImportPhymmBL.pl
MetAnnotate/MetAnnotate
d8a68b3a135d7186f1f98fda43fcb8fac929c8a3
[ "Apache-2.0" ]
2
2017-08-14T19:10:08.000Z
2017-08-14T19:23:05.000Z
#! /usr/bin/perl # Copyright © 2011, Battelle National Biodefense Institute (BNBI); # all rights reserved. Authored by: Brian Ondov, Nicholas Bergman, and # Adam Phillippy # # See the LICENSE.txt file included with this software for license information. use strict; use lib (`ktGetLibPath`); use KronaTools; setOption('name', 'all'); setOption('key', 0); my @options = qw( out name minConfidence combine depth hueBad hueGood phymm local standalone url postUrl ); getKronaOptions(@options); if ( @ARGV < 1 ) { setOption('out', 'phymm(bl).krona.html'); printUsage ( 'Creates a Krona chart of Phymm or PhymmBL results. Note: Since confidence scores are not given for species/subspecies classifications, they inheret confidence scores from genus classifications.', 'phymmbl_results', 'PhymmBL results files (results.03.*). Results can also be from Phymm alone (results.01.*), but ' . getOptionString('phymm') . ' must be specified.', 1, 1, \@options ); exit 0; } if ( ! defined getOption('out') ) { if ( getOption('phymm') ) { setOption('out', 'phymm.krona.html'); } else { setOption('out', 'phymmbl.krona.html'); } } my @ranks = ( 'Phylum', 'Class', 'Order', 'Family', 'Genus', 'Species/Subspecies' ); my $tree = newTree(); my $set = 0; my @datasetNames; my $useMag; foreach my $input ( @ARGV ) { my ($fileName, $magFile, $name) = parseDataset($input); if ( ! getOption('combine') ) { push @datasetNames, $name; } my %magnitudes; print "Importing $fileName...\n"; if ( defined $magFile ) { print " Loading magnitudes from $magFile...\n"; loadMagnitudes($magFile, \%magnitudes); $useMag = 1; } print " Reading classifications from $fileName...\n"; open INFILE, "<$fileName" or die $!; <INFILE>; # eat header while ( my $line = <INFILE> ) { chomp $line; my @values = split /\t/, $line; my @lineage; my $scores; my $readID = shift @values; if ( getOption('phymm') ) { my ($species, $score); ($species, $score, @lineage) = @values; $scores = $score; @lineage = reverse @lineage; push @lineage, $species; } else { if ( @values < 12 ) { my $phymm = getOptionString('phymm'); ktDie("Not enough fields in $fileName. Is it a PhymmBL result file (see $phymm)?"); } $scores = (); $values[1] = $values[3]; # use genus conf for species for ( my $i = 0; $i < @values; $i += 2 ) { unshift @lineage, $values[$i]; unshift @$scores, $values[$i + 1]; } } for ( my $i = 0; $i < @lineage; $i++ ) { $lineage[$i] = decode($lineage[$i]); } map { if ( $_ eq '' ) { $_ = 'unknown' } } @lineage; addByLineage($tree, $set, \@lineage, $readID, $magnitudes{$readID}, $scores, \@ranks); } close INFILE; if ( ! getOption('combine') ) { $set++; } } # tree output my @attributeNames = ( 'magnitude', 'count', 'unassigned', 'rank', 'score' ); my @attributeDisplayNames = ( $useMag ? 'Magnitude' : undef, 'Count', 'Unassigned', 'Rank', getOption('phymm') ? 'Avg. score' : 'Avg. confidence' ); writeTree ( $tree, \@attributeNames, \@attributeDisplayNames, \@datasetNames, getOption('hueBad'), getOption('hueGood') ); # subroutines sub decode { # return special characters in place of their Phymm placeholders my ($string) = @_; $string =~ s/_/ /g; $string =~ s/UNDERSCORE/_/g; $string =~ s/SLASH/\//g; $string =~ s/LPAREN/\(/g; $string =~ s/RPAREN/\)/g; $string =~ s/SINGLEQUOTE/'/g; $string =~ s/DOUBLEQUOTE/"/g; $string =~ s/COLONCOLON/:/g; $string =~ s/SEMICOLON/;/g; return $string; }
16.484163
88
0.608839
73fe81af9f794e2db5a238255790a8bdfdbbf145
508,284
t
Perl
doc/uguide.t
muparkkra/mup
ac46d4b25de20203b48b849fd311fe9c9505ce6e
[ "Mup" ]
5
2020-12-01T20:35:21.000Z
2022-02-15T02:16:20.000Z
doc/uguide.t
muparkkra/mup
ac46d4b25de20203b48b849fd311fe9c9505ce6e
[ "Mup" ]
1,129
2019-02-25T00:55:24.000Z
2022-03-06T02:18:11.000Z
doc/uguide.t
muparkkra/mup
ac46d4b25de20203b48b849fd311fe9c9505ce6e
[ "Mup" ]
4
2019-09-29T13:39:12.000Z
2022-03-22T22:13:30.000Z
.\" .if \n(.g .warn \n[.warn]-512 .\" turning off warnings doesn't seem to work on all versions .\" of groff, so explicitly initialize null strings to pacify it. .sp -3 .\" This also avoids ignoring valid warnings .ds aA .ds aB .ds aC .ds aD .ds aE .ds aF .ds aG .ds aH .ds aI .ds aJ .ds aK .ds aL .ds aM .ds aN .ds aO .ds aP .ds aQ .ds aR .ds aS .ds aT .ds aU .ds aV .ds aW .ds aX .ds aY .ds aZ .ds bA .ds bB .ds bC .ds bD .ds bE .ds bF .ds bG .ds bH .ds bI .ds bJ .ds bK .ds bL .ds bM .ds bN .ds bO .ds bP .ds bQ .ds bR .ds bS .ds bT .ds bU .ds bV .ds bW .ds bX .ds bY .ds bZ .ds cA .ds cB .ds cC .ds cD .ds cE .ds cF .ds cG .ds cH .ds cI .ds cJ .ds cK .ds cL .ds cM .ds cN .ds cO .ds cP .ds cQ .ds cR .ds cS .ds cT .ds cU .ds cV .ds cW .ds cX .ds cY .ds cZ .ds dA .ds dB .ds dC .ds dD .ds dE .ds dF .ds dG .ds dH .ds dI .ds dJ .ds dK .ds dL .ds dM .ds dN .ds dO .ds dP .ds dQ .ds dR .ds dS .ds dT .ds dU .ds dV .ds dW .ds dX .ds dY .ds dZ .ds eA .ds eB .ds eC .ds eD .ds eE .ds eF .ds eG .ds eH .ds eI .ds eJ .ds eK .ds eL .ds eM .ds eN .ds eO .ds eP .ds eQ .ds eR .ds eS .ds eT .ds eU .ds eV .ds eW .ds eX .ds eY .ds eZ .ds fA .ds fB .ds fC .ds fD .ds fE .ds fF .ds fG .ds fH .ds fI .ds fJ .ds fK .ds fL .ds fM .ds fN .ds fO .ds fP .ds fQ .ds fR .ds fS .ds fT .ds fU .ds fV .ds fW .ds fX .ds fY .ds fZ .ds gA .ds gB .ds gC .ds gD .ds gE .ds gF .ds gG .ds gH .ds gI .ds gJ .ds gK .ds gL .ds gM .ds gN .ds gO .ds gP .ds gQ .ds gR .ds gS .ds gT .ds gU .ds gV .ds gW .ds gX .ds gY .ds gZ .ds hA .ds hB .ds hC .ds hD .ds hE .ds hF .ds hG .ds hH .ds hI .ds hJ .ds hK .ds hL .ds hM .ds hN .ds hO .ds hP .ds hQ .ds hR .ds hS .ds hT .ds hU .ds hV .ds hW .ds hX .ds hY .ds hZ .ds iA .ds iB .ds iC .ds iD .ds iE .ds iF .ds iG .ds iH .ds iI .ds iJ .ds iK .ds iL .ds iM .ds iN .ds iO .ds iP .ds iQ .ds iR .ds iS .ds iT .ds iU .ds iV .ds iW .ds iX .ds iY .ds iZ .ds jA .ds jB .ds jC .ds jD .ds jE .ds jF .ds jG .ds jH .ds jI .ds jJ .ds jK .ds jL .ds jM .ds jN .ds jO .ds jP .ds jQ .ds jR .ds jS .ds jT .ds jU .ds jV .ds jW .ds jX .ds jY .ds jZ .\" These next few macros are used by HTML post-processor; no-ops for troff .de Hi .. .de He .. .de Hd .. .de Ht .. .de Hr .. .de Hm .. .de Hh .. .de pI .. .Hd /dev/null .rm )k .de Ex .br .ev 1 .nr Fn \\n(.f .ft CW .if n .sp1 .DS .in +0.5i .. .de HY .if \\n(.g \X'ps: exec 0 0.1 0.5 setrgbcolor' .. .de HZ .if \\n(.g \X'ps: exec 0 0 0 setrgbcolor' .. .nr Nn 1 .de Pt .if \\n(.g \{ .sp -3.7 .psbb \\$1 .nr pict-width \\n[urx]-\\n[llx] .nr pict-offset \\n[.l]-\\n[.i]-\\n[pict-width]p/2 .nr pict-height \\n[ury]-\\n[lly] .nr ps-pict-width \\n[pict-width]p .if \\n[Nn] .ne \\n[pict-height]p \h'\\n[pict-offset]u' .if \\n[Boxpict] \X'ps: exec gsave 0 0.25 0.75 setrgbcolor 0 \\n[pict-height] rlineto \\n[pict-width] 0 rlineto 0 \\n[pict-height] neg rlineto closepath stroke grestore' \v'\\n[pict-height]p'\h'-6p' \X'ps: import \\$1 \\n[llx] \\n[lly] \\n[urx] \\n[ury] \\n[ps-pict-width]' .br .sp \\n[pict-height]p \} .. .de Ee .in -0.5i .DE .ft \\n(Fn .if n .sp1 .br .ev .if t \{ .if \\n(.$=5 \{ .ie \\n(.g .Pt \\$1 .el \{ .rs .ne \\$4p .br .nr oF (\\n(.l-\\$5p)/2.0 .ie \\n(oF<0 \{ .nr oF 0 .nr Po 200u \} .el .nr Po \\n(.o .if \\n(.P \\!x X PI:\\n(Po:\\n(.i:\\n(.l:\\n(.t:\\$1:\\$2,\\$3,0.2,\\n(oFu:to: \ \ \ .br .rs .sp \\$4p-\n(.sp \ \ \ .br \} \} .sp -\n(.sp \} .. .de Ix .if !'\\*(\\$1'' .as \\$1 ", .as \\$1 \\n% .. \ \ \ .sp 3 .ev 1 \X'ps: exec 0 0.15 0.65 setrgbcolor' .ft BI .ps 24 .vs 32 .ce 3 M u p M\|u\|s\|i\|c P\|u\|b\|l\|i\|s\|h\|e\|r U\|s\|e\|r\|'\|s G\|u\|i\|d\|e .sp 1i .ft P \X'ps: exec 0 0 0 setrgbcolor' .nr Boxpict 0 \ \ \ .br .Ex 1 .\"score leftmargin=3; rightmargin=3 .\"music .\"1: 4e; 4d; 2c; .\"bar .Ee .sp 2i \X'ps: exec 0 0.15 0.65 setrgbcolor' .ps 14 .nr Boxpict 1 .ce Mup Version 6.9 .ps .vs .ev .pn 0 .if \n(.g \{ \X'ps: exec 0 0 0 setrgbcolor' .pg@disable-top-trap .nr % 0 .nr P 0 .hd@set-page 0 \} .SK \ \ \ .sp 5.5i Mup Music Publisher User's Guide \(em Mup Version 6.9 .sp 0.5 \(co Copyright 1995-2021 by Arkkra Enterprises .sp 0.5 All rights reserved. .sp Trademarks: All brand names and product names included in this User's Guide are trademarks, registered trademarks, or trade names of their respective holders. .if \n(.g \{ \X'ps: exec %-marker1-' .nr N 2 .nr % 0 .nr P 0 .pg@enable-top-trap .hd@set-page 0 \} .SK .nr Cl 4 .ft B .ps 16 .ce 2 Mup \(em Music Publisher .sp User's Guide .sp 2 .ps 12 .ds HP +5 +4 +3 +2 +1 .ds HF 3 3 2 2 2 .nr Hb 4 .ft P .\" for HTML .ig .Ht Mup User's Guide .Hd index.html .P This is the on-line version of the Mup User's Guide, giving information about how to use the Mup Music Publication program. .H 2 "Mup Background Information" .Hr intro.html Introduction to Mup .br .Hr basics.html Quick tutorial on Mup basics .br .Hr running.html Running Mup .br .Hr cmdargs.html Mup Options .br .Hr utilpgms.html Mup utility programs for displaying and printing music .br .Hr gensyn.html Mup General syntax information .br .Hr contexts.html Mup contexts .br <HR> .H 2 "Basic Standard Music Notation" .Hr music.html Specifying Mup music input .br .Hr chordinp.html Chords (pitch, duration, and other attributes) .br .DL .LI .Hr chordinp.html#letter Notes, rests, or spaces .LI .Hr chordinp.html#measdur Measure duration .LI .Hr chordinp.html#acc Accidentals .LI .Hr chordinp.html#oct Octave .LI .Hr chordinp.html#shorthnd Shorthand notations .LI .Hr noteattr.html Note attributes .DL .LI .Hr noteattr.html#small Small notehead .LI .Hr noteattr.html#ntie Note ties .LI .Hr noteattr.html#nslur Slurs .LI .Hr noteattr.html#ntag Note location tag .LE .LI .Hr chrdattr.html Chord attributes .DL .LI .Hr chrdattr.html#chstyle Chord style (grace, cue, xnote, diamond) .LI .Hr chrdattr.html#shaped Shaped notes .LI .Hr chrdattr.html#withlist Symbols to be printed with a chord .LI .Hr chrdattr.html#slashes Slashes .LI .Hr chrdattr.html#stemdir Stem direction .LI .Hr chrdattr.html#stemlen Stem length .LI .Hr chrdattr.html#pad Chord padding .LI .Hr chrdattr.html#ctag Chord location tag .LI .Hr chrdattr.html#hoffset Horizontal offset .LI .Hr chrdattr.html#dist Rest distance .LI .Hr chrdattr.html#rptattr Shorthand for repeated attributes .LE .LI .Hr midmeas.html Mid-measure parameter changes .LI .Hr crossst.html Cross-staff stems .LI .Hr ichdattr.html Inter-chord attributes .DL .LI .Hr ichdattr.html#tie Chord ties .LI .Hr ichdattr.html#slur Chord slurs .LI .Hr ichdattr.html#custbeam Custom beaming .LI .Hr ichdattr.html#crossbm Cross-staff beams .LI .Hr ichdattr.html#alt Alternation groups .LE .LI .Hr tuplets.html Tuplets .LE .br .Hr altinp.html Chord-at-a-time input style .br .Hr bars.html Bar lines .br .DL .LI .Hr bars.html#bpad Bar line padding .LI .Hr bars.html#btag Bar line location tag .LI .Hr bars.html#endings Endings .LI .Hr bars.html#reh Rehearsal marks .LI .Hr bars.html#setmnum Setting the measure number .LI .Hr bars.html#hide Hiding time/key signature and clef changes .LE .Hr bars.html#subbar Subbars .br .Hr multirst.html Multirests .br .Hr lyrics.html Lyrics <HR> .H 2 "Tablature" .Hr tabstaff.html Tablature notation <HR> .H 2 "Shaped notes" .Hr shaped.html Shaped notes <HR> .H 2 "Text Strings" .Hr textstr.html Mup text strings <HR> .H 2 Tempo, dynamic marks, ornaments, etc. .Hr stuff.html General Information .br .Hr textmark.html Text .br .Hr textmark.html#grids Guitar grids .br .Hr mussym.html Music symbols .br .Hr phrase.html Phrase marks .br .Hr cres.html Crescendo and decrescendo marks .br .Hr octave.html Octave marks .br .Hr pedal.html Piano pedal marks .br .Hr roll.html Rolls <HR> .H 2 "Tags, printing text, lines and curves" .Hr tags.html Location tags .br .Hr prnttext.html Printing text .br .Hr linecurv.html Lines and curves <HR> .H 2 "Miscellaneous Mup features" .Hr newscore.html Newscore and newpage, samescore and samepage .br .Hr headfoot.html Page headers and footers .br .Hr macros.html Macros .br .Hr ifclause.html Generalized if clauses .br .Hr include.html Include files .br .Hr exit.html Exit .br .Hr udefsym.html User-defined symbols .br .Hr fontfile.html Installing other fonts .br <HR> .H 2 "Custom Accidentals and Alternate Tunings" .Hr tuning.html Custom Accidentals and Alternate Tunings <HR> .H 2 "Mup Parameters" .Hr param.html Mup parameters <HR> .H 2 "Hints" .Hr debug.html Debugging .br .Hr adjust.html Adjusting output .br .Hr invisbar.html Special uses of invisible bars .br .Hr chant.html Chant .br .Hr sharehd.html Forcing shared noteheads .br .Hr mantup.html Manually placed tuplet numbers .br .Hr manual.html Manual placement of notes .br .Hr trillacc.html Trill with accidental .br .Hr tieacc.html Accidental on tied-to note .br .Hr brackmac.html Bracketing notes across staffs .br .Hr crossbar.html Cross-bar beaming .br .Hr lyrtag.html Printing relative to lyric syllables .br .Hr slantxt.html Printing slanted text .br .Hr mixtsig.html Mixed time signatures .br .Hr nestmac.html Defining a macro inside another macro .br .Hr tempochg.html Marking complicated tempo changes .br .Hr multsong.html Placing several songs on one page .br .Hr cadenza.html Cadenzas .br .Hr trnspose.html Transposition .br .Hr verses.html Placing verses below the scores .br .Hr pianored.html Automatic piano reduction .br .Hr autocue.html Deriving cue notes from another staff .br .Hr slashmrk.html Diagonal slash marks .br .Hr breathmk.html Breath marks .br .Hr breaks.html Breaks .br .Hr heeltoe.html Organ pedal heel and toe marks .br .Hr muspaper.html Generating blank staff paper .br .Hr pscoord.html Passing multiple coordinates to PostScript .br .Hr brace.html Printing braces .br .Hr pstools.html Converting Mup files to other formats <HR> .H 2 "MIDI output" .Hr midi.html Basic Information .br .Hr gradmidi.html Gradual MIDI Changes <BR> <HR> <P> .Hr mupindex.html Index </P> <HR> <P> <ADDRESS> Arkkra Enterprises .br .Hr mailto:support@arkkra.com support@arkkra.com .br .Hr http://www.arkkra.com http://www.arkkra.com </ADDRESS> </P> <HR> <P> Copyright (c) 1995-2021 by Arkkra Enterprises </P> .. .Ht Introduction to Mup .Hd intro.html .H 1 "INTRODUCTION" .nr Ej 1 .P The music publisher program called "Mup" takes a text file describing music as input, and generates PostScript* .Hi .FS * PostScript is a trademark of Adobe Systems Incorporated .FE .He .Ix cF .Ix hA output for printing that music. After being available as shareware for 17 years, as of version 6.1, it is now available as free, open-source software. The input file can be created using your favorite text editor, or with the help of the companion Mupmate program, or generated from any other source, such as another program. The input must be written in a special language designed especially for describing music. The majority of the Mup User's Guide is the explanation of this language and how to use it. .P Mup has the power to print almost any kind of music, everything from a single melody line to full orchestral or choral scores complete with .Ix hJ tempo and dynamic marks. In addition to standard 5-line staffs, it can handle 1-line staffs (typically used for percussion), and tablature notation (typically used for guitar). Because Mup can do so much, it takes a while to .Ix cH .Ix fR master its entire language. However, it has built-in default values for many things, so that you can start using it for simple songs after .Hr basics.html learning just the basics, then learn the more complicated features as you need them. Mup also has an option to produce .Hr midi.html output in the standard Musical Instrument Digital Interface (MIDI) format. .Ix aA .Hi .P The User's Guide begins by introducing the basics and describing the general framework of the language. Then it gives detailed information about all the features of Mup. Appendix A gives a sample input file. There is a Quick Reference available that may be useful for jogging your memory after you've had a little experience using Mup. .P This User's Guide is for Mup version 6.9. .\" Add copyright. Probably better way to do this, but this will work .FS " " .ce \(co Copyright 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2021 by Arkkra Enterprises .FE .He .ig <BR> <HR> * PostScript is a trademark of Adobe Systems Incorporated .. .Ht "Mup Basics" .Hd basics.html .H 1 "MUP BASICS" .P This section introduces the Mup language, giving some simple examples to give you the flavor of a Mup input file. Subsequent sections will go into greater detail. .H 2 "Notes and chords" .Ix gW .P Music is described one measure at a time. Each note is specified by its pitch .Ix fM .Ix hG .Ix hL value, "a" to "g." As an example, the first measure of "Three Blind Mice" can be described like this: .Ex 1 .\"score leftmargin=3; rightmargin=3 .\"music 1: 4e; 4d; 2c; .\"bar .Ee The "1:" at the beginning of the line tells Mup that we are describing the notes on staff number 1. In this very simple example, we only have one staff, but later we'll do songs with more than one. Each staff of each measure is normally put on a separate line. .P The first three notes of "Three Blind Mice" are E, D, and C. For Mup input, these pitches are given in lowercase to avoid having to use the shift key. No octave information was specified in this simple example, so Mup .Ix gA would use its default, which in this case would be the octave beginning with middle C. .P The first two notes are quarter notes, and the last note is a half note. Time values of notes are given as shown in the example. A quarter note is marked by a 4, a half note by 2, a sixteenth note by a 16, etc. .P A semicolon is used to separate chords. In this simple example, each chord .Ix hH has only a single note in it, but it is possible to have lots of notes in one .Hr chordinp.html chord. .P At the end of each measure, we have to tell Mup what kind of .Hr bars.html bar line .Ix gG to draw. The standard bar line is just called "bar." So a complete description of the first measure would be: .Ex 1: 4e; 4d; 2c; bar .Ee .P To save typing, Mup allows a lot of shortcuts. One such shortcut is that it assumes that unless you tell it otherwise, each note in the measure is like the note before. You can leave out the second 4, because if you don't specify a time value, Mup will assume the note is the same length .Ix gT as the previous note. .P The same sort of idea works with pitches. The third measure of "Three Blind Mice" could be stated like this: .Ex 1 .\"score leftmargin=2;rightmargin=2 .\"music 1: 4g;8f;;2e; bar .Ee The third note has no information given at all in this example\(emthere is only a semicolon. In this case, Mup will get both pitch and time value from the previous note, so the actual third note in this measure would be an eighth note with pitch F. .P You may have noticed that this example doesn't have spaces between chords. .Ix gZ There are only a few places where the Mup language requires you to put spaces. However, you can always put some in other places to make things easier to read. .H 2 "Parameters" .P .Ix aD Printed music contains a lot more than just notes and bar lines. Among other things, each staff normally begins with a clef, key signature, and time .Ix cG .Ix fI .Ix gU signature. Mup provides default values for these, which you can then override if you want something different. In the examples so far, we didn't override anything, so Mup would assume its default values, which are treble clef, a key signature with no sharps or flats, and a time signature .Ix fC of 4/4. .P There is a long .Hr param.html list of "parameters" that can be set. Things like clef and key signature are among them. Parameters can be changed with a line of the form: .Ex \fIparameter_name\fP=\fIvalue\fP .Ee For example, suppose we have a song written in 6/8 time in the key of D major. We can convey this information to Mup like this: .Ex 1 score .\"rightmargin=2; leftmargin=2 time=6/8 key=2# music 1: 4d;8e;4f;8d; bar .Ee .P Note that in this example, the key was specified as two sharps. You can also specify the key by name: .Ex key = d major .Ee .P These parameters give a very different sort of information than the notes of a measure, so they go in a separate section of the input file. Each section of the file describes information for a specific .Hr contexts.html \&"context." .Ix fQ Information about musical notes is given in "music" context, .Ix hM while things that apply in general to the whole score are given in "score" context. .Ix hJ Once you start a measure in music context, you have to complete that measure before switching to another context, but otherwise you can pretty much change from one context to another as necessary. Each new context section is headed by its name (e.g., \&"music" or "score"). At the beginning of input, music context is assumed. .P Here is a more complicated example: .Ex 1 score staffs=2 key=3& time=2/4 .\" rightmargin=2.5 .\" leftmargin=2.5 music 1: ceg;; 2: 2c; bar .Ee This example starts by setting some parameters. First it states that this piece of music should be printed with two staffs, instead of the default of only one. Then it gives a key signature. Since there is no "flat" symbol on a standard computer keyboard, Mup uses the "&" symbol for flat. .Ix fC The time signature is then set to 2/4. .P Next we find the keyword "music," which indicates the end of parameters and the beginning of the music. Data is given for both staff 1 and staff 2. Staff 1 has two chords in the measure. The first is a C minor triad (it's minor since the key is three flats). No time value is specified for this chord. Since it is the very first chord of the piece, Mup cannot use the previous chord's time value, because there is no previous chord. In this case, Mup falls back to using the denominator (bottom number) .Ix gN of the time signature, so the chord is a quarter note. Incidentally, if Mup has to back up to previous notes to deduce pitch and/or time values, it only goes back as far as the beginning of the current measure. That means the default time value for the first chord of every measure in this piece would be quarter note. The second chord on staff 1 is the same as the first, since only a semicolon is specified. .P Staff 2 has only a single chord, consisting of a half note with pitch C. Mup checks to make sure the time values on each staff add up to the time signature\(emno more or less. It is an error to specify too much time. For too little time, Mup will print a warning message (unless warnings are turned off via the .Hr param.html#warn warn parameter). .Ix hF If you have something like a "pickup" measure, which doesn't add up to the .Ix aV time signature, you can specify "space" rather than a chord, .Ix gZ to account for the rest of the time. .P Some parameters can be set on a per-staff basis as well as for the entire score. Mup also allows for .Hr param.html#vscheme up to three independent voices on each staff, .Ix bF .Ix hJ and each voice can have parameters set that apply to only that voice. To get the value of a parameter, Mup always starts at the most specific place it could be defined and works toward the most general. In other words, it will first see if the parameter is set for the current voice. If not, it will see if it is set for the current staff. If not, it will use the value set for the entire score. Staff parameters are set in "staff" context, and voice parameters are set in "voice" context. As an example: .Ex 1 score staffs=3 key=1& .\" rightmargin=2 .\" leftmargin=2 staff 2 key=2& clef=bass music 1: 2f;a; 2: 2c;f; 3: 1f; bar .Ee Staff 2 will have two flats, whereas the other staffs will have one flat. Staff 2 will use the bass clef, whereas the other staffs will use treble clef (since that is the default when none is specified). .ig .Hr param.html The complete list of Mup parameters includes .. .Hi All the available parameters are listed later in this User's Guide, along with .He information about whether they can be set for an individual staff or voice, or just for the score as a whole. .Ix hJ .H 2 "Page headers and footers" .P Mup allows you to specify a .Hr headfoot.html header and/or footer .Ix aS .Ix aT to put on the first page, as well as a header and/or footer to use on subsequent pages. These can include a page number that will be incremented automatically as pages are printed. The headers and footers can be customized as you like, with .Ix bG .Ix bH .Ix dN .Ix fY different fonts and sizes of text and items centered or left or right justified. There is also a shortcut .Hr prnttext.html \&"title" command .Ix gC that can be used to create a canned format title. For example: .Ex title "Three Blind Mice" .Ee will create a centered title. You can also get left and right justified titles. .H 2 "Lyrics" .P You can specify .Hr lyrics.html lyrics .Ix aE .Ix cJ for as many verses as you like. They are specified somewhat like notes. As an example: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music 1: 4e;d;2c; lyrics 1: 4;;2; "Three blind mice,"; bar .Ee This example describes the lyrics to go with staff 1. There are three lyric syllables, having time values of quarter note, quarter note, and half note. .Ix gF The actual syllables are given inside the double quotes. Incidentally, since in this example the time values for the lyrics are the same as those of the notes, the time values don't actually need to be specified; if no lyrics time values are given, Mup assumes they match the note time values. .H 2 Miscellaneous .P Mup provides a way to .Hr textmark.html print arbitrary text (like "allegro") and .Hr mussym.html musical symbols (like a fermata). It can also print .Hr phrase.html phrase marks, .Ix fJ .Hr pedal.html piano pedal marks, .Ix fL etc. The placement of these items is specified in terms of "counts" into the measure. For example: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music .\"1: 4e;d;2c; boldital below 1: 3 "mf"; .\"bar .Ee .Ix dL tells Mup to print "mf" in bold-italics below staff 1, at count 3 of the measure. You can also print .Hr chrdattr.html#withlist marks associated with specific chords. All of these facilities are described in detail in following sections. .H 2 "Displaying, printing, and playing music" .P .Ix hA Once you have an input file, you can run Mup on it to get the printed version of the music. Entering: .Ex mup \fImyfile\fP .Ee from a command line prompt or selecting Run > Display from Mupmate will cause Mup to read \fImyfile\fP, which should contain text in the Mup input language. If there are no errors in \fImyfile\fP, PostScript output .Ix hF .Ix cF will be produced, which can be displayed on the screen or printed via Mupmate or other programs. Mup can also produce .Hr midi.html MIDI output, which can then be played on your speakers. .P .Ix cE If you are using Ghostscript, but without Mupmate, two utility programs are included with Mup for .Hr utilpgms.html displaying and printing music using Ghostscript. These are described in more detail in the next section. .Ht Running Mup .Hd running.html .H 1 "RUNNING MUP" .P There are two basic ways to run Mup: directly from a command line or via the Mupmate program. You can use either approach, or switch between them as you wish. The Mupmate program just provides a more menu-driven environment on top of the Mup program itself. .P You can create a Mup file using any ordinary text editor, and then run the Mup program on the file you created. On Windows, Notepad is a typical editor choice, and on Linux, editors like vim and emacs are commonly used, but pretty much any text editor (not word processor) can be used. Many people, however, prefer to be able to edit, display, and play from a single integrated and more graphical interface, and for them, a helper program called "Mupmate" is provided. The Mupmate program helps lead you through some of the steps, and you can easily access this User's Guide from its Help menu. .H 2 Mupmate .P Mupmate is currently only supported on Microsoft Windows, Apple Mac OS X, and Linux. Since the source code is available, and it is based on the cross-platform FLTK toolkit, it would probably be fairly easy to make it run on any system supported by FLTK. .P Once you have installed Mup and Mupmate on Windows, double clicking a .mup file in Windows Explorer will run Mupmate on that file. Or, you can run Mupmate by going to the Start menu, and choosing Programs, then Arkkra, and then Mupmate. If you would like an icon on the desktop, you can create one by right clicking the Mupmate choice in the Arkkra menu, choosing "copy", right clicking somewhere on the desktop, and choosing "paste". .P On Linux, you can just type the mupmate command in a terminal window, optionally followed by the name of a Mup input file. Or you can add mupmate to your favorite window manager's menus. .P On Mac OS X, you can double click on the MupMate.app in Finder. You should also be able to double click any file with a .mup suffix, which should then run Mupmate on that file. For setting paths in the Preferences, several "magic" variables are set automatically, if you have not already set them to something else. $APPL is set to the top of the application directory hierarchy. $RSRC is effectively set to $APPL/MupMate.app/Contents/Resources. $HOME is set to your home directory. $SUPP is set to your applications support folder (which is typically $HOME/Library/Application Support). $DOCS is set to your document folder (which is typically $HOME/Documents). .P Mupmate provides five top level menus: File, Edit, Run, Config, and Help. The File menu provides commands for opening new files and saving the file you are working on, as well as exiting the program. The Edit menu provides the kinds of things you would expect in a editor: commands to find a pattern, or find and replace; to select text; to copy, cut, and paste; to go to a specific line; and to undo the previous operation, if you make a mistake or change your mind. The Run menu lets you set runtime options, and then run the Mup program on your input in various ways. You can either just generate a PostScript, PDF, or MIDI file, or display the PostScript or play the MIDI. The Config menu lets you specify what application program you want to use to view PostScript files and which you want to use to play MIDI files, and well as specify locations for other Mup files. Mupmate will try to find reasonable default values, but you may want to check that they are what you want, and tweak them if they aren't. For paths, you can include environment variables to be expanded, by giving their name preceded by a dollar sign. A tilde by itself will be expanded to your home directory, whereas a tilde followed by the name of a user will be expanded to that user's home directory. The Help menu lets you browse this User's Guide, view some startup hints, view the Mup license, or see the current version number of Mup and Mupmate. .P Mupmate does not directly provide a print facility. Almost any PostScript viewer already provides this ability, so you can simply select "Display" from the Run menu and use the viewer's print capabilities. Alternately you can use "Write PostScript File" from the Run menu to create a PostScript file that you can print as you would any other PostScript file. .Ht Mup Options .Hd cmdargs.html .H 2 "Mup Options" .P Mup accepts a number .Ix hA of options. When invoking Mup from a command line, the options are specified by a dash followed by a letter. On Windows/MS-DOS .Ix aI systems, you can substitute a slash instead of the dash. If you are using Mupmate, you will use the "Set Options" form off of the "Run" menu to set the options. You just fill values into the form, and Mupmate will take care of the details of running Mup with your values, so you won't use the dash and letter shown below at all. Some of the options listed below are not available from Mupmate, either because they are meant for debugging, and thus not generally of interest to most users, or because Mupmate handles the appropriate details automatically. .Ix cA The options to the mup command (in alphabetical order) are: .Hi .de Co .in -0.4i .ne 1i .sp .ft CW Command line:\ .ft P .. .de Mo .br .ft CW Mupmate:\ \ \ \ \ \ .ft P .. .de Op .sp 0.3 .in +0.4i .. .He .in +0.4i .Co .Hi \fB-c\fP \fIN\fP .He .ig .Hm coption <B>-c</B> <I>N</I> .. .Mo Run > Set Options > Enable Auto Multirest and Min Measures to Combine .Op Combine consecutive measures of all rests or spaces into .Ix gZ .Ix hC .Ix hG .Hr multirst.html multirests .Ix aW (multiple measures of rest printed as a single measure, usually with the number of .Hr param.html#prmultn measures of rest printed above the staff). Any time there are \fIN\fP or more measures in a row that consist entirely of rests or spaces, they will be replaced by a multirest. The combining of measures stops when there is a visible staff that contains notes .Ix gL .Ix hL or lyrics, or that contain .Hr textmark.html text or .Hr mussym.html musical symbols after the first beat of the measure, or when there are .Hr param.html parameter changes on a visible staff or in score context that .Ix fQ .Ix gL .Ix hJ .Hr param.html#visible change .Hr param.html#clef clef, .Ix fI .Hr param.html#key key, .Ix cG or .Hr param.html#time time signature, .Ix gU or when there is a .Hr bars.html bar line .Ix gG other than an ordinary bar. This option is most likely to be useful when printing a subset of staffs, where the particular staff(s) you are printing have long periods of rests. See information about .Hr cmdargs.html#soption the -s option and the .Hr param.html#visible \&"visible" parameter below. .Ix gL This option overrides the .Hr param.html#restcomb restcombine parameter. .Co .Hi \fB-C\fP .He .ig .Hm C_option <B>-C</B> .. .Mo Option not available (only used for debugging). .Op This option is only used in connection with .Hr cmdargs.html#Eoption the -E option. It specifies that comments .Ix aF are to be passed through rather than deleted. .Co .Hi \fB-d\fP \fIN\fP .He .ig .Hm dbgoption <B>-d</B> <I>N</I> .. .Mo Option not available (only used for debugging). .Op Print debugging information. \fIN\fP is a bitmap, so you can turn on multiple .Ix aP debugging levels by adding up the flag values. For example, if you want to turn on both level 2 and level 4 tracing, \fIN\fP would be 6 (because 2+4=6). .Hi .VL 5 .LI 1 input syntax/grammar analysis tracing .LI 2 high level parse phase tracing .LI 4 low level parse phase tracing .LI 8 reserved .LI 16 high level placement phase tracing .LI 32 low level placement phase tracing .LI 64 reserved .LI 128 contents of the main internal list .LI 256 high level print or MIDI phase tracing .LI 512 low level print or MIDI phase tracing .LE .He .ig <DL> <DT>1 <DD> input syntax/grammar analysis tracing <DT>2 <DD> high level parse phase tracing <DT>4 <DD> low level parse phase tracing <DT>8 <DD> reserved <DT>16 <DD> high level placement phase tracing <DT>32 <DD> low level placement phase tracing <DT>64 <DD> reserved <DT>128 <DD> contents of the main internal list <DT>256 <DD> high level print or MIDI phase tracing <DT>512 <DD> low level print or MIDI phase tracing </DL> .. .sp \fIN\fP can be specified in decimal, octal (by using a leading zero), or hex (by using a leading 0x). This information is intended for debugging of Mup itself and thus is not likely to be of use to the average user, and is not available from Mupmate. .Co .Hi \fB-D\fP \fIMACRO[=macro-def]\fP .He .ig .Hm doption <B>-D</B> <I>MACRO[=macro-def]</I> .. .Mo Run > Set Options > Macro Definitions .Op Define the .Hr macros.html macro .Ix aM \fIMACRO\fP. The macro name must consist of uppercase letters, digits, and underscores, beginning .Ix fW with an uppercase letter. The \fImacro_def\fP is optional, and gives the text of the macro. On UNIX, Linux, or similar .Ix aJ .Hi .FS * UNIX is a registered trademark of X/Open Company Limited. .FE .He systems, if it contains any white space or other special characters, it must be quoted. On other systems, white space may not be allowed. The -D option can be specified multiple times, if you wish to define more than one macro. .Co \fB-e\fP \fIerrfile\fP .Mo Option not needed. Mupmate automatically saves and displays error output. .Op Place the error message output into \fIerrfile\fP instead of writing it to the standard error output stream. .Co .Hi \fB-E\fP .He .ig .Hm Eoption <B>-E</B> .. .Mo Option not needed (only used for debugging). .Op Rather than produce PostScript or MIDI output, just expand .Ix aM macros .Ix aO and includes, and write the result to the standard output stream. Comments in the input are deleted, unless the -C option is also specified. .Co \fB-f\fP \fIoutfile\fP .Mo Option not needed. Mupmate automatically creates appropriate output file. .Op Place the PostScript output into \fIoutfile\fP instead of writing to the standard output. .Co .Hi \fB-F\fP .He .ig .Hm Foption <B>-F</B> .. .Mo Run > Write PostScript File .Op This is like the \fB-f\fP option, except the name of the output file is derived from the name of the Mup input file. If the name of the Mup input file ends with a ".mup" suffix, the generated PostScript output file will end with a ".ps" suffix instead. If the name of the Mup input file ends with a ".MUP" suffix, the PostScript file will end with a ".PS" suffix. Otherwise, a ".ps" suffix will be appended to the end of the Mup input file name. If multiple input files are listed, the last is used. If none are specified (input is read from standard input), the name "stdin.ps" will be used for the output file. .Co .Hi \fB-l\fP .He .ig .Hm loption <B>-l</B> .. .Mo Help -> License .Op Show the Mup license and exit. .Co .Hi \fB-m\fP \fImidifile\fP .He .ig .Hm moption <B>-m</B> <I>midifile</I> .. .Mo Option not needed. Mupmate automatically creates appropriate output file. .Op Instead of generating PostScript output, generate standard .Hr midi.html MIDI (Musical Instrument Digital Interface) output, .Ix aA and put it in \fImidifile\fP. This option also causes the .Hr macros.html macro "MIDI" to become defined. .Co \fB-M\fP .Mo Run > Write MIDI File .Op This is like the \fB-m\fP option, except the name of the MIDI file is derived from the name of the Mup input file. If the name of the Mup input file ends with a ".mup" suffix, the generated MIDI file will end with a ".mid" suffix instead. If the name of the Mup input file ends with a ".MUP" suffix, the MIDI file will end with a ".MID" suffix. Otherwise, a ".mid" suffix will be appended to the end of the Mup input file name. If multiple input files are listed, the last is used. If none are specified (input is read from standard input), the name "stdin.mid" will be used for the MIDI file. .Co .Hi \fB-o\fP \fIpagelist\fP .He .ig .Hm ooption <B>-o</B> <I>pagelist</I> .. .Mo Run > Set Options > Pages to Display .Op Print only the pages given in \fIpagelist\fP. The \fIpagelist\fP can begin or end with optional qualifiers. .Ix dC A qualifier of "odd" will restrict printing to only odd numbered pages, while a qualifier of "even" will restrict to even numbered pages. A qualifier of "reversed" will cause pages to be printed in reverse order, which may be useful for printers that stack output in backwards order. A comma-separated list of pages and/or page number ranges can also be specified, where a range is two numbers separated by a dash. For example, -o1,7-9,12-14 would print pages 1, 7, 8, 9, 12, 13, and 14. Adding a qualifier, -oodd,1,7-9,12-14 would print pages 1, 7, 9, and 13, while -o1,7-9,12-14,even,reversed would print pages 14, 12, and 8 in those orders. -oreversed would print all pages backwards, while -oreversed,odd would print all odd pages backwards. There is also a special page number of "blank" which will result in a completely blank page being output. This is most likely to be useful when the .Hr param.html#panels panelsperpage parameter. is set to 2. For example, to print a one-page song on the right-hand panel rather than the left, you could use -oblank,1 .Co .Hi \fB-p\fP \fIN\fP .He .ig .Hm poption <B>-p</B> <I>N</I><B>,</B><I>pageside</I> .. .Mo Run > Set Options > First Page's Page Number .Op Start numbering pages at \fIN\fP instead of at 1. This can be set inside the Mup input file with .Hr param.html#firstpg the "firstpage" parameter, but the command line option will override the parameter. The page number can optionally be followed by a comma and either leftpage or rightpage, to specify whether any header, footer, top, or bottom on the first page should use the left or right page versions, if they are different. This would, of course, also control whether the left or right versions of header2, footer2, top2, and bottom2 are used on subsequent pages. .Ix aU If \fB-o\fP and \fB-p\fP are used together, the page numbers given in the \fB-o\fP\fIpagelist\fP must be the printed page numbers. For example, if you use -p10 and want to print just the second page, you would need to specify -o11. .Co .Hi \fB-q\fP .He .ig .Hm qoption <B>-q</B> .. .Mo Option not needed. .Op Quiet mode. Omits printing of version and copyright notice at startup. .Co .Hi \fB-s\fP \fIstafflist\fP .He .ig .Hm soption <B>-s</B> <I>stafflist</I> .. .Mo Run > Set Options > Staffs to Display/Play .Op Only print the staffs that are included in \fIstafflist\fP. The \fIstafflist\fP can be a comma-separated list of staff numbers or ranges, such as "1,5" or "1-3,7-8" but no spaces are allowed in the list. If the -m or -M option is also used, to produce .Hr midi.html MIDI output, this option controls which staffs are played rather than which are printed. If you want only a single voice to be printed or played, you can follow a staff number or range with \fBv1\fP or \fBv2\fP or \fBv3\fP to restrict to voice 1, 2 or 3 respectively, such as "1v2" or "1-4v1,5-6v2". Otherwise all voices on the staff are printed or played. You can't specify a list or range for voices; if you only want to make two out of three voices visible, you have to specify them separately, like "1v2,1v3". .Hr param.html#visible See also the "visible" parameter. .Co \fB-v\fP .Mo Help > About Mupmate .Op Print the Mup version number. When invoked from command line, Mup will then exit. This document is for version 6.9. .Co .Hi \fB-x\fP\fIM\fP\fB,\fP\fIN\fP .He .ig .Hm xoption <B>-x</B><I>M</I><B>,</B><I>N</I> .. .Mo Run > Set Options > Extract Measures .Op Extract measures \fIM\fP through \fIN\fP of the song. This allows you to print or play a part of a song. The comma and second value are optional; if not specified, the default is to go to the end of the piece. Positive values specify the number of measures from the beginning of the piece, while negative values are relative to the end, with -1 referring to the last measure of the song. So -x1,-1 means the entire song, if the song doesn't have a pickup measure. .Ix aV If the song has a pickup measure, that is specified by 0. So for a song with a pickup, -x0,-1 would mean the entire song, and -x0,0 would mean just the pickup measure. As other examples, -x-1,-1 means just the final measure of the song, -x2 means starting after the first full measure, -x3,4 means only measures 3 and 4, and -x6,6 means just measure 6. The starting measure is not allowed to be inside an ending. A common use for this option might be to .Hr midi.html generate a MIDI file for just a few measures. For example, if you were trying to tweak tempo values for a ritard in the last 2 measures of a song, you could use -x-2 to listen to just those measures. .in -0.4i .ig <HR> .. .P When invoked from command line, the options, if any, can be followed by one or more \fIfiles\fP in the format described in this User's Guide. If no \fIfiles\fP are specified, standard input is read. If several \fIfiles\fP are listed, they are effectively concatenated together and treated as one big file. Since there are some things (such as .Hr headfoot.html header and footer) .Ix aS .Ix aT that are only allowed to occur once, if you have several independent pieces, Mup should be called on each individually rather than trying to print them all with one command. If a specified file does not exist, and its name does not already end with .mup or .MUP, then Mup will append .mup to the specified name and attempt to open that. .P If you just want to create a PostScript output file, for printing on a PostScript printer, or viewing with a tool such as GSview, you can use the -f option, as in: .Ex mup -f outfile.ps infile.mup .Ee Or on Unix, Linux or MS-DOS command window, you could redirect the output into a file using the > character, as in: .Ex mup infile.mup > outfile.ps .Ee .P For more debugging, in addition to the .Hr cmdargs.html#dbgoption -d option, if the environment variable MUP_BB is set to "bcfgnsu" or any subset of those letters, the generated output will include "bounding boxes" for the things Mup internally calls bars (b), chords (c), feeds (f), grpsyls (g), header/footer and top/bottom (h), notes (n), staffs (s), and stuff (u). While this is intended for use in debugging Mup itself, it may also help you understand why Mup places things the way it does, since in general, Mup only allows bounding boxes to overlap according to specific rules. If viewed with a color PostScript viewer (not .Hr utilpgms.html Mupdisp, which is covered below), these boxes will be in color. .ig <BR> <HR> * UNIX is a registered trademark of X/Open Company Limited .br MS-DOS and Windows are registered trademarks of Microsoft Corporation .br PostScript is a trademark of Adobe Systems Incorporated .. .Ht Mup Utilities for displaying and printing output .Hd utilpgms.html .H 2 "Mupdisp and Mupprnt utility programs" .P .Ix cE If you are using Ghostscript, but prefer to not use Mupmate, there are two utility programs included with Mup for displaying and printing music. .Ix hA .Ex mupdisp \fIMup_options myfile\fP .Ee .Ix aG will display music to your screen, while .Ex mupprnt \fIMup_options myfile\fP .Ee will print the output to your printer. .Ix aH See the installation instructions for more details on configuring the Mupprnt program for your printer. .P The \fIMup_options\fP can be any of the options listed in the section on .Hr cmdargs.html \&"Command line arguments" .Ix bN except -C, -E, -f, -F, -l -m, -M, or -v, which don't send PostScript output to the standard output. .Ix cF .P The Mupdisp program allows you to view pages in any order, with either a version small enough to fit on your screen or a near-actual-size version .Ix gY that you can scroll if it doesn't fit on your screen. .Ix bZ Mupdisp will run under MS-DOS/Windows or will run under .Ix aI UNIX with TERM of AT386, linux, or xterm (under X windows). .Ix aJ .P Mupdisp begins in partial page mode, which displays output at approximately actual size (depending on the size of your monitor). In this mode, it is possible that not all of the page fits on the screen, so the scrolling commands can be used to move up and down to view different parts of the page. In full page mode, a small version of the entire page is displayed. This is useful for seeing overall page layout, but is generally too small to see much detail. This mode is now somewhat of a relic of the days when screens were typically much smaller than they are today, and is thus becoming less useful. .P Once the music has been drawn on the screen, you can enter various commands to view different pages or parts of the current page. The commands are: .Hi .VL 15 .LI "\fInum\fP<Enter>" Go to page number \fInum\fP. .LI "+ or <space> or <control-E> or <control-F>" move forward on the page by about 1/8 of an inch (partial page mode only) .LI "- or <backspace> or <control-Y> or <control-B>" move backward on the page by about 1/8 of an inch (partial page mode only) .LI "b or <control-U> or <control-P> or <upward-arrow-key>" move backward on the page by about an inch (partial page mode only) .LI "f or <Enter> or <control-D> or <control-N> or <downward-arrow-key>" move forward on the page by about an inch (partial page mode only) .LI "h or ?" display help screen .LI "m" toggle between partial page and full page modes. .LI "n or <PageDown>" go to next page .LI "p or <PageUp>" go to previous page .LI "q or ZZ" quit .LI "r" Repaint the page (useful for exiting help page) .LE .He .ig <DL> <DT>\fInum\fP <Enter> <DD> Go to page number \fInum\fP. <DT>+ or <space> or <control-E> or <control-F> <DD> move forward on the page by about 1/8 of an inch (partial page mode only) <DT>- or <backspace> or <control-Y> or <control-B> <DD> move backward on the page by about 1/8 of an inch (partial page mode only) <DT>b or <control-U> or <control-P> <DD> move backward on the page by about an inch (partial page mode only) <DT>f or <Enter> or <control-D> or <control-N> <DD> move forward on the page by about an inch (partial page mode only) <DT>h or ? <DD> display help screen <DT>m <DD> toggle between partial page and full page modes. <DT>n <DD> go to next page <DT>p <DD> go to previous page <DT>q or ZZ <DD> quit <DT>r <DD> Repaint the page (useful for exiting help page) </DL> .. .P When in X windows, the mouse can be used for scrolling. The left button scrolls .Ix cX downward like the f command, while the right button scrolls backwards like the b command. .ig <HR> UNIX is a registered trademark of X/Open Company Limited .br MS-DOS and Windows are registered trademarks of Microsoft Corporation .br Apple and Mac OS X are registered trademarks of Apple, Inc. .. .Ht Mup General Syntax .Hd gensyn.html .H 1 "MUP FILE STRUCTURE" .P Mup files do not have to follow any naming convention, although on systems that use file name suffixes to associate a file with an application, it is traditional to use .mup for the suffix. It can also be useful to put a special "magic string" on the first line of Mup files. This magic string is completely optional, but having it there makes it easy for both people and programs to identify the file as Mup input. The standard recommended value for this string is: .Ex //!Mup-Arkkra .Ee with exactly that spacing and capitalization. If the file uses features of newer versions of Mup, and thus would not work with older versions, you can add a dash and the minimim version number the file requires, as in: .Ex //!Mup-Arkkra-6.9 .Ee .H 2 "Mup General Syntax" .P Any number of spaces and tabs can be put in .Ix gZ almost anywhere except in the middle of a word. Each statement goes on a separate line. If for some reason you wish to split a statement onto several lines, each but the last must end with a "\e" (backslash) character, to .Ix bC tell Mup to treat the next line as a continuation of the current line. Blank lines can be put between statements to make things easier to read. .P Comments begin with two slashes and continue to end of line. All comments .Ix aF will be totally ignored by Mup, and are for your own use to remind yourself of something. For example: .Ex // Note: in some early manuscripts, this chord had an accent .Ee .P Staffs are numbered from top to bottom, starting at staff 1. .Ix gM .Ix gN .Ix hK .P Several different units are used for distances. One is inches or centimeters. (There is a .Hr param.html#units units parameter that is used to select which you want to use.) Another .Ix fO is "stepsizes." One stepsize is half the distance between two staff lines. In the horizontal dimension, "counts" are sometimes used. A "count" refers to the musical duration of a note with a duration of the denominator .Ix fP .Ix gN (bottom number) of the time signature. The actual distance on the page will vary depending on how Mup determines notes should be placed. When you use a .Hr param.html#time time signature with two or more fractions added together, as in 3/4 + 3/8, the "count" is the largest denominator, which would be 8 in the example just given. .P Uppercase and lowercase letters are not interchangeable. Thus, for example, \&"SCORE" is not the same as "score." .P Most lines of input end with a semicolon. There are some kinds of input that .Ix hH do not require an ending semicolon, but Mup will allow semicolons on most of those too, so that if you can't remember if a given command requires a semicolon or not, you can just use one anyway. For the examples in this User's Guide, semicolons are not used when .Hi they are not necessary.* .FS * .Ix aD .Ix aW .Ix cC .Ix cD .Ix cV .Ix cW .Ix fD .Ix fE .Ix fY .Ix gC .Ix gG .Ix hA For setting, unsetting, saving, or restoring of parameters, either a semicolon or a newline is required. For bar, multirest, print, left, right, center, title, line, curve, newscore, newpage, postscript, and paragraph a newline is required, but it may optionally be preceded by a semicolon. For commands for changing context, semicolon and newline are both optional, but a newline is traditionally used to improve readability. .FE .He .ig they are not necessary. For .Hr param.html setting, unsetting, saving, or restoring of parameters, either a semicolon or a newline is required. For .Hr bars.html bar, .Hr multirst.html multirest, .Hr prnttext.html print, left, right, center, title, .Hr linecurv.html line, curve, .Hr newscore.html newscore, newpage, .Hr prnttext.html#postscript postscript, and .Hr prnttext.html#paragrph paragraph, a newline is required, but it may optionally be preceded by a semicolon. For commands for changing .Hr contexts.html context, semicolon and newline are both optional, but a newline is traditionally used to improve readability. .. .P In .Hr music.html music context, newlines are required to separate commands: music data, bar lines, rolls, commands to print strings, dynamic marks, lyrics, etc. all must each end with a newline. In .Hr textmark.html#grids grids context and .Hr shaped.html#hdshape headshape context, each pair of strings must end with a newline. In other contexts, there are a few cases where newlines between commands are optional, although you may wish to use them anyway to improve readability. .P Mup supports .Hr macros.html macros and conditionals (like 'if' and 'ifdef') that can be placed anywhere in input, except in the middle of words, numbers, or strings; they needn't be on separate lines. .P In a number of statements, Mup expects a text string. All strings must be .Ix hB enclosed in double quotes. For example: .Ex \&"This is a string." \&"Allegro" .Ee .P A string can contain any combination of letters, numbers, spaces, and punctuation. It can also contain various things that will cause printing of special music characters, change font and size, and so forth. Those things are covered in .Hr textstr.html the chapter on text strings. .Ht Mup Contexts .Hd contexts.html .H 2 "Contexts" .Ix fQ .P There is always a current Mup "context" that is in effect. When Mup begins reading input, it is operating in "music" context, which is where music, lyrics, barlines, and other related things .Ix aE are described. You can change to another context by entering its name. A context remains in effect until another context is named. The contexts are: .Hi .VL 18 .LI \fBheader\fP to define what goes at the top of the first page, typically the title, composer, etc. .Ix aS .Ix gC .LI \fBfooter\fP to define what goes at the bottom of the first page, .Ix gN typically a copyright notice, performance notes, etc. .Ix bO .LI \fBheader2\fP to define what is to be printed on the top of pages after the first page. .LI \fBfooter2\fP to define what is to be printed on the bottom of pages after the first page. .LI \fBtop\fP to define what is to be printed on the top of page. .Ix gM This gets printed below the header (or header2), if any. If the output is not already at the beginning of a new page, a new page is started. Unlike header, which can only be used once, and is used only on the very first page, top can be used multiple times. In a song with multiple movements, you might use top to put a title at the beginning of each movement. .LI \fBbottom\fP to define what is to be printed on the bottom of page. .Ix gN This gets printed above the footer (or footer2), if any. If the output is not already at the beginning of a new page, a new page is started. Unlike footer, which can only be used once, and is used only on the very first page, bottom can be used multiple times. .LI \fBtop2\fP to define what is to be printed on the top of pages, after the page that uses "top." If the output is not already at the beginning of a new page, a new page is started. .LI \fBbottom2\fP to define what is to be printed on the bottom of pages after the page that uses "bottom." If the output is not already at the beginning of a new page, a new page is started. .LI \fBblock\fP to define a .Hr prnttext.html#block block .Ix jC that contains text rather than music. .LI \fBscore\fP to define parameters that apply to the entire score. .Ix aD .Ix hJ .LI "\fBstaff\fP \fIS\fP" to define parameters to be used for staff \fIS\fP, where \fIS\fP is a number from 1 to 40. You can also specify a comma-separated list of staffs or staff ranges: .br .in +0.5i staff 3,7 // staffs 3 and 7 .br staff 1-2, 5-8, 10 // staffs 1, 2, 5, 6, 7, 8, and 10 .in -0.5i .Ix hK .LI "\fBvoice\fP \fIS V\fP" to define parameters for a particular voice \fIV\fP on staff \fIS\fP. .Ix bF The voice \fIV\fP can be either 1, 2, or 3. \fIS\fP is a staff number from 1 to 40. Multiple staffs and/or voices can be specified: .br .in +0.5i voice 1-4 1 // voice 1 on staffs 1 through 4 .br voice 1-2 2 & 3 1 // voice 2 on staffs 1 and 2 and voice 1 on staff 3 .in -0.5i .LI "\fBcontrol\fP" to save and restore parameter settings .LI \fBgrids\fP to define .Hr textmark.html#grids grids (typically for guitar) .Ix iW .LI \fBheadshapes\fP to define what notehead shapes to use for notes of various durations. This context is rarely used, and is described in the chapter on .Hr shaped.html shaped notes. .Ix jG .LI "\fBsymbol \(dq\fIname\fB\(dq\fR" to define .Hr udefsym.html user-defined symbols, or override the appearance of .Hr textstr.html#symlist built-in music symbols. .LI "\fBaccidentals \(dq\fIname\fB\(dq\fR" .Ix bL to define symbols and frequency adjustments to use for accidentals. More details are given in the chapter on .Hr tuning.html Custom Accidentals and Alternate Tunings. .LI "\fBkeymap \(dq\fIname\fB\(dq\fR" .Ix jL to define a mapping from what you type in to other symbols. This is typically used to make it easier to enter strings that you want printed in another alphabet, like Cyrillic or Greek. More details are given in the .Hr textstr.html#keymaps keymap section of the chapter on .Hr textstr.html text strings. .LI \fBmusic\fP to define everything else. This includes notes, lyrics, bar lines, .Ix aE .Ix cH .Ix fJ .Ix fR .Ix hL .Ix hM phrase marks, tempo and dynamic marks, etc. .LE .He .ig <DL> <DT> .Hr headfoot.html header <DD> to define what goes at the top of the first page, typically the title, composer, etc. <DT> .Hr headfoot.html footer <DD> to define what goes at the bottom of the first page, typically a copyright notice, performance notes, etc. <DT> .Hr headfoot.html header2 <DD> to define what is to be printed on the top of pages after the first page. <DT> .Hr headfoot.html footer2 <DD> to define what is to be printed on the bottom of pages after the first page. <DT> .Hr headfoot.html top <DD> to define what is to be printed on the top of page. This gets printed below the header (or header2), if any. If the output is not already at the beginning of a new page, a new page is started. Unlike header, which can only be used once, and is used only on the very first page, top can be used multiple times. In a song with multiple movements, you might use top to put a title at the beginning of each movement. <DT> .Hr headfoot.html bottom <DD> to define what is to be printed on the bottom of page. This gets printed above the footer (or footer2), if any. If the output is not already at the beginning of a new page, a new page is started. Unlike footer, which can only be used once, and is used only on the very first page, bottom can be used multiple times. <DT> .Hr headfoot.html top2 <DD> to define what is to be printed on the top of pages after the page that uses "top." If the output is not already at the beginning of a new page, a new page is started. <DT> .Hr headfoot.html bottom2 <DD> to define what is to be printed on the bottom of pages after the page that uses "bottom." If the output is not already at the beginning of a new page, a new page is started. <DT> .Hr prnttext.html#block block <DD> to define a block that contains text rather than music. <DT> score <DD> to define .Hr param.html parameters that apply to the entire score. <DT> staff \fIS\fP <DD> to define .Hr param.html parameters to be used for staff \fIS\fP, where \fIS\fP is a number from 1 to 40. You can also specify a comma-separated list of staffs or staff ranges: <PRE> staff 3,7 // staffs 3 and 7 staff 1-2, 5-8, 10 // staffs 1, 2, 5, 6, 7, 8, and 10 </PRE> <DT> voice \fIS V\fP <DD> to define .Hr param.html parameters for a particular voice \fIV\fP on staff \fIS\fP. The voice \fIV\fP can be either 1, 2, or 3. \fIS\fP is a staff number from 1 to 40. Multiple staffs and/or voices can be specified: <PRE> voice 1-4 1 // voice 1 on staffs 1 through 4 voice 1-2 2 & 3 1 // voice 2 on staffs 1 and 2 and voice 1 on staff 3 </PRE> <DT> .Hr textmark.html#grids grids <DD> to define grids (typically for guitar) <DT> .Hr shaped.html headshapes <DD> to define what notehead shapes to use for notes of various durations. This context is rarely used, and is described in the chapter on .Hr shaped.html shaped notes. <DT> .Hr udefsym.html symbol <DD> to define user-defined symbols, or override the appearance of .Hr textstr.html#symlist built-in music symbols. <DT> accidentals "\fIname\fP" <DD> to define symbols and frequency adjustments to use for accidentals. More details are given in the chapter on .Hr tuning.html Custom Accidentals and Alternate Tunings. <DT> keymap "\fIname\fP" <DD> to define a mapping from what you type in to other symbols. This is typically used to make it easier to enter strings that you want printed in another alphabet, like Cyrillic or Greek. More details are given in the .Hr textstr.html#keymaps keymap section of the chapter on .Hr textstr.html text strings. <DT> .Hr music.html music <DD> to define everything else. This includes .Hr chordinp.html notes, .Hr lyrics.html lyrics, .Hr bars.html bar lines, .Hr phrase.html phrase marks, .Hr textmark.html tempo and dynamic marks, etc. </DL> .. .P Most contexts are optional. An input file just needs to contain either at least one measure of music or at least one .Ix jC .Hr prnttext.html#block block. .P All the contexts for things that go at the tops or bottoms of pages (i.e., header, footer, header2, footer2, top, bottom, top2, bottom2) can have different versions for left and right pages, by following their name with a modifier of "leftpage" or "rightpage." This is described more fully in the section on .Hr headfoot.html Headers and Footers. Each of the three variations of header, footer, header2, or footer2 contexts can be used only once, although they can be placed anywhere in the file. The other contexts may appear any number of times in any order, and the order in which they occur is significant in determining the output produced. .Ht Mup music context .Hd music.html .H 1 "BASIC STANDARD MUSIC NOTATION" .P Music data is given in the .Hr contexts.html \&"music" context. .Ix fQ .Ix hG .Ix hM For each measure, there is usually one line of input for each voice. .Ix bF At the end of the measure, the kind of .Hr bars.html bar line .Ix gG to be used to end the measure is specified. This section describes the input for generating standard music notation. Mup can also generate .Hr tabstaff.html tablature notation, and that is covered in the next section. .ig .br .Hr chordinp.html Chords .br .Hr bars.html Bar lines .br .Hr multirst.html Multirests .br .Hr lyrics.html Lyrics .. .Ht Specifying chords .Hd chordinp.html .H 2 "Specifying chords" .Ix gW .H 3 "Staff and voice" .P The description of the music for one voice begins with the staff and voice .Ix bF .Ix hK number, followed by a colon. For example: .Ex 3 1: .Ee indicates that the remainder of the line contains musical information for voice 1 of staff 3. If the "voice" number is omitted, voice 1 is assumed. Thus .Ex 3: .Ee is equivalent to the previous example. Both the staff and voice can be given as a list. This may be useful if several staffs have the same notes, or multiple voices on a staff have the same notes. For example: .Ex 1-4 2: // voice 2 of staffs 1, 2, 3, and 4 1,2,4: // voice 1 of staffs 1, 2, and 4, 1,3,6-7 1-2: // voices 1 and 2 on staffs 1, 3, 6 and 7 5-8 1,2: // voices 1 and 2 on staffs 5, 6, 7, and 8 .Ee .P If you want notes to go to one voice on some staffs and a different voice on others, this can be specified using an ampersand. For example: .Ex 1 1 & 3 2: .Ee will cause the music to go to voice 1 of staff 1 as well as to voice 2 of staff 3. Various styles can be combined: .Ex // Voices 1 and 2 on staff 2, // as well as voice 2 on staff 4 // and voice 1 on staffs 6, 7, and 9 2 1-2 & 4 2 & 6-7,9 1: .Ee .P It is possible to have up to 40 .Hr param.html#staffs staffs and up to .Hr param.html#vscheme three voices per staff. While there can be voice crossings, in general voice 1 should be the "top" voice, voice 2 the "bottom" voice, and voice 3 the "middle" or "extra" voice. With the first two voices, Mup tries hard to avoid any "collisions" between notes, rests, and other things. Since voice 3 is an extra voice, there are some cases when overlap with the other voices is basically unavoidable, but there are some techniques discussed later that let you .Hr chrdattr.html tweak placement when necessary. .P As an alternative to this voice-at-a-time input style, there is also a chord-at-a-time input style, which will be covered .Hr altinp.html later. .Hh duration .H 3 "Chord duration information" .Ix fP .P The rest of the line contains a list of chords, with a semicolon at the .Ix hH end of each chord. Each chord has a time value. The time values of all .Ix gT the chords in the line must add up to no more than the .Hr param.html#time time signature. .Ix gU Time values are given as follows: .Hi .DS .He .TS center; c c c l. \fBInput\fP \fBMeaning\fP _ 1/8 octuple whole 1/4 quadruple whole 1/2 double whole 1 whole 2 half 4 quarter 8 eighth 16 sixteenth 32 thirty-second 64 sixty-fourth 128 128th 256 256th .TE .Hi .DE .He .P Any of these time values can be followed by one or more dots, to indicate .Ix gX .Ix hL a dotted note. Each dot increases the time value by 50% of the preceding note or dot. .P It is also possible to specify time as two or more times to be added together. For example, 2+8 would indicate the time of a half note plus the time of an eighth note, or in other words, a half note tied to an eighth note. The expression can also include subtractions, like 2.-16. When subtractions are present, it isn't clear what time values you want Mup to use, so it will start with the largest possible time value and add enough additional chords to add up to the total. For example, if you were to use 1-4, indicating a whole note minus a quarter note, Mup will use a dotted half note, even though there are a number of other ways to represent that total time, such as a half note tied to a quarter note. .P If a time value is not specified for the first chord in a measure for a given voice, the default timeunit value .Ix cT is used. You can set the default value using the .Hr param.html#timeunit \&"timeunit" parameter as described in the .Hr param.html \&"Parameters" section. If that parameter is not set, the default is the denominator (bottom number) of the .Ix gN .Hr param.html#time time signature. For chords after the first, if a time value is not specified, the time value for the previous chord is used. .Hh letter .H 3 "Notes, rests, or spaces" .P There are three kinds of "chords." The first type consists of one or more pitches, given by the letters "a" through "g". .Hm pitchpar Parentheses .Ix iA can be placed around the pitch if you want the note to be printed in parentheses. (If the pitch is modified by an .Hr chordinp.html#acc accidental or .Hr chordinp.html#oct octave, which will be discussed later, those must also be included inside the parentheses.) .Ix fM .Ix hC .Hm restspc The second is a rest, which is designated by the letter r. The third type is a "space," designated .Ix gZ by the letter s. Space is basically a placeholder that takes up time, but doesn't print anything. It is useful when a certain voice only has notes during part of the measure. It can also be useful for specifying "pickup" measures to account for the time before .Ix aV the first note in the measure. For example: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music // a pickup measure 1: 2.s;8.c;16d; bar 1: e;g;e;c; endbar .Ee .P If all voices contain spaces, no space is actually taken up on output. Most of the time, this will be what you want. For example, when you are using space for a pickup, the space is just to add up to a measure, and you don't want any actual blank space at the beginning of the piece. Once in a while, however, you may want space to actually be allocated on output, perhaps to be able to allow space for some special notation. In that case, .Ix iX you prefix the "s" with a "u" to indicate an uncollapsible space. For .Hr midi.html MIDI, normal space is squeezed out to take no time, whereas uncollapsible space essentially becomes a rest. .P If a given voice is omitted for a particular measure, Mup normally defaults to a measure of space, but you can make it default to something else (most commonly a measure of rest) by setting the .Hr param.html#emptym emptymeas parameter. .Hh measdur .H 4 "Measure duration" .P .Ix hG There is a special duration of "m," which means an entire measure. It can only be used with a rest, space, or "rpt" (repeat). For example: .Ex 1 1: mr; 1 2: ms; .Ee .P A measure rest looks like a whole rest, but is centered in the measure. .Ix hD It should be used when an entire measure is a rest, regardless of the time signature. .Ix gU However, if you want to force use of a symbol other than the whole rest symbol, you can specify a duration before the mr, and the rest symbol for that duration will be drawn instead. .Ex 4mr; // use a quarter rest symbol 1/4mr; // use a quadruple whole rest symbol 2.. mr; // use a double-dotted half rest .Ee .P Using "m rpt" will cause the .Ix hE measure repeat symbol to be printed, indicating the measure is just like the previous measure. Measures repeats will automatically be numbered, unless the .Hr param.html#nummrpt numbermrpt parameter is set to n. If there is more than one voice, you only need to specify the mrpt on voice 1. If you do specify other voices as well, they must be either a mrpt or ms. .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music 1: c;d;e;f; bar // another measure just like the first 1: m rpt; bar // the space between m and rpt is optional 1: mrpt; bar .Ee .P .Hm multrpt It is also possible to specify "dbl m rpt" for a double measure repeat, or "quad m rpt" for a quad measure repeat. The subsequent measures that are part of a multi-measure repeat must be either all spaces ("ms" or "mus") or not specified at all. There must, of course, be at least two measures of music before a dbl and at least four before a quad, as well as at least one measure after a dbl and at least three measures after a quad. .P The measures associated with a mprt are not allowed to contain changes in time signature, key, clef, transpose, addtranspose, or vscheme, and the number of staffs cannot be reduced to eliminate the staff with the mrpt. For the purposes of counting measures, invisbar counts just like visible ones. Bar types of repeatstart, repeatend, or repeatboth are not allowed. .Hh acc .H 4 "Accidentals" .P Each pitch letter in a chord may be followed by up to 4 accidentals, although typically no more than one is used. (Probably the most common uses of more than one would be either something like n# to remind the user that the note had had a double sharp earlier, or when using .Hr tuning.html non-standard tunings.) .Ix bL .Ix fM The standard accidentals are: .Hi .DS .He .TS center; c c c l. \fBInput\fP \fBMeaning\fP _ \f(CW#\fP sharp .Ix fC \f(CW&\fP flat \f(CWx\fP double sharp \f(CW&&\fP double flat \f(CWn\fP natural .TE .Hi .DE .He .P Note that a double flat or double sharp counts as a single accidental, so this is one place where the use of spaces matters: & & with a space between is two flat accidentals, whereas && with no space between is one double flat accidental. It is possible to define your own custom accidentals, which is covered in the chapter on .Hr tuning.html Custom Accidentals and Alternate Tunings. The accidental(s) can be placed inside .Ix iA parentheses if you want them to be printed within parentheses. All accidentals have to be within a single set of parentheses in that case; you can't put just a subset in parentheses. .Hh oct .H 4 "Octave" .P An octave indicator may be specified after the pitch letter or optional accidentals. .Ix gA The octave can be specified in either of two ways: absolute or relative. A number from 0 to 9 is used to specify an absolute octave. Octaves run from C up to B. Octave 4 is the octave starting on middle C. Octave 3 is the octave below that, etc. .Ix dL A relative octave is specified by one or more plus or minus signs, and indicates that number of octaves above or below the default octave. For example: .Ex c // c in the default octave e++ // e two octaves above default octave f#--- // f# three octaves below default octave b&6 // b flat in octave 6 .Ee .P The default octave can be set using the .Hr param.html#defoct \&"defoct" parameter, .Ix cU which is described in the .Hr param.html \&"Parameters" section. If that parameter is not set, the default octave is the octave containing the note associated with the middle line of the staff, based on the current .Hr param.html#clef clef. .Ix fI In other words, the default octaves are: .Hi .DS .He .TS center; c c l c. \fBClef\fP \fBOctave\fP _ frenchviolin 5 8treble 5 treble 4 soprano 4 mezzosoprano 4 alto 4 8bass 4 treble8 3 tenor 3 baritone 3 bass 3 bass8 2 subbass 2 .TE .Hi .DE .He .Hh shorthnd .H 3 "Shorthand notations" .P If a chord is omitted, then most of the values for the previous chord are reused. This includes duration, pitch/rest/space, and octave, as well as notehead size and shape (which are described in the .Hr noteattr.html next section). For normal, .Ix fM .Ix gZ .Ix hC .Hr param.html#stlines 5-line staffs, the pitches for the first chord of every measure .Ix hG must always be specified, since there is no previous chord. .P Putting all these things together, here are some examples: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 ; staffs = 2 .\"staff 1 vscheme=2o .\"music // Two eighth notes, each b#, followed by an eighth // note d, eighth note e, and half note e, with the // last 3 notes being in the next higher octave. 1 1: 8b#; ; d+; e+; 2; // Whole note C-E-G chord in default octave // for voice 2 of staff 1 1 2: 1ceg; // Four quarter notes on staff 2, voice 1. // The last is in the octave above the default octave. 2: 4g; a; b; c+; .\"bar .Ee .P For .Hr param.html#stlines 1-line staffs, it is never necessary to specify a pitch, since all notes .Ix fM go on the single staff line. You can, however, specify a pitch if you wish. The pitch will be ignored for the purposes of printing, but will be used for .Hr midi.html MIDI output. .Ix aA If you don't specify a pitch, it is arbitrarily set to middle C. .P If you have several notes in a chord, it is generally convenient to input them in order, either top-down, or bottom-up, as you prefer. If you like to always use a particular order, there is an alternate input mode, set via the .Hr param.html#inputdir noteinputdir parameter, that may save some typing. If this is set to "up" or "down" then the octave of each note in a chord after the first is determined relative to the previous note in that chord. If a note letter is an octave or less from the previous, you list it without any octave specified. Mup will then use the next instance of that letter in the appropriate direction. If it is farther than that, you use plus signs (when noteinputdir=up) or minus signs (when noteinputdir=down) to say how many octaves away it should be. Here is an example: .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 noteinputdir=up music 1: ceg;ece;a-a;a-e+; bar 1: acfc;c+c;2cgec; bar .Ee .Ht Note attributes .Hd noteattr.html .H 3 "Note attributes" .Ix hL .P There are several optional attributes that can be specified for each note. Any or all of these may appear on any note in any order after the .Hr chordinp.html#letter letter, .Hr chordinp.html#acc accidental, and .Hr chordinp.html#oct octave specifications. They include: .DL .LI .Hr noteattr.html#small small notehead .LI .Hr noteattr.html#ntie tie .LI .Hr noteattr.html#nslur slurs .LI .Hr noteattr.html#shaped headshape .LI .Hr noteattr.html#ntag location tag .LE .Hh small .H 4 "Small notehead" .P A note specification can be followed by a "?" to indicate the note is to be printed with a small notehead, .Ix gY rather than the normal size. (Note: if you have several notes in a chord and want all of them to be small, .Hr chrdattr.html#cue the "cue" construct, described later, may be preferable.) .P Examples: .Ex 1 .\"score leftmargin = 2 ; rightmargin = 2 .\"music // print the "e" as a small note 1: 1c e? g; bar // make the second note small 1: f; ?; g; ; bar .Ee .Hh ntie .H 4 "Note ties" .P A "~" can be used to indicate the note is to be tied to the note of the same .Ix aK .Ix fM pitch in the following chord. That following chord need not be in the same .Ix hG measure, but it must contain a matching note. (Note: if a chord with several notes is to have all the notes tied to the following chord, .Hr ichdattr.html#tie the "tie" construct described later may be preferable.) The ~ may be preceded by the word "dotted" or "dashed" if you want a dotted or dashed tie; otherwise a normal, solid tie is drawn. The ~ may be followed by the word "up" or "down" to specify the direction for the curve's bulge. If neither is specified, Mup will determine an appropriate direction, so you only need to give a direction if you wish to override Mup's choice. After the aforementioned items (if any), you may put "to voice \fIN\fP" to tie to the matching note in voice \fIN\fP rather than in the current voice. .Ix iJ .P Examples .Ex 1 .\"score leftmargin=2 ; rightmargin = 2; time=3/4 .\"music 1: d~; 8; e~; ; f; bar // tie the g (which also happens // to be a "small" note) 1: 2g+g?~; 4eg?; bar .Ee .Hh nslur .H 4 "Slurs" .P A note can also be followed by a list of notes to be slurred to, enclosed in angle brackets. .Ix cB .Ix dX A slur will be drawn from the note to each of the notes listed in the angle brackets. The notes inside the brackets .Ix fM .Ix gA are specified by a pitch and optional octave. No .Hr chordinp.html#acc accidentals .Ix bL are specified, even if the note to be slurred to has an accidental. Examples: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music // slur from c of first chord to e of second chord 1: c<e>; e; f; g; bar // slur from c+ of first chord to a& of second chord // and from c+ of first chord to d&+ of second chord 1: 2cc+<ad+>; a&d&+; bar .Ee .P If there is only one note in the following chord, it isn't necessary to explicitly state it within the angle brackets; "<>" will suffice. .Ex 1 .\"score leftmargin=2.5 ; rightmargin=2.5 .\"music // slur from c to d, and f to g 1: c<>; d; f<>; g; bar .Ee .P The < may be preceded by the word 'dotted' or 'dashed' if you want a dotted or dashed slur, otherwise a normal, solid slur is drawn. .Ix iJ The > may be followed by the word "up" or "down" to specify the direction for the curve's bulge. If neither is specified, Mup will determine an appropriate direction, so you only need to give a direction if you wish to override Mup's choice. After the aforementioned items (if any), you may put "to voice \fIN\fP" to slur to the matching note in voice \fIN\fP rather than in the current voice. .P There are four special "slurs" which are really slides to/from an indefinite note. They are most commonly used on .Hr tabstaff.html tablature staffs, but are allowed on ordinary staffs too. They are: </n> <\en> <n/> and <n\e> for sliding upward into the note, downward into the note, upward out from the note, and downward out from the note respectively. These have to be in angle brackets by themselves, so if you want to have both one of these slides and another slur on the same note, multiple sets of angle brackets must be used, as in .Ex 1: 2c</n><d>;d; .Ee .Hh shaped .H 4 "Head shape" .P Sometimes you may want to mix head shapes on a single stem. .Ix jG For example, you might want to use a diamond to designate a harmonic, with other notes in the same chord being normal shape. .Hi There will be an entire .He .ig There is an entire .. .Hr shaped.html section on head shapes, so only a simple example is given here. To make a single note have a different head shape, use hs followed by the name of the shape in quotes. .Ex 1: 2e e+ hs "diam";g; .Ee .Hh ntag .H 4 "Note location tag" .P Finally, a .Hr tags.html \&"location tag" .Ix bE can be associated with a note. This would enable you to draw things relative to the note. A note location tag is set by using an "=" followed by a name. The name can be either: .DL .LI a single lowercase letter .LI an underscore followed by one or more letters, numbers, and underscores in any combination. .LE .sp The name is arbitrary, and is used as a tag that can be referred to later. Examples: .Ex // associate tag p with note e& 3: 2c; e& =p g; // associate tag _end with note f 2: 1f =_end; .Ee Location tags can only be used when defining a single voice. .Ht Chord attributes .Hd chrdattr.html .H 3 "Chord attributes" .Ix gW .P There are optional attributes that are associated with an entire chord rather than an individual note. These are put inside square brackets .Ix dW before the list of notes and the time value. There are several classes of information: .DL .LI .Hr chrdattr.html#chstyle chord style (grace, cue, diam, or xnote) .LI .Hr chrdattr.html#shaped head shape .LI .Hr chrdattr.html#withlist symbols to be printed with a chord .LI .Hr chrdattr.html#slashes slashes .LI .Hr chrdattr.html#stemdir stem direction .LI .Hr chrdattr.html#stemlen stem length .LI .Hr chrdattr.html#pad padding .LI .Hr chrdattr.html#ctag chord location tag .LI .Hr chrdattr.html#hoffset horizontal offset .LI .Hr chrdattr.html#dist rest distance .LE .P Each class of information is separated from the other by a semicolon. All classes are optional, and can .Ix hH occur in any order. .Hh chstyle .H 4 "Chord style" .P Several chord styles can be specified. .Hm cue Grace note chords are designated by the word "grace," or cue note chords by "cue." .Ix aL .Ix bB Grace notes can be specified as any undotted time value of eighth note or .Ix gT .Ix gX shorter, but are treated as taking no time. The time value given is merely used .Ix dH to specify how many flags or beams to put on the grace note. You can also specify a quarter note or longer grace note, which will be printed as a small, stemless note, as is used to show .Hr tabstaff.html#prebend a "prebend" in guitar music. (Actually, you can force a stem if you want, by specifying a .Hr chrdattr.html#stemlen len, as is described later.) Cue notes have time like regular notes, but they are printed smaller. .Ix gY If there are several grace notes in a row, they will be beamed automatically. However, you cannot mix quarter (stemless) grace notes with shorter ones. Cue notes follow the same beaming rules as regular notes. .Ix bA .P It is also possible to specify "diam," or "xnote." .Ix bS .Ix bT In the case of "diam," the chords will be drawn with diamond-shaped notes, while with "xnote," the chords will be drawn with X-shaped notes. A diamond shaped notehead will be used for xnotes that are half note or longer. Here are some examples: .Ex [grace] .br [xnote] .br [cue; xnote] .br [diam] .Ee .Hh shaped .H 4 "Head shape" .P If you want to have the noteheads in a chord .Ix jG use a shape other than the normal shapes, you use hs followed by the name of the head shape in quotes. .Hi There will be an entire .He .ig There is an entire .. .Hr shaped.html section on shaped notes, so only the basics are covered here. The xnote and diam .Hr chrdattr.html#chstyle described above are really just shorthands for two common head shapes. The method using hs lets you use many other notehead styles, .Ix cA such as a slash, or triangle. .Ex 1: [hs "righttri"]cf; [hs "slash"]fa; .Ee .P The .Hr shaped.html section on shaped notes lists all the built-in head shape names, and explains how you can define your own. .Hh withlist .H 4 "Symbols to be printed with a chord" .P It is possible to specify one or more musical symbols or text strings to be printed with a chord. .Ix hB This is typically used for things like staccato and accent marks. The word "with" .Ix bK .Ix bU .Ix fZ is followed by one or more things to print. If there are more than one, they are separated by commas. They will be printed outwards from the notes in the order specified. .P The "with" list is not allowed on space groups. On rests, the side on which the items are printed is determined as if the rests had a stem, so if they are not placed on the side you want, in some cases .Hr chrdattr.html#stemdir forcing the "stem" direction will produce what you want. .P .Ix hC The list can include symbols from the following table: .Hi .DS .He .TS center; c c. \fBSymbol\fP \fBMeaning\fP _ \f(CW.\fP staccato \f(CW-\fP legato .Ix bV \f(CW>\fP accent \f(CW^\fP accent .TE .Hi .DE .He .P .Hr textstr.html A quoted string .Ix hB can also be specified (e.g., "ff", "adagio", etc.). This will be printed in the font and size specified by the .Hr param.html#withfam \&"withfontfamily," .Hr param.html#withfont \&"withfont," and .Hr param.html#withsize \&"withsize" parameters. Any of the .Hr textstr.html#symlist special music characters can be printed by using the usual convention, e.g., \e(ferm) for a fermata. (This is described in a .Hr textstr.html later section.) However, it is usually preferable to use the printing of .Hr textmark.html text strings relative to beats. .Ix dJ .Ix hB .Hi This will be described in a later section. .He .P Here are some examples: .Ex [with ., -] [with ^, "\e(ferm)"] [with "sfz"; cue] .Ee .P If the symbols acc_hat, ferm, or wedge are used by themselves in a "with" list item, they are handled specially. If the stem direction is such that .Ix hI .Ix iH the upside-down versions of these characters should be used, the upside-down version will be used. .P At the end of the list, you can specify "above" or "below" to force a side. Otherwise Mup will normally place them on the notehead side, unless there is more than one voice. .Ex [with . below; with sfz above] .Ee .Hh slashes .H 4 "Slashes" .P Diagonal lines to be drawn through the stem of the group .Ix cA can be specified using .Ex slash \fIN\fP .Ee where \fIN\fP is the number of slashes to draw. In the case of .Hr chrdattr.html#chstyle grace notes, .Ix aL \fIN\fP can only be 1, which will produce a grace note with a slash through it. In the case of other notes, \fIN\fP can be 1 or greater, and is used to specify tremolo or repetition of the note group. Examples: .Ex [slash 2] [grace; slash 1] .Ee .Hh stemdir .H 4 "Stem direction" .P .Ix hI .Ix iH The chord stem direction can be specified as "up" or "down". Normally Mup chooses the stem direction, but once in a while you may want to override its choice. There are some restrictions. All chords beamed together and the pair of chords in an .Hr ichdattr.html#alt alternation pair (described later) must have the same stem direction. Examples: .Ex [up] [down] .Ee .P For voice 3, stem direction works a little differently. By default, the stem direction for voice 3 is up, but for voice 3 on any given staff, when you specify a stem direction, that direction will remain in effect until explicitly changed. Thus, for example, if you want all voice 3 stems on a given staff in an entire song to be down, you only need to specify "[down]" on the first chord. Grace notes on voice 3, however, are always stem up unless explicitly forced down. .Hh stemlen .H 4 "Stem length" .P Normally, Mup sets stem lengths as appropriate, but sometimes you might want to make a stem longer or shorter than normal. This is done with .Ix iB the keyword "len" followed by a length in stepsizes. Some examples: .Ex [ len 14 ] [ len 7; up ] .Ee .P You cannot specify stem length on chords inside of beams. The len can be set to 0 to produce a notehead with no stem at all. .P There is a .Hr param.html#stemlen stemlen parameter that can be used to set the default stem length. If you don't want any stems, setting that parameter to 0 is more convenient than setting len to 0 on each chord individually. .P There are certain circumstances in which Mup will normally shorten stems slightly on beamed chords or on chords whose stems protrude from the staff. There is a .Hr param.html#sshorten stemshorten parameter that allows you to control how Mup handles those cases. .Hh pad .H 4 "Padding" .P Sometimes it may be desirable to space notes somewhat differently than .Ix gZ Mup would normally place them. It is possible to specify "padding" before any note group. .Ix bD This is done by specifying the word "pad" followed by a number of stepsizes of white space padding to add before the chord. .Ix fO The number can be fractional, as in 0.5 or 2.25. For example: .Ex [ pad 2.5 ] .Ee .P The padding can also be negative. Padding affects the minimum amount of width allocated to a chord, so you can use positive padding values to force additional room in front of a chord, or negative padding to allow things closer together. .Hh ctag .H 4 "Chord location tag" .P It is possible to set a location tag .Ix bE which is associated with an entire chord rather than an individual note. This .Hr tags.html tag is specified like .Hr noteattr.html#ntag location tags for notes, with an "=" followed by a name, but is inside the square brackets rather than after a note. .Ex 3: 2cf; [=h] egc+; 1: [cue; with >; =_ch] fa; .Ee .Hh hoffset .H 4 "Horizontal offset" .P A horizontal offset can be applied to a chord by specifying "ho" followed by a number of stepsizes. The number can be positive or negative, and can include a fractional part. A positive number will cause the chord to be placed that far right of where the horizontal center of the chord would normally be; a negative number will place it that far to the left. It is also possible to simply specify a "+" or "-" which says to place the chord to the right or left, as close as possible without running into something. .P A horizontal offset is most commonly used on the third voice of a staff, although it can be used on other voices too. By default, Mup places third voice chords as close as it thinks is safe for avoiding most collisions. Sometimes it may actually be okay visually to place the chord a little closer than that, or perhaps there is a better "nook" to tuck it into on the left side. By specifying a horizontal offset, you can place chords anywhere you want. Mup makes no checks to avoid collisions when you specify a horizontal offset, so this attribute needs to be used with some care. .P The ho can be used on grace groups, and has generally similar effects. It only has an effect if there are multiple voices having grace notes at the same point in time, and specifies how to move the grace note relative to where it would be if no ho had been specified. .P Here is an example of the use of horizontal offset and stem direction on voice 3. .Ex 1 score vscheme=3f .\"rightmargin=2 .\"leftmargin=2 music 1 1: c+;b;a;c+; 1 2: e;d;e;f; 1 3: [ho+1] g; [ho-5.2; down]; [ho-] f; [ho+; up] a; bar .Ee .Hh dist .H 4 "Rest distance" .P Usually Mup's placement of rests is satisfactory, but once in a while you might want to force a rest to be placed a little higher or lower than Mup would place it. You can specify a "dist" which is the number of stepsizes from the center of the staff to place the rest symbol, with positive numbers being above the center and negative numbers below. If the staff is .Hr param.html#xpose transposed, the placement of the rest symbol will be adjusted accordingly. .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\"music .\" // The first and last rests are in normal position. // The second is forced higher, the third is forced lower. 1: r; [dist 6]; [dist -4]; r; bar .Ee .P Note that the .Hr param.html#alignrst alignrests parameter can also be used to affect how rests are placed. .Hh rptattr .H 4 "Repeated attributes" .P If two or more chords in a row have the same bracketed attributes, .Ix dW there are two shorthand notations. Specifying an empty set of brackets "[]" means to use the same attributes as were specified on the previous chord. The previous chord must be within the same measure. .Ix hG Some examples: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music 1: [cue] 4c;[]d;[grace; slash 1] 8f;2e; bar 1: d; [with .,-]d; []e; []f; bar .Ee .P The other shorthand is to put 3 dots after a set of bracketed items. This means to repeat the same bracketed items on all chords for the rest of the measure, or until a new set of bracketed items is specified. Items in a "with" list are omitted on rests, since usually they are things that don't make sense for rests. If you wish to cancel this before the end of a measure but without specifying a new set, the special set "[-]" can be used. .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music // put staccato marks on all notes 1: [with .]... c; d; e; g; bar // put several cue size notes in the middle of a measure 1: c; [cue]... 8d; f; e; g; [-] 4c+; bar .Ee .P You can use more than one set of brackets on a single chord. For example "[len 5][down]" and "[len 5;down]" are equivalent. However, [-] can only be used by itself, and if you want to use [] along with another bracketed set of items (to duplicate the items on the previous chord plus add some more), the empty [] needs to be first, before the other set of items. .Ht Mid-measure parameter changes .Hd midmeas.html .H 3 "Mid-measure parameter changes" .P The group attributes can optionally be preceded by mid-measure parameter changes. .Ix jF This is not used very often, but the most common use is to change the .Hr param.html#clef clef .Ix fI in the middle of a measure. There are only a few other parameters that can be changed inside a measure: .Hr param.html#alignrst alignrests, .Hr param.html#defoct defoct, .Ix cU .Hr param.html#release release, .Ix jE and .Hr param.html#vcombine vcombine. The change is enclosed in double angle brackets. After the opening angle bracket is the .Hr contexts.html context to which the changes apply (score, staff, or voice), followed by one or more parameter changes. .Ex 1 .\" score .\" leftmargin=1.5 .\" rightmargin=1.5 .\" music 1: c; e; <<score clef=bass>> 2g; bar .Ee If there is more than one parameter listed, they are separated by semicolons. .Ex << staff clef = tenor ; defoct = 4 >> .Ee .P If you wish to change parameters in more than one context, multiple angle-bracketed items can be given: .Ex 2-3 2: 2c; <<score release=100>><<staff clef=alto>><<voice defoct=3>> c; .Ee .P If you specify "staff" or "voice" context, the specific staff(s) or voice(s) to which the changes apply is based on which staff(s) or voice(s) are being described on the input line. So in the example above, the clef is changed to alto on staffs 2 and 3, and the defoct is changed to 3 for voice 2 on both of those staffs. The release change applies to the entire score. .Ht Cross-staff stems .Hd crossst.html .H 3 "Cross-staff stems" .P Sometimes, on music for instruments that use more than one staff, .Ix jI you may want some of the notes of a chord to be printed on the staff above or below, rather than using a lot of ledger lines. You can specify this by putting the word "with" before the notes that are to go on the other staff, and following those notes with "above" or "below" to specify which is the other staff. For example: .Ex 1 score .\" leftmargin=1.5 .\" rightmargin=1.5 .\" staffpad=-8 staffs=2 staff 2 clef=bass music 1: 1e+g+c++; 2: cc+; ee+; g with g+ above; with c+c++ above; bar 1: cc+; g with g- below; e with e- below; with cc- below; 2: 1c-e-g-; bar .Ee .P The notes for the other staff have to follow the notes on the normal staff in the input. As is shown in the example, it is possible to have \fIall\fR the notes on the "other" staff, if you wish. The octave is specified as if the note were on the normal staff; Mup will automatically adjust appropriately for the other staff's clef. Once in a while, Mup may not be able to figure out how to completely avoid colliding with other notes; in that case you can use the .Hr chrdattr.html#hoffset horizontal offset that was described earlier. .P For .Hr midi.html MIDI purposes, only the normal staff's key signature and accidentals are considered, so if the other staff has a different .Hr param.html#key key signature or accidentals that should really apply to these notes, you will have to supply accidentals explicitly. .Ht Inter-chord attributes .Hd ichdattr.html .H 3 "Inter-chord attributes" .P In addition to the .Hr chrdattr.html chord attributes that can appear in the square brackets before time and pitch information, there are a few attributes that are .Ix fM specified after the time and pitch information. These are attributes that start or end on the chord but also affect other chords. There are several such attributes: .DL .LI .Hr ichdattr.html#tie chord ties .LI .Hr ichdattr.html#slur chord slurs .LI .Hr ichdattr.html#custbeam custom beaming .LI .Hr ichdattr.html#crossbm cross-staff beams .LI .Hr ichdattr.html#alt alternation .LI .Hr ichdattr.html#slope slope .LI .Hr ichdattr.html#phrase phrase .LE .P If several of these are specified on a single chord, they may be in any order, separated by commas. .Hh tie .H 4 "Chord ties" .P If all notes in a chord are to be tied to the following chord, the keyword "tie" .Ix aK can be placed at the end of the chord. As was mentioned earlier, .Hr noteattr.html#ntie individual notes can be tied using a "~" symbol. Thus: .Ex ceg tie; .Ee is equivalent to .Ex c~e~g~; .Ee The word "tie" may be preceded by the word "dotted" or "dashed" to produce dotted or dashed ties. Otherwise, normal, solid ties are drawn. .Ix iJ The word "tie" may be followed by the word "up" or "down" to specify the direction of each curve's bulge. If neither is specified, Mup will determine an appropriate direction, so you only need to give a direction if you wish to override Mup's choice. After the aforementioned items (if any), you may put "to voice \fIN\fP" to tie to the chord in voice \fIN\fP rather than in the current voice. .P You can also produce the effect of tying chords by using additive time values. For example, the following lines produce the same output: .Ex 1: 2ceg tie;8;;4; // explicit tie 1: 2+8ceg;8;4; // tie implied by added time values .Ee .Hh slur .H 4 "Chord slurs" .P The keyword "slur" can be placed at the end of a chord to indicate .Ix cB that each note in the chord is to be slurred to the corresponding note in the following chord. In other words, the top note of the chord is slurred to the top note of the following chord, the second from the top note in the first chord to the second from the top note in the second chord, etc. Thus the following 2 measures give equivalent output: .Ex 1 .\"score leftmargin=3; rightmargin=3 .\" label=" " .\"music 1: 2f<d> a<b> c+<d+>; dbd+; bar 1: 2fac+ slur; dbd+; bar .Ee .P The chord with the "slur" keyword and the chord that follows it must have the same number of notes. The word "slur" may be preceded by the word "dotted" or "dashed" to produce dotted or dashed slurs. Otherwise, normal, solid slurs are drawn. .Ix iJ The word "slur" may be followed by the word "up" or "down" to specify the direction of each curve's bulge. If neither is specified, Mup will determine an appropriate direction, so you only need to give a direction if you wish to override Mup's choice. After the aforementioned items (if any), you may put "to voice \fIN\fP" to slur to the chord in voice \fIN\fP rather than in the current voice. .Hh custbeam .H 4 "Custom beaming" .P .Ix dI Normally, notes of eighth or shorter duration are automatically beamed .Ix fP according to the specification of .Hr param.html#beamstyl the "beamstyle" parameter. .Ix dE Occasionally, you may wish to override the default beaming style for a particular situation. .Ix bA This is done using the "bm" and "ebm" keywords. The "bm" (short for "beam") is placed at the end of the chord that is the first to be beamed. The "ebm" (short for "end beam") is placed at the end of the last chord. Both chords must be in the same measure. If there is any custom beaming .Ix hG specified for a given voice in a given measure, only what you explicitly specify to be beamed will be beamed. An example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music // The d, e, and f will be beamed together, // but other 8th notes will not be. 1: 4c; 8; d bm; e; f ebm; g; a; bar // First two chords beamed together. // Second chord is tied to third chord. 1: 8.fa bm; 16gc+ tie, ebm; 2; 8a; g; bar .Ee .P In the absence of custom beaming, Mup will beam notes together using the .Hr param.html#beamstyl beamstyle parameter, .Ix dE if that parameter is set. The beamstyle parameter is a list of time values that add up to a measure. Each time value tells how many chords to beam together. For example, a 2 means to beam a half note worth of chords together, whereas 1.. would indicate that a double dotted whole note worth of chords should be beamed together. Here are some examples of how the beamstyle parameter works. .Ex 1 .\"score leftmargin=1.5; rightmargin=1.5 .\"scoresep=10,14 .\" label=" " // beam each quarter note worth of notes together, // breaking the beaming at each quarter note boundary score beamstyle = 4,4,4,4 music 1: 8c;d;e;f;g;a;b;c+; bar 1: 8c;d;4e;f;8g;c; bar // beam each half note worth of notes together, // breaking the beaming at each half note boundary score beamstyle = 2,2 music 1: 8c;d;e;f;g;a;b;c+; bar // the middle two eighth notes will not be beamed together, // because they are on opposite sides of the half note boundary 1: 8c;4d;8e;f;4g;8c; bar // beam each whole note worth of notes together score beamstyle = 1 music 1: 8c;d;e;f;g;a;b;c+; bar 1: 8c;4d;8e;f;4g;8c; bar // in 9/8 time, beam each dotted quarter note worth of notes together score time = 9/8 ; beamstyle = 4., 4., 4. music 1: 8c;d;e;d;e;f;e;f;g; bar // the eighth notes will not be beamed together, // because they are on opposite sides of the dotted quarter boundary 1: 4.c;4d;8e;8f;4g; bar // in each measure, beam the first dotted half worth of notes together, // then beam the remaining dotted quarter worth of notes together score beamstyle = 2., 4. music 1: 8c;d;e;d;e;f;e;f;g; bar // in each measure, beam the first dotted quarter worth of notes together // then beam the remaining dotted half worth of notes together score beamstyle = 4., 2.; music 1: 8c;d;e;d;e;f;e;f;g; bar .Ee .P It is possible to apply the automatic beaming to just a portion of a measure, by specifying abm ("automatic beaming") on the first group where it is to be applied, and eabm ("end automatic beaming") on the last such group. .Ex 1 .\"score leftmargin=1; rightmargin=1 score beamstyle=2,2 music 1: 8c;d;e;f;g abm;a;b;c+ eabm; bar 1: 8c abm;d;e;f eabm;g;a;b bm;c+ ebm; bar .Ee .P The value of the beamstyle parameter is remembered for any later changes back to the same time signature. For example, suppose you set .Ex time=4/4 beamstyle=4,4,4,4 .Ee then later in the piece switched to .Ex time=3/4 beamstyle=4,4,4 .Ee Then any time you went back to 4/4 or 3/4, the beamstyle you had set for that time signature would automatically be set as well. You could, of course, override the automatic setting with a new beamstyle if you wished. .P Normally Mup will break beams whenever it encounters a rest or space, but if you specify an "r" at the end of the beamstyle parameter, it will beam across rests of eighth note or shorter duration. Similarly, specifying an "s" at the end of the beamstyle parameter will cause it to beam across spaces of eighth note or shorter. Specifying both (in either order) will result in beaming across both. Mup will also beam across eighth note or shorter rests or spaces inside of custom beams. .P Sometimes, if there are many short notes beamed together, you may wish to subdivide the beams into smaller groupings, where the outer, or primary beam remains unbroken, but the inner, or secondary beams are broken periodically. When using custom beaming, this is specified by "esbm" ("end subbeam" or "end secondary beam") on the chord after which you want the break to occur. When using beamstyle, parentheses are used to indicate what sets of secondary beams are to be included in a given outer beam. .Ex 1 score .\"leftmargin=1.5 .\"rightmargin=1.5 .\"scoresep=10,14 beamstyle=(4,4),(4,4) music // use the beamstyle parameter 1: 16c;d;e;f; g;a;b;c+; c+;b;a;g; 32f;e;f;e;d;c;d;c; bar // use custom beaming 1: 16c bm;d;e;f;g;a esbm;b;c+;c+;b;a;g esbm;f;e;d;c ebm; bar .Ee .Hh crossbm .H 4 "Cross-staff beams" .P In keyboard music, sometimes notes on adjacent staffs are beamed together. .Ix iC Mup will do this with a variation on .Hr ichdattr.html#custbeam custom beaming. A bm and ebm must be specified on both staffs, and in each case the bm is followed by a qualifier: on the first of the two staffs, "bm with staff below" must be specified, while on the second staff you use "bm with staff above". For every point in time for the duration of the beam, one staff must have a chord with notes in it, and the other staff must have a space chord. (This is somewhat different than ordinary, non-cross-staff beams controlled by the .Hr param.html#beamstyl beamstyle parameter, where spaces are not allowed unless beaming across spaces is specifically requested.) The two "bm" marks must occur at the same time in the measure. Similarly, the two "ebm" marks must occur at the same time in each staff. Grouping subbeams using "esbm" is not supported on cross-staff beams. .P Some examples: .Ex 1 .\" score staffs=2 .\" leftmargin=1.5 .\" rightmargin=1.5 .\" staff 2 clef=bass .\" music 1: 8f bm with staff below; a; 4s ebm; 4s bm with staff below; 8b; d ebm; 2: 4s bm with staff above; 8a; b ebm; b bm with staff above; d; 4s ebm; bar .Ee .P Normally the beam will be drawn between the staffs, but you can force the beam to be above or below all the notes by specifying a .Hr chrdattr.html#stemdir stem direction. .Ix iH You can also adjust the appearance of the beam by giving .Hr chrdattr.html#stemlen stems lengths for the first and last chords in the beam. .Ex 1 .\" score staffs=2 .\" leftmargin=1.5 .\" rightmargin=1.5 .\" staff 2 clef=bass .\" music 1: [up]8f bm with staff below;a;4s ebm;4s bm with staff below;8b;[len 11]d ebm; 2: 4s bm with staff above;8a;b ebm;[down;len 14]b bm with staff above;d;4s ebm; bar .Ee .P If a cross-staff beam includes .Hr tuplets.html tuplets, the tuplet numbers will not be printed. You would have to print them yourself using either .Hr prnttext.html a "print" statement or .Hr stuff.html a "boldital" statement. .P It is possible for cross-staff beams to collide with other items, such as .Hr stuff.html dynamic marks. In these cases, you may need to move the other items. Another thing you might try is .Hr chrdattr.html#stemlen specifying stem lengths to alter where the beams get placed, or .Hr prnttext.html printing a blank string between the staffs to cause them to get placed further apart. If you specify a .Hr ichdattr.html#slope slope, you have to specify it on the staff having notes in the first chord, not the staff with space. .Hr chrdattr.html#slashes Slashes are not allowed on cross-staff beams. .P Mup doesn't directly allow cross-staff grace note beams. However, you may be able simulate the effect by using cue note chords along with invisible time signature changes and possibly invisible bar lines. See the .Hr invisbar.html section on "Special uses of invisbar" for more details. .P You may want to also look at the section on .Hr crossst.html cross-staff stems, for an alternate way to handles some cases where you might use cross-staff beams. .Hh alt .H 4 "Alternation" .P Alternation pairs .Ix aZ can be specified using "alt \fIN\fP" where \fIN\fP is a number. An alternation pair is two chords that are to be played alternately in quick succession but are not written out as such. This is shown by drawing \fIN\fP beams between the stems of the chords. The note value you specify for each .Ix hI chord must be the same, and the time value of each must equal the time .Ix gT taken by the pair. For example, if the pair takes up the time of a half note, each chord would be a half note. Here is an example: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music // Alternate between c and c an octave // higher. Total time taken is that of // a half note. Two "beam-like" lines // will be drawn to show the alternation. 1: 2c alt 2; 2c+;2g; bar .Ee .P Alternation is not allowed on cross-staff beams. .Hh slope .H 4 "Slope" .P On the first chord of a set of chords that are beamed together, you can specify a .Ix jJ beam angle from -45 to 45 degrees. This will override whatever angle Mup would have used. .Ex 1 .\" score time=3/4 ; beamstyle=4,4,4 .\" leftmargin=2 ; rightmargin = 2 .\" music 1: 8g slope 11; b; g slope 0; b; g slope -5.75; b; bar .Ee .Hh phrase .H 4 "Phrase marks" .Ix fJ .P Phrase marks can be specified by putting "ph" on the chord where you want the phrase to begin, and "eph" on the chord where you want it to end. The ph can optionally be followed by "above" or "below" to specify the side for the phrase mark. The "ph" and its matching "eph do not have to be in the same measure. There is also an alternate way to specify phrase marks, described in the section on .Hr phrase.html Tempo, Dynamic Marks, Ornaments, etc. .Ht Tuplets .Hd tuplets.html .H 3 "Tuplets" .P Tuplets are specified by giving a list of chords within curly braces. .Ix aX .Ix dV The ending brace is optionally followed by a side ("above" or "below"). .Ix bJ .Ix dL This is followed by a number or pair of numbers, and a semicolon. .P The "side" tells Mup whether to print the tuplet number and bracket above or below the chords. It only applies on voice 1 or 2 when the other voice (1 or 2) is nonexistent or a space. If there are at least two voices, the number and bracket will always be put above on voice 1 and below on voice 2. You can always force the side on voice 3. If you don't specify a side for a tuplet, Mup will choose the side that seems best. .P .Ix hH The first number is the number that should be printed with the tuplet. If it is followed by an "n," the number (and bracket) will not actually be .Ix dW printed. If it is followed by a "y," the number and bracket will always be printed, unless there is only a single chord in the tuplet, in which case only the number will be printed. If it is followed by "num," the number will always be printed, but the bracket will never be printed. If none of those modifiers are specified, the number will always be printed, but the bracket will be omitted in cases where all the notes in the tuplet are beamed together and the beam does not include any notes not in the tuplet. .P The second number, if any, is separated from the first by a comma, and tells the time unit that the tuplet is to .Ix gT take up. This number can be dotted if necessary. It can also be a time expression, like 2+8, although that is very rarely likely to be useful. .Ix gX If no second number is given, the default is to fit in the next shorter un-dotted note. For example, three eighth notes would be fitted into the time of a quarter note, or five eighth notes would be fitted into the time of a half note. .P Occasionally in music, as a shorthand, a single note or chord is printed with a tuplet number to indicate the note or chord is to be repeated several times as a tuplet. .Ix dZ .Ix hL Mup will allow this; simply use a tuplet with only one chord, and add one or more .Hr chrdattr.html#slashes slashes. .Ix cA .P The final item that can optionally be specified is the word "slope," followed by an angle in degrees, for the the angle of the tuplet bracket, if any. If that is omitted, the angle is calculated based on the .Hr param.html#tupslope tupletslope parameter. .P Nested tuplets are not allowed. .P Here are some examples of tuplets: .Ex 1 .\"score leftmargin=1.5 ; rightmargin=1.5 ; time=2/4 ; beamstyle=2 .\"music // This has a triplet, where 3 eighth // notes take as much time as a // normal quarter note. 1: { 8ce; df; eg;}3; 4fa; bar // This has a dublet, in which 2 quarter notes // take the time of a normal dotted quarter 1: { 4f; g; } 2, 4.;8a; bar // A quarter note and eighth note that // make up a triplet the length of a // normal quarter note, // with the 3 printed above the notes 1: { 4c+; 8b; } above 3; 4c+; bar // A septuplet in the time of a half note // with the "7" printed below the notes 1: { 8c; b-; c; e; d; f; a; } below 7; bar // A single chord tuplet 1: { [slash 1] 4.ceg;}3; 4; bar // Forcing a tuplet bracket to be flat 1: {g-;c+;a+;}3 slope 0; bar .Ee .Ht Chord-at-a-time input style .Hd altinp.html .H 2 "Chord-at-a-time input style .P There is an alternate input style, in which you enter music .Ix gW a chord-at-a-time, rather than a voice-at-a-time. In this style, the specification before the colon gives one or more patterns that tells .Ix iV how to map notes to staffs and voices. .P Suppose you want to print some music in a style common for many traditional hymns: it is to be printed on two staffs, each staff will always have exactly two notes, and the rhythm is exactly the same for all voices. With chord-at-a-time input, you specify, for each note in a chord, which staff and voice to map that note. Since there are four notes in each chord, there will be four mappings listed. You want the bottom two notes to get mapped to staff 2, and the top two notes to staff 1. This is shown as .Ex // Bass to staff 2 voice 1 // | Tenor to staff 2 voice 1 // | | Alto to staff 1 voice 1 // | | | Soprano to staff 1 voice 1 [ 2 1; 2 1; 1 1; 1 1 ] .Ee Each item in the semicolon-separated list tells how to map one note. So the first note in each chord will get mapped to staff 2 voice 1. The second note in each chord will also get mapped to staff 2 voice 1. The third and fourth notes will get mapped to staff 1 voice 1. .P Since voice 1 is, as always, the default, this could be written more compactly as just: .Ex [ 2; 2; 1; 1 ] .Ee If you wanted to input notes from top to bottom instead (in soprano-alto-tenor-bass order, rather than bass-tenor-alto-soprano order), you could use: .Ex // Soprano // Alto // Tenor // Bass [ 1; 1; 2; 2 ] .Ee If you wanted to use two separate voices on each staff (going back to bottom-to-top order), you could specify: .Ex // Bass to staff 2 voice 2 // | Tenor to staff 2 voice 1 // | | Alto to staff 1 voice 2 // | | | Soprano to staff 1 voice 1 [ 2 2; 2 1; 1 2; 1 1 ] .Ee .P Now let's put these mappings with music data. .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 staffs=2 vscheme=2f staff 2 clef=bass music [ 2; 2; 1; 1 ] : facf;dgfb;2cgec+; bar [ 1 1; 1 2; 2 1; 2 2 ] : fcaf;bfgd;2c+egc; bar .Ee In the first measure, the first two notes listed in each chord are mapped to staff 2, voice 1, while the third and fourth notes listed in each chord are mapped to staff 1 voice 1. In the second measure, two voices are used and notes are entered in descending order. Note that each note takes on the correct default octave for whichever staff it is mapped to. .P It is also possible to use rests or spaces for some of the voices. .Ex 1 score .\" leftmargin=1.5 .\" rightmargin=1.5 key=3& vscheme=2f music [ 1 2; 1 1 ]: rb; eg; ca; gr; bar [ 1 2; 1 1 ]: er; sr; 8sf; se; 4sg; bar .Ee .P Chord attributes and interchord attributes (like tie, slur, xnote, len, and alt) can be specified just like for voice-at-a-time input. Note attributes (like ? and ~) apply to the note wherever it gets mapped, and items that apply to the chord as a whole will be applied to all the notes. .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\" vscheme=2f .\"music .\" [1 2; 1 1] : [cue; xnote; len 6] b-e; [with > ] ce& slur; dg~; c?g; .\"bar .Ee .P It is possible to map a note to more than one place by using ranges, and/or by giving a list of staffs and voices, separated by ampersands. This may be useful, for example, if several voices are in unison. In the next example, the first note in each chord will be mapped to voice 1 of staffs 1 through 3, as well as to voice 2 of staff 1, while the second note in each chord will be mapped to voice 2 of staffs 2 and 3. .Ex 1 .\"score .\" rightmargin=2 .\" leftmargin=2 .\" staffs=3 .\" vscheme=2f .\"music [ 1-3 1 & 1 2; 2-3 2 ] : ec;fd;ge;af; .\"bar .Ee .P It is also possible to specify more than one bracketed mapping. Each must include a mapping for a different number of notes. So, for example, if some chords in a measure have two notes and others have three, you can define two maps: one for two notes, and one for three. The example below demonstrates placing alto and soprano as two voices on one staff, but sometimes the alto part splits. .Ex 1 .\"score .\" rightmargin=2 .\" leftmargin=2 .\" vscheme=2f .\"music // For chords with two notes, // map the first to staff 1 voice 2 (alto), // and the second to staff 1 voice 1 (soprano). // For chords with three notes, // map the first two notes to staff 1 voice 2 // (first and second alto part), // and the third to staff 1 voice 1 (soprano). [ 1 2; 1 1 ] [ 1 2; 1 2; 1 1 ]: cec+;df;eg;a-fc+; .\"bar .Ee If mappings of different chords need to vary by something other than the number of notes in the chord, then you will have to use the voice-at-a-time input style. .P Since the mapping specifications can get rather complex, and they may be used many times during a song, it is usually best to define .Hr macros.html macros for them, and possibly even put the macro definitions in .Hr include.html an "include" file. .Hi Macros and include files are described in a later section. .He .P You can use the different input styles in different measures of a single song, and use different mappings in different measures. You can even mix the two input styles within a measure, but a given staff/voice can only appear on one line of input per measure. So, for example, you could choose to input staffs 1 and 2 of a song in chord-at-a-time input style, and staff 3 in voice-at-a-time style. The .Hr param.html#inputdir noteinputdir parameter is ignored on chord-at-a-time input. Location tags cannot be used with chord-at-a-time input, since often that would be ambiguous. .Ht Bar Lines .Hd bars.html .H 2 "Bar lines" .P .Ix hG Each measure must be ended with a "bar" of some kind. There are several kinds: .Ix gG .Hi .DS .He .TS center; c c l l. \fBKeyword\fP \fBMeaning\fP _ bar ordinary bar line dblbar double bar repeatstart beginning of repeated section .Ix dZ repeatboth end of one repeated section and beginning of another repeatend end of repeated section endbar heavy double bar line used at end of song .Ix fH invisbar no bar line printed restart end staffs and begin anew .TE .Hi .DE .He .P In addition, the bar and dblbar types can be preceded .Ix fF .Ix fG by the word "dashed" or "dotted" to produce dashed or dotted bar lines. .P .Ex 1 .\"score leftmargin=2;rightmargin=2 .\" label=" " .\"music 1: mr; bar 1: mr; dblbar 1: mr; dashed bar 1: mr; dotted dblbar 1: mr; repeatstart 1: mr; repeatboth 1: mr; repeatend 1: mr; endbar .Ee .P When a repeatstart would end up at the end of a score, it will automatically get moved to the beginning of the following score. In that case, it isn't clear what kind of bar line you would like to have put at the end of the original score. By default, Mup will use an ordinary bar, but in some cases\(emlike if the repeatstart begins a new section, or there is also a key change\(emyou might want to have a dblbar instead. You can get a dblbar there by specifying dblbar in parentheses before the repeatstart: .Ex (dblbar) repeatstart .Ee Actually, you are allowed to specify any bar type in the parentheses, including dashed or dotted types, but dblbar or possibly invisbar are probably the only ones likely to be useful. If the repeatstart ends up in the middle of a score, so that it doesn't need to get moved to the beginning of the next score, the parenthesized bar type is not needed, so it is just ignored. .P There is a .Hr param.html#brktrpts bracketrepeats parameter that can be set that will cause Mup to draw brackets around repeated sections, to make them more obvious to the performer, which may be helpful when playing in dimly lit areas. .P Sometimes music is printed without bar lines. The "invisbar" can be used in this case, to fulfill Mup's requirement to specify some sort of bar after every measure without actually printing bar lines. .P .Hm restart The restart is a special kind of bar. .Ix iS It follows immediately after another bar line without any intervening music data. (That is, you can't have any notes. You can use score or staff context things, like changing time or key signature.) It would be most commonly used for something like a short coda. .Ex 1 score .\" leftmargin=1.5 .\" rightmargin=1.5 staffs=2 brace=1-2 staff 2 clef=bass music 1-2: c;d;e;f; rom above 1: 3 "D.C. al Coda"; dblbar // The restart follows a bar // without any music data in between. restart rom above 1: 1 "Coda"; 1-2: f;e;d;c; endbar .Ee .P There are several optional directives that can follow the bar line keyword. They can be specified in any order and are described below. .Hh bpad .H 3 "Bar line padding" .P One optional directive is padding. .Ix bD It can be used to force Mup to place extra white space to .Ix gZ the left of the bar line. It is specified by the keyword "pad" followed .Ix fO by a number of stepsizes of padding to add. For example: .Ex dblbar pad 3 .Ee would add 3 stepsizes of padding. One possible use would be if you wanted a different amount of gap on a restart than what Mup uses by default: .Ex restart pad 10 .Ee .Hh btag .H 3 "Bar line location tag" .P It is also possible to associate a .Hr tags.html location tag .Ix bE with a bar line. For example: .Ex // Associate tag "_bar6" with bar line bar =_bar6 // Do double bar with an extra stepsize of // padding, and associate tag "q" // with the bar line dblbar pad 1 =q .Ee .fi .ad .P The y coordinate of a bar line is not very useful. Special rules apply if a bar line happens to be placed at the end of a score. Any locations taken .Ix hJ relative to the bar that would be to the right of the bar are treated as if the bar line were at the beginning of the following score, just beyond the clef and time and key signatures, if any. .Ix cG .Ix fI .Ix gU .Hh endings .H 3 Endings .P First and second endings, etc. can be designated at bar lines. .Ix aR This is done with the keyword "ending," followed by a quoted string to use as the label for the ending that should begin at the .Ix dP .Ix hB bar line. An ending will span bars until either another ending is specified, the piece ends, or the special keyword "endending" is used. Examples: .Ex bar ending "1." repeatend ending "2-3" endbar endending .Ee .P The ending label will always be forced into 12-point Times roman font. If you change font or size or include .Ix bG .Ix bH .Ix gJ special characters in the ending label, the output is not likely to be aligned properly. .P .Hr param.html#endingst The "endingstyle" parameter .Ix dG .Hi (described in the section on parameters) .He controls where endings are placed. Endings cannot start at or cross over a restart bar. .P When doing an endending, Mup will draw a vertical line at the end unless it is at a plain bar or an invisbar that is not at the end of the piece. Once in a while, you may want to override that. To do so, instead of specifying endending, you can specify openendending (to force Mup to not draw the final vertical), or closedendending (to force it to draw the final vertical). .Hh reh .H 3 "Rehearsal marks" .P Rehearsal letters or numbers .Ix aQ can be specified on any bar line. There are four formats: .nf .na .in +0.5i .br \fBrehearsal let\fP .br \fBrehearsal num\fP .br \fBrehearsal mnum\fP .br \fBrehearsal "\fP\fIlabel\fP\fB"\fP .in -0.5i .fi .ad .Ix dP .P In the first example, a rehearsal letter will be placed on the bar. The first occurrence of this will become rehearsal "A", the next "B", and so forth. The second format works in a similar fashion except that numbers are used rather than letters. With the third format, the current measure .Ix dY number is used. With the last format, any arbitrary string .Ix hB within the quotes will be used. The keyword "rehearsal" can be abbreviated to "reh" if you wish. Only one rehearsal mark is allowed on any one bar, but the types can be mixed throughout the composition. Note, however, that mixing "num" with "mnum" is likely to be very confusing, as would using "num" while the .Hr param.html#measnum measnum parameter is set to "every \fIN\fP." The rehearsal marks can be intermixed with other bar options: .Ex 1 .\"score leftmargin=2;rightmargin=2 .\" warn=n .\"music 1: 1c; dblbar reh num ending "1" 1: 1e; repeatend pad 1 =_xyz reh let ending "2." 1: 1g; bar rehearsal "Duet" 1: 1ce; endbar endending .Ee .P The rehearsal marks are normally put directly above the bar line. However, if the bar line falls at the end of a score, the rehearsal .Ix hJ mark will be placed at the beginning of the following score, after the .Hr param.html#clef clef, .Ix fI .Ix gU .Hr param.html#key key signature, and .Hr param.html#time time signature. .Hr param.html#endingst The "endingstyle" parameter .Ix dG .Hi (described in the section on parameters) .He is used to determine which staffs get rehearsal marks. .Hr param.html#rehstyle The "rehstyle" parameter specifies whether to put rehearsal marks inside a box or a circle or leave them plain. .P By default, rehearsal marks are printed in 12-point Times bold, but the rehearsal keyword may be followed by a specification for \fIfontfamily\fP, \fIfont\fP, and/or \fB(\fP\fIsize\fP\fB)\fP. Once specified, these remain in effect for any future rehearsal marks, until explicitly changed. Some examples: .Ex bar rehearsal helvetica bold (14) let repeatend reh newcentury num invisbar reh rom (10) mnum .Ee .P After all the options listed above, you may specify "dist \fIN\fP" where \fIN\fP is some number of stepsizes. This will override the .Hr param.html#dist dist parameter for determining how close to the staff to place the rehearsal mark. If the number is followed by a "!" Mup will place the mark exactly that far from the top of the staff, even if it overwrites other things; otherwise the value specifies a minimum distance. .Ex rehearsal num dist 5 // at least 5 stepsizes away reh bold "A1" dist 2 ! // exactly 2 stepsizes away .Ee .Hh setmnum .H 3 "Setting the measure number" .P Mup keeps track of .Hr param.html#measnum measure numbers .Ix dY automatically, but sometimes you may want to override this to set the current measure number to some specific value. This is done by adding mnum=\fInumber\fP on a bar line, which will set the current measure number to the given \fInumber\fP. .Ex // Set the current measure number to 50 dblbar mnum=50 .Ee You can also tell Mup to adjust up or down from what it would otherwise count, by using a plus or minus sign instead of the equals sign, following by the number of measures to adjust by. So, for example, suppose you use .Hr invisbar.html invisbar in some way that causes Mup to not count something as a measure that you actually want to be counted. You could then use .Ex invisbar mnum+1 .Ee .Hh setreh .H 3 "Setting rehearsal letter or number" .P If you are using the "rehearsal let" or "rehearsal num" styles, you can set those to specific values too, similarly to how mnum can be set. This might be useful, for example, if you have a single input file that contains multiple songs or movements, and you want the rehearsal marks to start over at the beginning of each song or movement. .P The rehearsal number can be set on any bar line using num=\fIN\fP, where \fIN\fP is a number, typically 1. .Ex bar num=1 .Ee The rehearsal letter can be set in a similar way, using let="\fIX\fP" where \fIX\fP is either a single uppercase letter, A to Z, or two uppercase letters, AA to ZZ. .Ex dblbar let="A" reh let .Ee .Hh hide .H 3 "Hiding time/key signature and clef changes" .P Generally in printed music, when a .Hr param.html#time time signature .Ix gU .Hr param.html#key or key signature .Ix cG change occurs at the beginning of a score, these changes are also printed at the very end of the previous score, to make it clear there is a change coming up. Mup normally does this, but occasionally you may not want that behavior. Sometimes you may want to make a new score appear like the beginning of a new piece. If you wish to suppress the printing of time signature, key signature, and clef changes at the end of the preceding score, you can use the "hidechanges" .Ix hR keyword on the bar line at which the changes occur. Hidechanges cannot be used on a restart bar. .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"scoresep=10,14 .\" label=" " .\"music 1: c;d;e;f; bar // change time/key with normal treatment newscore score time=5/4 ; key = 1& music 1: d;e;f;2g; // don't show changes at end of previous score bar hidechanges newscore score time=6/4 ; key = 2# music 1: d;e;f;2.g; bar .Ee .Hh subbar .H 2 "Subbars" .P Sometimes you may want to mark subdivisions of measures. For example, you may want to indicate that something in 7/4 time is to be interpreted as 3+4 or 4+3. Although you could indicate that with the .Hr param.html#time time signature, this can also be done using the .Hr param.html#subbar subbarstyle parameter. The general syntax of this parameter is .Ex \fBsubbarstyle = \fP\fIlinestyle bartype appearance ranges \fP\fBtime \fP\fIcounts\fP .Ee The \fIlinestyle\fP is optional, and can be dashed or dotted. The \fIbartype\fP is either bar or dblbar, and indicates whether to draw a single line or two lines. .P The \fIappearance\fP is optional. When specified, it is in parentheses, describing where the subbar should end vertically. Top and bottom specifications are given, with the word "to" between them. Each specification consists of the word "top," "middle," or "bottom," indicating which line of the staff to draw relative to, optionally followed by a plus or minus sign and a number of stepsizes. .Ex (top to bottom) .Ee means draw from the top line of the top staff in each range to the bottom line of the bottom staff in the range. This is the default if no appearance is given. .Ex (middle to middle) .Ee would mean draw from the middle line of the top staff in each range to the middle line of the bottom staff in the range. As mentioned earlier, you can also specify adding or subtacting some number of stepsizes on each. So .Ex (top-2 to bottom+2) .Ee would draw from 2 stepsizes below the top line of the top staff to 2 stepsizes above the bottom line of the bottom staff. .P The \fIrange\fP is similar to ranges for the barstyle parameter, so things like 1-2 or 1-4,8-12 or all. .P Often you may want the subbar marks to span just a part of each individual staff, so the "ranges" will be just individual staffs. .P The "time" keyword is required and must be followed by at least one count at which to draw the subbar. The time can include a decimal part. Multiple times are separated by commas. Examples would be time 3 or time 2.5,4.75 .P Subbars are only drawn on staffs where there is actually a note or rest at that count. .P Multiple styles can be given. For example: .Ex subbarstyle=bar 1-4 time 2 dotted dblbar (top-1 to bottom+1) 5,6 time 4 .Ee .P Finally, you can use "between" as the appearance, to draw between staffs in the range. .Ex subbarstyle=dotted bar between all time 3 .Ee Once between is specified, it applies to all future styles in the parameter value, so if you want a mixture of between and not, specify all the not between first. .Ht Multirests .Hd multirst.html .H 2 "Multirest" .Ix hG .P Multiple measure rests can be indicated using the "multirest" statement. .Ix aW .Ix hC .Ix hD It is followed by the number of measures of rest. The number must be greater than 1, and no larger than 1000. There must not be any note or lyric information specified for .Ix hL a multirest measure. Examples: .Ex 1 .\"score leftmargin=1.5; rightmargin=1.5 .\"music multirest 15 bar 1: 2c;4;; bar 1: 2.c;4r; bar multirest 5 bar .Ee .P See also .Hr cmdargs.html#coption the -c command line option, and .Hr param.html#restcomb the restcombine parameter. .P Normally, the number of measures of rest is printed, but it is possible to turn this off using .Hr param.html#prmultn the printmultnum parameter. An alternate notation can be specified using .Hr param.html#restsymm the restsymmult parameter. .Ht Lyrics .Hd lyrics.html .H 2 "Lyrics" .P .Ix aE Lyrics are specified in a somewhat similar manner to .Hr chordinp.html note groups. Lyrics for each staff are specified with the word "lyrics" .Ix hK optionally followed by a \fIplace\fP, followed by the \fIstaff number\fP, followed by a colon, then the timing and syllable information. .Ix gF .P The \fIplace\fP, if specified, can be "above" or "below," to .Ix bJ .Ix dL indicate whether the lyrics are to be printed above or below the given staff. The default is below. .P The \fIstaff number\fP can be a single number or list of ranges of numbers. It can also be given as the keyword "all," which will place the lyrics above the top visible staff or below the bottom visible staff. .Ix gL .Ix gM .Ix gN .P The place can also be specified as "between \fIM\fP\fB&\fP\fIN\fP" where \fIM\fP and \fIN\fP are numbers. .Ix dM This will cause the lyrics to printed approximately halfway between staff \fIM\fP and staff \fIN\fP. \fIN\fP must be exactly one greater than \fIM\fP. .Ex lyrics 1: lyrics above 2,3: lyrics between 1&2, 3&4: .Ee .P If you want the same lyrics above some staffs but below others, you can specify several places and list of staffs, separated by semicolons. For example: .Ex lyrics above 1,3 ; below 2,4 ; between 5&6 : .Ee .P After the colon comes a list of time values. .Ix gT Time values are separated by semicolons and are specified as they are .Ix hH for notes: "2" for half notes, "8." for dotted eighth, etc. .Ix gX .P If the time values for lyrics are the same as the time values for the notes on the staff, the time values need not be specified. If you don't specify them, Mup will derive the appropriate values from the music input. If you list more than one staff, the time values will be derived from the first staff you list. Usually, the time values will be derived from voice 1, but if voice 1 music data doesn't exist or is invisible, or if the lyrics are explicitly specified as "below" and there is a visible voice 2, then voice 2 will be used. Voice 3, if any, is never used for automatically deriving time values for lyrics. Some examples: .Ex 1: c;d;e;f; lyrics 1: "The sun will shine"; // The time values will be all quarter notes, // as derived from the music on staff 1 bar 1: 8g;4.f;4g;a; lyrics 1: "up-on the earth."; // The derived time values will be 8;4.;4;; bar // In these examples, time values will be taken // from staff 4, since it is the first one listed. // In the last case, because "below" is specified explicitly, // the times will be taken from voice 2 // if there is a visible voice 2; in all the other cases // it will be taken from voice 1 if voice 1 music // has been entered and is visible. lyrics 4,7,9: "for-ev-er"; lyrics above 4-6: "nev-er-more"; lyrics between 4&5,6&7: "this is it"; lyrics below 4,2: "and so forth"; .Ee The line describing the music from which to derive the times must appear in the input prior to the lyrics line that is deriving the times. If chords in the music are tied or slurred together, Mup will treat those chords as being for a single syllable. However, there may be some circumstances in which the rules Mup uses to derive time values may not yield what you want, in which case you will have to explicitly specify the times for that measure. .P Or if there is some other voice in the measure that has the times you want, you can tell Mup to use that one, by adding the keyword "using" and the staff and voice of that other voice. As usual, an omitted voice defaults to 1. This can even let you use voice 3 for time derivation, which would otherwise not be possible. Here is a simple example: .Ex 1 score vscheme=3f .\" leftmargin=1.3 .\" rightmargin=1.3 music 1: g+;;;; 1 2: 2c;; 1 3: 8e;;;;;;;; lyrics 1 using 1 3: "This de-rives from voice num-ber three."; bar .Ee .P Following the time values is a list of one or more verse numbers and lyric strings containing the words of the lyrics. .Ix cJ .Ix hB The verse number(s) are given within square brackets. If no verse is .Ix dW specified on the first set of lyrics for a staff and place, verse 1 is assumed. On subsequent lyrics strings for that staff and place, the verse number is assumed to be one more than the previous verse number. Thus you only need to explicitly specify a verse number if you want to skip over a verse or supply them out of order. .P Verse numbers need not be consecutive. The staff number and verse number can be given as lists or ranges. Another example: .Ex 1 .\"score leftmargin=2 ; rightmargin = 2; staffs=2 .\"music 1-2: 4.c+;8c;{4e;f;g;}3; lyrics below 1-2: 4.;8;{4;;;}3; \e "This is some-thing else."; \e [4,5] "How do you like this?"; \e [2-3,6] "Now try this out too."; bar .Ee .P In this example, the lyrics will go below staffs 1 and 2. There are 5 syllables. The first is a dotted quarter in length, the second is an eighth, and the last three make up a quarter note triplet. The first string is for verse 1, since no verse number was specified. The second string will be used for verses 4 and 5, and the last string for verses 2, 3, and 6. .P .Hm centered You can also specify a verse number of "c" which means the verse is .Ix cV to be centered vertically. This is useful if you have a refrain that is identical for several verses, and you don't want to have it printed multiple times. .Ex 1 .\"score .\" leftmargin=2.5 .\" rightmargin=2.5 .\"music 1: c;;e;; lyrics 1: ;;2s; [1] "verse one"; [2] "verse two"; lyrics 1: 2s;4;; [c] "The refrain"; // centered lyrics bar .Ee .P The lyrics string is followed by a semicolon. There must normally be one syllable in the lyrics string for each time value. .Hr lyrics.html#except (There is one exception, discussed later.) Syllables are separated in the lyrics string by white space, .Ix gZ a dash, or an underscore. .Ix fW .P Sometimes a syllable is to be held out for several counts or over several notes. This can be indicated by dashes or underscores. .Ix hL If the syllable in the lyric string ends with a dash, on output the dash will be placed halfway between the given syllable and the next syllable. If the distance between the two syllables is long, several evenly spaced dashes will be printed. If a syllable in the lyric string ends with an underscore, an underscore line will be printed from the end of the current syllable to the edge of the last note associated with the syllable. .Ix hC .P Here are some examples: .Ex 1 .\"score leftmargin=2 ; rightmargin=2 .\"music // Verse 1. The first two words have the // duration of a quarter note each. // The last word lasts a half note. 1: e;d;2c; lyrics 1: 4;;2; [1] "Three blind mice"; bar .Ee .Ex 1 .\"score leftmargin=2 ; rightmargin = 2; .\"music // examples of above lyrics with dash and underscore 1: 4d<>;e;8g;b;4a; lyrics above 1: "now_ or nev-er"; bar .Ee .P Mup does its best to figure out where to end dashes or underscores. However, if there isn't a following syllable after a dash or underscore, Mup would extend the dash or underscore to the end of the piece, which may not be what you want. There are a few other cases where Mup may be unable to properly deduce where you had intended an underscore to end. You can manually halt the dash or underscore by adding in .Ix fU an "empty syllable," consisting of "<>". Normally, the angle brackets are .Ix dX used inside lyrics to enclose special non-lyrics items, as will be .Hr lyrics.html#lyrext described a bit later. However, if they are used by themselves with nothing between them, they essentially mean a syllable with no text. .Ex 1 .\"score leftmargin=1.5; rightmargin=1.5 .\"music 1: 2c;4d<>;e; lyrics 1: "last word._"; bar 1: 4d;e;f;g; // add empty syllable to end the underscore lyrics 1: 1; "<>"; bar .Ee .P Occasionally, a single chord is used for more than one syllable. If the syllables are within the same word, it is sufficient to omit the dashes between syllables, so that Mup will treat them as a single syllable. However, if the syllables are in separate words, a "~" can be used in place of a space between the syllables. On output, Mup will replace the "~" with a space and a small, curved line below the space, indicating that the .Ix fD syllables on either side are to be joined. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music 1: b;a;2g; lyrics 1: ;;2; "man-y~a day"; bar .Ee If you don't want the curved line, you can use the special character name "\e(space)" instead of a .Ix gZ literal space. .Hr textstr.html#space That special space character is printed like a normal space on output, but is not considered a space for the purposes of determining syllable boundaries. Alternately, .Hr lyrics.html#lyrext a technique using angle brackets, described later, can be used. .P If several verses use the same time values, you can specify them all on one input line. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music 1: d;f;a;g; lyrics 1: [1] "this is verse one"; \e [2] "this is verse two"; bar .Ee .P In this example, because of the \e at the end of the first line, both verses are effectively on the same input line. .P .Hm except Occasionally, lyrics may occur during only part of a measure. .Ix hG This case can be handled by specifying "space" .Ix gZ by using an "s" after time values that have no lyric syllable associated with them. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music 1: 2r;g; lyrics 1: 2s;; [1] "Now"; bar .Ee .P In this example, the first half note of the measure is a space, so there will be no lyric there. The second half note of the measure will have the word "Now" as its lyric. Note that the "s" does not work quite the same way with lyrics as it does with notes. With notes, "2s;;" would mean two half note spaces, because the space would be used as default for the following chord where no notes were specified. With lyrics, "2s;;" means a half note space, followed by a half note lyric; the space is not carried forward as a default. .P If you don't specify any time values, relying on Mup to derive the time values from the corresponding music time values, any rests and spaces in the music will be translated to lyric spaces. If the first note entered in a chord is tied to or slurred to the following chord, that following chord will also be translated to a lyric space, since you most likely want a single syllable to span both chords in that case. .P In addition, if you set the .Hr param.html#xtendlyr extendlyrics parameter, Mup will deduce where to add in underscores, based on the locations of ties and slurs. .P .Hm lyrext Occasionally, you may want to print something within a lyric string which isn't really a lyric syllable. The most common example of this would be that you may want to print verse numbers. Other possibilities may include associating a dynamic mark (e.g., "mf") with a particular verse, or .Ix fR marking a section for a subset of the singers (e.g., "Men:" or "Solo:"). These extra things are specified within angle brackets. They can be placed .Ix dX immediately before or after any syllable. Mup will not consider them when lining up the syllable with notes. .Ix hL Normally, it will assume there is enough space to print them rather than reserving space for them. If you want Mup to ensure there is enough space to print them, put a "^" immediately after the "<". .P Some examples: .Ex 1 .\"score leftmargin=2;rightmargin=2 .\"music 1: f;e;d;c; lyrics 1: "<1. >This is verse one."; bar 1: 2g;4;; lyrics 1: 2s;4;; "<^\ef(TX)ff\ef(PV) >Loud-er"; bar .Ee .P The < > construct can also be used to fine-tune the placement of syllables. The placement of syllables is governed in general by the .Hr param.html#lyralign lyricsalign parameter. .Ix hT Sometimes, however, you may want to adjust the placement of specific syllables. Suppose you have a long syllable, like "strength" and would like to shift it leftward somewhat. Entering it as "<str>ength" would cause Mup to move the syllable farther to the left than it normally would. .Ex 1 .\"score leftmargin=2;rightmargin=2 .\"music 1: c;d;e;f; lyrics 1: "This strength not moved."; \e "This <str>ength was moved."; bar .Ee .P Angle brackets may also be useful for entering .Ix iK chant, where many words are to be associated with a single note. For example: .Ex lyrics 1: "All<^ these words will be treated like one syllable.>"; .Ee .P The font and size to use for lyrics is initially determined .Ix bG .Ix bH from the .Hr param.html#lyrfam \&"lyricsfontfamily," .Ix gB .Hr param.html#lyrfont \&"lyricsfont" and .Hr param.html#lyrsize \&"lyricssize" parameters for the appropriate staff. If "all" is used for the staff number, the score parameters are used. .Ix cQ .Ix hJ In the case of "between," the parameters for the staff above are used for determining the font and size. The usual \ef and \es forms can be used to .Hr textstr.html change these values for a given verse. Lyrics fontfamily, font and size values are maintained separately for each combination of staff number, verse number, and place, and are carried forward from one measure to the next. Thus, for example, if you want one verse to be printed in roman and another in italics (perhaps one is in English and the .Ix gJ .Ix gK other in another language), you need only put a "\ef(TI)" at the beginning of the syllable string for the first measure of the second verse, and all subsequent syllables for that verse will be in italics. Setting the .Hr param.html#lyrfam \&"lyricsfontfamily," .Hr param.html#lyrfont \&"lyricsfont" or .Hr param.html#lyrsize \&"lyricssize" parameters will reset the values for all verses of the staff (if set in .Hr contexts.html staff context), .Ix hK or the entire score (if set in .Hr contexts.html score context). .Ix hJ .P Another way to align a syllable in a particular way is to precede the syllable with a |. If the | is preceded by a number (optionally signed), the left edge of the syllable will be placed that many points from the horizontal "middle" of the chord. .Ix jB If there isn't a number before it, the value is obtained from the .Hr param.html#sylpos sylposition parameter. Negative values are to the left, and will usually be what you want. This alignment method is particularly useful for lining up multiple verses, either to get verse numbers to line up or to align words at the beginning of a poetic line. The | goes after anything in angle brackets. .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\"music 1: 8c;d;4e;8e;g;4c+; lyrics 1: "<1. >|\e"How are you?\e" -7|He asked her."; \e "<2. >|\e"I am fine,\e" -7|She re-plied."; bar .Ee .P .Hm ltag Location tags can be set on lyrics syllables .Ix bE by adding \e=(\fItagname\fR) to the syllable. As with all tags, the \fItagname\fP must be either a single lowercase letter, or an underscore followed by any number of uppercase or lowercase letters, digits, or underscores. The area associated with the tag will include the syllable itself and anything inside <^ >, but excluding things inside < >. While Mup will recognize a tag like this almost anywhere within a syllable (except inside < > or before any initial < >), it is recommended that it be placed at the end of the syllable, before the dash or underscore, if any, because that's less confusing to read than putting it in the middle of a syllable. An .Hr lyrtag.html example showing common uses of lyric tags in given in the Hints section. .P A few more examples of lyrics: .Ex 1 .\"score leftmargin=2;rightmargin=2;staffs=4 .\"music 1,3-4: c;8e;;4d;r; 2: c+;8g;;4b;; lyrics between 1&2,3&4: 4;8;;4;s; "This is a test."; lyrics above 2: 2s;4;; "The end."; bar .Ee .Ht Tablature notation .Hd tabstaff.html .H 1 "TABLATURE NOTATION" .P .Ix hU Mup can print tablature staffs. Tablature notation is commonly used for .Ix hY guitar and several other instruments. Mup supports tablature for 1 to 9 strings. .P Mup will automatically create a normal 5-line staff above each tablature staff, giving the equivalant music on that staff. This staff will be referred to as the "tabnote staff." Normally, you will input music just for the tablature staff, and the tabnote staff will be derived from that. However, for any given measure, you can explicitly input music for a tabnote staff, which will turn off the automatic translation for that measure. If you only want either the tab or tabnote staff to be printed, you can mark the other one as invisible .Ix gL .Hr param.html#visible (see the "visible" parameter). You should specify the appropriate .Hr param.html#clef clef and .Hr param.html#key key signature for the tabnote staff, so that Mup can make the best derivation. .H 2 "Specifying a tablature staff" .P To set up a tablature staff, you use the .Ix fX .Hr param.html#stlines stafflines parameter. To get a standard 6-line guitar tablature staff, you can just say .Ex score staffs=2 staff 2 stafflines = tab .Ee There are 2 staffs, because there is both the tablature staff and the automatically generated tabnote staff. The tablature staff is always immediately below the corresponding tabnote staff. Setting the .Hr param.html#stlines stafflines parameter to "tab" marks staff 2 as a tablature staff. .P If you want tablature for an instrument other than a 6-string guitar with standard tuning, you specify the pitches of the strings from top to bottom within parentheses after the "tab." For example: .Ex stafflines = tab (e a d& g) .Ee would define some instrument that had 4 strings, with the string on the top line of tablature staff being an e string, the next a, the next d flat, and the bottom g. As shown in the example, pitches can include a # or & if necessary. Strings are assumed to be in octave 4 unless otherwise marked. You can specify a different octave by specifying an .Hr chordinp.html#oct octave number after the string's pitch (using either an absolute octave number or pluses or minuses). If the instrument has more than one string with the same pitch (even if they are in different octaves), they must be distinguished by adding one or more ' marks after the pitch. The tablature definition for standard guitar is .Ex stafflines = tab (e5 b g d a3 e'3) .Ee This specifies that the top string on the staff is e in octave 5. The next three strings are in the default octave of 4, and the last two strings are in octave 3. Since there are two different strings with pitch letter of e, the lower e is marked as e'. Note that the octaves given are how they should be printed on the tabnote staff. A standard guitar actually sounds an octave lower than written. If you just use "stafflines = tab" without specifying any strings, Mup not only assumes the standard guitar layout, and prints in the appropriate octave, .Hm autotran but it also automatically .Ix fB .Hr trnspose.html transposes the .Ix aA .Hr midi.html MIDI output to the actual pitches an octave lower. If you specify strings explicitly, you will have to specify the octaves and any desired MIDI transposition values yourself. Stated another way, .Ex score staffs = 2 staff 2 stafflines = tab .Ee is equivalent to .Ex score staffs=2 staff 2 stafflines = tab (e5 b g d a3 e'3) staff 1 ifdef MIDI transpose = down perfect 8 endif .Ee Note from this last example that MIDI is taken from the tabnote staff, not the tablature staff, so MIDI directives should be placed with the tabnote staff. .P Mup should be able to handle almost any instrument with up to 9 strings. Several strings can have the same pitch; you just need to distinguish them with ' marks. The strings must be listed in whatever order the strings are to appear on the tablature staff. As another example, .Ex stafflines = tab (g3 d3 a2 e2) .Ee would define a standard bass guitar. Note that a bass guitar also sounds an octave lower than written, so it should be transposed for MIDI purposes. .P The list of strings, if any, can optionally be followed by y or n. Using y will cause the word TAB to be printed vertically at the beginning of every score. Using n will cause that to never to be printed. Not specifying either will cause it to be printed only on the very first staff, which is the most common way of printing tablature. .H 2 "Music input on tablature staffs" .P Input of tablature is similar to that on regular staffs. Each note in a chord is specified by a string and a .Ix hZ fret. So fret 3 on the g string is designated by g3, or fret 0 on the e' string is designated by e'0. If your open string pitch includes an accidental, that would be included as well, so if you had an instrument with an f# string and wanted to play the 6th fret on that string, it would be f#6. Fret numbers can range from 0 to 99. If you want fret numbers to be placed inside parentheses, .Ix iA put parentheses around them in the input. You can also put both the string and fret within a set of parentheses, in which case, the note generated on the tabnote staff will have parentheses around it. Here are some examples of chords: .Ex 1 .\"score staffs=2 .\"leftmargin=2.5 ; rightmargin=2.5 .\"staff 2 stafflines=tab .\"music 2: d4; d5a3; b0 d(5); e2(b3)g2; bar .Ee .P .Hr chordinp.html#duration Time values are specified just like on non-tablature staffs: a number optionally followed by one or more dots (like 4 or 8..), or a list of such numbers added together (like 2+8), preceding the chord pitches. Tablature staffs follow the same rules as non-tablature staffs for using time values from the previous chord if no time value is specified on the current chord. Similarly, if no notes are specified for a chord, the same notes used in the previous chord are reused. As an example: .Ex 1 .\"score staffs=2 .\"leftmargin=2.5 ; rightmargin=2.5 .\"staff 2 stafflines=tab .\"music 2: 4.e5; ;8;b2; bar .Ee Since nothing is specified for the second chord, both time value (dotted quarter) and note (e string fret 5) are copied from the first chord. The third chord in the measure has only a time value (an eighth note) so the note (string/fret) is repeated. The final chord has only a note, so the previous time value is used. .P Rests and spaces can be specified with r and s, just like on non-tablature staffs. They result in nothing being printed on the tablature staff, and rest or space being printed on the tabnote staff. .H 2 "Chord attributes" .P Any chord on a tablature staff can be preceded by a list of .Hr chrdattr.html#chstyle chord attributes in brackets, just like with non-tablature staffs. If you want a chord to be printed with X (for a muffled string) rather than a fret number, .Ix bS use [xnote]. In this case, the fret number will be used only to determine where to put the X on the tabnote staff, and what note to use for .Hr midi.html MIDI. Using [diam] .Ix bT will have no effect on the tablature staff, but will cause diamond notes to be used on the tabnote staff. .Ix aL .Ix bB Using [grace] or [cue] will cause the fret numbers to printed in a smaller size, and the corresponding notes on the tabnote staff to be printed in a smaller size. Using [slash \fIN\fP] will cause \fIN\fP slashes to be printed below the chord on the tablature staff, as well as .Ix cA .Hr chrdattr.html#slashes slashes on the corresponding chord on the tabnote staff. You can use the other chord attributes (with, pad, and =tag) just like on a non-tablature staff. .H 2 "Ties" .P From an input point of view, .Ix aK .Hr noteattr.html#ntie ties work much the same on tablature staffs as on other staffs. On output, tie marks on tablature staffs are normally not printed, and the frets are not printed on the tied-to chord. If a tie goes across to a new score, the frets are printed, but in parentheses, to indicate the chord is really just the continuation of a tie. .H 2 "Slides" .P In Mup input, .Ix hX slides are shown with <>, rather like .Hr noteattr.html#nslur slurs on non-tablature staffs. There is a special variation used for slides that come from nowhere in particular or go to nowhere in particular. These are shown with <\en>, </n>, <n\e>, or <n/>. A slide is indicated on output on tablature staffs as a slanted line between 2 fret numbers on a string. On tabnote staffs, they as drawn as a slanted line between 2 notes. See the examples below: .Ex 1 .\"score staffs=2 .\"leftmargin=1.5 ; rightmargin=1.5 .\"staff 2 stafflines=tab .\"music 2: a5<>; a6; d3<>; d2; bar 2: b4</n>; e3<\en>; a2<n/>; e'5<n\e>; bar .Ee .H 2 "Bends" .P A bend (stretching a string to make it sound higher than normal) .Ix hW is specified on tablature staffs by putting a text string after the string. The text string can be the word "full" or a number and/or fraction. Some examples: .Ex 1 .\"score staffs=2 .\"leftmargin=2 ; rightmargin=2 .\"staff 2 stafflines=tab .\"music 2: e4 "full"; e "1/2"; 2e "1 1/2"; bar .Ee .P If you want to bend back down to having no bend (a release), the text string specifying the bend is just an empty string of "". Note that if both a fret and bend other than "" are specified, .Hm prebend this indicates a prebend, whereas if only a bend is specified, this indicates a normal bend. .P Bends need not be a whole number of half steps, but if you specify a bend that falls between half steps, when it is used on the tabnote staff, the bend is rounded to the nearest half step, or rounded downward if it is exactly in the middle of a half step. When possible, bends of 1/4 step or less are shown on the tabnote staff by a small curve rather than by a separate note. .P You can specify bends on more than one string at once, but a continuation bend (bending to a new distance without replucking the string) is only allowed on a single string at a time. Here are some examples: .Ex 1 .\" score staffs=2 .\" leftmargin=1.7; rightmargin=1.7 .\" staff 2 stafflines=tab .\" music .\" 2: g0b2e'0; e' "1/2" g "full" b "3/4"; e' ""; a2; bar 2: a "1/2"; a "full"; a "1/2"; a ""; bar .Ee .P If you have more than one voice on a tablature staff, bends on other than the top voice may collide with other voices in some cases, and if there are bends from more than one voice simultaneously, they may collide. .P On non-tablature staffs, bends are specified with a ^ symbol followed by the note to bend to. The note to bend to is specified by letter and optional octave (accidentals are not specified). If you want just a small bend (1/4 step), this is specified by ^/. For example: .Ex 1 .\"score .\"leftmargin=2 ; rightmargin=2 .\"music 1: e ^f; f; b ^c5; c#5; bar 1: d+^e+ g^a; e+a; g ^/; c ^/ c+^/; bar .Ee .H 2 "Miscellaneous" .P Note attributes of ~ for tie, ? for a small note, and = for a tag work the same on tablature staffs as on non-tablature staffs. .P If bm, ebm, esbm, abm, or eabm are given on tablature staffs they are transferred to the tabnote staff and used for .Ix dI .Hr ichdattr.html#custbeam custom beaming or automatic beaming there, as appropriate. .Ix fZ .Hr chrdattr.html#withlist Items in "with" lists inside [ ] are also copied to the tabnote staff. In general, unless otherwise specified here, if you want items such as .Hr stuff.html tempo and dynamic marks to appear on both tablature and tabnote staff, you have to specify them for both staffs. .P The .Hr ichdattr.html#alt \&"alt" inter-chord attribute is not allowed on tablature staffs. .P When there is a tablature staff, the .Hr midi.html MIDI is actually generated from the tabnote staff. There are some limitations. Currently, no MIDI pitch bends are generated; slides and bends are instantaneous rather than gradual. .P If a .Ix hV capo is being used, it probably better to declare a .Ix fB .Hr trnspose.html transposition of the tabnote staff rather than declaring the strings to be different notes. This is because most people would rather think of the original string letters when entering the tab staff information; and if you decide to put the capo on a different fret later, you only have to change the "transpose" line. .Hr tabstaff.html#autotran The automatic MIDI octave transposition for standard guitar will also then still apply, on top of your transposition. .P If you specify an .Hr octave.html octave mark (discussed in a later section) on a tabnote staff, the derived music will be printed with the notes raised or lowered the appropriate number of octaves to correspond to the given octave mark interval. .P Since ties are not printed on tablature staff, and input notation for tablature slides is like what is used for slurs on ordinary staffs, if you want a curved line like a tie or slur on a tablature or tabnote staff, you have to use a phrase mark. See the section on .Hr phrase.html phrase marks for more details. .P The chord-at-a-time input style can also be used for tablature. The staffs being mapped to from a single input line must either be all tablature or all non-tablature, however. .Ex 1 score staffs=4 .\" leftmargin=2.2 .\" rightmargin=2.2 brace=1-2, 3-4 .\" scale=0.9 tabwhitebox=y staff 2 stafflines=tab staff 4 stafflines=tab music // The first two notes in each chord go to staff 2, // and the last two go to staff 4. [ 2; 2; 4; 4] : a2d0 g0b3; e'0a2 g0e0; 2 e'0d2 b0e3; bar .Ee .Ht Shaped notes .Hd shaped.html .H 1 "SHAPED NOTES" .P If you intend to only use the usual system of noteheads, you can skip over this section on shaped notes. .Ix jG If you wish to use less common notehead shapes, like X-shaped notes, rather than normal noteheads, or want "shaped note" music that is often used for "Sacred Harp" style music, sometimes also called "fasola notation," then this section will explain how you can do that. .Hh hdshape .H 2 "Headshapes context" .P The headshapes context is used in conjuction with the .Hr param.html#notehead noteheads parameter to determine what shapes will be used when printing noteheads. It is rarely necessary to include a headshapes context in your music, since Mup already has the most common values built in, so generally you just need to use the .Hr param.html#notehead noteheads parameter to access them. However, it is still important to understand what the headshapes context can contain, to understand how the built-in values work. .P The headshapes context defines, for a given head shape name, what specific notehead characters to use for the notes of various durations. It contains one or more pairs of strings. The first string in the pair gives a name for a set of notehead shapes. The second string contains a space-separated list of the names of 4, 5, or 6 notehead characters to use for that head shape name. The first shape in the list is used for quarter notes and shorter, the second for half notes, the third for whole notes, and the fourth for double whole notes. If there is a fifth, that is used for quadruple whole notes. If there is a sixth, that is used for octuple whole notes. .P If an upside-down version of the character is to be used for stem-down notes, the name is prefixed by "u?" (The "u" stands for "upside-down" and the question mark is intended to be mnemonic for the fact that the upside-down version will only be used part of the time, namely for stem-down notes.) .P As was mentioned above, the most common mappings are already built into Mup. Here is the list of the pre-defined values. Pay particular attention to the first string on each line, since those are the names you will use in the .Hr param.html#notehead noteheads parameter and for .Hr shaped.html#chord overriding chord and .Hr shaped.html#note note shapes. .br .ne 3i .TS l l. \&"norm" "4n 2n 1n dblwhole quadwhole octwhole" \&"x" "xnote diamond diamond dwhdiamond quadwhole octwhole" \&"allx" "xnote xnote xnote xnote xnote xnote" \&"diam" "filldiamond diamond diamond dwhdiamond quadwhole octwhole" \&"blank" "blankhead blankhead blankhead blankhead" \&"righttri" "u?fillrighttriangle u?righttriangle u?righttriangle u?dwhrighttriangle quadwhole octwhole" \&"isostri" "fillisostriangle isostriangle isostriangle dwhisostriangle quadwhole octwhole" \&"rect" "fillrectangle rectangle rectangle dwhrectangle quadwhole octwhole" \&"pie" "fillpiewedge piewedge piewedge dwhpiewedge quadwhole octwhole" \&"semicirc" "fillsemicircle semicircle semicircle dwhsemicircle quadwhole octwhole" \&"slash" "fillslashhead slashhead slashhead dwhslashhead quadwhole octwhole" \&"allslash" "fillslashhead fillslashhead fillslashhead fillslashhead fillslashhead fillshlashhead" .TE .P You can redefine these or define new ones if you wish. The name (the first of the two strings in the pair) can be almost anything you want. The four to six names in the second string must be taken from the list of valid notehead characters given below, or be characters you have defined yourself and for which you have provided a ystemoffset value (described in the .Hr udefsym.html section on user-defined symbols). .br .Hi .ne 3i .TS center; l l l. 4n 2n 1n dblwhole quadwhole octwhole filldiamond diamond dwhdiamond fillisostriangle isostriangle dwhisostriangle fillpiewedge piewedge dwhpiewedge fillrectangle rectangle dwhrectangle fillrighttriangle righttriangle dwhrighttriangle ufillrighttriangle urighttriangle udwhrighttriangle fillsemicircle semicircle dwhsemicircle fillslashhead slashhead dwhslashhead xnote altdblwhole blankhead .TE .He .ig <PRE> 4n 2n 1n dblwhole quadwhole octwhole filldiamond diamond dwhdiamond fillisostriangle isostriangle dwhisostriangle fillpiewedge piewedge dwhpiewedge fillrectangle rectangle dwhrectangle fillrighttriangle righttriangle dwhrighttriangle ufillrighttriangle urighttriangle udwhrighttriangle fillsemicircle semicircle dwhsemicircle fillslashhead slashhead dwhslashhead xnote altdblwhole blankhead </PRE> .. The righttriangle shape names can be prefixed by u? when used in the headshapes context, to indicate the upside-down version of them should be used when the stem is down. Note that u? cannot be used on any other notehead characters, since none of the others have a corresponding upside-down version. .P As an example of how you could use the headshapes context, suppose you wished to use xnote for half notes and shorter, and diamond for longer notes. That is different than either of the built-in values "x" or "allx," but you could override one of them: .Ex headshapes "x" "xnote xnote diamond diamond" .Ee .P Another common case is if you want to use the alternate double whole note symbol. There are two very commonly used forms for double whole. One has a single vertical line on either side of an ellipse, the other has two vertical lines. Mup uses the one-line form by default, but if you prefer the two-line form, you can get that via: .Ex headshapes "norm" "4n 2n 1n altdblwhole" .Ee .P The blankhead does not print any head at all, it just leaves space as if there were a notehead. It might be used if for some reason you just want stems. .H 2 "Noteheads parameter" .P .Hr param.html#notehead The noteheads parameter describes which notehead shape to use for each pitch in the scale. It can be specified in score, staff, or voice contexts. If you want to use the same shape for all pitches, (as is the case with standard notation), only one shape name is specified. Thus the default value for this parameter is .Ex noteheads = "norm" .Ee .P If you want to use different shapes for different pitches, the noteheads value needs to be a string containing a list of 7 shape names. They are listed from the "tonic" of the major key up the scale, with the key based on the number of sharps or flats in the .Hr param.html#key key signature. The shape names must be from the list of pre-defined head shapes (norm, xnote, diam, blank, righttri, isostri, rect, pie, semicirc, slash), or names that you have given as the first in a pair of strings in the headshapes context. .P You can get the most common shaped note system using 4 shapes using: .Ex noteheads = "righttri norm rect righttri norm rect diam" .Ee There are several shaped notes systems using 7 different shapes. One such system is specified by: .Ex noteheads = "isostri semicirc diam righttri norm rect pie" .Ee .P Once the noteheads parameter is set, you specify your music just like you would for standard notation, but Mup will use the appropriate noteheads based on your specifications. .P .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 // Use a 7-shaped system. noteheads = "isostri semicirc diam righttri norm rect pie" // Noteheads are given in order for the major key, // so we'll start out with an example in major. key = d major music // Do a descending scale in D major 1: d+;c+;b;a; bar 1: g;f;e;d; dblbar score // Now we switch to D minor, where the "tonic" // will start at the rect and then wrap around. key = d minor music // Do a descending scale in D minor 1: d+;c+;b;a; bar 1: g;f;e;d; bar .Ee .Hh chord .H 2 "Overriding chord noteheads" .P It is possible to override what note shape to use for a chord, by giving "hs" followed by a head shape name from the headshapes context, inside square brackets. Thus .Ex [hs "righttri"] .Ee would use the "righttri" headshape. The specific character to use would be based on the group's duration. In other words, if the chord was a quarter note or shorter, the "fillrighttriangle" notehead would be used, but if the chord was a half or whole note, a "righttriangle" notehead would be used, and a "dwhrighttriangle" would be used for a double whole note. .P The hs specification can be used along with other things that can go in the square brackets. For example, .Ex [hs "blank"; len 0] .Ee would use blankheads and no stem, resulting in no chord being printed at all! .Hh note .H 2 "Overriding individual noteheads" .P If you want to override the notehead shape to be used for one specific note in a chord, you use hs followed by the head shape name as a string after the note. .Ex 1 .\" score .\" leftmargin=2 .\" rightmargin=2 .\" music 1: cg e+ hs "diam"; f a hs "x" c+; 2ge+; bar .Ee .H 2 "Putting it all together to use shaped notes" .P In summary, notehead shapes can be specified in five different places: per note, per chord, in voice context, in staff context, and in score context. When deciding what notehead shape to use, Mup checks for specifications in that order, using the first it finds. .P Since fret numbers are used rather than noteheads on .Hr tabstaff.html tablature staffs, the only head shape name that is allowed is "allx." which is used for "muffled" notes. .P Here is a simple example of shaped notes, using the common 4-shape system. .Ex 1 score .\" leftmargin=2.5 .\" rightmargin=2.5 noteheads = "righttri norm rect righttri norm rect diam" staffs=4 key=2# bracket=1-4 staff 3 clef=treble8 staff 4 clef=bass music 1: 2c+;4d+;e+; 2: 2e;4a;f; 3: 2e;4f;c; 4: 2a-;4f-;a-; bar 1: 1d+; 2: 1f; 3: 1d; 4: 1d; endbar .Ee .P Here is an example of using the same notehead shape for all pitches, illustrating how the proper version\(emfilled or open\(emof the notehead is used, based on the note's duration. .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 .\" label="" time=8/4 beamstyle=2,2,2,2 music 1: 8cf;;4;2;1; bar score noteheads="isostri" music 1: 4ec+;8;;2;1; bar score noteheads="rect" music 1: 1gc+;4;2;8;; bar score noteheads="pie" music 1: 8cf;;4;2;1; bar score noteheads="x" music 1: 4ec+;8;;2;1; bar score noteheads="slash" music 1: 1gc+;4;2;8;; bar .Ee .P And finally, here is a somewhat silly example that demonstrates how you can use the various shaped notes features to get any kind of notehead that Mup supports anywhere you want. .Ex 1 .\" score .\" leftmargin=1.7 .\" rightmargin=1.7 headshapes // Make some user-defined head shapes. // These combinations don't really make sense; // they are just to demonstrate what you can do. "reg" "4n 2n 2n 2n" "other" "fillrectangle diamond isostriangle dblwhole" score // Set notesheads, using an arbitrary mixture of built-in // and user-defined head shapes. noteheads="norm reg other reg reg other righttri" music 1: c;d;2e; bar 1: 2g;f; bar 1: {b;a;g;}3;2c+; bar 1: 1d; bar // do some shape overrides, both on group and note 1: [ hs "pie" ]2ce; [hs "isostri"] c e g hs "righttri"; endbar .Ee .Ht Text Strings .Hd textstr.html .H 1 "TEXT STRINGS" .P Text strings are used in many different ways. A text string is enclosed in double quotes, and can contain any combination of letters, numbers, spaces, and punctuation. It can contain a \en to indicate a newline or \eb to indicate a backspace, .Ix bI but otherwise cannot contain tabs or other control characters. If you want a double quote mark inside a string, it has to be preceded by a backslash, to indicate it is not ending the string: .Ex \&"A \e"word\e" in quotes" .Ee .P If you want an actual backslash in a string, it must be entered as two backslashes. .P .Hm strcat You can concatenate strings with a + sign. Thus the following are equivalent: .Ix jM .Ex \&"this is a string" \&"this is " + "a string" .Ee .Hh symlist .H 2 "Special characters" .P A string can also contain special music characters. These are specified by \e(\fIxxx\fP), where the \fIxxx\fP is a name from the following table: .Hi .TS center; l l l. type name music symbol _ clef gclef G clef (treble clef) .Ix fI fclef F clef (bass clef) cclef C clef (used for alto clef, tenor clef, etc.) time sig com common time .Ix gT cut cut time accidental flat flat .Ix bL .Ix fC dblflat double flat sharp sharp dblsharp double sharp nat natural note 4n quarter (and shorter) note notehead .Ix hL 2n half note notehead 1n whole note dblwhole double whole note altdblwhole alternate double whole quadwhole quadruple whole note (longa) octwhole octuple whole note (maxima) dn2n half note with stem down .Ix hI dn4n quarter note with stem down dn8n eighth note with stem down dn16n 16th note with stem down dn32n 32nd note with stem down dn64n 64th note with stem down dn128n 128th note with stem down dn256n 256th note with stem down up2n half note with stem up up4n quarter note with stem up up8n eighth note with stem up up16n 16th note with stem up up32n 32nd note with stem up up64n 64th note with stem up up128n 128th note with stem up up256n 256th note with stem up .Ix dH upflag upward flag dnflag downward flag notehead xnote X-shaped notehead .Ix bS diamond open diamond-shaped notehead .Ix bT filldiamond filled diamond-shaped notehead dwhdiamond double whole diamond-shaped notehead isostriangle open isosceles triangle notehead fillisostriangle filled isosceles triangle notehead dwhisostriangle double whole isosceles triangle notehead piewedge open piewedge notehead fillpiewedge filled piewedge notehead dwhpiewedge double whole piewedge notehead rectangle open rectangle notehead fillrectangle filled rectangle notehead dwhrectangle double whole rectangle notehead righttriangle open right triangle notehead fillrighttriangle filled right triangle notehead dwhrighttriangle double whole right triangle notehead urighttriangle upside-down open right triangle notehead ufillrighttriangle upside-down filled right triangle notehead udwhrighttriangle upside-down double whole right triangle notehead semicircle open semicircle notehead fillsemicircle filled semicircle notehead dwhsemicircle double whole semicircle notehead slashhead open slash notehead fillslashhead filled slash notehead dwhslashhead double whole slash notehead blankhead blank notehead rest owhrest octuple whole rest qwhrest quadruple whole rest dwhrest double whole rest .Ix hC 1rest whole rest 2rest half rest 4rest quarter rest 8rest eighth rest 16rest sixteenth rest 32rest thirty-second rest 64rest sixty-fourth rest 128rest 128th rest 256rest 256th rest pedal begped begin pedal mark .Ix fL endped end pedal mark pedal pedal up/down mark ornaments tr trill .Ix bX .Ix fS .Ix gD mor mordent invmor inverted mordent .Ix gE turn turn invturn inverted turn misc ferm fermata uferm upside-down fermata acc_gt accent like a greater-than sign .Ix bK acc_hat accent like a "hat" (circumflex or "up-arrow") acc_uhat accent like an upside-down hat leg legato mark .Ix bV .Ix gX dot dot wedge wedge uwedge upside-down wedge sign sign for D. S. .Ix hN coda coda mark upbow up bow dnbow down bow rr "railroad tracks" or caesura (2 slanted lines sometimes put at the top of a staff to indicate the end of a musical thought) measrpt measure repeat .Ix dZ .Ix hE .Ix bO dblmeasrpt double measure repeat quadmeasrpt quadruple measure repeat copyright C-in-circle copyright symbol dim diminished .Ix iQ halfdim half diminished triangle triangle perfmaior perfectum maior perfminor perfectum minor imperfmaior imperfectum maior imperfminor imperfectum minor perfmaiordim perfectum maior diminutum perfminordim perfectum minor diminutum imperfmaiordim imperfectum maior diminutum imperfminordim imperfectum minor diminutum .TE .He .ig .H 3 Clef <PRE> gclef G clef (treble clef) fclef F clef (bass clef) cclef C clef (used for alto clef, tenor clef, etc.) </PRE> .H 3 Time Signature <PRE> com common time cut cut time </PRE> .H 3 Accidentals <PRE> flat flat dblflat double flat sharp sharp dblsharp double sharp nat natural </PRE> .H 3 Notes <PRE> dn2n half note with stem down dn4n quarter note with stem down dn8n eighth note with stem down dn16n 16th note with stem down dn32n 32nd note with stem down dn64n 64th note with stem down dn128n 128th note with stem down dn256n 256th note with stem down up2n half note with stem up up4n quarter note with stem up up8n eighth note with stem up up16n 16th note with stem up up32n 32nd note with stem up up64n 64th note with stem up up128n 128th note with stem up up256n 256th note with stem up upflag upward flag dnflag downward flag </PRE> .H 3 Noteheads <PRE> 4n quarter (and shorter) note notehead 2n half note notehead 1n whole note dblwhole double whole note altdoublewhole alternate double whole quadwhole quadruple whole note (longa) octwhole octuple whole note (maxima) xnote X-shaped notehead diamond open diamond-shaped notehead filldiamond filled diamond-shaped notehead dwhdiamond double whole diamond-shaped notehead isostriangle open isosceles triangle notehead fillisostriangle filled isosceles triangle notehead dwhisostriangle double whole isosceles triangle notehead piewedge open piewedge notehead fillpiewedge filled piewedge notehead dwhpiewedge double whole piewedge notehead rectangle open rectangle notehead fillrectangle filled rectangle notehead dwhrectangle double whole rectangle notehead righttriangle open right triangle notehead fillrighttriangle filled right triangle notehead dwhrighttriangle double whole right triangle notehead urighttriangle upside-down open right triangle notehead ufillrighttriangle upside-down filled right triangle notehead udwhrighttriangle upside-down double whole right triangle notehead semicircle open semicircle notehead fillsemicircle filled semicircle notehead dwhsemicircle double whole semicircle notehead slashhead open slash notehead fillslashhead filled slash notehead dwhslashhead double whole slash notehead blankhead blank notehead </PRE> .H 3 Rests <PRE> owhrest octuple whole rest qwhrest quadruple whole rest dwhrest double whole rest 1rest whole rest 2rest half rest 4rest quarter rest 8rest eighth rest 16rest sixteenth rest 32rest thirty-second rest 64rest sixty-fourth rest 128rest 128th rest 256rest 256th rest </PRE> .H 3 Pedal <PRE> begped begin pedal mark endped end pedal mark pedal pedal up/down mark </PRE> .H 3 Ornaments <PRE> tr trill mor mordent invmor inverted mordent turn turn invturn inverted turn </PRE> .H 3 Miscellaneous <PRE> ferm fermata uferm upside-down fermata acc_gt accent like a greater-than sign acc_hat accent like a "hat" or ^ (circumflex or "up-arrow") acc_uhat accent like an upside-down hat leg legato mark dot dot wedge wedge uwedge upside-down wedge sign sign for D. S. coda coda mark upbow up bow dnbow down bow rr "railroad tracks" or caesura (2 slanted lines sometimes put at the top of a staff to indicate the end of a musical thought) measrpt measure repeat dblmeasrpt double measure repeat quadmeasrpt quadruple measure repeat copyright C-in-circle copyright symbol dim diminished halfdim half diminished triangle triangle perfmaior perfectum maior perfminor perfectum minor imperfmaior imperfectum maior imperfminor imperfectum minor perfmaiordim perfectum maior diminutum perfminordim perfectum minor diminutum imperfmaiordim imperfectum maior diminutum imperfminordim imperfectum minor diminutum </PRE> .. .Hi .SK .if \n(.P \{ .ie \n(.g \{ .nr Boxpict 0 .nr Nn 0 .Pt muschar.ps .nr Boxpict 1 .nr Nn 1 .nop \} .el \{ \!x X PI:\n(.o:\n(.i:\n(.l:\n(.t:muschar.ps:9,6.3,0,0:t: \ \ \ \} .He .ig <BR> <IMG SRC="muschar.gif" ALT="music characters"> <BR> .. .P Any of these music character names can be prefixed by "sm" to indicate a smaller version of the character. For example, "smup4n" is a small quarter .Ix gY note, as might be used for a "cue" note. .Ix bB .Ix hL Small music characters are 0.65 times as big as regular characters. .P .Hm special Various non-ASCII characters can be included in text strings. If you have a non-United States keyboard which can produce characters listed in the table below from the "Latin-1" alphabet, you can simply type them into strings as you normally would. If you want a character that your keyboard does not support, you can put them in strings by using their names in a manner similar to the music characters. For example, you can include an "a" with an acute accent on it in .Ix bK .Ix hB a string by using \e(aacute), or an upside-down question mark using \e(questiondown). .P There are 2-character shortcut names for many of the letters with diacritical marks. The shortcut names consist of the letter and a character representing the diacritical mark. So, for example, \e(aacute) can also be specified by just \e(a'), \e(Egrave) can also be specified by \e(E`), \e(ntilde) can be specified as \e(n~), and \e(Ocircumflex) can be specified as \e(O^). The following table lists the diacritical mark names, their shortcut symbols, and the list of available shortcut names using those symbols: .TS center, allbox; l c l. acute ' A' a' C' c' E' e' I' i' L' l' N' n' O' o' R' r' S' s' U' u' Y' y' Z' z' breve ( A( a( E( e( G( g( I( i( O( o( U( u( caron v Cv cv Dv dv Ev ev Lv lv Nv nv Rv rv Sv sv Tv tv Zv zv cedilla , C, c, S, s, circumflex ^ A^ a^ C^ c^ E^ e^ G^ g^ H^ h^ I^ i^ J^ j^ O^ o^ S^ s^ U^ u^ W^ w^ Y^ y^ dieresis : A: a: E: e: I: i: O: o: U: u: Y: y: dotaccent . C. c. E. e. G. g. I. A. z. grave ` A` a` E` e` I` i` O` o` U` u` macron - A- a- E- e- I- i- O- o- U- u- ogonek c Ac ac Ec ec Ic ic Uc uc ring o Ao ao Uo uo slash / L/ l/ O/ o/ tilde ~ A~ a~ I~ i~ N~ n~ O~ o~ U~ u~ .TE .P There are also a few special case shortcut names: .TS center, allbox; l c. germandbls ss quotedblleft `` quotedblright '' guillemotleft << guillemotright >> .TE .P The following charts list the full names of all of the available named characters, and shows what they look like. .Hi .nr Boxpict 0 .sp -6 .Pt ext_1.ps .sp -6 .Pt ext_2.ps .sp -6 .Pt ext_3.ps .sp -6 .Pt ext_4.ps .nr Boxpict 1 .He .ig <P> <IMG SRC="ext_1.gif" ALT="extended characters"> </P> <P> <IMG SRC="ext_2.gif" ALT="extended characters"> </P> <P> <IMG SRC="ext_3.gif" ALT="extended characters"> </P> <P> <IMG SRC="ext_4.gif" ALT="extended characters"> .. .P .Hm space One of the special characters is specified by \e(space). .Ix gZ This character appears as a normal space on output, but is not treated like a space when Mup is looking for word or syllable boundaries. The most common use for this is probably in .Hr lyrics.html lyrics when you want several words to be sung on a single note. Another use would be in cases where Mup would normally split up a long string between words in order to avoid running off the edge of a page, but you want to prevent that split. .Hh keymaps .H 2 "Keymaps" .P Typing in the names for the non-ASCII characters can become tedious, so if you are using some of them often, .Ix jL defining a keymap may be helpful. The keymap context is typically used to take the letters you type in, and map them to some other alphabet, but it could be used for other kinds of mapping inside strings as well. You can define up to 100 different keymaps, and you can assign different mappings to different kinds of text. You give each keymap a name, and then can set parameters to that name to cause mapping. .P A keymap context begins with a line with the word "keymap," followed by a string in double quotes, giving a name for the map. The name can be anything you like. This is followed by lines containing pairs of strings. The first in each pair is a pattern to be matched, and the second is the replacement. The pattern strings can only contain letters (uppercase or lowercase) and the equals sign. The replacement strings can only contain regular characters or the special named characters of the form \e(XXX). They cannot contain other "backslash escapes" like changes in font or size. Mapping is done as strings are parsed, not when they are printed. .P As an example, you could set up a mapping to allow something close to phonetic spelling on an English keyboard, but have the results come out in Cyrillic. The Mup distribution has an "include" file for one possible mapping of the full Cyrillic alphabet, but as a small example, to get the Russian word for "song" you could do .Ex 1 keymap "Russian" // map approximate phonetic equivalents to their Cyrillic symbols "e" "\e(afii10070)" "n" "\e(afii10079)" "p" "\e(afii10081)" "s" "\e(afii10083)" "q" "\e(afii10097)" score .\" leftmargin=2 .\" rightmargin=2 defaultkeymap="Russian" .\" fontfamily=courier music // enter Russian string phonetically title "pesnq" .\" block .\"paragraph "" .Ee .P In the previous example, the text string to be matched was only a single character, and the replacement string was also a single character, albeit one that normally has to be specified by a long name. Either or both can actually be multiple characters. So you could do something like .Ex keymap "names" "Ted" "Theodore" "Liz" "Elizabeth" .Ee and then "Ted and Liz" would become "Theodore and Elizabeth" .P As another example, suppose you want to use various styles of arrows in different places, and would like to have shorter names. You could do something like this: .Ex 1 keymap "arrows" "=l" "\e(arrowleft)" "=r" "\e(arrowright)" "==l" "\e(arrowdblleft)" "==r" "\e(arrowdblright)" "=ll" "\e(arrowleft)\e(arrowleft)" "=rr" "\e(arrowright)\e(arrowright)" score .\" leftmargin=3 .\" rightmargin=3 defaultkeymap="arrows" block paragraph "=r between arrows =l"; paragraph "==r between double arrows ==l"; paragraph "=rr between pairs of arrows =ll"; .Ee .P Patterns are matched left to right, using the longest pattern that matches. Thus for a pattern/replacement list of .Ex "a" "X" "b" "Y" "ab" "Z" .Ee the string "abba" would become "ZYX" .P There are a number of parameters that specify what kind of text strings to map. These parameters are: .TS center, allbox; c c l l. PARAMETER WHEN USED _ defaultkeymap when nothing else applies endingkeymap text on endings labelkeymap staff and group labels lyricskeymap lyrics printkeymap print, left, right, center, title rehearsalkeymap user-defined rehearsal marks textkeymap rom, ital, bold, boldital withkeymap "with" lists on chords .TE .P Having these different parameters generally makes it easy to do things like set a mapping for lyrics and titles, but leave musical directions like "Allegro" unmapped. To determine which mapping to use, Mup first looks up the specific parameter, and if that is not set, then it will fall back to using the value of the defaultkeymap parameter. Thus, for example, if you wanted only lyrics to be in Greek, with everything else left unmapped, you could define a Greek keymap and set .Ex lyricskeymap="Greek" .Ee Or if you wanted everything except "with" lists to be Cyrillic, you could do something like .Ex defaultkeymap="Cyrillic" withkeymap="" .Ee Note that the special name "" is used to mean "no mapping." You can also set these parameters to nothing at all, which effectively "unsets" them. So if you later wanted "with" lists to also be in Cyrillic like everything else, you could just do .Ex withkeymap= .Ee which basically "unhides" the defaultkeymap value that had been overridden by the withkeymap value. .P It is possible to change keymaps in the middle of a string by using \em(keymap_name). This might be used if you want just part of a sentence in a different alphabet: .Ex "This would be written \em(Russian)pesnq \em() in Russian." .Ee As shown, an empty keymap name of \em() means to return to normal literal text, without any mapping. .Hh fonts .H 2 "Font and size changes" .P Strings can contain special codes to indicate changes in font or size. .Ix bG .Ix bH The font codes begin with \ef, and can either be spelled out, as in the first column of the table below, or as the abbreviations given in the second column. .Hi .DS .TS center; c c c l l l. Code Abbr Meaning _ \ef(avantgarde rom) \ef(AR) change to \f(ARAvant Garde roman font\fP \ef(avantgarde bold) \ef(AB) change to \f(ABAvant Garde bold font\fP .Ix gH .Ix gI .Ix gJ .Ix gK \ef(avantgarde ital) \ef(AI) change to \f(AIAvant Garde italic font\fP \ef(avantgarde boldital) \ef(AX) change to \f(AXAvant Garde bold-italic font\fP _ \ef(bookman rom) \ef(BR) change to \f(KRBookman roman font\fP \ef(bookman bold) \ef(BB) change to \f(KBBookman bold font\fP \ef(bookman ital) \ef(BI) change to \f(KIBookman italic font\fP \ef(bookman boldital) \ef(BX) change to \f(KXBookman bold-italic font\fP _ \ef(courier rom) \ef(CR) change to \f(CWCourier roman font\fP \ef(courier bold) \ef(CB) change to \f(CBCourier bold font\fP \ef(courier ital) \ef(CI) change to \f(CICourier italic font\fP \ef(courier boldital) \ef(CX) change to \f(CXCourier bold-italic font\fP _ \ef(helvetica rom) \ef(HR) change to \fHHelvetica* roman font\fP \ef(helvetica bold) \ef(HB) change to \f(HBHelvetica bold font\fP \ef(helvetica ital) \ef(HI) change to \f(HIHelvetica italic font\fP \ef(helvetica boldital) \ef(HX) change to \f(HXHelvetica bold-italic font\fP _ \ef(newcentury rom) \ef(NR) change to \f(NRNew Century roman font\fP \ef(newcentury bold) \ef(NB) change to \f(NBNew Century bold font\fP \ef(newcentury ital) \ef(NI) change to \f(NINew Century italic font\fP \ef(newcentury boldital) \ef(NX) change to \f(NXNew Century bold-italic\fP _ \ef(palatino rom) \ef(PR) change to \f(PAPalatino roman font\fP \ef(palatino bold) \ef(PB) change to \f(PBPalatino bold font\fP \ef(palatino ital) \ef(PI) change to \f(PIPalatino italic font\fP \ef(palatino boldital) \ef(PX) change to \f(PXPalatino bold-italic font\fP _ \ef(times rom) \ef(TR) change to Times* roman font \ef(times bold) \ef(TB) change to \fBTimes bold font\fP \ef(times ital) \ef(TI) change to \fITimes italic font\fP \ef(times boldital) \ef(TX) change to \f(BITimes bold-italic font\fP _ \ef(previous) \ef(PV) change back to previous font \ef(rom) \ef(R) change to roman in the current family \ef(ital) \ef(I) change to \fIitalics\fP in the current family \ef(bold) \ef(B) change to \fBbold\fP in the current family \ef(boldital) \ef(X) change to \f(BIbold italics\fP in the current family .TE .DE .FS * Times is a trademark and Helvetica is a registered trademark of Allied Corporation. .FE .He .ig <PRE> Code Abbr Meaning \f(avantgarde rom) \f(AR) Avant Garde roman font \f(avantgarde bold) \f(AB) Avant Garde bold font \f(avantgarde ital) \f(AI) Avant Garde italic font \f(avantgarde boldital) \f(AX) Avant Garde bold-italic font \f(bookman rom) \f(BR) Bookman roman font \f(bookman bold) \f(BB) Bookman bold font \f(bookman ital) \f(BI) Bookman italic font \f(bookman boldital) \f(BX) Bookman bold-italic font \f(courier rom) \f(CR) Courier roman font \f(courier bold) \f(CB) Courier bold font \f(courier ital) \f(CI) Courier italic font \f(courier boldital) \f(CX) Courier bold-italic font \f(helvetica rom) \f(HR) Helvetica* roman font \f(helvetica bold) \f(HB) Helvetica bold font \f(helvetica ital) \f(HI) Helvetica italic font \f(helvetica boldital) \f(HX) Helvetica bold-italic font \f(newcentury rom) \f(NR) New Century roman font \f(newcentury bold) \f(NB) New Century bold font \f(newcentury ital) \f(NI) New Century italic font \f(newcentury boldital) \f(NX) New Century bold-italic \f(palatino rom) \f(PR) Palatino roman font \f(palatino bold) \f(PB) Palatino bold font \f(palatino ital) \f(PI) Palatino italic font \f(palatino boldital) \f(PX) Palatino bold-italic font \f(times rom) \f(TR) Times* roman font \f(times bold) \f(TB) Times bold font \f(times ital) \f(TI) Times italic font \f(times boldital) \f(TX) Times bold-italic font \f(previous) \f(PV) previous font \f(rom) \f(R) change to roman in the current family \f(ital) \f(I) change to italics in the current family \f(bold) \f(B) change to bold in the current family \f(boldital) \f(X) change to bold italics in the current family </PRE> .. Some of the .Hr textstr.html#special special characters look better in some fonts than others. We have found that .Ix cE .Ix cF a few older PostScript interpreters unfortunately don't always implement all the special characters in all fonts, so if you have one of those, you may want to see if a newer version is available that corrects the problem. .P If you need a font other than those Mup supports directly, it is possible to override Mup's built-in fonts with other fonts. This is described later in the .Hr fontfile.html section on "Installing other fonts." .P .Hm size The point size can also be changed. (A "point" is about 1/72 of an inch.) .Ix bH .Hi .DS .TS center; c c l l. Code Meaning _ \es(\fIN)\fP change to point size \fIN\fP \es(+\fIN)\fP increase point size by \fIN\fP points \es(-\fIN)\fP decrease point size by \fIN\fP points \es(PV) or \es(previous) revert to previous size .TE .DE .He .ig <PRE> Code Meaning \s(\fIN)\fP change to point size \fIN\fP \s(+\fIN)\fP increase point size by \fIN\fP points \s(-\fIN)\fP decrease point size by \fIN\fP points \s(PV) or \s(previous) revert to previous size </PRE> .. The point size can range from 1 to 100. A font or size change will last until changed or until the end of the string. Any subsequent strings will begin with default font and size values, except in the case of .Hr lyrics.html lyrics, .Ix aE where font and size information is maintained separately for each staff and verse, and carried forward from measure to measure, and .Hr bars.html#reh rehearsal marks, where the information is also carried forward. .Ix cJ .Ix hG .Ix hK The default values can be set as described in .Hr param.html the "Parameters" section. The .Hr textstr.html#symlist music symbols are affected by size changes. If a music symbol follows a specification for italics, bold, or bolditalics, it will be slanted and/or made bold, as appropriate. .P Here are some examples of strings: .Ex \&"hello" \&"( \e(up2n) = 100 )" \&"\ef(TB)this will be bold. \ef(TI)this will be italics" \&"A \ef(TX)\es(+12)BIG\ef(PV)\es(-12) word" \&"\ef(newcentury boldital)Allegro" .Ee .H 2 "Horizontal and vertical motion" .P It is also possible to specify a string that takes up more than one line, by putting a "\en" where you want to move to a new line. The place where this is most likely to be useful is for .Hr param.html#label staff labels, .Ix dP which you may want to make multi-line, to keep them from becoming excessively wide. For example: .Ex \&"Violins\enI&II" .Ee .P .Ix bI A "\eb" can be used to specify a backspace. This might be useful for .Ix hO adding underlines to text. If you wish to use letters with diacritical marks, .Ix cR you will probably want to use the .Hr textstr.html#special special characters, described earlier in this section, rather than trying to construct them using the plain letter, a backspace, and the mark. .P You are not allowed to back up to before the beginning of a line. Note that in all fonts except Courier, different characters have different widths, so using backspaces can be a bit tricky. For example, underlining a 5-letter word might require more than 5 underscores, if the characters in the word .Ix fW are wider than an underscore character. In general, it works better to enter an entire string, then backspace to add underscoring or accents, rather than doing them along the way. For example, "My\eb\eb___" will line up much better than "M\eb_y\eb_". .P .Hm vert Vertical motion within a string can be specified using "\ev(\fIN\fP)" .Ix iR where \fIN\fP is some percentage of the current font height. The distance may be negative for downward motion or positive for upward motion, ranging from -100 to 100. .Ix iL This might be used for creating superscripts and subscripts, although the next section describes an alternate way of doing that which is usually better. It might also be used just to line something up differently than Mup normally would. You cannot put newlines (with \en) in the same string with vertical motion. .H 2 "Piled text, for superscripts, subscripts, etc." .P It is also possible to "pile up" lines of text in a string. Some common uses of this could be for superscripts and subscripts or for .Ix iN figured bass notation. Some facilities to specifically deal with .Hr textmark.html#chordmod figured bass will be described in a later section, but here we describe the general-purpose constructs for piling text. .Ix iO A \e: is used to indicate the beginning of piling. Any subsequent instances of \e: in the same string will alternately turn piling off and on. When a pile is begun, the text size is automatically made smaller, and the text baseline is moved up, so that the first line of piled text is like a superscript, and the next like a subscript. If there are additional lines, they are placed below the subscript. By default, the lines in a pile are placed such that the last digit in each line will line up, or if there is no digit, the last character. However, you can force different alignment. .Ix iP A \e| will force alignment at that point, or a \e^ will force alignment at the center of the following character. A maximum of one alignment marker can be specified on each line of a pile. You cannot put newlines (with \en) in the same string with piling. A new line of the pile is started at each <space> character in the input string. If you want an actual literal space inside a piled line, it must be preceded with a backslash. As an example: .Ex 1 .\" block .\" paragraph rom (18) \e "Text\e:superscript subscript\e: back to normal."; .\" paragraph rom (8) " " .\" paragraph rom (18) \e "This pile \e:has\e literal spaces\e in\e it."; .\" paragraph rom (8) " " .\" paragraph rom (18) \e "This pile \e:h\e^as align\e|ment spec\e^ified."; .Ee .H 2 "Slash through number" .P Another thing which is common in figured bass notation .Ix cA is to draw a slash through a number. Again, the section on .Hr textmark.html#chordmod figured bass will describe how to do that inside figured bass, but it is possible to put a slash through a number elsewhere by placing a backslashed slash after a number, like this: .Ex "6\e/" "10\e/" .Ee .Hh boxed .H 2 "Boxed or circled text" .P You can cause the text to be .Ix iG printed inside a box by placing a \e[ at the beginning of the string and a \e] at the end of the string. Similarly you can cause text to be placed inside a circle (or ellipse for strings that are wide) by placing a \e{ at the beginning of the string and a \e} at the end of the string. Boxed or circled text are not allowed in .Hr lyrics.html lyrics. .Ex 1 .\" block .\" paragraph rom (16) \e "\e[This is in a box\e]" .\" paragraph rom (20) " " .\" paragraph rom (14) \e "\e{This is in an ellipse\e}" .Ee .ig <HR> * Times is a trademark and Helvetica is a registered trademark of Allied Corporation. .. .Ht "Tempo, dynamic marks, ornaments, etc." .Hd stuff.html .H 1 "TEMPO, DYNAMIC MARKS, ORNAMENTS, ETC." .Ix fR .Ix fS .H 2 "General information" .P There are a number of symbols and other markings that appear frequently in music and are normally associated with a particular time or place in the .Ix gT composition. There are several classes of such symbols, all of which are handled by Mup in a somewhat similar fashion. The general format of these statements is: .Ex \fImark_type place staff(s) distance aligntag : begintime text duration;\fP .Ee .Ix dK .Ix fP .Ix hK .P The \fImark_type\fP can be any of the following: .Hi .DS .TS center; c c l l. Mark_type Meaning _ .Ix gH .Ix gI .Ix gJ .Ix gK rom text in roman font ital text in italic font bold text in bold font boldital text in bold-italic font .Ix fT mussym music symbol (fermata, coda sign, etc.) phrase phrase mark .Ix cL .Ix cM .Ix fJ .Ix gA < crescendo "hairpin" > decrescendo "hairpin" octave play 1 or more octaves higher or lower pedal piano pedal marks .Ix fL .TE .DE .He .ig <PRE> Mark_type Meaning rom text in roman font ital text in italic font bold text in bold font boldital text in bold-italic font mussym music symbol (fermata, coda sign, etc.) phrase phrase mark < crescendo "hairpin" > decrescendo "hairpin" octave play 1 or more octaves higher or lower pedal piano pedal marks </PRE> .. .Ix bG .P The \fIplace\fP is as for .Hr lyrics.html lyrics: above, below, or between. .Ix bJ .Ix dL .Ix dM There are some restrictions, as summarized below: .Hi .DS .TS center; c c s s c c c c c c l c c c l. place allowed mark_type above below between default _ rom yes yes yes above bold yes yes yes above ital yes yes yes above boldital yes yes yes above mussym yes yes yes above phrase yes yes no varies < yes yes yes above > yes yes yes above octave yes yes no none pedal no yes no below .TE .DE .He .ig <PRE> place allowed mark_type above below between default rom yes yes yes above bold yes yes yes above ital yes yes yes above boldital yes yes yes above mussym yes yes yes above phrase yes yes no varies < yes yes yes above > yes yes yes above octave yes yes no none pedal no yes no below </PRE> .. .P .Hr octave.html Octave marks must include a \fIplace\fP of above or below. For all the other mark_types, the \fIplace\fP is optional. For .Hr phrase.html phrase, if \fIplace\fP is not specified, Mup determines it on a case-by-case basis, depending on the location of the notes, unless the .Hr param.html#defphside defaultphraseside parameter is set to force a side. .P As with musical data or lyrics, the \fIstaff\fP can be a single number or may include lists and ranges. In the case of "between", staff numbers must be in pairs, separated by an "&", with the second staff number one greater than the first. .P The \fIstaff\fP can also be specified by the keyword "all," in which .Ix cQ .Ix gL case the mark will be placed above the top visible staff or below the .Ix gM .Ix gN bottom visible staff. .P Here are some examples: .Ex rom 3: boldital below 1: < between 3&4: pedal below 2: octave above 3: phrase 3,4: mussym above 2-3, 5: ital between 1&2, 3&4: .Ee .P .Hm dist The \fIdistance\fP is optional. It is specified by the keyword "dist" followed by a number. This number overrides the .Hr param.html#dist dist, .Hr param.html#chdist chorddist, or .Hr param.html#dyndist dyndist parameter value that would normally apply, and is given in stepsizes. If the number is followed by a ! the items will be placed at exactly that distance from the edge of the staff, without regard for anything they might overwrite. Otherwise the normal rules apply: the dist is a minimum value, and items may be placed farther away than this to avoid colliding with other things. If the ! is used, the number is allowed to be negative, which allows you to place items inside the staff. A dist cannot be specified with phrase or between. .Ex 1 score .\" leftmargin=1.5 .\" rightmargin=1.5 dist=2 music rom above 1: 1 "normal dist"; rom above 1 dist 4: 2 "dist 4"; // higher than usual rom above 1 dist 0! : 3 "forced 0"; // lower than normal mussym above 1 dist -2! : 4.5 "rr"; // forced down into staff 1: c;;;; endbar .Ee .P The \fIaligntag\fP is optional, and allows forcing several items to be placed at the same vertical position. This will be covered in more detail .Hr stuff.html#aligntag a bit later. .P After the colon comes one or more items to be printed. Each item contains at least a begintime specification. Some may also contain a .Ix dK .Ix hA .Ix hB .Hr textstr.html text string and/or a duration. Each item ends with a semicolon. A newline ends the list of items. .Ix hH .P The begintime describes where in time the item should be printed. It is a number ranging from 0 to the numerator (top number) .Ix gM of the .Hr param.html#time time signature .Ix gU plus one. 0 refers to the bar line at the beginning of the current measure, 1 refers to the first beat of the measure, 2 to the second beat, etc., with the .Ix dJ .Ix gG .Ix hG maximum value referring to the bar line which ends the measure. A "beat" is whatever time value is given by the denominator (bottom number) .Ix gN of the time signature. For example, in 4/4 or 3/4 time, a beat is a quarter note, whereas in 6/8 .Ix hL or 9/8 time, a beat is an eighth note. Fractional values can be specified using a decimal number. Thus 1.5 is halfway between beats 1 and 2, while 2.66 is about 2/3 of the way between beats 2 and 3. For .Hr param.html#time time signatures that are the addition of two or more fractions, like 4/4 + 3/8, a "beat" is given by the largest denominator. .P .Ix aL .Ix dJ .Ix hL Since grace notes effectively take zero time, special notation is used .Ix gT to place something relative to a grace note. The \fIbegintime\fP can be .Ix dK followed by a number of grace notes to "back up" from the beat. The number is a negative number enclosed in parentheses. .P The beat time value can optionally be followed by .Hm stepoff an offset, in stepsizes. This offset is a number in square brackets. The number must begin with a + or - sign. It can optionally include a decimal point and fractional part. A negative offset will cause the item to be moved to the left, while a positive offset will cause it to be moved to the right. This offset is used as a final adjustment after all the other placement has been done. A common use for this would be if you want to place something slightly before the beginning of the first measure of a song. You could then specify something like: .Ex rom above all: 0 [-3.5] "Allegro"; .Ee which would place the "Allegro" 3.5 stepsizes left of the beginning of the measure. .P The grace note backup, if any, must occur before the stepsize offset, if any. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music 1: c; [grace] 8d; []e; []f; 2.g; ital above 1: 2(-3)[+1] "cresc."; bar .Ee would find the chord at or closest to count 2, .Ix gW and back up 3 grace notes from there, then move right by 1 stepsize. .P For items that include a duration, the duration tells the ending point of the item. A duration is specified by: .Ex \fBtil\fP \fIM\fP\fBm\fP + \fIN\fP .Ee .Ix gV where \fIM\fP is a number of .Hr bars.html bar lines to cross, and \fIN\fP is a number of additional beats. (An "m" is used because it counts the number of measures.) If either of them is 0, it can be omitted, but at least one of them must be non-zero. .P This can optionally be followed by a grace backup and/or an offset, like the start time. The grace backup is a negative number in parentheses, telling how many grace notes to back up. The steps offset is a number in square brackets, which must begin with a + or - sign, and can optionally include a decimal point and fractional part. A negative offset will cause the item to be moved to the left, while a positive offset will cause it to be moved to the right. This offset is used as a final adjustment after all the other placement has been done. Here are some examples: .Ex til 3 // until beat 3 of current measure til 1m+2 // until beat 2 of next measure til 1m // until next bar line til 3m+2.8[-1.5] // 3 bar lines and 2.8 beats, then left 1.5 stepsizes .Ee .P Whether the text and duration are allowed or required depends on the mark_type, as summarized below: .Hi .DS .TS center, box; c|c|c l|l|l. mark_type text duration = rom required optional bold required optional ital required optional boldital required optional mussym required allowed on tr only phrase not allowed required < not allowed required > not allowed required octave required optional pedal * or nothing not allowed .TE .DE .He .ig <PRE> mark_type text duration rom required optional bold required optional ital required optional boldital required optional mussym required allowed on tr only phrase not allowed required < not allowed required > not allowed required octave required optional pedal * or nothing not allowed </PRE> .. .P If there are several items, such that they have to be stacked on top .Ix gM .Ix gN of each other, all items of a particular class are placed from top to bottom according to input order. The classes are done in the order shown in the table below, unless the order is overridden by the .Hr param.html#aboveord aboveorder, .Hr param.html#beloword beloworder, or .Hr param.html#betwnord betweenorder parameters. .Hi .DS .TS center, box; c|c l|l. Place mark_type order = above (from bottom up) .Ix bJ phrase .Ix fT .Ix gH .Ix gI .Ix gJ .Ix gK mussym octave rom bold ital boldital < > lyrics endings rehearsal marks _ below (from top down) phrase mussym octave rom bold ital boldital < > lyrics pedal _ between (from bottom up) .Ix dM mussym rom bold ital boldital < > lyrics .TE .DE .He .ig <PRE> above (from bottom up) phrase mussym octave rom bold ital boldital < > lyrics endings rehearsal marks below (from top down) .Ix dL phrase mussym octave rom bold ital boldital < > lyrics pedal between (from bottom up) mussym rom bold ital boldital < > lyrics </PRE> .. .P .Ix aE .Ix aQ .Ix aR For example, for the above items, all phrases will be placed as close to the staff as possible, then mussym items above them, then octave marks above .Ix hK them, etc. However, if there are several mussym items that belong at the same horizontal position, the first one entered in the input will be printed above the second, the second one entered will be printed above the third, etc. All of the "above all" items of a given class will be above the items of that class for the top visible staff, and all "below all" items of a given class will be below the items of that class for the bottom visible staff. .Ix cQ .P Additional control of placement can be imposed by the .Hm aligntag optional align tag. .Ix iP This is the keyword "align" followed by a number between 0 and 10000 inclusive. On a given score, all marks in the same placement order level and having the same align tag value will be placed together, so that they will all be aligned at the same vertical position. An align tag can only be applied to text (rom, ital, bold, boldital) and crescendo and decrescendo marks. It can also be used on pedal, but only when the .Hr param.html#alignped alignped parameter is set to n. Among marks with the same placement order level, those without alignment are placed first. Then those with alignment are placed, in ascending numerical order of the align tag. If any of the aligned marks also have a dist specified, the rightmost such dist applies to all with that alignment tag, otherwise the largest default distance is used. If any also have ! specified, to force an exact distance, that applies to all. .P If after placing a set of aligned marks, Mup determines that any of them overlap horizontally, it will squeeze the one on the left in an attempt to avoid the overlap\(emto a point. If some overlap remains even after squeezing as much as is allowed by the .Hr param.html#minalign minalignscale parameter, Mup will issue a warning. You can then adjust things yourself if you wish. .P Here is an example showing the impact of using alignment. The two measures are the same, except the second uses alignment tags. Note that since in this example only a single align tag value is used for above and one for below, there is no need for specifying an order among alignment tags, so the numeric values can be arbitrary. .Ex 1 score beamstyle=2,2 .\"leftmargin=1.5 .\"rightmargin=1.5 music rom above 1: 1 "Allegro con brio"; ital above 1: 3 "dolce"; 1: [with .]... 8g-;a-;b-;c;g;a;g;a; < below 1: 1 til 2.8; boldital dyn below 1: 3 "mf"; > below 1: 3.3 til 4.8; bar rom above 1 align 17: 1 "Allegro con brio"; ital above 1 align 17: 3 "dolce"; 1: [with .]... 8g-;a-;b-;c;g;a;g;a; < below 1 align 3: 1 til 2.8; boldital dyn below 1 align 3: 3 "mf"; > below 1 align 3: 3.3 til 4.8; bar .Ee .Hi .P We now discuss each of the mark_types in more detail. .He .ig .br .Hr textmark.html Text .br .Hr mussym.html Music symbols .br .Hr phrase.html Phrase marks .br .Hr cres.html Crescendo and decrescendo marks .br .Hr octave.html Octave marks .br .Hr pedal.html Piano pedal marks .br .Hr roll.html Rolls .. .Ht Mup Text Marks .Hd textmark.html .H 2 "Text" .P The four forms of Mup text statements (rom, bold, ital, and boldital) operate identically except for the font .Ix gH .Ix gI .Ix gJ .Ix gK .Ix bG which is used. .P The text statements can have several additional qualifiers. The first is a .Ix gB fontfamily, given before the font. It can have any of the values of .Hr param.html#fontfam the "fontfamily" parameter (avantgarde, bookman, courier, helvetica, newcentury, palatino, or times), with the default being the value of the "fontfamily" parameter. .P The next optional qualifier is a .Ix bH point size, given in parentheses after the font type of rom, bold, etc. If this is omitted, the size is obtained from .Hr param.html#size the "size" parameter for the given staff, or for the score if the staff is specified by "all." .Ix cQ .Ix hJ .Hh chordmod .H 3 "Chord, analysis, figured bass, and dynamics" .P The final optional qualifier specifies special treatment of the text. .Ix iM .Ix iN The qualifier can be "chord", "analysis", "figbass", or "dyn". .Ix gW The "chord" modifier is typically used for marking chords that might be played by a guitar or other instrument. The "analysis" modifier is typically used when marking harmonic analysis like "IV" or "vii". The "figbass" modifier is for figured bass notation. For all three, distance from the staff is affected by .Hr param.html#chdist the "chorddist" parameter. .Ix dO The "dyn" modifier is to mark the text as something that specifies dynamics. Mup only uses it when deciding where to place the text; something marked "dyn" will be treated like crescendo and decrescendo "hairpins." The default \fIplace\fP for chord and dyn is above, whereas the default for the others is below. .P The text strings used with these chord, analysis, or figbass modifiers can contain any characters, but characters that indicate accidentals ("#", "&", "x", "&&", and "n") .Ix fC are translated to the appropriate music character, while "o", "o/", .Ix iQ and "^" are translated to "\e(dim)", "\e(halfdim)", and "\e(triangle)" respectively. However, with "chord," the translation of "n" to natural sign is not done, so you have to use \e(nat) if you want a natural sign. This is because a literal letter "n" tends to occur more often in chords than natural signs. .P If you want to turn off the translation, to treat one of these characters literally, you can precede it with two backslashes. Thus, for example, "\e\e&" would yield a literal ampersand rather than a flat symbol. .P If the .Hr param.html#xpose transpose or .Hr param.html#addxpose addtranspose parameters are set, chords are transposed to match the new key: .Ix fB the letters "A" through "G" and any following accidentals will be transposed appropriately. The accidental can be either something like "#" or "&" or any of the special .Hr textstr.html#symlist music characters for accidentals (\e(sharp), \e(flat), etc.). If the staff is specified as "all," the score transposition value is used. Transposition has no effect on analysis or figbass. .P .Hr param.html#chordxlate The "chordtranslation" parameter can be used to translate chords to something like DO/RE/MI, or to apply the German usage of H for B, and B for B flat. .P In figbass, the string starts out in piled mode, which means that .Ix iO each space in the input string will cause a new line on output, and, .Ix iP unless you specify other alignment, each line will be aligned on the last digit in the line. Also, the meanings of / and \e/ are reversed from the normal meaning. This is done since .Ix cA drawing a slash through a number is very common in figured bass, so you can just use a / to indicate this, but if you really want a real slash, you can still get one by entering \e/. .P With all three special qualifiers, the usual meanings of : and \e: are reversed. This is because piling is very common in these strings, so it's handier to just put a : to indicate this, and for those rare cases when you want a literal colon, you can still get one by entering a \e:. .P Here is an example showing chord, analysis, and figbass: .Ex 1 .\"score .\" rightmargin=1.5 .\" leftmargin=1.5 .\" size=14 .\" chorddist=3 .\" label=" " .\"music .\" 1: egc+;dgb;dfa;dgb; bold chord above 1: 1 "C"; 2 "G"; 3 "Dm"; 4 "G"; rom analysis below 1: 1 "I"; 2 "V"; 3 "ii"; 4 "V"; bar 1: egc+;dgb;df#a;dgb; rom figbass below 1: 1 "6 3"; 2 "6 4"; 3 "3/"; 4 "6 4"; bar .\"newscore .\" 1: 1cegb; rom chord above 1: 1 "C^7"; bar 1: 1ce&g&b&; rom chord above 1: 1 "Co/"; bar 1: 1ce&g&b&&; rom chord above 1: 1 "Co:7"; bar 1: 1e&g&b&; rom chord above 1: 1 "E&m"; bar .Ee .P If a music symbol occurs inside an ital, bold, or boldital string, .Hm italmus the music symbol will automatically be made to match the rest of the string. .P It is possible to supply a duration on text statements. When this is done, .Ix fP Mup will draw a dashed line from the end of the text to the .Ix fF end of the duration. This may be useful if you want to indicate how long an action such as an accelerando or crescendo is to last. .Ix cL If the last character of the string is a "~", a wavy line will be drawn instead of a dashed line. .Ix dF If the last character of the string is an underscore, an underscore .Ix fW line will be drawn. .P Here are some examples of text: .Ex 1 .\"score leftmargin=2; rightmargin=2; key=3&; staffs=2 .\"staff 2 clef=bass .\"music 1: e;g;b;d+; 2: 2e;b-; rom (12) above 1: 0 "Andante ( \e(smup4n) = 88 )"; boldital (12) below 1: 1 "mf"; 3.5 "mp"; newcentury bold (12) chord above 1: 1 "E&7"; 3 "B&9"; ital between 1&2: 2 "rit."; palatino ital below 2: 2 "cresc." til 1m+2; bar 1: 1egc+; 2: 1c; bold (12) chord above 1: 1 "Cm"; bar .Ee .Hh grids .H 2 Grids .P If the .Hr param.html#gridused gridswhereused parameter is set to "y," chords will also have a grid printed. .Ix iW For this to work, a grid with the same name as the chord must be defined in "grids" context elsewhere in the input file. .P The grids context contains lines each consisting of two text strings. The first is the name of the chord, matching the name you want to use in printing text with the "chord" qualifier. The second describes the fret pattern for that chord. It is a space-separated list, with each list element being either a fret number from 1 to 99, which will result in a dot being printed at that fret, or an "o" or "x" which will result in a circle or x respectively being printed above the grid, or a "-" in which case no mark at all will be made. The fret pattern may also contain an open and closing parenthesis to mark where a curve is to be drawn, indicating the use of a single finger to span several strings. For example: .Ex 1 score .\" leftmargin=1.3 .\" rightmargin=1.3 gridswhereused=y gridfret=3 grids "C" " - 3 2 o 1 o " "C5" " - 3 x o 1 3 " "Em" " o 2 2 o o o " "A&" "(4 6 6 5 4 4)" "A11" " - o o o o o " music rom chord 1: 1 "C"; 2 "C5"; 3 "Em"; 1: 2c;e; bar rom chord 1: 1 "A&"; 3 "A11"; 1: 2a&;an; bar .Ee .P If .Hr param.html#xpose transposition is in effect, the chord names in the grids context have to match the transposed names. So, for example, if you use an "A" chord in a chord statement, then transpose the staff up a major second, Mup will look for and use the grid definition called "B" to match the transposed chord name. .P If you supply more than one grid definition for the same chord name, Mup uses the last one. This allows you to easily .Hr include.html \&"include" a file of standard chords, but override a few of them with a special fingering for a particular song. If you really want to use more than one fingering in different places in the same song for the same chord name, you need to make the names look different, so Mup will treat them as different chords. One way to do this would be to put a space and backspace in the name. So, for example, "Am" and "Am \eb" would count as separate chords and could have different grid definitions, but the chord names would still look the same on output. .Ht Music symbols .Hd mussym.html .H 2 "Mussym" .Ix fT .P While it is possible to place musical symbols such as fermatas and coda signs using .Hr textmark.html text statements, it is perhaps a bit confusing, since music symbols are really not part of any particular font. So there is a "mussym" statement that can be used. The text strings after the colon must each consist of a single musical symbol whose name can be given without the usual \e() wrapper. The following two lines produce identical results, but the second is perhaps a bit clearer: .Ex rom above 1: 1 "\e(ferm)"; mussym above 1: 1 "ferm"; .Ee .P A duration is not allowed on mussym statements .Ix fP except in one special case\(emif the .Ix bX symbol is "tr" (trill). In that case, the duration tells Mup how long a wavy line to draw from the end of the "tr" symbol. .Ex 1 .\"score leftmargin=2;rightmargin=2 .\"music 1: 2e;g; mussym above 1: 1 "tr" til 2; 3 "ferm"; endbar .Ee .P .Ix bH A size can optionally be specified, inside parentheses: .Ex mussym (15) above 2: "turn"; .Ee .Ht Phrase marks .Hd phrase.html .H 2 "Phrase marks" .Ix fJ .P While it may often be more convenient to .Hr ichdattr.html#phrase specify phrase marks using "ph" and "eph" in the music input, you can also use the phrase statement. .P If there is only one voice, specifying \fIplace\fP for a phrase just tells .Ix bF Mup where to draw the phrase mark. If there are .Hr param.html#vscheme two or more voices, and a \fIplace\fP is specified, "above" .Ix bJ .Ix cO indicates to Mup that the phrase is associated with voice 1, and "below" indicates to Mup that the phrase is associated with voice 2. .Ix dL .P If no \fIplace\fP is specified and there is only one voice with notes, Mup will decide which side would be better based on the musical data. This means the phrase mark may come out above or below. In the case where there are two voices and there are notes present in both voices, phrase marks will be drawn both above and below. .P Each phrase statement item must include a begintime and duration. .Ix dK .Ix fP A phrase mark must begin and end on a chord, so Mup first takes the begintime .Ix gW and duration and finds the chords nearest to each of them. It then draws a phrase mark between them, shaping it to be out of the way of other things as much as possible. It is possible to specify a "grace backup" on the begintime or endtime to make the phrase start or end on a grace note. This is done by giving a negative number in parentheses, specifying how many grace notes to back up. It is possible to "nest" phrase marks (i.e., have one phrase on a subset of the chords of another phrase). .P Some examples: .Ex 1 .\"score leftmargin=2; rightmargin=2; staffs=3 staff 2 vscheme=2o music 1: d;f;a;b; 2,3 1: a;f;d;g; 2 2: 4.c;8b-;4d;g; phrase 1: 1 til 4; phrase above 2,3: 1 til 2; 3 til 4; phrase below 2: 2.5 til 1m + 1.5; bar 1: b;c+;d+;e+; 2,3 1: g;a;f;c; 2 2: 4.e;8f;4b-;g; bar .Ee .P Phrase marks are sometimes used on .Ix hU tablature staffs in conjunction with slides. .Ex 1 score staffs=2 .\"leftmargin=2 ; rightmargin=2 staff 2 stafflines=tab music 2: a3<>;a4;e4<>;e2; phrase above 2: 1 til 2; 3 til 4; bar .Ee .P The word "phrase" can be preceded by a line type modifier: dotted or dashed. The dotted or dashed styles might be used for phrase marks that were added by an editor rather than the composer, or to show a phrase that doesn't apply to all verses. .Ht Crescendo and decrescendo marks .Hd cres.html .H 2 "Crescendo and decrescendo marks" .P .Ix cL .Ix cM The "<" and ">" statements are used to specify crescendo and decrescendo marks respectively. Each mark must include a begintime and duration. The begintime and duration can include a grace backup specification, to make the mark begin or end on a grace note. Some examples: .Ix dK .Ix fP .Ex 1 .\"score leftmargin=1.5;rightmargin=1.5;staffs=3 .\"staff 3 clef=bass .\"music 1-2: c;d;e;f; < below 1: 1 til 2; 3 til 4.5; 3: 2c;g; > between 2&3: 1.7 til 2m + 1; bar 1-2: d;e;2g; 3: 2d;a; < 2,3: 2 til 3.8; bar 1-2: e;g;2c; 3: 2.e;4c; endbar .Ee .P The placement of crescendo and decrescendo marks can be controlled by setting the .Hr param.html#dyndist dyndist parameter. .Ht Octave marks .Hd octave.html .H 2 "Octave marks" .Ix gA .P Octave statements are used to mark notes that are to be played one or more .Ix hL octaves higher or lower than written. An "octave above" statement is .Ix bJ used to specify playing higher than written, or "octave below" for playing lower than written. Each item must include a begintime .Ix dK .Ix dL .Ix hB and a text string. The text string is most typically "8va" although Mup will print whatever you say. For .Hr midi.html MIDI purposes, up to two digits at the beginning of the string are examined, and a string starting with 8 will be treated as one octave, 15 or 16 will be treated as two octaves (15 is really "correct," but a few publishers may use 16), 22 or 24 as three octaves, etc. It will always default to be printed in 12-point Times ital font, although you can override that using the usual \ef and \es conventions. If the octave .Ix gK shifting applies to more than a single chord, there should also be a duration specified, reaching to include the last affected note. In this case, Mup will draw a dashed line to mark the span affected. Note that .Ix fF .Ix fP .Ix gW specifying the exact beat of a chord indicates the horizontal center of the chord, so if you want the dashed line to reach a bit past the note, it will be necessary to specify a duration slightly beyond the point of the last chord to be included. Examples: .Ex 1 .\"score leftmargin=2;rightmargin=2; staffs=3 .\"music 1: 2f;g; 2: 2d+;g; 3: 2g;ce; octave above 1: 2 "8va" til 1m + 1.3; bar 1: 2a;c; 2: 2f;e; 3: 4f;;c;; octave below 2: 1 "8va"; octave below 3: 1 "8va" til 2.5; 3 "15" til 4.5; bar .Ee .Ht Piano pedal marks .Hd pedal.html .H 2 "Piano pedal marks" .Ix fL .P Piano pedal marks are somewhat different than .Hi other statements described in this section. .He .ig .Hr textmark.html other similar Mup statements. .. Rather than having begintime, text, and duration, each .Ix fP item is just a time offset value, plus an optional "*". If no pedal mark is currently in progress, the first time offset value indicates where the pedal is depressed. Any subsequent pedal items on that staff will then .Ix hK indicate a "blip"\(emlifting and then immediately depressing the pedal (which is indicated on the printed music by a "^"), unless there is a "*", in which case it means to lift the pedal and leave it up. .P Some examples may help: .Ex 1 .\"score leftmargin=2;rightmargin=2;time=6/4; staffs=2; brace=1-2 .\"staff 2 clef=bass .\"music 1: c;d;e;2.g; 2: 1.ceg; // depress pedal on beat 1, release on 3 pedal 2: 1; 3*; bar 1: g;d;e;f;g;; 2: 1.gdb-; // depress pedal on 2, release and depress // on 4, release on 6 pedal below 2: 2; 4; 6*; bar .Ee .P .Hr param.html#pedstyle See also the "pedstyle" parameter. .Ix dS .Ht Rolls .Hd roll.html .H 2 "Rolls" .P .Ix aY Rolls can be specified with the "roll" statement, which has a format: .Ex \fBroll\fP \fIstaff voice\fP \fB:\fP \fItimeval\fP\fB;\fP .Ee .Ix bF .P A simple example would be: .Ex roll 2 1: 3; .Ee which indicates that a roll is to be placed on the chord at count 3 of .Ix gW staff 2 voice 1. As usual, if the \fIvoice\fP is omitted, voice 1 is assumed. .P Multiple rolls in a measure can be listed on a single statement if they are .Ix hG associated with the same voice. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2 .\"music 1: ceg;dfa;egb;fac+; // rolls on 3 chords: on the first, // second, and third beats of the measure roll 1: 1;2;3; bar .Ee would produce rolls on the chords on counts 1, 2, and 3. .P A roll can extend over several chords on different voices, or even different staffs. This is specified .Ix hK by giving the top and bottom staffs and voices, with the keyword "to" .Ix gM .Ix gN between them. For example: .Ex 1 .\"score leftmargin=2; rightmargin=2; staffs=3 .\"staff 3 clef=bass .\"music 1: 4.r;8g+b+d++ tie;2; 2-3: 4.ceg;8gbd+ tie;2; roll 1 1 to 3 1: 2.5; bar .Ee The roll would extend from voice 1 of staff 1 to voice 1 of staff 3. .P If you wish the roll to be downward, the keyword "down" can be placed after "roll." This will result in a downward arrow being drawn on the bottom end of the roll. .Ex 1 score .\"leftmargin=2; rightmargin=2; vscheme=2o music 1 1: c+e+g+;;;; 1 2: ceg;;;; // downward roll on staff 1 // on beats 2 and 4 roll down 1 1 to 1 2: 2; 4; bar .Ee .P You can also explicitly say "up" to cause an upward arrow to be drawn at the top of the roll. If no direction is specified, no arrow is drawn. .Hi .H 1 "TAGS, PRINTING, LINES, AND CURVES" .He .Ht Location Tags .Hd tags.html .H 2 "Location tags" .Hi .P .Ix bE The concept of "location tags" has been mentioned several times. We now describe this facility in more detail. .He .P A location tag is associated with a .Hr noteattr.html#ntag note, .Ix hL .Hr chrdattr.html#ctag chord, .Ix aE .Hr lyrics.html#ltag lyric syllable or .Hr bars.html#btag barline. .Ix gG It can then be referenced in order to place a second object, like a comment or dotted line, relative to the first object. .P A tag name can be either a single lowercase letter, or an underscore folowed by one or more letters, digits, or underscores. .Ix fG Each location tag is really a collection of six values, namely the north, south, east, .Ix cY .Ix cZ .Ix dA .Ix dB west, x, and y values of the tagged object. These are referenced by giving the tag name followed by a dot, followed by the letter n, s, e, w, x, or y. For example: .Ex c.n // north of tag c _xyz.e // east of tag _xyz x.x // x coordinate of tag x .Ee .P The n, s, e, and w values describe the smallest rectangle that will completely enclose the object being tagged. The north refers to the top of the object, the south to the bottom, the .Ix gM .Ix gN west to the left edge, and the east the right edge. The x and y values .Ix cW .Ix fY correspond to the "center" coordinate of the object. This is not necessarily the geometric center, but more of a "logical center." In the case of a tag associated with an individual note, it is the geometric center of the notehead. .Ix hL However, on tags associated with a chord, the x is at the center line of noteheads that are on the "normal" side of the stem. (Normally, when a stem .Ix hI is up, notes are put on the left side of the stem, and when the stem is down they are placed on the right side. However, when two notes adjacent on the staff have to be printed in a single chord, one has to be moved to the opposite side.) The y of a chord is always the middle line of the staff .Ix hK containing the chord. The x of a bar line is its geometric center. The y of a bar line is the center line of the top visible staff. .Ix gL For lyrics, the n, s, e, and w give the boundaries of the smallest box that encloses the syllable, including anything inside <^ >, but excluding anything inside < >, while the x and y are the center of that box. .P Tag names can be reused. The value of a tag will always be its most recent definition. .P There are also several "pre-defined" tags. They are: .Hi .DS .TS l l. _page the entire page _win the available part of the page _cur the current location _score the current score _staff.\fIN\fP staff \fIN\fP of the current score .TE .DE .He .ig <DL> <DT> _page <DD> the entire page <DT> _win <DD> the available part of the page <DT> _cur <DD> the current location <DT> _score <DD> the current score <DT> _staff.\fIN\fP <DD> staff \fIN\fP of the current score </DL> .. .P .Ix jN The _page tag refers to the entire page. The x and y values of _page are at the geometric center of the page. This tag is seldom useful, but is provided in case you want to force something to a specific place on a page. .P .Hm wintag The _win tag .Ix jO refers to the area of the page available for printing. The name comes from the idea that it provides a view, as if through a window, of a portion of the page. Its precise meaning depends upon the current context. .Ix aS .Ix aT .Ix gM .Ix gN In header, footer, top, bottom, header2, footer2, top2, bottom2, and block contexts, it refers to the area of the .Ix gS page taken up by the corresponding element. In music context, it refers .Ix hM to the area of the page that remains after excluding the margins and the header, footer, top and bottom for the page. There is no way to access location tags in any other contexts, so _win (and all other location tags) are meaningless in other contexts. .P .Ix jP The _cur tag refers to the current location on the page. This is a single point, such that east and west values are the same as x, and north and south values are the same as y. It is only useful immediately after a command that explicitly sets the current location, that is, after a printing command or line or curve command. Since Mup places musical .Ix fD .Ix fE data in an arbitrary order, trying to use _cur at other times is likely to cause output at a seemingly random place. .P .Ix jQ The _score built-in tag refers to the current or most recent score. _score.x will be at the position of the left edge of the staffs. _score.y will be at the middle line of the top visible staff. _score.w will be the left margin. _score.e will be the right margin. _score.n will be the farthest upward that anything associated with the score protrudes. _score.s will be the farthest downward that anything associated with the score protrudes. .P .Ix jR There are also built-in tags for each staff in the current or most recent score. Since there is one per staff, there is a special notation: _staff followed by a dot and the staff number. Only staff numbers that exist (i.e., are between 1 and the value of the .Hr param.html#staffs staffs parameter) and that are currently visible can be referenced. _staff.2.x will be the place on staff 2 between where the clef and time signature end and the first measure of the score begins. (Actually all staffs have the same x value.) _staff.5.y will be the middle line of the staff 5. _staff.7.w will the left edge of the staff label if it has a staff label; otherwise the left edge of the staff (the same as _score.x). _staff.10.e will be the right margin of staff 10 (or really any staff, since they will all be the same). _staff.4.n will be the farthest upward protrusion of anything associated with staff 4. _staff.15.s will be the farthest downward protrusion of anything associated with staff 15. .P Location tags can be referenced by a number of commands, including those for .Hr prnttext.html printing text, .Ix hA or .Hr linecurv.html drawing lines or curves, or in .Hr prnttext.html#postscript user-defined PostScript code. In the simplest case, two tag references are given in parentheses. The first tag will refer to a horizontal direction (the "x" direction for mathematicians), namely a tag with a w, e, or x after the dot. The second tag is then a vertical tag, having n, s, or y. For example: .Ex (g.x, g.y) // x and y of tag "g" (_tag.w, _item.n) // west of tag "_tag" and // north of tag "_item" .Ee The first example refers to the x,y coordinate of tag "g". The second item refers to two different tags. The point referenced has its horizontal location aligned with the west side of the object having the tag "_tag," while its vertical position is in line with the north side of the object having the tag "_item". In other words, if a line were drawn along the west side of the object tagged with "_tag" and another line were drawn along the top edge of the object with tag "_item", the point where those two lines crossed would be the point referenced. .P Frequently, you may want to place something relative to a tagged object. You can add offsets in both the x and y dimensions. These offsets are given in stepsizes. .Ix fO As was mentioned earlier, a stepsize is half the distance between two staff lines. .Ex (g.x + 4.5, g.y + 4.5) .Ee refers to the point 4.5 stepsizes to the right and above the point (g.x, g.y). Adding an offset moves to the right in the horizontal direction and upward in the vertical direction. You can also subtract an offset: .Ex (k.w - 1.3, m.n - 2) .Ee refers to a point 1.3 stepsizes to the left of the west edge of k and 2 stepsizes below the top of m. .P In the horizontal direction, offsets can be given in terms of "time". This .Ix gT is specified by using the keyword "time" followed by a number of beats. As an example, suppose we have the tag reference: .Ex (q.x + time 1, q.y + 2) .Ee If the .Hr param.html#time time signature .Ix gU is 4/4 and tag "q" happens to be associated with a half note, this tag reference would refer to a point halfway between that note and the following chord, since it includes an offset of a quarter note. If "q" had been associated with a whole note, the point would be only 1/4 of the way between the note and the following chord. Since notes are placed based on various constraints and aesthetic considerations, the actual distance will vary depending on which tag is referenced. .P In the case of a .Hr bars.html#btag tag associated with a bar line, the time to distance mapping is done based on the distance between the bar (at count "0") and the first .Ix hG chord in the measure (at count "1"). So, for example, in 4/4 time, a reference to a bar line tag + time 0.5 would indicate a place halfway between the bar line and the first chord, whereas tag + time 0.25 would be one fourth of the way. .P The mapping of time to distance is done based on the note, rest, lyric syllable, or bar .Ix gG .Ix hC .Ix hL line associated with the most recent horizontal tag in the expression. For example, if the most recent horizontal tag is associated with a quarter note, and the distance between that note and the next was 0.5 inches, specifying "+ time 2" (a half note) would mean 1.0 inch to the right, or specifying "- time 2" would mean 1.0 inch to the left, even if the notes to the left or right happened to be spread somewhat differently than 0.5 inches .Ix cW per quarter note. Thus it is usually advisable not to specify a time offset greater than the time value of the note or rest associated with the tag, nor to subtract a time value. Stated another way, when specifying the X portion of a coordinate using a time offset, it is best to use a location tag based on whichever note, rest, or bar is immediately to the left of the X location you are trying to specify. .P If the first horizontal tag in a horizontal expression is associated with a bar, and that bar happens to be at the end of a score other than the final score, and the result of evaluating the expression is a location that would be out in the right margin or off the right edge of the page, it will be moved to act as if the bar was at the beginning of the following score. .P The various kinds of offsets can be combined. .Ex ( _pp + 1.2 - time 3.5, _zz + 2) .Ee .P If no tag is specified, the reference becomes an absolute reference, giving an exact page location. For example: .Ex (10, 20) .Ee is 10 stepsizes from the left edge and 20 stepsizes above the bottom of the page. .P While usually the horizontal and vertical specifications will each be just a tag and direction, possibly plus or minus some offset, they can be more complicated arithmetic expressions. The expressions can involve * for multiplication, / for division, or % for modulo. These operators have higher precedence than addition or subtraction, but you can use parentheses to force different precendence. You can also use + or - as a unary operator, which has the highest precedence of all. The unary + is rarely useful, but unary - is used if you want to have a negative number. There are also several functions available that you can use, namely: .Hi .DS .He .TS center, box; c|c|c l|l|l. Name Description Parameters _ sqrt square root 1 sin sine 1 cos cosine 1 tan tangent 1 asin arc sine 1 acos arc cosine 1 atan arc tangent 1 atan2 arc tangent y/x 2 hypot hypotenuse 2 .TE .Hi .DE .He .P A function name must be followed by parentheses containing its parameter(s). For functions with two parameters, the parameters are separated by a comma. Function parameters can themselves be arithmetic expressions. The sin, cos, and tan function parameters are expected to be in degrees. The return values of the asin, acos, atan, and atan2 functions are in degrees. For the most part, expressions are allowed to include operators and functions in any order. This makes it possible to do things like calculate a horizontal location based on some vertical attribute, if you really want to do that. But it also means Mup will not stop you from creating an expression that may not make any logical sense. Mup will do its best to try to do whatever you say, even if that wasn't what you meant. .P A common use for an expression more complicated than just a simple tag reference and offset would be to place something in the middle of a measure. You could set location tags on the bars at either end of the measure, and then use the average to get the midpoint of the measure. .Ex 1 .\" score .\" leftmargin=2 .\" rightmargin=2 .\"music 1: 2g;e; // Note that be able to set a tag on the left of the very first measure, // we could make an invisible bar, just to set a tag on it. But here, // we can use the actual bar line at the left of the measure of interest. bar =_firstbar 1: c;d;e;f; bar =_secondbar // Print a centered string at the average of the X values of // the bars on either side of the measure, // 6 stepsizes above the middle of the top staff of the score. center ((_firstbar.x + _secondbar.x) / 2, _firstbar.y + 6) "mid measure"; .Ee .P A much more complicated example is presented later, in the .Hr macros.html#arrow section on macros, demonstrating use of the trigonometric functions. .Ht "Mup commands for printing text .Hd prnttext.html .H 2 "Printing commands" .Ix hA .P There are several commands for printing text. There are four commands that have similar formats, differing only in how they justify text. .Ex \fBprint\fP \fIlocation\fP "\fItext\fP" \fBleft\fP \fIlocation\fP "\fItext\fP" \fBright\fP \fIlocation\fP "\fItext\fP" \fBcenter\fP \fIlocation\fP "\fItext\fP" .Ee .Ix cV .Ix cW .Ix dN .Ix fY .P The \fIlocation\fP is optional. If the \fIlocation\fP is omitted, the "print" command will cause the \fItext\fP to be printed beginning at the current horizontal and vertical location. The other commands will cause the text to be placed vertically at the current vertical position, but left justified, right justified, or centered within the current margins of the page. .Ix gS .P The \fIlocation\fP can be specified using the special keyword of "nl" which means "next line." This moves the current location to the beginning of the following line before placing the text. In other words, the current vertical position is moved downward by the height of the current text .Ix bH point size (or by as much as necessary if the string is taller than that). Then the \fItext\fP is printed on that line with the given justification style. .P The other way to specify a \fIlocation\fP is by using coordinates. The justification then takes place relative to the referenced location. For example, consider the following "right" command containing a reference to an absolute location: .Ex right (25, 4) "something" .Ee The y location given is 4. Since this is an absolute location with no location tags being referenced, this means the vertical position will be 4 stepsizes from the bottom of the page. The x location given is 25. Again, this is an absolute location, so the current horizontal position will be 25 stepsizes from the left edge of the page. Since right justification is indicated, the word "something" will be placed such that the right edge of the final "g" will be 25 stepsizes from the left edge of the page. If "center" had been specified, the middle of the word "something" would be at the 25 stepsize point. .P Here are some other examples: .Ex print "Author unknown" center nl "subtitle" left (h.x - 1.5, h.n + 2.3) "Ad lib" right (_fine.e + time 3, _note.n + 5) "Duet" .Ee .P Another type of print command is "title." The full format of this command is: .Ix gC .Ex \fBtitle\fP \fIfontfamily font size "text1" "text2" "text3"\fP .Ee However, only the word "title" and one quoted text string are required. .Ix hB The \fIfontfamily\fP, if specified, has one of the values valid for .Hr param.html#fontfam the "fontfamily" parameter (avantgarde, bookman, courier, helvetica, newcentury, palatino, or times). The default is the value of the "fontfamily" parameter. .Ix bG The \fIfont\fP, if specified, has one of the values valid for the "font" parameter (rom, bold, ital, or boldital). If no \fIfont\fP is specified, .Ix gH .Ix gI .Ix gJ .Ix gK the default is the value of .Hr param.html#font the "font" parameter. The optional \fIsize\fP is a point size within parentheses. .Ix bH If not specified, the default is the value of .Hr param.html#size the "size" parameter. .P In all cases, the location will be like that obtained via the "nl" location to a print command. In other words, the title text string(s) will be printed on the line below the location that was current when the title command was encountered. If there is only one string given, it will be centered between the margins. If two strings are given, both will be printed on the same line, but the first will be left justified and the second will be right justified. If three strings are given, they will all be printed on the same line, with the first left justified, the second centered, and the last right justified. .P Some samples: .Ex title bold (12) "Sonata 12" title (18) "Song Without Words" title ital (12) "Text: John Doe" "Tune: Jane Doe" title "Suite in C" "Trumpet I" "Waltz" title "" "A. Composer" .Ee .P .Hm paragrph The final command for printing text is .Ix jD the "paragraph" command. This is used when you have a long section of text, and you would like it to automatically wrap around onto as many lines as necessary. You can specify whether you want the right margin to be "justified" or "ragged." If you don't specify, the type of the previous paragraph is used. The default for the very first paragraph is to be justified. By default, the values of the .Hr param.html#fontfam fontfamily, .Hr param.html#font font, and .Hr param.html#size size parameters are used to determine the text style, but any or all of those parameters can be overridden on the paragraph command. The complete syntax is: .ig <BR> .. .DS \fIjustify_type\fR \fBparagraph\fR \fIfontfamily font\fR \fB(\fR\fIsize\fR\fB) "\fR\fIstring\fR\fB"\fR .DE .ig <BR> .. Only the keyword "paragraph" and the string are required. Here are some example paragraphs: .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\"block paragraph "This is an example of a paragraph. Since no justification type was specified, and this is the very first paragraph, the default (justified) is used. A paragraph will wrap around to as many lines as needed. An explicit newline is given at the end of this paragraph, to force a blank line between it and the following paragraph.\en" ragged paragraph avantgarde ital (15) "This paragraph is ragged rather than flush right. It is in a different font and size. Ragged paragraphs are split onto multiple lines if necessary, but they are not spread out to make lines go all the way to the right margin." justified paragraph (14) " Here is another paragraph. This one is justified. Only the size was specified for this paragraph; the font was not, so the current default will be used. Some spaces are included at the beginning of the paragraph text, to create an indented first line for the paragraph." paragraph "Here is the final paragraph. Since no justification type was given, that of the previous paragraph (justified in this case) was used. A paragraph may be used for many things, such as describing how you want a piece to be performed, or a biography of the composer." .Ee .P .Hm block Sometimes you may want to mix blocks of text with music. .Ix jC This can be done by specifying a "block" context. The block context will typically contain one or more "paragraph" commands, although any of the printing commands (paragraph, print, left, center, right, or title) can be used. The block can also contain changes in certain parameters, namely .Hr param.html#font font, .Hr param.html#size size, and .Hr param.html#fontfam fontfamily, which will affect the appearance of the following text. A block can also contain .Hr newscore.html \&"newscore" or "newpage" commands. Using "newscore" will cause vertical space to be added, as would be used to separate scores. The amount of space is affected by the .Hr param.html#scoresep scoresep and .Hr param.html#scorepad scorepad parameters. Using "newpage" will cause a new page to be started. If a newscore or newpage includes a "leftmargin" specification, that will alter the left margin on the block text that follows. A "rightmargin" specification will alter the right margin of the block text that precedes it. .P Here is an example of a block. .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\" scoresep=6,8 .\" label="" .\" fontfamily=helvetica block title bold "Notation in Simple and Compound Meters" title "" paragraph "It is common for a person familiar with mathematics but not with music to assume that 3/4 and 6/8 time are equivalent, but that is not the case. In 3/4 time (which is known as simple triple meter), a measure containing 3 quarter notes would be notated like this:" score time=3/4 music 1: c;;; bar hidechanges block paragraph "whereas in 6/8 time (which is compound duple meter), a measure with 3 quarter notes should be notated thus:" score time=6/8 music 1: 4c;8~;;4; bar .Ee .P The printing commands may occur in the .Hr headfoot.html header, footer, header2, footer2, top, bottom, top2, bottom2, .Ix aS .Ix aT .Ix gM .Ix gN .Hr prnttext.html#block block, and .Hr music.html music contexts. .Ix fQ .Ix hM After each printing command, the current location is set to the right edge of the last character printed horizontally and at the baseline of the current line vertically. .Hh postscript .H 2 "Including raw PostScript" .P There is another command that looks a lot like the printing commands, but gives you a way to insert raw PostScript into the Mup output. This might be used, for example, to include a picture or logo along with your music. The syntax is .Ex \fBpostscript\fP \fIoptional_location optional_exports\fP \fB"\fP\fIraw PostScript\fP\fB"\fP .Ee As with the other print commands, if the location is omitted, the current location is used. .P Instead of specifying an (x, y) coordinate location, you can declare various PostScript "hooks" that will be called at specific times: .Hi .VL 15 .LI afterprolog .He .ig <DL> <DT>afterprolog <DD> .. The PostScript code you specify will be placed in the generated Mup output right after the %EndProlog, and before the first page. The current location will be the upper left corner of the page. A typical usage might be to set up some global things that you would then use later in other hooks. Or it could be used to override things defined in the Mup prolog. .Hi .LI beforetrailer .He .ig <DT>beforetrailer <DD> .. The PostScript code you specify will be placed in the generated Mup output right after the final page, and before the %Trailer. The current location will be the lower right corner of the page. One possible use might be to write out some data gathered to some other file. .Hi .LI atpagebegin .He .ig <DT>atpagebegin <DD> .. The PostScript code you specify will be placed in the generated Mup output on every page, before anything is written to the page. The current location will be the upper left corner of the page. Some possible uses would be to paint the page some background color or add a fancy border. Or it could be used to add a red "Do not copy" watermark, where the music output would still be completely readable, since it would get drawn on top of the mark. .Hi .LI atpageend .He .ig <DT>atpageend <DD> .. The PostScript code you specify will be placed in the generated Mup output on every page, after everything else has been written to the page. The current location will be the lower right corner of the page. An example of a possible use would be to write "SAMPLE" in huge letters across each page. to leave enough music readable that a potential user can get an idea of what the music is like, but overwrite enough that it isn't really usable, to encourage paying for a copy without the mark. .Hi .LI atscorebegin .He .ig <DT>atscorebegin <DD> .. The PostScript code you specify will be placed in the generated Mup output just before the output for each score. The current location will be the upper left corner of the score. A possible usage would be to put a different color background behind each score, so they would really stand out even on a very crowded page. Another would be to put yellow highlighting behind a particular staff on each score. .Hi .LI atscoreend .He .ig <DT>atscoreend <DD> .. The PostScript code you specify will be placed in the generated Mup output just after the output for each score. The current location will be the lower right corner of the score. One possible use would be to "white-out" something Mup printed that you don't like, but have no other way to prevent. With enough work, you could probably even create an ossia. .Hi .LE .He .ig </DL> .. .P It should be noted that since a postscript command can contain arbitrary PostScript code that is merely passed through by Mup, any tools that try to transform Mup input to some other music notation format (e.g., Music XML) will most likely be unable to understand any of that PostScript code, and any information in it will almost certainly be completely lost during the transformation. So while it is provided as an "escape hatch" to allow you to do things Mup does not support natively, its usage is discouraged, unless you really need to do something that Mup does not support directly, and if you are willing to accept the fact that doing so will compromise portability. .P The \fIoptional_exports\fP let you specify a list of .Hr tags.html Mup location tags whose values you want to pass to your PostScript code. If you list a tag by itself, all six values (x, y, n, s, e, w) are passed to Postscript, or you can list just a specific direction: .Ex postscript atscorebegin with _score, _mytag.y, "...PostScript... " .Ee As a special case, you can specify _staff, which will pass all six values for all visible staffs. The PostScript name will be the Mup name with Mup prepended to it. So _tag.x in the Mup input will become Mup_tag.x in the PostScript output. Often it is useful to use a more generic name in your Postscript code, and then pass the values from different tags to it at different times. You can do this by specifying an alias tag. .Ex postscript atpagebegin with _value = _staff.2 "...PostScript... " .Ee In that example, _value will be an alias, and the PostScript name will be Mup_value, but its value will be that of _staff.2. So suppose the value of _staff.2.x is 3.8. If you say: .Hi .DS with _staff.2.x .DE the output would be: .DS /Mup_staff.2.x 3.8 def .DE but if you say: .DS with _value.x = _staff.2.x .DE the output would be: .DS /Mup_value.x 3.8 def .DE and you can later use the exact same PostScript code (that uses Mup_value.x), but pass it the value from some other tag, like _staff.5.x or your own tag. Note that you don't have to use the same direction for both, so you could say .DS with _value.x = _another_tag.w .DE .He .ig <PRE> with _staff.2.x </PRE> the output would be <PRE> /Mup_staff.2.x 3.8 def </PRE> but if you say <PRE> with _value.x = _staff.2.x </PRE> the output would be <PRE> /Mup_value.x 3.8 def </PRE> and you can later use the exact same PostScript code (that uses Mup_value.x), but pass it the value from some other tag, like _staff.5.x or your own tag. Note that you don't have to use the same direction for both, so you could say <PRE> with _value.x = _another_tag.w </PRE> .. .P The string containing raw Postscript is copied directly to the Mup output. You can use the usual \e" to embed a double quote in the string, but otherwise the string is copied exactly as it is, enclosed inside a PostScript save/restore. After the restore, the current location is reset back to where it was originally. .P Alternately, you can use the keyword "file" and then give a file name as the string. The contents of the file are copied to the output verbatim, so it is not necessary to use backslashes before double quotes to preserve them. .P Since the PostScript code is copied without any interpretation, Mup does not reserve any space on the page for it, and it is your responsibility to provide valid PostScript. The PostScript language is beyond the scope of this User's Guide; consult a book on PostScript if you need more information. .P As a simple example, you might include an Encapsulated PostScript file near the lower left corner of the current page, using: .Ex postscript "50 50 translate (file.eps) run" .Ee .P Or you could print a message in red italics near the bottom of the page, like this: .Ex postscript (70, 20) " 1 0 0 setrgbcolor /NewCenturySchlbk-Italic findfont 16 scalefont setfont (Photocopying prohibited) show " .Ee .P Next we show an example of a hook that allows you to do the equivalent of a yellow highlighting pen on a particular staff. .Ex 1 score staffs=2 .\" leftmargin=2 .\" rightmargin=2 music define SOPRANO 1 @ define ALTO 2 @ .\" define HIGHLIGHT ALTO @ ifdef HIGHLIGHT // If HIGHLIGHT is set to a staff number, // highlight that staff by drawing a yellow box behind it. postscript atscorebegin with _box = _staff.HIGHLIGHT " newpath Mup_box.w Mup_box.n moveto Mup_box.e Mup_box.n lineto Mup_box.e Mup_box.s lineto Mup_box.w Mup_box.s lineto closepath 0.9 0.9 0.0 setrgbcolor fill stroke" endif SOPRANO: g;8c+;;4;; ALTO: e;8g;;4a;e; lyrics below SOPRANO,ALTO: "This is a sam-ple"; bar newscore SOPRANO: e+;d+;b;c+; ALTO: g;b;g;e; lyrics below SOPRANO,ALTO: "of high-light-ing."; bar .Ee If you invoke Mup with -DHIGHLIGHT=SOPRANO, the top score will be highlighted. If you invoke with -DHIGHLIGHT=ALTO (as shown), the second will be highlighted. Otherwise nothing will be. .Ht Lines and curves .Hd linecurv.html .H 2 "Lines and curves" .P The "line" statement is used for drawing lines. Its format is: .Ix fE .Ex \fIlinetype\fP \fBline (\fP\fIX1, Y1\fP\fB) to (\fP\fIX2, Y2\fP\fB)\fP .Ee The \fIlinetype\fP can be "wide," "medium," "wavy," "dotted," "dashed," .Ix dF .Ix fF or it can be omitted, which means narrow. .Ix bQ The wavy line could be used for glissandos. It could also be used for manually drawing rolls and trills, although it should rarely, if ever, .Ix bX .Ix fU be necessary to resort to this, since the .Hr roll.html roll .Ix aY and .Hr mussym.html mussym .Ix fT statements will usually suffice and are much easier to use. Narrow, dashed, or dotted lines would typically be used for voice crossings. .Ix bF .Ix fG The medium line is about twice as wide as a narrow line, and a wide line is about twice as wide as a medium line. .P The x and y coordinates are specified as was described in the section on .Hr tags.html \&"Location tags." .Ex 1 score .\"leftmargin=2; rightmargin=2; staffs=2 vscheme=2f staff2 clef=bass music 1 1: c+ =c;e =e;g;c+; 1 2: e =_e;g =_g;c =_c;s; 2 1: 2.s;4g =_gg; 2 2: 1ce; line (c.e + 2, c.y) to (e.w - 2, e.y) line (_e.e + 2, _e.y) to (_g.w - 2, _g.y) dashed line (_c.e + 1, _c.y) to (_gg.w - 1, _gg.y) bar .Ee .P It is possible to print a text string by the line by adding .Ex \fBwith \fP\fIfontfamily font \fP\fB(\fP\fIsize\fP\fB) "\fP\fIstring\fP\fB"\fP .Ee at the end of the "line" statement. Only the keyword "with" and the text string itself are required; the font and size information is optional. As usual, the .Hr param.html#fontfam fontfamily, .Hr param.html#font font, and .Hr param.html#size size parameter values are used to get values if the optional items are omitted. The most common usage for printing a string with a line is probably for glissandos. .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\"music 1: 2d =n; g+ =m; wavy line (n.e + 1.5, n.y) to (m.w - 1.5, m.y) with ital (9) "gliss." bar .Ee .P Arbitrary curves can be drawn using the "curve" statement: .Ix fD .Ex \fIlinetype\fP \fBcurve (\fP\fIX1,Y1\fP\fB) to (\fP\fIX2,Y2\fP\fB) to (\fP\fIX3,Y3\fP\fB)\fP \fI...\fP .Ee When using this form of the "curve" statement, at least three coordinates must be specified; more are permitted. The \fIlinetype\fP can be "medium," "wide," "dashed," or "dotted," or omitted. A curve will be drawn through the specified points in the specified order. .Ex 1 score .\"leftmargin=2; rightmargin=2 staffs=2 staff 2 clef=bass music 1: 4.s;[=c] 8e; [=d] g; [=e] e;4s; 2: [=a] 8c;g; [=b] c+;4.s; [=f] 8c+; [=g] c; medium curve (a.x, a.n+1) to (b.x, b.n+15) to (c.x, c.n+4) \e to (d.x, d.n+3) to (e.x, e.n+3) \e to (f.x, f.n+11) to (g.x, g.n+1) bar .Ee .P An alternative way to specify a curve is to only specify the two endpoints, along one or more "bulge" values, given in stepsizes. Suppose a single bulge value \fIn\fP is given. To find the midpoint of the resulting curve, imagine a line is drawn between the two endpoints, then from the midpoint of that line, move perpendicular to the line for \fIn\fP stepsizes. A positive \fIn\fP will cause the curve to bulge to the left as you move from the start point to the end point, while a negative \fIn\fP will make it bulge to the right. If two bulge values are given, bulges are calculated from the 1/3 and 2/3 point of the line between the endpoints; with three points, at 1/4, 1/2, and 3/4, and so forth. Multiple bulge values are separated by commas. .Ex 1 .\"score .\"leftmargin=1.7 .\"rightmargin=1.7 .\"music 1: c =_c1; f; f; d =_d1; medium curve (_c1.x, _c1.y + 8) to (_d1.x, _d1.y + 10) bulge 3 bar 1: g =_g1; e+; d+; a =_a1; dotted curve (_g1.x, _g1.y - 2) to (_a1.x, _a1.y - 2) bulge -4.3 bar 1: g =_g2; a; d+; c+ =_c2; curve (_g2.x, _g2.y - 2) to (_c2.x, _c2.y + 2) bulge -2.5, 4 bar .Ee .Hi .H 1 "MISCELLANEOUS FEATURES" .He .Ht Newscore and newpage, samescore and samepage .Hd newscore.html .H 2 "Newscore and newpage, samescore and samepage" .P Normally, Mup determines how many measures to put on each score and how many .Ix hG .Ix hJ scores to put on each page. You can force Mup to move to the next score with the "newscore" statement, or to the next page with a "newpage" statement. .Ix cC .Ix cD Here is an example: .Ex 1: c;d;e;f; bar 1: e;f;g;; bar newscore // go to next score 1: 2c;; bar 1: e;f;g;; bar newpage // go to next page 1: e;g;2c; bar .Ee .P You can temporarily change the indent for the new score by specifying "leftmargin=\fInum\fP," where \fInum\fP is a number of inches or centimeters (depending on the current setting of .Hr param.html#units the "units" parameter.) The number may include a decimal fraction part (e.g., 8.5). The number can optionally be preceded by a plus or minus sign, in which case the number is taken as an amount to add or subtract from the normal margin, rather than as the actual margin value. .Ix gQ The new score will then be indented by that much, overriding the value of .Hr param.html#leftmar the leftmargin parameter. .P In a similar way, you can specify "rightmargin=\fInum\fP," which .Ix gR will affect .Hr param.html#rightmar the right margin on the \fBprevious\fP score. This might be used, for example, if you want a piece to end with a shorter than normal score. .Ex newscore leftmargin=1.2 rightmargin=2.7 .Ee The equals sign is optional in these margin overrides. .P For rightmargin, you can specify rightmargin=auto rather than giving a number. In that case, Mup will calculate the appropriate value to use to make the music on the previous score spaced based on the .Hr param.html#packexp packexp and .Hr param.html#packfact packfact parameters, without spreading to fill the line. .Ex 1 .\"score packfact=1.5 .\" leftmargin=2 .\" rightmargin=2 .\"music .\" 1: c;d;e;f; bar 1: g;f;e;g; bar 1: c;d;e;f; bar 1: g;f;e;g; bar 1: 2e;c; endbar newscore rightmargin=auto .Ee .P On a "newscore" line you can also specify the separation between the preceding and following scores. The separation is the distance between the bottom line of the bottom visible staff of the preceding score, and the top line of the top visible staff of the following score. It is measured in step sizes. An example is: .Ex newscore scoresep = 10.5 .Ee This distance will be enforced, regardless of the values of the .Hr param.html#scorepad scorepad and .Hr param.html#scoresep scoresep parameters. The distance can even be negative, which will force them to overlap. If there is not room on the page for both scores with the stated distance between them, the second score will be put on the next page instead. .P This scoresep option also works if the preceding and/or following item is a .Hr prnttext.html#block block instead of a score. The distance is then measured from the boundaries of the block(s). .P Also, a newscore can be put in the middle of a block, which effectively breaks the block into two blocks, and the scoresep option can be used there. This can be especially useful with a big block. Suppose you would normally like it to appear as one big block, but if the page is mostly full of music already, and the whole block doesn't fit, you may prefer to break it in half, so that the first half will still go on the first page in this case, rather than forcing it all to the next page. To do this, at the place you would like to allow the break to occur, put this line: .Ex newscore scoresep = 0 .Ee .P Sometimes it may be useful to tell Mup where you do \fInot\fP want a new score to begin. This is done by: .Ex samescorebegin // ... two or more measures of Mup input samescoreend .Ee .P Similarly, to specify that certain measures and/or .Hr prnttext.html#block blocks should all be kept on the same page: .Ex samepagebegin // ... two or more measures of Mup input or blocks samepageend .Ee .Ht Mup header and footers .Hd headfoot.html .H 2 "Headers and footers" .P .Ix aS .Ix aT .Ix fQ Mup provides ways to put headers and footers on pages of output. Often you may want a certain kind of header and footer on the first page, but a different kind on any subsequent pages, so Mup makes it easy to do that. Mup also offers two different "layers" of headers and footers. These layers may be particularly useful if you have a single Mup file that contains multiple songs, or multiple movements of a song. In that case, there may be certain things that you want printed in headers and footers throughout, like the current page number and the name of the entire collection, but other things that you want to have change with each new song or movement. .P The "outer" layer is specified by four contexts: header, footer, header2, and footer2. The "inner" layer is specified by four contexts: top, bottom, top2, and bottom2. .Ix gM .Ix gN .P All of these contexts can have different versions for left and right pages, by following their name with a modifier of "leftpage" or "rightpage." So, for example, you can have both a "top leftpage" and a "top rightpage." These will override any corresponding version without a page side modifier. So if you also defined a plain "top" in addition to ones for leftpage and rightpage, it wouldn't actually ever get used. If, on the other hand, you defined only a "top leftpage" and a plain "top," then the plain top would get used for right-hand pages, and if you only define "top rightpage," and nothing for the other two, nothing would be used on left-hand pages. Pages will always alternate between left and right, but you can control which to start with, using the .Hr param.html#firstpg firstpage parameter. .P All of these contexts are optional. Each of the three variations (leftpage, rightpage, and unmodified) of each outer context (header, footer, header2, footer2) can only be specified once per file. The inner contexts can be specified more than once per file, and each time a set of them occurs, a new page is started. On output pages, all of these contexts are placed horizontally between the left and right margins, and vertically the elements appear in the following order: .DS (topmargin) header top (one or more scores of music or blocks of text) bottom footer (bottommargin) .DE .P Which version is used\(emthe one with or without the "2" suffix\(emdepends on which page is being printed. The items in header and footer appear on only the very first page, while those in header2 and footer2 appear on all subsequent pages. Somewhat similarly, the items in top and bottom will appear on the page that is started when they are encountered in the input, while top2 and bottom2 will then be used on all subsequent pages. However, you can specify a new top and/or bottom later, which will then be used for one page, and you can specify a new top2 and/or bottom2 later, which will replace the previous top2/bottom2. Note, however, that if you change top2 but not top, that new top2 is used immediately on the new page, whereas if you change both, the new top applies to the immediately following new page, and the new top2 isn't used until the following page. Subsequent pages will use top2 in either case. .P Some examples may help. First a simple case: suppose you have a single song, and you'd like a title at the top of the first page. This is straightforward: .Ex top title "Here is the Title" .Ee For this simple example, it would work just as well to use "header" instead of "top," so you can use either one, although top is slightly more flexible. Later we'll see some examples where you might use both header and top in the same file, for different kinds of titles. .P Now suppose you'd like to make the title bigger and bolder, and would like to add a subtitle and composer information, as well as add a copyright notice to the bottom of the page. .Ex top title bold (18) "Here is the Title" title ital (14) "Here is a subtitle" title "Lyrics: Ann Author" "Composer: Me" bottom title "\e(copyright) Copyright 2003 by Ann Author and Me" .Ee Again, in this simple example, you could use "header" and "footer" rather than "top" and "bottom." .P Now suppose the song is long enough to take several pages, and you would like to repeat the title along with the page number on all pages after the first. To accomplish this, you could add: .Ex top2 title "Here is the Title - \e%" .Ee .Ix aU The \e% is a special marker that will get replaced on each page with the current page number. While it can be used in any text string, it is probably only likely to be useful in these header and footer kinds of contexts. .Hm pagenum Another special marker is \e#, which will be replaced by the page number of the final page. This could be useful for doing something like "page \e% of \e#." .P As a variation, perhaps you'd prefer the information at the bottom of the page. .Ex bottom2 title "This is the title" "Page \e%" .Ee In this variation, two separate text strings are specified, so the first string will be left justified and the second will be right justified. .P Note that if you give a top2 or bottom2, but it turns out there aren't any additional pages, they would never actually get used. But it wouldn't hurt to have set them. .P Now let's consider a more complicated example, using both outer and inner contexts. Suppose you are publishing a book of songs, entitled "My Favorite Songs," and you want to put that title at the top of every page throughout the book, and you want a page number at the bottom of each page except the first. You could get that much using: .Ex header title "My Favorite Songs" header2 title "My Favorite Songs" footer2 title "\e%" .Ee But suppose that in addition, you want each song to have its title on its first page in big print, and on subsequent pages in regular size print. To get this, at the beginning of each song, you could use top and top2: .Ex top title (18) "This is the Song Title" top2 title "This is the Song Title" .Ee .P Now suppose you'd prefer to have the page numbers at the left margin of left-hand pages and at the right margin of right-hand pages. Instead of the single unmodified footer2 shown above, you would make two: .Ex footer2 leftpage title "page \e%" "" footer2 rightpage title "" "page \e%" .Ee .P A composition with multiple movements can be handled similarly, by giving header, footer, header2, and footer2 (or any subset thereof) for the composition as a whole, and then giving new top, bottom, top2, and bottom2 definition (or any subset) at the beginning of each new movement. .P These contexts are conceptually in a separate coordinate space, which will be overlaid on each page coordinate space. When in these contexts, .Hr tags.html#wintag the _win special tag applies to the header or footer window rather than the space between the header and footer as it does in the music context. .Ix hM .P Since headers or footers will expand as necessary, the .Hr tags.html#wintag value of _win.s and _win.y may be changed by any of the statements in the context. At any given time, they refer to the boundaries as defined by what has been printed so far. Thus, if the first line of a header contains an 18-point title, after that, _win.s would be 18 points below _win.n. If the header then contained a 12-point title, after that it would be 31 points below _win.n (12 points for the title string, plus 1 point of padding that is added between lines printed). .P In addition to the "title" commands used in the examples above, you can also use .Hr prnttext.html the "print," "left," "right," or "center" commands. .Ix cV .Ix cW .Ix fY In most cases you will want to use "nl" for the \fIlocation\fP on those commands to place things. If you don't specify a \fIlocation\fP for the first of these commands in a header or footer, Mup will start at the left margin, just far enough down from the top to accommodate the text string to be printed. .Ix hB These contexts can also contain settings of the .Hr param.html#font font, .Ix bG .Hr param.html#fontfam fontfamily, .Ix gB and .Hr param.html#size size parameters. These parameter values will be used until the end of the context or until set again to some other value. .Ht Mup macros .Hd macros.html .H 2 "Macros" .H 3 "Simple Macros (without parameters)" .P .Ix aM .Ix cS Macros can be defined to avoid retyping or to give mnemonic names to things. A macro is defined with the following syntax: .Ex \fBdefine\fP \fI macro_name macro_text\fP \fB@\fP .Ee .P The \fImacro_name\fP consists of one or more uppercase letters, digits, and underscores, with the first character being a letter. .Ix fW The \fImacro_text\fP can be any text. It can be any length from empty to many pages. The "@" terminates the macro. A literal "@" can be placed in the \fImacro_text\fP by preceding it with a backslash. .Ix bC If you want a literal backslash in the \fImacro_text\fP, it also must be preceded by a backslash. .P A macro is called by stating the \fImacro_name\fP in the input. The \fImacro_name\fP is replaced by the \fImacro_text\fP. A macro can be defined at any point in the input. It can be used as often as desired any time after it has been defined. A given \fImacro_name\fP can be redefined as many times as desired, with each new definition overwriting the previous definition. .P As an example, suppose you are printing an orchestral score, and the oboe .Ix hJ part happens to be on staff 5. Rather than having to remember which staff it is, you could define a macro: .Ex define OBOE 5: @ .Ee Not only is the name easier to remember than a number, but if you later decide to move the oboe part to a different place in the score, only the macro definition and perhaps a few other things would have to be changed. .P Another common use of macros might be if a musical motif occurs several times. You could define a macro for the motive: .Ex define SCALE 8c;d;e;f;g;a;b;c+; @ .Ee then do something like: .Ex OBOE SCALE .Ee .P It is possible to remove the definition of a macro using the "undef" .Ix bY statement: .Ex undef OBOE .Ee .P It is possible to have parts of the input skipped over depending on whether certain macros are defined or not. This is done using \&"ifdef," "else," and "endif." The keyword "ifdef" is followed by .Ix aN a macro name. If a macro by that name is currently defined, Mup will continue reading and processing input normally. If it finds a matching "else," it will skip over input until the matching "endif." If the macro is not currently defined, Mup will skip over the input until it finds a matching "else" or "endif." There is also an "ifndef" command that uses the opposite logic: it will read the input up to the "else" or "endif" only if the macro is NOT defined. .P The ifdefs can be sprinkled between other items in the input; they need not be on separate lines. They can be nested. Examples: .Ex // make last c an octave higher if macro "FRED" is defined 1: c;e;g;c ifdef FRED + endif; ifdef PIANO staff 1 visible=n else ifdef VIOLIN staff 2 visible=n staff 3 visible=n endif endif .Ee .P .Hr cmdargs.html#doption Macros can also be set from the command line using the -D option. Only ordinary macros can be defined using the -D option, not macros with parameters. .P Macro text cannot begin or end in the middle of a token, like a keyword or a number or a string. Usually it will be clear what things are tokens; generally tokens end where you are allowed to have white space. But there are a few obscure cases. For historical reasons that are now hard to change, "dashed tie" or "dashed slur" or the per-note versions of "dashed ~" and " dashed <>" (or the "dotted" counterparts of any of these) are treated as a single token. That means you can't define one macro for "dashed" and another for "tie" and put them together and have that be recognized. .Hh macparm .H 3 "Macros with parameters" .P Macros defined within Mup input can be defined to have "parameters." .Ix aD This may be useful when you have something that is repeated with small variations. When defining a macro with parameters, the macro name must be followed immediately by a ( with no space between the end of the name and the parenthesis. The opening parenthesis is followed by one or more parameter names, separated by commas, and ending with a close parenthesis. Parameter names have the same rules as macro names: they consist of uppercase letters, numbers, and underscores, starting with an uppercase letter. The parameter names can then appear in the text of the macro definition where you want a value to be substituted. .P As an example, suppose you are doing a score with staffs 1 through 4 for vocal parts, and staffs 5 and 6 for a piano accompaniment, and that you frequently want to mark a dynamics change at the same point in time below each of the vocal scores and between the two piano staffs. You could typically do this with something like: .Ex boldital below 1-4: 1 "ff"; boldital between 5&6: 1 "ff"; .Ee but if you needed to do this lots of times, it could get tedious. So let's define a macro with parameters: .Ex define DYN( COUNT, VOLUME ) boldital below 1-4: COUNT VOLUME; boldital between 5&6: COUNT VOLUME; @ .Ee This macro has two parameters, which have been given the names COUNT and VOLUME. When you call the macro, you will give them values. For example, .Ex DYN(1,"ff") .Ee would give a VOLUME of "ff" at COUNT 1, whereas .Ex DYN(3.5,"mp") .Ee would give a VOLUME of "mp" at COUNT 3.5. .P When calling a macro with parameters, the values to give the parameters are given inside parentheses. The values are separated by commas. The values in the parentheses are copied exactly as they are, including any spaces, newlines, macro names, etc. There are only a few exceptions to this: you can include a comma, closing parenthesis, or backslash as part of a parameter value by preceding it with a backslash, and a backslash followed by a newline in a parameter value will be discarded. Thus a macro call of .Ex MAC(\e\e\e,\e)) .Ee has one parameter, the text of which is 3 characters long: a backslash, comma, and closing parenthesis. If you backslash other characters, they will be copied without the backslash, but doing this on anything other than a double quote will produce a warning, because it seems unlikely the backslash was really needed. .P .Hm quoting If in a macro definition a parameter is used inside backticks, as in \(gaNAME\(ga, the value of the parameter will be placed .Ix iT inside double quotes. Thus, another way to do the example above would be: .Ex define DYN( COUNT, VOLUME ) boldital below 1-4: COUNT \(gaVOLUME\(ga; boldital between 5&6: COUNT \(gaVOLUME\(ga; @ DYN(1,ff) DYN(3.5,mp) .Ee .P Conceptually, when the macro is expanded, the backticks are replaced by double quote marks, but in addition, any double quote mark found in the value being passed to the parameter will have a backslash inserted before it, and any backslash that occurs within double quotes in the value will also have a backslash inserted before it. Thus, for example: .Ex // If we define a macro like this: define QUOTED(X) \(gaX\(ga @ // then for input value passed is \(gaX\(ga would be which would print as print QUOTED(hello) hello "hello" hello print QUOTED("hello") "hello" "\e"hello\e"" "hello" print QUOTED(\e\en) \en "\en" a literal newline print QUOTED("\e\en") "\en" "\e"\e\en\e"" "\en" .Ee .P Sometimes it can be a little tricky to get the number of backslashes right, or other details like that. .Hr cmdargs.html#Eoption The -E Mup command line option shows how macros will expand, which may help you figure out what to do. .Hh concat .H 3 "Concatenating macro names" .P Inside the ` ` it is possible to use ## to concatenate the values of two or more macros to form a macro name, whose value is then converted to a string. This is probably easiest to understand from an example. This example shows a way to print .Ix hV capo and real chords. .Ex 1 // Define some guitar chords define D d0 g2 b3 e2 @ define F e'1 a3 d3 g2 b1 e1 @ define A a0 d2 g2 b2 e0 @ define C a3 d2 g0 b1 e0 @ // Define the mapping of F and C transposed by a minor third define TR_F D@ define TR_C A@ // This is used by the K macro below to derive a pasted-together macro name define TR TR_@ // Define a macro that will print both real and capo chords, // when given a count at which to print, and the real chord name. define K(COUNT, NAME) bold chord all align 2: COUNT `TR##NAME`; // capo chords ital(9) chord all align 1: COUNT `NAME`; // real chords @ score .\" leftmargin=2 .\" rightmargin=2 staffs = 3 key = 1& staff 2 transpose = up min 3 staff 3 stafflines = tab music // Use the K macro to print the real and capo chords K(1,F) K(3,C) 1: 2f;c; // Enter the chords as you would think about them, but transpose them. 3: 2 TR_F;TR_C; bar .Ee .P The capo chords line is the one of interest here, which has the `TR##NAME`. The TR macro will be evaluated, and found to have a value of TR_. At the first place the K macro is called, the value being passed to the NAME parameter is F. Those two values (TR_ and F) are concatenated to form TR_F and that macro is then looked up, and found to have the value D. That is then made into a string (because of the ` ` enclosing the construct) and printed. On the second call to K, a C is passed to NAME, so the pasted-together name will be TR_C, which then yields "A" to be printed. On the second-last line, the TR_F gets replaced by the correct notes for a transposed F, namely a D chord, and the TR_C gets replaced by the correct notes for an A chord. Thus the various TR_F macros, along with the K macro, adjust the music for having capo. In a real example, there would likely be more chords, with an additional TR_ macro to map each one. .P It is possible to paste more than two macro names together, as in `AA##BB##CC##DD` but each component must represent a valid defined name, and the result of pasting them all together must also yield a valid defined macro name. .Hh arrow .H 3 "A complex macro example" .P Let's look at an example of much more complicated use of macros. This example demostrates the use of arithmetic functions described in the .Hr tags.html section on location tags. We will draw a line with an arrow between notes on two different staffs. While it may be possible to write the expressions directly, the result would be very hard to read and understand, so using macros to build up the pieces of the expression can be very helpful. .Ex 1 define HEAD_LENGTH 5 @ define HEAD_WIDTH 3 @ define ANGLE(X1,Y1,X2,Y2) atan2((Y2) - (Y1), (X2) - (X1)) @ define COS(X1,Y1,X2,Y2) cos(ANGLE(X1,Y1,X2,Y2)) @ define SIN(X1,Y1,X2,Y2) sin(ANGLE(X1,Y1,X2,Y2)) @ define HEAD_X(X1,Y1,X2,Y2) (HEAD_LENGTH * COS(X1,Y1,X2,Y2)) @ define HEAD_Y(X1,Y1,X2,Y2) (HEAD_LENGTH * SIN(X1,Y1,X2,Y2)) @ define HB_X(X1,Y1,X2,Y2) ((X2) - HEAD_X(X1,Y1,X2,Y2)) @ define HB_Y(X1,Y1,X2,Y2) ((Y2) - HEAD_Y(X1,Y1,X2,Y2)) @ define THICK_LEN (HEAD_WIDTH / 2) @ define THICK_X(X1,Y1,X2,Y2) (THICK_LEN * SIN(X1,Y1,X2,Y2)) @ define THICK_Y(X1,Y1,X2,Y2) (THICK_LEN * COS(X1,Y1,X2,Y2)) @ define FEATH_UP_X(X1,Y1,X2,Y2) (HB_X(X1,X2,Y1,Y2) - THICK_X(X1,Y1,X2,Y2)) @ define FEATH_UP_Y(X1,Y1,X2,Y2) (HB_Y(X1,X2,Y1,Y2) + THICK_Y(X1,Y1,X2,Y2)) @ define FEATH_DN_X(X1,Y1,X2,Y2) (HB_X(X1,X2,Y1,Y2) + THICK_X(X1,Y1,X2,Y2)) @ define FEATH_DN_Y(X1,Y1,X2,Y2) (HB_Y(X1,X2,Y1,Y2) - THICK_Y(X1,Y1,X2,Y2)) @ define ARROW(X1,Y1,X2,Y2) medium line (X1, Y1) to (X2, Y2) medium line (X2, Y2) to (FEATH_UP_X(X1,Y1,X2,Y2), FEATH_UP_Y(X1,Y1,X2,Y2)) medium line (X2, Y2) to (FEATH_DN_X(X1,Y1,X2,Y2), FEATH_DN_Y(X1,Y1,X2,Y2)) @ score staffs = 2 .\" leftmargin=1.5 .\" rightmargin=1.5 staff 2 clef = bass music 1: c =h; r; 2; 2: r; g =k; e; g; bar ARROW(h.x + 2, h.y - 1, k.x - 2, k.y + 1) .Ee .Hh saverest .H 3 "Saving and restoring macros" .P You can take a snapshot of all your current macro definitions by using the savemacros command, and then restore that set of definitions later using the restoremacros command. These are both followed by a quoted string, which is a name you give to the saved definitions. This might be useful if, for example, you had a multi-movement piece, and wanted to use one set of macros on the first and third movements, but a completely different set on the second movement. You could save the macro state at the very beginning under one name, and after the first movement under a different name. Before the second movement, you could restore to the original state with no macros defined, and define your second set. Before the third movement, you could restore the macros as they had been at the end of the first movement. .P Another possible use would be if you have several standalone files, each containing a complete song, and you want to "include" those files in another file. By putting a save/restore around each .Hr include.html include, you can prevent any macro definitions in one file from interacting with those from another file. .P Here is a very simple example, using single measures rather than a whole movement or song. .Ex 1 .\" score leftmargin=2 ; rightmargin=2 // Define one "global" macro that will stay around, // by defining it before doing any savemacros. define ONE_MEAS score BSTYLE music 1: 8c;;e;;A 2g; bar @ // Save just that one macro as the "default." savemacros "default" // Now define a couple other macros and save the macros. define BSTYLE beamstyle=2,2 @ define A [with >] @ // Note that the name can be any arbitrary text string. savemacros "2,2 >" // Restore the default setting and set macros // with the same names to different values. restoremacros "default" define BSTYLE beamstyle=4,4,4,4 @ define A [with ^] @ savemacros "4,4,4,4 ^" // Now use the "global" macro with each saved macro state. restoremacros "2,2 >" ONE_MEAS restoremacros "4,4,4,4 ^" ONE_MEAS .Ee .P If you do another savemacros using the same name as you had already used, the old state is forgotten and replaced with the new. .P Often, though not always, you may want to use .Hr param.html#saverest saveparms/restoreparms at the same places as you use savemacros/restoremacros. .Ht Generalized conditionals .Hd ifclause.html .H 3 "Generalized conditionals" .P Mup also supports more general "if" clauses. If you happen to be familiar with the preprocessors for the C and C++ programming languages, Mup "if" clauses are very similar. If you're not, that's okay, since things are explained below. Also, some of the operations are really very rarely needed, so if you find some of them confusing, you just can skip past this section; you'll likely never have a need for the complicated operations anyway. .P The general form is .Ex \fBif\fR \fIcondition\fR \fBthen\fR \fIMup statements\fR \fBelse\fR \fIMup statements\fR \fBendif\fR .Ee As with the "ifdef," the "else" and second set of Mup statements is optional. .P One form of "if" is really just a variation of ifdef. It uses the keyword "defined" followed by a macro name. So .Ex ifdef DUET .Ee could also be written .Ex if defined DUET then .Ee You may put a set of parentheses around the macro name for clarity if you wish: .Ex if defined(DUET) then .Ee .P The ! is used to mean "not," so .Ex ifndef TRIO .Ee could also be written as .Ex if ! defined(TRIO) then .Ee .P So far, this just looks longer, so what's the advantage? The difference is that ifdef and ifndef can only be used to check if a single macro is defined or not, whereas the "if" condition is much more general, and therefore much more powerful. Decisions can be based on the values of macros, not just whether they are defined or not, and can also be based on more than one macro at a time, Here is an example of a condition based on several macros at once: .Ex if defined(FULL_SCORE) && defined(TRANSPOSE_UP) && ! defined(MIDI) then .Ee would be true only if both FULL_SCORE and TRANSPOSE_UP were defined, but MIDI was not defined. The && means "and." There is also || which means "or," so .Ex if defined(CELLO) || defined(STRINGBASS) .Ee would be true as long as at least one of the macros was defined. .P The condition can also include numbers and macros used as numeric values in arithmetic and comparisons. For example, .Ex define STAFFS 3 @ define S 5 @ if STAFFS > 5 then // ... this would not be executed, since 3 is not greater than 5 endif if 2 <= STAFFS then // ... This would be executed, since 2 is less than or equal to 3 endif if STAFFS + 1 == S - 1 then // ... This would be executed, since 3+1 equals 5-1 endif .Ee Note that the symbol to test for "equals" is two equals signs, not just one. This is to be consistent with what is used in the C and C++ languages. The operators for comparisons are: .TS l l. < less than > greater than <= less than or equal >= greater than or equal == equal != not equal .TE .P Note that the values in the conditions can only be either literal numbers or macros whose values evaluate to a number. They cannot be things like .Hr param.html Mup parameters. A macro that is not defined is treated as having a value of zero. Macro values are substituted for macro names just as elsewhere in Mup, so if you use a macro whose resulting value does not evaulate to a number, you may get an error or other unexpected result. .P If you are familiar with "octal" and "hexadecimal" numbers, they can be used, following the C language convention of a leading zero for octal or a leading 0x for hexadecimal. (If you're not familiar with these numbers or conventions, don't worry about it; it's never really necessary to use them. Just make sure you don't accidentally start a number other than a zero with a zero). .P Values are limited to 32-bit signed whole numbers. (If you don't know what that means, what you need to know is that you can only use numbers between -2147483648 and 2147483647, and cannot use fractions.) Results of arithmetic on values will also be whole numbers, so division will result in either rounding or truncation to a whole number, and the exact characteristics may be system dependent. .P Before we introduce the remaining operators, it would be good to discuss two concepts, called precedence and associativity. These determine the order in which operations are done. Consider the following expression: .Ex 5 + 3 * 8 .Ee What is its value? If we just went left to right, we would add 5 and 3, getting 8, then multiply by 8, for a final value of 64. However, multiplication is generally considered to have higher "precedence" than addition, meaning that multiplications should be done before additions. In other words, the expression should actually be treated as .Ex 5 + (3 * 8) .Ee so we would first multiply 3 by 8, getting 24, and then add 5 and 24, obtaining a final answer of 29. .P If you really intended the 64 meaning, that could be shown by parentheses, indicating you want the addition to be done first: .Ex (5 + 3) * 8 .Ee .P Associativity determines whether operators of equal precedence are done left to right or right to left. Parentheses and all of the operators that have two operands associate left to right, while all the others associate right to left. For example, since addition and subtraction associate left to right, the expression .Ex 10 - 6 - 1 .Ee would be evaluated by first subtracting 6 from 10 to get 4, then subtracting 1, yielding 3. If they associated right to left, first 1 would be subtracted from 6 to get 5, which would then be subtracted from 10, yielding 5. So using different associativity can lead to different answers! .P Since the "not" operator and unary minus associate right to left, in the expression .Ex ! - (5) .Ee the unary minus would be applied first to get -5, then the "not" would be applied. But what does "not -5" mean? The "not" operator will treat its operand as a Boolean value, with a value of zero meaning false, and any non-zero value being true. Since -5 is not zero, it represents "true," and "not true" would be "false," or zero. By the way, any operator that yields a Boolean result (not, logical and, logical or, less than, greater than, less than or equal, greater than or equal, equal, or not equal) will always yield 1 for true, even though any non-zero value could mean true. .P The operators are listed below. Those on the same line have the same precedence, with those on each line having higher precedence than the lines below. .TS center, allbox; l l l. \fBoperators\fP \fBoperations\fP \fBassociativity\fP _ \f(CW( )\fP grouping left to right \f(CW! ~ - +\fP not, one's complement, unary minus, unary plus right to left \f(CW* / %\fP multiply, divide, modulo left to right \f(CW+ -\fP add, subtract left to right \f(CW<< >>\fP left shift, right shift left to right \f(CW< <= > >=\fP less than, less or equal, greater than, greater or equal left to right \f(CW== !=\fP equal, not equal left to right \f(CW&\fP bitwise AND left to right \f(CW^\fP bitwise XOR left to right \f(CW|\fP bitwise OR left to right \f(CW&&\fP logical AND left to right \f(CW||\fP logical OR left to right \f(CW? :\fP interrogation right to left .TE .Ht Mup include files .Hd include.html .H 2 "Include" .P .Ix aO The "include" statement can be used to include the contents of one file inside another. .Ex \fBinclude "\fP\fIfilename\fP\fB"\fP .Ee causes input to be read from the specified \fIfilename\fP. When the end of that file is reached, reading of input resumes from the original file after the include statement. .P If the \fIfilename\fP cannot be found as is, and it is not an absolute path, and if the environment variable MUPPATH is set, Mup will search for the file in each directory listed in MUPPATH. On Unix systems, the directories are separated by colons. On systems with DOS-like file naming conventions, they are separated by semicolons. The MUPPATH may be useful if, for example, you have a number of "boilerplate" files that you want to include in lots of songs. You can put them in some directory and set MUPPATH to list that directory; then any Mup files you have can refer to them. If a file by the name given is not found, and that name does not already have a .mup or .MUP suffix, the MUPPATH is searched again with suffix added. On systems where file names are case sensitive, .mup takes precedence over .MUP. If the file is not found in MUPPATH, then the directory of the "including" file is searched. .Ht Exit .Hd exit.html .H 2 Exit .P The exit statement will cause the rest of the input to be ignored. This might be useful if you haven't finished cleaning up the end of a piece, but would like to take a look at (or listen to) everything before that. Anything after the exit statement will be ignored. .Ht User-defined symbols .Hd udefsym.html .H 2 "User-defined symbols" .P Mup provides the most common musical symbols, but there are various other symbols that have been used over the centuries. If Mup doesn't provide some specific symbol that you would like, you can define up to 160 of your own symbols, as well as override any of the .Hr textstr.html#symlist built-in music symbols with your own versions. Most people will never need this facility, so feel free to skip past this section unless you feel you do need it. .P To define your own symbols, the description of how to draw those symbols must be provided as PostScript code. On the one hand, that means that unless you can find someone else's definition of just what you want, you will need to understand PostScript at least well enough to define your own. On the other hand, this gives access to the full power of the PostScript language, which lets you define essentially any kind of symbol you want. The PostScript language is beyond the scope of this User's Guide, but there are many books and Internet resources to help you learn, if you are interested. You can also look at the output that Mup generates for examples. If you want something similar to an existing Mup symbol, looking at its definition is probably the best place to start. .P A user-defined symbol or override is put in "symbol" context. The general format of this context is as follows: .Ex \fBsymbol "\fP\fIname\fP\fB" postscript = "\fP\fIPostScript code to draw the symbol\fP\fB" bbox = \fP\fIllx, lly, urx, ury\fP \fBystemoffset = \fP\fIup, down\fP\fR .Ee The three parameters can be supplied in any order, but only once each per symbol. The ystemoffset parameter is optional, and only used for symbols that will be used as noteheads. This is described in more detail .Hr udefsym.html#notehead later. The name and the postscript and bbox parameters are mandatory. .P The name for a user-defined symbol must include at least one letter, and can include letters, numbers, and underscores. It must be different than existing names for .Hr textstr.html#special non-ASCII characters. .P You can refer to user-defined symbols just like the built-in symbols, using their name in a .Hr mussym.html mussym statement, or in a .Hr textstr.html#symlist text string using the name inside \e( ). Adding the prefix "sm" to a name will result in a "small" version, just like with the built-in symbols. .P In addition to naming and defining your own symbols, you can also override the definitions of existing music symbols. Suppose, for example, you want a different style of C clef. You can then supply a symbol context for "cclef" and provide your own PostScript. .P A symbol definition applies to the entire file, no matter where in the file it is defined. If you try to define the same symbol more than once, a warning will be issued, and the last definition will be used. A user-defined symbol must have its "symbol" context before it is referenced. .P The symbols you define will become part of a PostScript Type 3 font. Symbols must be defined in a 1000 unit scale coordinate space, where 300 units equals one stepsize, with the symbol's "logical center" at (0, 0). Limitations of Type 3 fonts apply. For example, since PostScript does not allow using setrgbcolor or sethsbcolor after a setcachedevice operation in a BuildChar procedure, it is not possible to change the color of a symbol. The PostScript code will be written to the output exactly as it is, so you will have to provide any escaping needed by PostScript. The normal Mup text string escape rule of needing to put a backslash before a double quote inside a text string also applies. So, for example, suppose you wanted to output a PostScript style string containing a parenthesis inside double quotes. Since PostScript requires a parenthesis inside a string to be preceded by a backslash, the Mup input would require the backslash as well, and since Mup requires double quotes to be backslashed, that would need to be done. So Mup input of: .Ex postscript="(\e"\e(\e")" .Ee would result in: .Ex ("\e(") .Ee being copied to the PostScript output. (Of course, that is not a good symbol definition; it is just intended to show needed escapes.) As with any Mup text string, the postscript string can be as many lines long as you wish. But note that the .br .nf .na postscript = " .fi .ad .br part must all be on one line. .P There isn't currently any good way to call a PostScript procedure from within a symbol definition. So if you have some some code that is common to several symbols, probably the best way to handle that is to define a Mup .Hr macros.html macro for the common code, and then use the macro in the postscript string: .Ex define COMMONCODE \fI....the common code....\fP @ postscript = "\fI...some specific code\fP " + `COMMONCODE` + " \fImore specific code\fP" .Ee .P The bounding box lists four numbers, giving the (x,y) coordinates of the lower left and upper right corners of the smallest box that can contain the symbol. It is in the same units as the symbol itself: 300 units per stepsize. Normally you should define the bounding box to include a small amount of white space padding around what is actually drawn, typically about 100 units, so that if it is printed right next to another symbol, they won't touch. However, in the case of a symbol you want to use as a .Hr udefsym.html#notehead notehead, you should not include any padding, so that stems will touch the notehead. .P .Hm notehead If you want to use a user-defined symbol as a .Hr param.html#notehead notehead, you need to specify the "ystemoffset" parameter. If the symbol is not to be used as a notehead, you should omit that. The ystemoffset is given as two numbers, the first for when the stem is up, the second for when it is down. They specify, in the same units as the symbol itself (300 units per stepsize), where on the y axis the stem should begin. Any notehead should be defined with its vertical center at y of zero. So if you want the stem to start at the vertical center of the note, the ystemoffset would also be zero. A stepsize below the center of the note would be -300, a half stepsize above would be 150, etc. In the x dimension, the stem is always placed at the edge of the note, as given by the bbox. .P If you need an "upside-down" version of a notehead, just name the upside version of the symbol with a "u" prefix on the name of the right side up version. Then you can use the normal u? convention in .Hr shaped.html#hdshape headshapes context, and Mup will take care of the rest. .P Once defined, a user-defined symbol can be used just like the built-in symbols. There are only a few places where Mup uses some special knowledge of the characteristics of music symbols, but in those cases, if you redefine the symbol to have different characteristics, Mup may not place things quite as perfectly as you would like. One place where this might happen is if you redefine the symbol for flat, natural, or dblflat, to make them significantly different, since Mup tries very hard to pack accidentals as tightly as possible, based on some intimate knowledge of the shapes of the built-in versions. .P Here is an example that shows both overriding a built-in symbol and defining a completely new symbol, and then using them. .Ex 1 .\"score .\" leftmargin=1.5 .\" rightmargin=1.5 .\" scale=1.5 // Override the built-in xnote to have thicker lines symbol "xnote" bbox=-435, -365, 435, 375 postscript="gsave % normal xnote has 120 linewidth; we set to 300 here 1.15 1 scale 300 setlinewidth 1 setlinecap -300 -300 moveto 300 300 lineto stroke -300 300 moveto 300 -300 lineto stroke grestore" ystemoffset=300, -300 // Define a smiley face symbol. symbol "Smiley" bbox=-700, -700, 700, 700 postscript="gsave 100 setlinewidth % the face 0 0 600 0 360 arc stroke % the mouth 0 0 300 -160 -20 arc stroke % the eyes -200 200 100 0 360 arc fill 200 200 100 0 360 arc fill grestore" ystemoffset = 0, 0 headshapes // Set up to use the extra-thick xnote // for quarter or shorter, and Smiley for longer. "boldxnote" "xnote Smiley Smiley Smiley" music 1: [hs "boldxnote"]...g;8b;d+;2g; // You can use the user-defined symbol just like a built-in mussym above 1: 1.5 "Smiley"; // You can apply size just like for a built-in rom below 1: 2 "\e(Smiley) \es(+5)\e(Smiley) \es(+5)\e(Smiley)"; bar .Ee .Ht Mup font files .Hd fontfile.html .H 2 "Installing other fonts" .P The "fontfile" statement is used to override a Mup font with some other font. You may place one or more of these anywhere in Mup input. This might be used either because you'd like a different style of printing, or because you need a different alphabet. .Hr ../mkmupfnt.ps The "mkmupfnt" program that is distributed with Mup can be used to generate a font description file. You can then use .Ex fontfile "file" .Ee in your Mup program, where the given "file" is the name of the font description file. The manual page for mkmupfnt describes how to use that program. It also describes the format of the font description file, in case you wish to generate it by some means other than the mkmupfnt program. .P Mup searches for fontfiles via the MUPPATH mechanism, just like for .Hr include.html included files. .Ht Custom Accidentals and Alternate Tunings .Hd tuning.html .H 1 "CUSTOM ACCIDENTALS AND ALTERNATE TUNINGS" .P Mup supports custom accidentals: the ability to use any character, including a .Hr udefsym.html user-defined symbol, as an .Ix bL accidental. They can be placed on notes, though not in key signatures. Feel free to skip this section; many Mup users will probably never use the features described here. .P .Ix aA If you want to generate .Hr midi.html MIDI for a piece using custom accidentals, a method is provided for defining their frequency offsets. You can also override the default frequency offsets of the standard (built-in) accidentals (#, &, n, x, &&). Also, you can specify a .Hr param.html#tuning tuning other than the standard equal temperament tuning, and you can .Hr param.html#a4freq define a pitch level different from the standard of the note a4 being 440 Hz. .P Note that some MIDI players, including the standard Microsoft Windows Media Player, do not support the special MIDI commands that are needed for these features. .H 2 "Printing custom accidentals" .P Although you can use an existing character as a custom accidental, typically you would want to define a new one, as explained in the .Hr udefsym.html section on user-defined symbols. When you put a custom accidental on a note, the x axis of the symbol (the place where y is 0) will be aligned vertically with the note. The position of the y axis (the place where x is 0) does not affect the positioning. .P The Mup distribution contains two "include" files of symbol definitions that can be used as custom accidentals. The file "quarterstep_accs" defines accidentals intended for use as quarter steps and three quarter steps. The file "helmholtz_accs" defines many of the accidentals needed for a system called the Extended Helmholtz-Ellis Just Intonation Pitch Notation. Even if you don't intend to use these files in your music, you can use them as examples of how to define symbols. .P In a Mup input file, a custom accidental is put after a note letter similarly to a standard accidental. It is specified by the name of the accidental as a string inside braces. .Ex 1 .\"score leftmargin=2; rightmargin=2; time = 6/8; beamstyle = 4., 4. include "quarterstep_accs" music 1: 8f{"qsharp"}; f#; f{"tqsharp"}; g{"qflat"}; g&; g{"tqflat"}; bar .Ee To reduce the amount of typing, you can define .Hr macros.html macros for the accidentals. For example: .Ex define QS {"qsharp"} @ .Ee You can put up to four accidentals on a note. They can be any combination of standard and custom accidentals. You can put parentheses around the entire set, and parentheses will be drawn around the set. You cannot put parentheses around just a subset of them. .H 2 "MIDI for custom accidentals and alternate tunings" .P The parameters and the accidentals context described in this section need not be used if you do not intend to generate MIDI. In that case it is only necessary to define the symbols for the custom accidentals you are using. .H 3 "Defining custom accidentals for MIDI" .P To generate MIDI for a piece that uses custom accidentals, their frequency offsets must be defined in an "accidentals" context. A frequency offset tells how much the accidental alters the pitch of the note. It can be specified in any of these ways: .DL .LI A positive number by which the note's frequency is to be multiplied. It may include a decimal fraction part (e.g., 0.97 or 1.5). Of course, a number greater than 1 will raise the pitch, and a number less than 1 will lower the pitch. .LI A ratio of two positive numbers; that is, two numbers with a / between them. Mup will divide the numbers and multiply the note's frequency by the result. The numbers may include decimal fraction parts, though whole numbers are more often used when stating ratios for this. .LI A + or - sign followed by a number and the word "cents". The number may include a decimal fraction. A cent is 1/100 of an equally tempered halfstep, or in other words, 1/1200 of an octave. The note's frequency will be multiplied by 2 to the cents/1200 power. So a positive cents value will raise the pitch, and a negative cents value will lower the pitch. .LE .P Each line in an accidentals context contains a symbol name in quotes followed by either the word "all" followed by a single offset, or a list of 1 to 7 note letter / offset pairs. In the single offset case, this same offset will be applied when the accidental is used on any of the 7 notes, a through g. In the other case, each offset follows the note letter it is to be applied to. Not all note letters need to be listed, but a custom accidental cannot be used if the value for its note letter has not been defined. .P Any of the standard accidentals can also be listed in an accidentals context: "sharp", "flat", "nat", "dblsharp", "dblflat". Offsets are set for them the same way as for custom accidentals. If any notes are not specified in a list of note letter / offset pairs, the default offset (as described in the section below on tuning) is used for them. A standard accidental for which no line is provided will use the default value for all notes. .P By default a natural has a ratio of 1 and it doesn't change the pitch. But you can define a different ratio for it. Note also that when a note has no accidental, it is treated the same as if it had a natural on it. .P The first line of an accidentals context consists of the word "accidentals" followed by a name you provide in quotes. To make use of it, in a score context you set .Hr param.html#acctable the acctable parameter equal its name in quotes. It will be used starting at that point in the file until such time as you change acctable. The accidentals context must occur earlier in the file than the place it is referenced. You can define any number of accidentals contexts. If "acctable" is not set, only standard accidentals can be used, and they will have their default offsets. .P The following is an example of an accidentals context: .Ex accidentals "mine" "acc1" all 23/22 "acc2" all 1.0873 "acc3" all +87 cents "acc4" c 17/18 f 0.9103 g -93 cents .Ee .P It is possible to define an invisible accidental. This is useful in cases where you want to alter the pitch of a note for MIDI but you don't want it to print anything. In the symbol definition for an invisible accidental, you print nothing, and you need to set the bounding box to all zeros. .H 3 "Setting the pitch level" .P The standard pitch of the note a4, the A above middle C, is 440 Hz. With the .Hr param.html#a4freq a4freq parameter, you can set this to a different number. The frequencies of all other notes are figured relative to a4, so if you set a4freq to frequency X, their frequencies will be multiplied by X/440. .H 3 "Setting the type of tuning" .P The .Hr param.html#tuning tuning parameter lets you set the tuning system to "equal", "pythagorean", or "meantone". Each tuning sets differently the frequencies of the "white" notes (a through g) and the default offsets of the standard accidentals. Naturals, however, have default ratio 1 (or 0 cents) in all of these tunings. .H 4 "Equal temperament" .P The default value of "tuning" is "equal", which means equal temperament, the modern standard for Western music. In this system, all half steps are equal. Since there are 12 half steps in an octave, each has a ratio of the twelfth root of 2, about 1.05946, which is 100 cents by definition. When this tuning is set, the default value of a sharp is this ratio, and a flat is the inverse, 0.94387, or -100 cents. For a double sharp you square the sharp ratio (1.12246) or double the number of cents (200). For a double flat you square the flat ratio (0.890900) or double the number of cents (-200). .H 4 "Pythagorean tuning" .P Pythagorean tuning is based on a perfect fifth having a ratio of 3/2 (1.5), which works out to about 702 cents. Starting from the reference note a4, the other notes are determined by going around the circle of fifths, using this ratio. So, if you are using the default 440 for a4, e5 would be 660, b5 would be 990, etc. To get from any natural note to its sharp version in the same octave (like f4 to f#4), you go up 7 fifths and down 4 octaves: (3/2)^7 / 2^4 = 2187/2048, about 1.06787 or 114 cents. So a sharp is defined to be that ratio. A flat is the inverse, 0.93644, or -114 cents. For a double sharp, square the sharp ratio (1.14035) or double the cents (227). For a double flat, square the flat ratio (0.87692) or double the cents (-227). .P Pythagorean tuning is usually not used with only its default intervals and accidentals. It is usually used with custom accidentals or redefining the ratios for standard accidentals, as shown in examples below. .H 4 "Meantone tuning" .P Meantone tuning is based on a major third being 5/4 (1.25), or about 386 cents. Perfect fifths are the fourth root of 5, so that if you go up 4 fifths and down 2 octaves, you get the 5/4 for the major third. Using this value for a fifth (about 1.49535 or 697 cents), the other notes are determined by going around the circle of fifths, using this ratio. To get from any natural note to its sharp version in the same octave (like f4 to f#4), you go up 7 fifths and down 4 octaves: (5^(1/4))^7 / 2^4, about 1.044907 or 76 cents. So a sharp is defined to be that ratio. A flat is the inverse, 0.95702, or -76 cents. For a double sharp, square the sharp ratio (1.09183) or double the cents (152). For a double flat, square the flat ratio (0.91589) or double the cents (-152). .P Meantone is a compromise that lets you approximate the sound of just intonation in any key, without having to use custom accidentals or redefining standard accidentals. .H 3 "Using just intonation" .P This section illustrates the use of custom accidentals and the related parameters by showing two ways to set up standard just intonation scales, with all the major, minor and perfect intervals, plus the augmented fourth. For an example, we will use a key note of c, and we will have a4 be 440 Hz. .P Here are the ratios for the just intervals from c up to each other note: .Ex 1 .\"score leftmargin=1.25; rightmargin=1.25; time = 13/1n .\"music .\"rom above 1: 1 "P1"; 2 "m2"; 3 "M2"; 4 "m3"; 5 "M3"; 6 "P4"; 7 "A4"; .\"rom below 1 dist 5: 1[-1] "1/1"; 2[-3] "16/15"; 3 "9/8"; 4[-1] "6/5"; .\"rom below 1 dist 5: 5[-1] "5/4"; 6[-1] "4/3"; 7[-2] "45/32"; .\"rom above 1: 8 "P5"; 9 "m6"; 10 "M6"; 11 "m7"; 12 "M7"; 13 "P8"; .\"rom below 1 dist 5: 8 "3/2"; 9[-1] "8/5"; 10[-1] "5/3"; 11[-1] "16/9"; .\"rom below 1 dist 5: 12[-1] "15/8"; 13[-1] "2/1"; .\"1: 1cn; d&; dn; e&; en; fn; f#; gn; a&; an; b&; bn; cn+; .\"bar .Ee .P For both methods, we'll start with pythagorean tuning. Going around the circle of fifths starting from c, we find that this g and d agree with pythagorean. But a would be 27/16. To arrive at 5/3, we need to multiply the 27/16 by 80/81. This lowers it by a "syntonic comma". It turns out that e, b, and f# also need to be lowered by that amount. Going the other direction, we find that f and b& agree, but e&, a&, and d& need to be raised by 81/80, a syntonic comma. .P For the just a to be 440 Hz, the pythagorean a has to be 445.5 (multiply by 81/80). So we set a4freq to 445.5. .H 4 "First method: redefine standard accidentals" .P For the first method, we use normal notation (standard accidentals), but redefine their offsets as necessary to achieve the ratios shown above. .P Consider e&. The pythagorean e is 81/64. (Up four fifths from c, then down two octaves.) To get to the 6/5 that we need for e&, we have to multiply 81/64 by 128/135. So when they are used on the note e, flats should be 128/135. .P Using similar reasoning, we find that flats on a and d should also be 128/135. But flats on b should be 2048/2187. The sharp on f should be 135/128. .P Naturals also need to be redefined when they differ from their pythagorean values. We have already found those values: naturals on a, e, and b need to be 80/81. The other natural notes agree, and we can let them default to 1/1. Remember, when a note appears without any accidental on it, is is treated the same as if it had a natural. .P So, the following will set up everything as required: .Ex accidentals "key_of_c_just" "flat" d 128/135 e 128/135 a 128/135 b 2048/2187 "sharp" f 135/128 "nat" e 80/81 a 80/81 b 80/81 score a4freq = 445.5 tuning = pythagorean acctable = "key_of_c_just" .Ee .P Notes not defined in this table will default to their pythagorean values. We have found that those are the correct values for naturals. But they are probably wrong for sharps, flats, double sharps, and double flats. If you wanted to use any of those notes, you would have to decide what its ratio should be, and then figure out what offset should be put in the table. Especially for notes far from the key center (c), it is not obvious what ratio you would want. .P This brings up a problem. You may need multiple versions of some notes, even for ones not far from the key center. For example, the ratio 5/3 is used for a. That works well if you are playing an F major chord, fac+. But if you are playing a D minor chord, dfa, that is not the right ratio. To get a perfect 3/2 fifth from d to a, you would want a to be 27/16. This leads us to the second method. .H 4 "Second method: use custom accidentals" .P This method also uses pythagorean tuning as a basis, but instead of redefining the standard accidentals to different values for different notes, it defines custom accidentals for offsets that differ from the pythagorean defaults. Each accidental, standard or custom, has the same offset no matter what note it is applied to. .P In simple cases such as the scales we are defining in this section, it turns out that each note either agrees with the pythagorean ratio, or else is higher or lower by a syntonic comma, 81/80 or 80/81. You could define accidentals for up and down commas, and use them alone or together with standard accidentals, as follows: .Ex 1 .\"score leftmargin=1.5; rightmargin=1.5; time = 8/1n; label = "" symbol "commaup" bbox = -350, -700, 350, 700 postscript = "gsave 0 600 moveto -250 135 lineto -230 135 lineto 0 420 lineto 230 135 lineto 250 135 lineto fill 70 setlinewidth 0 500 moveto 0 -600 lineto stroke grestore" symbol "commadn" bbox = -350, -700, 350, 700 postscript = "gsave 0 -600 moveto -250 -135 lineto -230 -135 lineto 0 -420 lineto 230 -135 lineto 250 -135 lineto fill 70 setlinewidth 0 -500 moveto 0 600 lineto stroke grestore" accidentals "just" "commaup" all 81/80 "commadn" all 80/81 score a4freq = 445.5 tuning = pythagorean acctable = "just" define CU {"commaup"} @ define CD {"commadn"} @ music rom 1: 1 "C Lydian"; 1: 1c; d; eCD; fCD#; g; aCD; bCD; c+; bar rom 1: 1 "C Phrygian"; 1: 1c; dCU&; eCU&; f; g; aCU&; b&; c+; bar .Ee Or, you may instead want to define a set of custom accidentals that act as combinations of standard accidentals and commas, and perhaps some accidentals for other ratios. One such set was mentioned earlier: the set defined in the "helmholtz_accs" file that is in the Mup distribution. Using those definitions, the above example looks like this: .Ex 1 .\"score leftmargin=1.5; rightmargin=1.5; time = 8/1n; label = "" include "helmholtz_accs" score a4freq = 445.5 tuning = pythagorean acctable = "helmholtz" define SD {"sharpdn"} @ define ND {"natdn"} @ define FU {"flatup"} @ music rom 1: 1 "C Lydian"; 1: 1c; d; eND; fSD; g; aND; bND; c+; bar rom 1: 1 "C Phrygian"; 1: 1c; dFU; eFU; f; g; aFU; b&; c+; bar .Ee .H 3 "Debugging tuning settings" .P To help verify that you have specified the correct input, you can run the "mup" command with the .Hr cmdargs.html#dbgoption debugging option of "-d 512", along with an .Hr cmdargs.html#moption option to generate MIDI. In addition to some other debugging output, it will print tables to standard error output, which show the frequency being used for each note in your piece. If you change any of the parameters along the way, it will print a table for each section of your piece as delimited by the places where the parameters change. .Ht Mup Parameters .Hd param.html .H 1 PARAMETERS .P .Ix aD Parameters can be set in various contexts. All parameters .Ix fQ have default values, so that you need to explicitly set them only if you want some value other than the default value. .P Some parameters can be set only in the score context. Others can be set in .Ix hJ .Ix hK either score or staff contexts. A few can be set in score, staff, or voice .Ix bF context. If a given parameter can be set in several .Hr contexts.html contexts, the value is that of the parameter at the most specific context in which it is set. For example, if Mup is working on musical data for voice 2 of staff 5, and it needs to look up the value of a parameter, it will first see if that parameter has been set in context "voice 5 2". If so, it will use that value. If not, it will see if the parameter was set in context "staff 5". If that has not been set either, it will use the value from the score context. The score context initially has all parameters set to their default values. There are a few parameters, mostly related to font and text size, that can also be set in .Hr headfoot.html header, footer, and similiar contexts. .P Parameters are set by the following syntax: .Ex \fIparameter_name\fP\fB=\fP\fIvalue\fP .Ee .P Several parameters can be set on a single line by separating them with a semicolon. For example: .Ix hH .Ex staffs=2 ; key=2& ; time=2/4 .Ee .P Parameters can be unset in staff or voice context using .Ex \fBunset\fR\fI parameter_name\fR .Ee Unsetting a parameter in staff context will cause it to revert to its value in score context (unless overridden in voice context). Unsetting a parameter in voice context will cause it to revert to its value in staff context if that is set, otherwise to its value in score context. .P There are a few parameter that can be changed .Hr midmeas.html mid-measure. That is noted in their descriptions. .P .Hm saverest It is possible to take a "snapshot" of the current state of all the parameters, and then restore that state later. This is done in the "control" context. When you want to take a snapshot, you do .Ex control saveparms "some name" .Ee and then to restore, you do .Ex control restoreparms "some name" .Ee using whatever name you used for the save. The name can be anything you like. You can save as often as you like. You can restore from any previous save. .P Here is a simple example that saves the default parameter settings, changes three parameters, and saves again under a different name. It then uses the changed parameters for one measure, restores the defaults for one measure, then restores to the changed values for a measure. .Ex 1 .\"score .\" leftmargin=1 .\" rightmargin=1 .\" scale=0.9 control saveparms "default" score time=cut beamstyle=2,2 key=3& control saveparms "22" music 1: 8c;;;;2e; bar control restoreparms "default" music 1: 8d;;;;2f; bar control restoreparms "22" music 1: 8e;;;;2g; endbar .Ee .P Sometimes when you use saveparms/restoreparms, you may want to use .Hr macros.html#saverest savemacros/restoremacros as well. .P The parameters are listed below in alphabetical order. For each, the description includes the parameter's name, legal values, default value, when it takes effect, and contexts in which the parameter can be set, along with an example of its usage. If there are other related parameters, they are referenced as well. .\" include Parameter index here for html .pI .\" .\" .Hi .ft B .nr Pa \wDescription..... .ft P .de bP .br .di pA .ev 1 .ft R .ps 10 .ta \n(Pau .in +(\n(Pau+0.1i) .fi .. .de eP .br .in 0 .ev .di .ne \\n(dnu .ev 1 .nf .na .pA .fi .ev .. .de Na .sp 3 .ti 0 \fBName\fP .. .de Va .br .ti 0 \fBValue\fP .. .de Df .br .ti 0 \fBDefault\fP .. .de Cn .br .ti 0 \fBContext\fP .. .de mM .br It is possible to change this parameter in the middle of a measure, using << >>. .. .de Te .br .ti 0 \fBTakes effect\fP .. .de Nm .Te at next music context .. .de Ni .Te at next music context, or immediately if mid-measure .. .de Im .Te immediately .. .de Ns .Te at start of next score .. .de Pm .Te immediately for purposes of checking for interactions with other parameters, at next music context for printing .. .de Ps .Te immediately for purposes of checking for interactions with other parameters, at start of next score for printing .. .de Oo .Te applies to entire input, and cannot be changed after music input .. .de Mn .Te at next music context if measnum parameter is "every N," else start of next score .. .de Bw .Te between the current score and the next score .. .de eX .br .ti 0 \fBExample\fP .. .de eS .br .ti 0 \fBExamples\fP .. .de De .br .ti 0 \fBDescription\fP .. .de Sa .br .ti 0 \fBSee also\fP .. .He .\" .\" .\" .\"------------------------- .bP .Na .Hm a4freq a4freq .De This parameter specifies the frequency, in Hertz, of the A in octave 4, which is the A above middle C. .Va 100.0 to 1000.0 .Df 440.00 .Cn score .Nm .eX a4freq = 420.15 .Sa .Hr param.html#acctable acctable, .Hr param.html#tuning tuning .eP .\"------------------------- .bP .Na .Hm aboveord aboveorder .De This parameter specifies in what order to stack items that are printed above a staff. The value is a comma-separated list of all the types of things that can be printed above a staff. Items are stacked in the order listed, starting from just above the staff and working upward. If you want several types to be handled as a single category, with all types in the category having the same stacking priority, separate them with an ampersand rather than a comma. The ampersand cannot be used with lyrics, ending, or reh. The dyn category applies to crescendo and decrescendo marks (from "<" and ">" statements) as well as text with the dyn modifier. The chord category applies to text with chord, analysis, or figbass modifiers. The othertext category applies to rom, bold, ital, and boldital items that do not have a chord, analysis, figbass, or dyn modifier. If you omit any categories, they will be stacked last, in their default order. .Va .Hr mussym.html mussym, .Hr octave.html octave, .Hr textmark.html#chordmod dyn, othertext, chord, .Hr lyrics.html lyrics, .Hr bars.html#endings ending, .Hr bars.html#reh reh .Df mussym, octave, dyn & othertext & chord, lyrics, ending, reh .Cn score, staff .Ns .eX aboveorder = mussym, lyrics, dyn, octave, othertext, chord, ending, reh .Sa .Hr param.html#beloword beloworder, .Hr param.html#betwnord betweenorder, .Hr param.html#chdist chorddist, .Hr param.html#dist dist, .Hr param.html#dyndist dyndist .Ix fT .Ix gA .Ix aE .Ix gW .Ix fR .Ix iN .Ix iM .Ix aR .Ix aQ .Ix gH .Ix gI .Ix gJ .Ix gK .Ix cL .Ix cM .eP .\"------------------------- .bP .Na .Hm acctable acctable .De This parameter specifies which table of accidentals, as defined in an accidentals context, to use. It can be set to nothing, to mean to use only the normal standard accidentals (#, &, x, &&, n) with their default meanings as implied by the .Hr param.html#tuning tuning parameter. .Va a quoted string that matches the name used for an accidental context .Df not set .Cn score .Nm .eS acctable = "my_accs" .br acctable = // set back to default .Sa .Hr param.html#a4freq a4freq, .Hr param.html#tuning tuning .eP .\"------------------------- .bP .Na .Hm addxpose addtranspose .De This parameter specifies by what additional interval to transpose the music data. There is another parameter called just .Hr param.html#xpose transpose. Typically you would use the transpose parameter to change the key of individual staffs (for transposing instruments), and then use the addtranspose parameter if you want to change the key of the entire score. But either of these parameters can be used either way. In any case, for each staff, and for the score, the values of transpose and addtranspose are both applied, one after the other, to the current key signature, notes, and chords to determine their resulting values. The interval can be larger than an octave, but must be a valid interval (e.g., there is no such thing as a perfect 6th). It is an error to specify a transposition value that would result in a key signature with more than 7 flats or sharps. .Ix cG It is also an error if transposition would result in a note requiring a triple sharp or triple flat. .Va the word "up" or "down," followed by an interval and a whole number greater than 0. You can optionally add the keyword "notes" or "chords" at the end, to restrict the transposition to just notes or just chord symbols; by default, both are transposed. The interval is one of major, minor, augmented, diminished, or perfect. .Ix iQ The intervals can be abbreviated to their first three letters (maj, min, aug, dim, or per). The .Hr trnspose.html section on transposition lists transposition intervals and gives further details. Depending on which key signature you are transposing from, some transposition intervals may not work, because they result in more than 7 flats or sharps. .Df up perfect 1 (i.e., no transposition) .Cn score, staff .Nm .eS addtranspose = down major 3 .br addtranspose = up perfect 5 .br addtranspose = up minor 2 notes .Sa .Hr param.html#a4freq a4freq, .Hr param.html#key key, .Hr param.html#xpose transpose, .Hr param.html#useaccs useaccs .Ix fB .Ix fC .Ix gA .Ix cG .Ix hF .eP .\"----------------- .bP .Na .Hm alignlabels alignlabels .De This parmaeter specifies how to align labels for staffs, including those for brace and brackets group. Each nesting level will be aligned independently. This applies to labels relative to each other, not to lines within a single multi-line label. .Va center, left, or right .Df right .Cn score .Ns .eX alignlabels = center .Sa .Hr param.html#brace brace, .Hr param.html#bracket bracket, .Hr param.html#label label, .Hr param.html#label2 label2 .eP .\"----------------- .bP .Na .Hm alignped alignped .De If set to n, this parameter allows pedal marks to individually move closer to the staff. If set to y, all pedal marks on a score are aligned. If set to n, you can use .Hr stuff.html#aligntag align on pedal marks, and in either case, you can use .Hr stuff.html#dist dist, to force them to a particular place. .Va y or n .Df y .Cn score, staff .Ns .eX alignped=n .Sa .Hr param.html#pedstyle pedstyle .eP .\"----------------- .bP .Na .Hm alignrst alignrests .De This parameter controls whether rests stay as close to the middle of the staff as possible, or whether they are adjusted to align with the notes surrounding them. If the value is "n," no alignment to the notes is done. If the value is "y," rests are moved to try to follow the flow of the voice. The alignment of rests with notes is only done when the .Hr param.html#vscheme vscheme parameter is something other than 1, and if there are no non-space chords in voice 3. It is not used on voice 3. This parameter can be changed in mid-measure. Only notes that are inside the time period when this parameter is set to y will affect alignment. .Va y or n .Df n .Cn score, staff, voice .mM .Ni .eX alignrests=y .Sa .Hr param.html#vscheme vscheme .eP .\"----------------- .bP .Na .Hm barstyle barstyle .De This parameter specifies which staffs are to have their bar lines connected together. When drawing bar lines, a continuous vertical line will be drawn from the top line of the top staff in a range to the bottom line of the bottom staff of the range. Any staff not listed will be barred by itself, with the bar line spanning only the height of the staff. .Va a comma-separated list of staff numbers and/or ranges of staff numbers. Staff numbers can be from 1 to the value of the .Hr param.html#staffs \&"staffs" parameter. A range is a pair of numbers separated by a dash. You can also specify all, which means to bars all staffs together regardless of how many there are. You can specify between, which causes the bar lines to be drawn between adjacent staffs and not through them. If you want a mixture of between and not between, all the non-between ranges must be specified first, then the word between, then the between ranges. A given staff number can be specified only once, and there can be no overlapping between ranges. .Df each visible staff barred individually .Cn score .Nm .eX barstyle = 1-2, 5-8 .br barstyle = all .br barstyle 1-4,10-12, between 5-9,13-17 .br barstyle = between all .Sa .Hr param.html#staffs staffs, .Hr param.html#subbar subbarstyle, .Hr param.html#visible visible .Ix dD .Ix gG .Ix gL .Ix gM .Ix gN .eP .\"------------------------------------------ .bP .Na .Hm beamslp beamslope .De This parameter allows you to control the slope of beams. Two values must be given, separated by a comma. Mup calculates an appropriate slope for beams by applying a linear regression algorithm that uses the positions of the noteheads within the beam. The first value supplied for the beamslope parameter is a factor by which to multiply the default slope that Mup calculates. The minimum value of 0.0 would cause all beams to be horizontal, whereas the maximum value of 1.0 will use the slope Mup calculates. Intermediate values will yield beams that are less slanted than the default slope calculation. The second value given to the beamslope parameter is the maximum angle for the beam, in degrees. If the originally calculated value multiplied by the factor yields an angle of greater than this maximum angle, the maximum angle will be used. .Hr ichdattr.html#crossbm Cross-staff beams that are between staffs are allowed to have a slope up to 1.4 times the value of the slope of the maximum angle, since they face more constraints. The slope can be overridden on a particular beam by specifying a .Hr ichdattr.html#slope slope as an interchord attribute on the first chord of the beamed set. .Va 0.0 to 1.0 for the factor, and 0.0 to 45.0 for the maximum angle .Df 0.7, 20.0 .Cn score, staff, voice .Nm .eX beamslope=0.8,20 .Ix jJ .Sa .Hr param.html#tupslope tupletslope .eP .\"------------------------------------------ .bP .Na .Hm beamstyl beamstyle .De This parameter specifies how to beam eighth notes or shorter. It is specified as a list of time values. Any number of notes up to each time value will be beamed together. For example, in 4/4 time, with beamstyle=4,4,4,4 each quarter note worth of shorter notes would be beamed together. However, beams would not span across beats. As another example, for an input of 4.; 8; 8; 4.; the two eighth notes would not be beamed together, because they span beats. If beamstyle had been specified as 4,2,4 then the eighth notes would be beamed. Normally, beams also end whenever a rest or space is encountered. However, if an "r" is placed at the end of the list of time values, Mup will beam across rests of less than quarter note duration. Similarly, if an "s" is placed at the end of the list, Mup will beam across spaces of less than quarter note duration. You can specify both r and s in either order. It is possible to specify subbeams, or secondary groupings within a beam, by enclosing a list of time values in parentheses. In this case, the outer beam extends for the sum of the values in the parentheses, while inner beams extend only for the individual values within the parentheses. For example, if you set beamstyle=(4,4),(4,4) and then have a measure that consists of all 16th notes, the first eight notes would be connected by an outer beam, as would the last eight notes, but the second (inner) beams would cover only four notes each. The parentheses cannot be nested. It is possible to override this default beaming style within a specific measure. See the section on .Hr ichdattr.html#custbeam Custom Beaming for examples of how to obtain various kinds of beaming. The value of the beamstyle parameter is remembered for any later changes back to the same time signature. In other words, if you set the value of the .Hr param.html#time time parameter and the beamstyle parameter in the same context, then later set only the time, the beamstyle that you had set earlier will be used again. .Va a comma-separated list of time values that add up to a measure. Time values are specified as 4 for a quarter note, 2 for half note, etc, and can be dotted if necessary, or an expression with added and/or subtracted times. The list can optionally be followed by an "r" to indicate beams should span rests. It can optionally be followed by "s" to indicate beams should span spaces. Two or more of the time values may be enclosed in parentheses, to indicate sub-groupings of inner (secondary) beams within outer (primary) beams. If the value is empty, automatic beaming is turned off. .Df no beams; each note of eighth or shorter duration is individually flagged. .Cn score, staff, and voice .Pm .eS beamstyle = 4,4,4,4 .br beamstyle = 2. .br beamstyle=4+16, 4+16 .br beamstyle = 2, 2 rs // beam across rests and spaces .br beamstyle = (4., 4., 4.) // one outer beam per measure, .br // with inner beams broken at each dotted quarter duration .br beamstyle = // turn off beaming .Ix bA .Ix dE .Ix dH .Ix dI .Ix dJ .Ix fP .Ix gT .Ix gX .Ix hG .Ix hL .eP .\"------------------------- .bP .Na .Hm beloword beloworder .De This parameter specifies in what order to stack items that are printed below a staff. The value is a comma-separated list of all the types of things that can be printed below a staff. Items are stacked in the order listed, starting from just below the staff and working downward. If you want several types to be handled as a single category, with all types in the category having the same stacking priority, separate them with an ampersand rather than a comma. The ampersand cannot be used with lyrics or pedal. The dyn category applies to crescendo and decrescendo marks (from "<" and ">" statements) as well as text with the dyn modifier. The chord category applies to text with chord, analysis, or figbass modifiers. The othertext category applies to rom, bold, ital, and boldital items that do not have a chord, analysis, figbass, or dyn modifier. If you omit any categories, they will be stacked last, in their default order. .Va .Hr mussym.html mussym, .Hr octave.html octave, .Hr textmark.html#chordmod dyn, othertext, chord, .Hr lyrics.html lyrics, .Hr pedal.html pedal .Df mussym, octave, dyn & othertext & chord, lyrics, pedal .Cn score, staff .Ns .eX beloworder = mussym, lyrics, dyn, octave, othertext, chord, pedal .Sa .Hr param.html#aboveord aboveorder, .Hr param.html#betwnord betweenorder, .Hr param.html#chdist chorddist, .Hr param.html#dist dist, .Hr param.html#dyndist dyndist .Ix fT .Ix gA .Ix aE .Ix gW .Ix fR .Ix iN .Ix iM .Ix fL .Ix gH .Ix gI .Ix gJ .Ix gK .Ix cL .Ix cM .eP .\"------------------------- .bP .Na .Hm betwnord betweenorder .De This parameter specifies in what order to stack items that are printed between two staffs. The value is a comma-separated list of all the types of things that can be printed between staffs. Items are stacked in the order listed, starting from a baseline and working upward. If you want several types to be handled as a single category, with all types in the category having the same stacking priority, separate them with an ampersand rather than a comma. The ampersand cannot be used with lyrics. The dyn category applies to crescendo and decrescendo marks (from "<" and ">" statements) as well as text with the dyn modifier. The chord category applies to text with chord, analysis, or figbass modifiers. The othertext category applies to rom, bold, ital, and boldital items that do not have a chord, analysis, figbass, or dyn modifier. If you omit any categories, they will be stacked last, in their default order. .Va .Hr mussym.html mussym, .Hr textmark.html#chordmod dyn, othertext, chord, .Hr lyrics.html lyrics, .Df mussym, dyn & othertext & chord, lyrics .Cn score, staff .Ns .eX betweenorder = mussym, lyrics, dyn & othertext, chord .Sa .Hr param.html#aboveord aboveorder, .Hr param.html#beloword beloworder, .Hr param.html#chdist chorddist, .Hr param.html#dist dist, .Hr param.html#dyndist dyndist .Ix fT .Ix aE .Ix gW .Ix fR .Ix iN .Ix iM .Ix gH .Ix gI .Ix gJ .Ix gK .Ix cL .Ix cM .eP .\"------------------------- .bP .Na .Hm botmar bottommargin .De This parameter sets the amount of white space margin to put at the bottom of each page. It is specified in inches if the .Hr param.html#units units parameter is set to inches, or in centimeters if the units parameter is set to cm. This parameter can only be specified before any music or .Ix jC .Hr prnttext.html#block block input. Margins are unaffected by .Hr param.html#scale the "scale" parameter. The parameter name can be abbreviated to just "botmargin" if you wish. .Va 0.0 to pageheight minus 0.5 inches .Df 0.5 inches .Cn score .Oo .eX bottommargin = 0.8 .Sa .Hr param.html#leftmar leftmargin, .Hr param.html#rightmar rightmargin, .Hr param.html#topmar topmargin, .Hr param.html#pgheight pageheight, .Hr param.html#units units .Ix gM .Ix gN .Ix gO .Ix gS .eP .\"------------------------------------ .bP .Na .Hm brace brace .De This parameter specifies which staffs are to be grouped together with a brace to the left of the score. If there is a string given in parentheses, that string will be used as the label to print on the next score, left of the bracket at its vertical center. If there is a second string, that will be used as the label for succeeding scores. .Va a comma-separated list of staffs and/or staff ranges, each optionally followed by one or two double-quoted strings enclosed in parentheses. If there are two strings, they are separated by a comma. Staff numbers can range from 1 to the value of .Hr param.html#staffs the "staffs" parameter. A given staff number can be specified only once, and there can be no overlapping between ranges. Giving no value will result in no braces on any staffs. .Df no staffs are grouped by braces. .Cn score .Ps .eS brace = 3-4 .br brace = 1, 2-3, 4, 5-6 .br brace = 1-2 ("piano"), 3 ("cello") .br brace = 1-2 ("Primo", "I") .br brace = // no braces at all (the default) .Sa .Hr param.html#bracket bracket, .Hr param.html#label label, .Hr param.html#label2 label2, .Hr param.html#staffs staffs .Ix dP .Ix dV .Ix hB .Ix hJ .Ix hK .eP .\"------------------------------------ .bP .Na .Hm bracket bracket .De This parameter specifies which staffs are to be grouped together with a bracket to the left of the score. If there is a string given in parentheses, that string will be used as the label to print on the next score, left of the bracket at its vertical center. If there is a second string, that will be used as the label for succeeding scores. .Va a comma-separated list of staffs and/or staff ranges, each optionally followed by one or two double-quoted strings enclosed in parentheses. If there are two strings, they are separated by a comma. Staff numbers can range from 1 to the value of .Hr param.html#staffs the "staffs" parameter. A bracket range can overlap another bracket range, as long as one range is a proper subset of the other. Giving no value will result in no brackets on any staffs. .Df no staffs are grouped by brackets. .Cn score .Ps .eS bracket = 6-7 .br bracket = 17, 21-23 .br bracket = 8-9 ("SATB") .br bracket = 10-12 ("Strings", "Str") .br bracket = // no brackets at all (the default) .Sa .Hr param.html#brace brace, .Hr param.html#label label, .Hr param.html#label2 label2, .Hr param.html#staffs staffs .Ix dW .eP .\"------------------------------------ .bP .Na .Hm brktrpts bracketrepeats .De When set to "y," brackets are drawn at repeat signs to make it more obvious to the performer where the repeated section begins and ends, which may be helpful when playing in a dimly lit area. Which staffs are bracketed together is controlled by the .Hr param.html#endingst endingstyle parameter. .Va \fBy\fP or \fBn\fP .Df n .Cn score .Nm .eX bracketrepeats=y .Sa .Hr param.html#endingst endingstyle, .Hr param.html#rptdots repeatdots .eP .bP .Na .Hm canclkey cancelkey .De When set to "y," when a key changes, any sharps or flats in the previous key that are not part of the new key will be canceled by printing natural signs, before printing the new key signature. When set to "n," the naturals will only be printed if the new key has no sharps or flats. .Va y or n .Df n .Cn score, staff .Nm .eX cancelkey=y .Sa .Hr param.html#key key, .Hr param.html#useaccs useaccs .Ix iI .eP .\"-------------------- .bP .Na .Hm carryacc carryaccs .De This parameter specifies, for .Hr midi.html MIDI, whether accidentals follow the normal notation rules of carrying through the remainder of the current measure until explicitly changed. If set to n, each accidental will apply only to the specific chord where it was specified. .Va y or n .Df y .Cn score, staff .Nm .eX carryaccs = n .Sa .Hr param.html#useaccs useaccs .eP .\"-------------------- .bP .Na .Hm chdist chorddist .De This parameter sets the minimum distance from staffs to place chords. When chord marks are printed, they will be placed no closer to the staff than the value of this parameter. This can be used to reduce the ragged effect of having some chord marks much higher than others, because other things were in their way. If a specific chord mark has to be moved farther away than this parameter to avoid running into something, that will still happen, but any others will come out at the level specified by this parameter. This parameter may be overridden on specific items. The section on .Hr stuff.html tempo, dynamic marks, ornaments, etc. gives details on how to do this. .Va a number between 0.0 and 50.0 inclusive, given in stepsizes .Df 3.0 .Cn score, staff .Nm .eX chorddist = 4 .Sa .Hr param.html#dyndist dyndist, .Hr param.html#dist dist, .Hr param.html#lyrdist lyricsdist, .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep .Ix dO .Ix fO .Ix gW .Ix hK .eP .\"------------------------------------ .bP .Na .Hm chordxlate chordtranslation .De If set to "German" a B in a chord will be printed as H, while a B flat in a chord will be printed as B. If set to a string containing 7 syllables, those syllables will be substituted for pitches in chords, beginning with C. I.e., a C will be replaced by the first syllable, a D by the second syllable, etc. .Va \&"German" or a string like "do re mi fa sol la si" or nothing. .Df nothing .Cn score, staff .Nm .eX chordtranslation = "DO RE MI FA SOL LA TI" .eP .\"------------------------------------ .bP .Na .Hm clef clef .De This parameter sets the clef to use. Changing a clef may also change the default octave .Hr param.html#defoct (see the "defoct" parameter below). However, if clef and defoct are both changed in the same context, the defoct overrides what the clef would have set. If the clef name is followed by a y that means to force printing the clef even if it isn't different from the previous clef. .Va treble, treble8, 8treble, frenchviolin, soprano, mezzosoprano, alto, tenor, baritone, bass, 8bass, bass8, or subbass. Can optionally be followed by y, which will force the clef to be printed, even if it is the same as the previous clef. The treble8 clef looks like a treble clef with an 8 below it, and refers to notes that are an octave lower than a normal treble clef. The 8treble clef looks like a treble clef with an 8 above it, and refers to notes that are an octave higher than a normal treble clef. The bass8 clef looks like a bass clef with an 8 below it, and refers to notes that are an octave lower than a normal bass clef. The 8bass clef looks like a bass clef with an 8 above it, and refers to notes that are an octave higher than a normal bass clef. The subbass clef looks like a bass clef, but placed two stepsizes higher on the staff. If the .Hr param.html#stlines stafflines parameter includes the "drum" .Ix iE keyword, then the value of this clef parameter is only used for determining the placement of notes on the staff, with the drum (or "neutral") clef actually printed. Clef can be changed in .Hr midmeas.html the middle of a measure using a construct like <<staff clef=bass>> before a note group. .Df treble .Cn score, staff .mM .Ni .eX clef = alto .Sa .Hr param.html#defoct defoct, .Hr param.html#stlines stafflines .Ix fI .eP .\"-------------------- .bP .Na .Hm cue cue .De If set to y, all notes are made cue size. This lets you have a long passage of cue notes without having to specific [cue]... over and over. .Va y or n .Df n .Cn score, staff, voice .Im .eX cue=y .eP .bP .Na .Hm defkmap defaultkeymap .De This parameter specifies which keymap to use if none of the other keymap parameters applies. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") or nothing means don't do any mapping. .Df nothing .Cn score, staff .Im .eS defaultkeymap="Cyrillic" .br defaultkeymap= .Sa .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"------------------------ .bP .Na .Hm defphside defaultphraseside .De For cases where the side on which to place a phrase mark is not otherwise already determined (and thus Mup would normally choose the side that seemed best), this parameter can be set to force choosing above or below. .Va above, below, or not set .Df not set .Cn score, staff, voice .Im .eS defaultphraseside=above .br defaultphraseside= // Let Mup choose .eP .\"------------------------ .bP .Na .Hm defoct defoct .De This parameter sets the default octave for any note that does not have an explicit octave specified. An octave goes from C up to the next B, with octave 4 being the octave beginning on middle C. If the .Hr param.html#clef clef is changed on a staff, but defoct is not set in that same context, the default octave is changed to match the new clef. defoct can be changed in .Hr midmeas.html the middle of a measure using a construct like <<staff defoct=5>> before a note group. .Va a number from 0 to 9 inclusive. Octave 4 is the octave beginning at middle C. .Df the octave containing the note represented by the middle line of the staff given the current .Hr param.html#clef clef. (Octave 5 for frenchviolin and 8treble; octave 4 for treble, soprano, mezzosoprano, alto and 8bass clefs; octave 3 for treble8, tenor, baritone and bass clefs; octave 2 for bass8 and subbass clefs.) .Cn score, staff, voice .Pm .mM .eX defoct = 3 .Ix cU .Ix fI .Ix gA .Ix hL .eP .\"-------------------- .bP .Na .Hm dist dist .De This parameter sets minimum distance from staff to place .Hr textmark.html rom, bold, ital, and boldital items, and .Hr bars.html#reh rehearsal marks. When these items are printed, they will be placed no closer to the staff than the value of this parameter. This can be used to reduce the ragged effect of having some items much higher than others, because other things were in their way. If a specific item has to be moved farther away than this parameter to avoid running into something, that will still happen, but any others will come out at the level specified by this parameter. If an item is also a chord, .Hr param.html#chdist the chorddist parameter will be used instead of dist. This parameter may be overridden on specific items. The sections on .Hr stuff.html tempo, dynamic marks, ornaments, etc. and on .Hr bars.html#reh rehearsal marks give details on how to do this. .Va a number between 0.0 and 50.0 inclusive, given in stepsizes .Df 2.0 .Cn score, staff .Nm .eX dist = 6 .Sa .Hr param.html#chdist chorddist, .Hr param.html#dyndist dyndist, .Hr param.html#lyrdist lyricsdist, .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep .Ix dO .Ix fK .Ix fO .Ix gH .Ix gI .Ix gK .eP .\"----------------- .bP .Na .Hm division division .De This parameter sets the .Hr midi.html MIDI division (number of clock ticks per quarter note). This typically has a value of 192 or 384. This parameter can only be specified before any music or block input. .Va 1 to 1536 .Df 192 .Cn score .Oo .eX division = 384 .Ix aA .Ix bR .Ix hL .eP .\"-------------------- .bP .Na .Hm dyndist dyndist .De This parameter sets minimum distance from staff to place .Ix cL .Ix cM .Hr cres.html crescendo and decrescendo marks. and text that is marked "dyn." When these items are printed, they will be placed no closer to the staff than the value of this parameter. This can be used to reduce the ragged effect of having some items much higher than others, because other things were in their way. If a specific item has to be moved farther away than this parameter to avoid running into something, that will still happen, but any others will come out at the level specified by this parameter. This parameter may be overridden on specific items. The section on .Hr stuff.html tempo, dynamic marks, ornaments, etc. gives details on how to do this. .Va a number between 0.0 and 50.0 inclusive, given in stepsizes .Df 2.0 .Cn score, staff .Nm .eX dyndist = 4 .Sa .Hr param.html#chdist chorddist, .Hr param.html#dist dist, .Hr param.html#lyrdist lyricsdist, .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep .Ix dO .Ix fK .Ix fO .eP .\"------------------ .bP .Na .Hm emptym emptymeas .De By default, if you don't specify any music input for a given voice, Mup just leaves a measure of space. This parameter lets you specify what Mup should use. The most common value other than space would be a measure of rest, but you can supply any valid music input. So, for example, if your music has a measure-long pattern that repeats frequently in some voice, you could set this parameter to that pattern, and Mup will fill in that music for every measure where you don't override with something else. The value is a string, and is effectively placed in the input as if you had typed it yourself. Note that since errors in the string will generally not be caught until it is actually used, error messages may reference a line a long ways away from the line where the parameter is defined. Note also that since the value is a text string, all the usual rules for .Hr textstr.html text strings apply; for example, any double quotes inside the string must be backslashed. Since the processing of emptymeas happens before the derivation of music on tabnote staffs, you probably do not want to set a .Hr tabstaff.html tabnote staff to something like emptymeas="mr;" unless the tab staff is also going to be all rests, because that would override the music derivation. Also, when you have set the .Hr param.html#vscheme vscheme to have two or three voices just because there are a few spots in the song that need more than one, you probably only want to set emptymeas="mr;" on voice 1, or you will likely get more rests than you intended. .Va a text string (enclosed in double quotes, as usual), containing music input .Df ms; .Cn score, staff, voice .Nm .eS emptymeas="mr;" .br emptymeas="8.c;16;8.e;16;8.f;16;{8g;f;g;}3;" .eP .bP .Na .Hm endkmap endingkeymap .De This parameter specifies which keymap to use for labels of endings See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Nm .eS endingkeymap="Greek" .br endingkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"------------------ .bP .Na .Hm endingst endingstyle .De This parameter controls how .Hr bars.html#endings first and second endings are placed. This parameter also controls where .Hr param.html#measnum measure numbers and .Hr bars.html#reh rehearsal marks are placed, as well as which staffs are bracketed together if the .Hr param.html#brktrpts bracketrepeats parameter is set. A value of "top" means that the endings and similar marks will be shown only above the top .Hr param.html#visible visible staff. A value of "barred" means these marks will be shown above each set of staffs that is barred together. Each staff that is barred individually will also have the ending shown above it. .Hr param.html#barstyle (See the "barstyle" parameter above.) A value of "grouped" means the marks will be shown above the top visible staff of each range of staffs that are joined by a .Hr param.html#brace brace or .Hr param.html#bracket bracket. In all cases, at least the top visible staff will have endings shown above it. .Va top, barred, or grouped .Df top .Cn score .Nm .eX endingstyle = grouped .Sa .Hr param.html#barstyle barstyle, .Hr param.html#brace brace, .Hr param.html#bracket bracket, .Hr param.html#brktrpts bracketrepeats, .Hr param.html#measnum measnum, .Hr param.html#rehstyle rehstyle, .Hr param.html#visible visible .Ix aQ .Ix aR .Ix dD .Ix dG .Ix dV .Ix dW .Ix dY .Ix gG .Ix gL .Ix gM .Ix hG .Ix hK .eP .\"---------------------- .bP .Na .Hm xtendlyr extendlyrics .De This parameter specifies whether Mup should automatically add .Ix fW underscore "extender lines" to lyrics. This parameter only has effect when you let Mup derive the time values for .Hr lyrics.html lyrics, rather than specifying them explicitly. When the parameter is set to y, and Mup finds a tie or slur in the voice from which lyrics time values are being derived, an underscore will be added to the corresponding syllable, if that syllable doesn't already end with a dash or underscore. .Va y or n .Df n .Cn score, staff, voice .Nm .eX extendlyrics=y .Sa .Hr param.html#sylpos sylposition .eP .\"---------------------- .bP .Na .Hm firstpg firstpage .De This parameter specifies what to number the first page. This value can be overridden by the .Hr cmdargs.html#poption -p command line option. The number can be optionally followed by "leftpage" or "rightpage" to say whether any header, footer, top, or bottom block on the first page should use the left or right page versions, if those are different. This parameter can only be set before any music or block input. .Va 1 to 5000 .Df 1 rightpage (unless panelsperpage=2, in which case the page side will be leftpage) .Cn score .Oo .eS firstpage = 12 .br firstpage = 1 leftpage .Sa .Hr param.html#panels panelsperpage .eP .\"---------------------- .bP .Na .Hm flipmarg flipmargins .De This parameter specifies if the left and right margins are to be interchanged on every other page. This may be useful if you want extra space for book binding. If set to y, the first physical page will use the values of .Hr param.html#leftmar leftmargin and .Hr param.html#rightmar rightmargin as is, but on the second page, and every other page thereafter, the value for rightmargin will be used for the left margin and the value for leftmargin will be used for the right margin. The settings of the .Hr param.html#firstpg firstpage parameter or the .Hr cmdargs.html#ooption option to print only selected pages have no effect on this parameter. .Va y or n .Df n .Cn score .Te at next page .eX flipmargins = y .Sa .Hr param.html#leftmar leftmargin, .Hr param.html#rightmar rightmargin .eP .\"---------------------- .bP .Na .Hm font font .De This parameter specifies which font to use for .Hr prnttext.html print, left, right, center, and title statements. .Va rom, ital, bold, or boldital .Df rom .Cn score, staff, header, footer, header2, footer2, top, bottom, top2, bottom2, block .Im .eX font = boldital .Sa .Hr param.html#fontfam fontfamily, .Hr param.html#lyrfont lyricsfont, .Hr param.html#lyrfam lyricsfontfamily, .Hr param.html#size size, .Hr param.html#withfont withfont .Ix aS .Ix aT .Ix bG .Ix gH .Ix gI .Ix gJ .Ix gK .Ix gW .Ix hA .Ix hB .eP .\"--------------------- .bP .Na .Hm fontfam fontfamily .De This parameter specifies what font family to use for .Hr prnttext.html print, left, right, center, and title statements. It also provides the default for rom, bold, ital, and boldital statements. .Va avantgarde, bookman, courier, helvetica, newcentury, palatino, times .Df times .Cn score, staff, header, footer, header2, footer2, top, bottom, top2, bottom2, block .Im .eX fontfamily=palatino .Sa .Hr param.html#font font, .Hr param.html#lyrfont lyricsfont, .Hr param.html#lyrfam lyricsfontfamily, .Hr param.html#withfam withfontfamily .Ix gB .eP .\"------------------------------------ .bP .Na .Hm gridfret gridfret .De This parameter specifies when to print fret numbers on grids. .Ix iW Normally, the top line of a grid represents the nut. However, if the fingering for a chord is rather far up the neck, it is customary to have the top line of the grid represent some other fret, and print a fret number and "fr" next to the grid, showing the actual fret of the lowest fret mark. This parameter controls when Mup begins using this alternate format. Whenever all the frets of a chord are greater than or equal to the value specified for this parameter, and there are no strings marked "o", the "fr" notation is used. If no value is set for this parameter, the grid will just be made as tall as necessary to accommodate the chord's frets; but in any case, the grid will always be at least as high as the value of .Hr param.html#mingrid the mingridheight parameter. .Va 2 to 99, or not set .Df 4 .Cn score, staff .Nm .eS gridfret = 3 .br gridfret = .Sa .Hr param.html#gridend gridsatend, .Hr param.html#gridscl gridscale, .Hr param.html#gridused gridswhereused, .Hr param.html#mingrid mingridheight .eP .\"------------------------------------ .bP .Na .Hm gridend gridsatend .De This parameter specifies whether to print guitar grids at the end of the song. If set to "y," grids for all of the chords used in the song will be printed. Grids only associated with particular staffs will only be printed if that staff is visible. Grids associated with "all" will use the score level value of this parameter. .Va y or n .Df n .Cn score, staff .Te During each music context where this has been set to "y," it accumulates chords that are used. If you later set it to n, it stops accumulating, but doesn't forget the ones it accumulated earlier. At the end, it prints out whatever ones it has accumulated, even if the flag is n at that time. .eX gridsatend = y .Sa .Hr param.html#gridfret gridfret, .Hr param.html#gridscl gridscale, .Hr param.html#gridused gridswhereused, .Hr param.html#mingrid mingridheight .eP .\"------------------------------------ .bP .Na .Hm gridscl gridscale .De This parameter specifies how large to make grids, relative to their default size. For example, a value of 0.5 will make them 1/2 their default size. The default size for grids summarized at the end of the song .Hr param.html#gridend (the gridsatend parameter) is larger than the default size for those printed with the music .Hr param.html#gridused (the gridswhereused parameter). .Va 0.1 to 10.0 .Df 1.0 .Cn score, staff .Nm .eX gridscale = 0.5 .Sa .Hr param.html#gridend gridsatend, .Hr param.html#gridfret gridfret, .Hr param.html#gridused gridswhereused, .Hr param.html#mingrid mingridheight, .Hr param.html#scale scale, .Hr param.html#stscale staffscale .eP .\"------------------------------------ .bP .Na .Hm gridused gridswhereused .De This parameter specifies whether to print guitar grids along with chords where they appear in the song. If set to "y," each .Hr textmark.html#chordmod text item with the chord modifier will have a grid printed below its name. .Va y or n .Df n .Cn score, staff .Nm .eX gridswhereused = y .Sa .Hr param.html#gridfret gridfret, .Hr param.html#gridend gridsatend, .Hr param.html#gridscl gridscale, .Hr param.html#mingrid mingridheight .eP .\"------------------------------------ .bP .Na .Hm indentrs indentrestart .De This parameter specifies whether a restart should be indented when it occurs at the beginning of a new score. It does not affect restarts that occur in the middle of a score. .Va y or n .Df n .Cn score .Nm .eX indentrestart = y .eP .\"------------------------------------ .bP .Na .Hm key key .De This parameter sets the key signature. This can be specified either by giving the number of sharps (#) or flats (&), or by giving the name of the key. .Va If using the number of sharps/flats format, the value is a number from 0 to 7, followed by "#" or "&," optionally followed by "major" or "minor." 0& and 0# are equivalent. If using the name of the key, the value is a letter "a" through "g," optionally followed by a "#" or "&," optionally followed by "major" or "minor." The "major" and "minor" can be abbreviated to "maj" or "min." The "major" or "minor" is used for .Hr midi.html MIDI file purposes, and is optional; if omitted, it defaults to major. If you wish to use a mode other than major or minor, you have to specify the number of sharps or flats. .Df c major .Cn score, staff .Nm .eS key = 3& .br key = 6# .br key = c# minor .br key = d major .Sa .Hr param.html#addxpose addtranspose, .Hr param.html#canclkey cancelkey, .Hr param.html#carryacc carryaccs, .Hr param.html#stlines stafflines, .Hr param.html#xpose transpose, .Hr param.html#useaccs useaccs .Ix aA .Ix cG .Ix fC .eP .\"------------------------ .bP .Na .Hm label label .De This parameter specifies a label to be printed to the left of the staff on the next score. If there is also a .Hr param.html#brace brace or .Hr param.html#bracket bracket label, that label will be to the left of this label. There is a .Hr param.html#label2 label2 parameter that is used on subsequent scores. In addition to being used for the very first score of a song, this label parameter might be used to clearly mark a change in instrumentation or voices for a particular staff. The label2 would typically be changed at the same time, giving a more abbreviated label. For example, you might set label="Tenor/Bass" and label2="TB" .Va .Hr textstr.html a text string enclosed in double quotes .Df enough spaces to produce an indent of 1/2 inch .Cn score, staff .Ns .eX label = "oboe" .Sa .Hr param.html#alignlabels alignlabels, .Hr param.html#brace brace, .Hr param.html#bracket bracket, .Hr param.html#label label2 .Ix dP .Ix dV .Ix dW .Ix hB .Ix hJ .Ix hK .eP .\"------------------------- .bP .Na .Hm label2 label2 .De This parameter specifies a label to be printed to the left of the staff on all scores after the first. If there is also a .Hr param.html#brace brace or .Hr param.html#bracket bracket label, that label will be to the left of this label. If both the .Hr param.html#label label and label2 parameters are set at the same time, the label value will be used for the immediately following score, with the label2 value used for subsequent scores. If however, after the first score, only the label2 is changed, then the label2 value will be used on the immediately following score as well as subsequent scores. .Va .Hr textstr.html a text string enclosed in double quotes .Df no label .Cn score, staff .Ns .eX label2 = "Solo" .Sa .Hr param.html#alignlabels alignlabels, .Hr param.html#brace brace, .Hr param.html#bracket bracket, .Hr param.html#label label .eP .bP .Na .Hm labkmap labelkeymap .De This parameter specifies which keymap to use for labels to the left of staffs. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Im .eS labelkeymap="Cyrillic" .br labelkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"------------------------- .bP .Na .Hm leftmar leftmargin .De This parameter sets the amount of white space margin to put at the left side of each page. It is specified in inches if the .Hr param.html#units units parameter is set to inches, or in centimeters if the units parameter is set to cm. This parameter can only be specified before any music or block input. Margins are unaffected by .Hr param.html#scale the "scale" parameter. You can use the .Hr param.html#flipmarg flipmargins parameter to adjust alternating pages to allow room for book binding. .Va 0.0 to pagewidth minus 0.5 inches .Df 0.5 inches .Cn score .Oo .eX leftmargin = 0.3 .Sa .Hr param.html#botmar bottommargin, .Hr param.html#flipmarg flipmargins, .Hr param.html#rightmar rightmargin, .Hr param.html#topmar topmargin, .Hr param.html#pgwidth pagewidth, .Hr param.html#units units .Ix cW .Ix gQ .Ix gS .eP .bP .Na .Hm leftspc leftspace .De This parameter specifies what portion of the white space around a chord is placed on its left side. Usually (unless packexp is zero), longer notes will have more white space around them than shorter notes, which means that the white space to their left is also larger. The parameter allows you to control how pronounced that effect is, or even specify to put all the space on the right. Two numbers must be specified, separated by a comma. They may include decimal fraction parts. The first specifies what portion of the white space should go on the left. The second specifies a maximum amount of white space, in stepsizes. So if the amount calculated by the first number is greater than the second number, the second number will be used. .Va first number 0.0 to 0.5 and second number 0.0 to 100.0 .Df 0.15, 5.0 .Cn score .Nm .eX leftspace = 0.2, 4 .Sa .Hr param.html#lyralign lyricsalign, .Hr param.html#packexp packexp, .Hr param.html#packfact packfact .eP .\"------------------ .bP .Na .Hm lyralign lyricsalign .De This parameter specifies how to align lyric syllables with chords. Its value is the proportion of each syllable to place to the left of the syllable's chord. Thus, for example, a value of 0.0 causes the left edge of syllables to be aligned with the chords, whereas a value of 0.5 causes syllables to be centered with the chord, and 1.0 causes the right edge of the syllables to be aligned with the chord. .Va 0.0 to 1.0 .Df 0.25 .Cn score, staff .Nm .eX lyricsalign = 0.1 .Sa .Hr param.html#sylpos sylposition .Ix hT .eP .\"-------------------- .bP .Na .Hm lyrdist lyricsdist .De This parameter sets the minimum distance from staffs to place lyrics. When lyrics are printed, they will be placed no closer to the staff than the value of this parameter. This only affects lyrics above and below, not between. .Va a number between 0.0 and 50.0 inclusive, given in stepsizes. .Df 2.0 .Cn score, staff .Ns .eX lyricsdist = 4 .Sa .Hr param.html#chdist chorddist, .Hr param.html#dyndist dyndist, .Hr param.html#dist dist, .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep .eP .\"------------------ .bP .Na .Hm lyrfont lyricsfont .De This parameter sets which font to use for .Hr lyrics.html lyrics. .Va rom, ital, bold, boldital .Df rom .Cn score, staff .Im .eX lyricsfont = ital .Sa .Hr param.html#font font, .Hr param.html#lyrsize lyricssize .Ix aE .Ix bG .Ix gH .Ix gJ .Ix gK .eP .\"--------------------- .bP .Na .Hm lyrfam lyricsfontfamily .De This parameter specifies what font family to use for .Hr lyrics.html lyrics. .Va avantgarde, bookman, courier, helvetica, newcentury, palatino, times .Df times .Cn score, staff .Im .eX lyricsfontfamily=helvetica .Sa .Hr param.html#font font, .Hr param.html#fontfam fontfamily, .Hr param.html#lyrfont lyricsfont .eP .bP .Na .Hm lyrkmap lyricskeymap .De This parameter specifies which keymap to use for lyrics. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Nm .eS lyricskeymap="Cyrillic" .br lyricskeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"--------------------- .bP .Na .Hm lyrsize lyricssize .De This parameter sets point size to use for .Hr lyrics.html lyrics. .Va a number from 1 to 100 .Df 12 .Cn score, staff .Nm .eX lyricssize = 10 .Sa .Hr param.html#lyrfont lyricsfont, .Hr param.html#lyrfam lyricsfontfamily, .Hr param.html#size size .Ix bH .eP .\"--------------------- .bP .Na .Hm maxmeas maxmeasures .De This parameter specifies the maximum number of measures to put on any score. .Va a number from 1 to 1000 .Df 1000 .Cn score .Ns .eX maxmeasures = 3 .Sa .Hr param.html#leftmar leftmargin, .Hr param.html#maxscore maxscores, .Hr param.html#packexp packexp, .Hr param.html#packfact packfact, .Hr param.html#rightmar rightmargin, .Hr param.html#scale scale, .Hr param.html#stscale staffscale .eP .\"--------------------- .bP .Na .Hm maxscore maxscores .De This parameter specifies the maximum number of scores to print per page. .Va 1 to 1000 .Df 1000 .Cn score .Nm .eX maxscores=2 .Sa .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep .eP .\"--------------- .bP .Na .Hm measnum measnum .De This parameter specifies whether or not to print measure numbers. If set to "y," the current measure number will be printed at the beginning of each score other than the first. The number will be printed above any scores that would receive ending marks .Hr param.html#endingst (see "endingstyle" parameter). If set to "n," no measure numbers will be printed. If set to "every \fIN\fP," measure numbers will be printed on every Nth bar line unless some other .Hr bars.html#reh rehearsal mark has been specified on that bar. .Va y, n, or every N, where N can be from 1 to 10000 .Df n .Cn score .Te at next music context if "every N," else start of next score .eS measnum = y .br measnum = every 1 // number all measures .br measnum = every 5 .Sa .Hr param.html#endingst endingstyle, .Hr param.html#mnumfont measnumfont, .Hr param.html#mnumfam measnumfontfamily, .Hr param.html#mnumsize measnumsize, .Hr param.html#mnumstyl measnumstyle, .Hr param.html#rehstyle rehstyle .Ix aQ .Ix dG .Ix dY .Ix hG .Ix hJ .eP .\"--------------- .bP .Na .Hm mnumfont measnumfont .De This parameter specifies which font type to use for the automatic measure numbers, if they are turned on via the .Hr param.html#measnum measnum parameter. .Va rom, ital, bold, or boldital .Df rom .Cn score .Mn .eX measnumfont=boldital .Sa .Hr param.html#measnum measnum, .Hr param.html#mnumfam measnumfontfamily, .Hr param.html#mnumsize measnumsize, .Hr param.html#mnumstyl measnumstyle .eP .\"--------------- .bP .Na .Hm mnumfam measnumfontfamily .De This parameter specifies which font family to use for the automatic measure numbers, if they are turned on via the .Hr param.html#measnum measnum parameter. .Va avantegarde, bookman, courier, helvetica, newcentry, palatino, or times .Df times .Cn score .Mn .eX measnumfontfamily=helvetica .Sa .Hr param.html#measnum measnum, .Hr param.html#mnumfont measnumfont, .Hr param.html#mnumsize measnumsize, .Hr param.html#mnumstyl measnumstyle .eP .\"--------------- .bP .Na .Hm mnumsize measnumsize .De This parameter specifies what size to use for the automatic measure numbers, in points, if they are turned on via the .Hr param.html#measnum measnum parameter. .Va 1 to 100 .Df 11 .Cn score .Mn .eX measnumsize=15 .Sa .Hr param.html#measnum measnum, .Hr param.html#mnumfont measnumfont, .Hr param.html#mnumfam measnumfontfamily, .Hr param.html#mnumstyl measnumstyle .eP .\"--------------- .bP .Na .Hm mnumstyl measnumstyle .De This parameter specifies whether to put automatic measure numbers inside boxes or circles, or leave them plain. .Va plain, boxed, or circled .Df plain .Cn score .Mn .eX measnumstyle=boxed .Sa .Hr param.html#measnum measnum, .Hr param.html#mnumfont measnumfont, .Hr param.html#mnumfam measnumfontfamily, .Hr param.html#mnumsize measnumsize, .Hr param.html#rehstyle rehstyle .eP .\"--------------- .bP .Na .Hm midline midlinestemfloat .De This parameter controls the stem direction of chords whose notes are centered on the middle line of the staff, for cases where it is free to point in either direction. It is not free (and thus midlinestemfloat does not apply) when the direction is forced by the user, or by the vscheme, or another voice, or for chords that are part of a beamed set of chords, or for grace notes or for voice 3. When midlinestemfloat applies, if it is set to n, the stem will always be down. When set to y, the stem will be up in the case where the neighboring chords on either side, if any, have stems up. .Va y or n .Df n .Cn score, staff, voice .Im .eX midlinestemfloat=y .eP .\"--------------- .bP .Na .Hm minalign minalignscale .De This parameter specifies how much aligned strings can be compressed, in an effort to prevent them from running in the next item at the same alignment level. Only aligned things are ever compressed, and then only if they would collide with the the next item at the same level, and only as much as needed to make them fit, up the the limit of this parameter. Multiplying this value by the normal width of an item will tell the shortest width Mup will compress to before giving up and printing a warning. A value of 1.0 means nothing will ever be compressed at all. .Va 0.1 to 1.0 .Df 0.667 .Cn score, staff .Ns .eX minalignscale = 0.85 .eP .\"--------------- .bP .Na .Hm mingrid mingridheight .De This parameter specifies the minimum number of frets to print on grids. Grids will be made taller than this when necessary, but will never be shorter than this. .Va A number from 2 to 99 .Df 4 .Cn score, staff .Nm .eX mingridheight=6 .Sa .Hr param.html#gridfret gridfret, .Hr param.html#gridend gridsatend, .Hr param.html#gridscl gridscale, .Hr param.html#gridused gridswhereused .eP .\"--------------- .bP .Na .Hm notehead noteheads .De This parameter describes which notehead shape(s) to use for each pitch in the scale. If you want to use the same shape for all pitches, as is the case with standard notation, the value is a string containing a single shape name (e.g., "norm" for standard notation). If you want to use different shapes for different pitches, the noteheads parameter value is a string containing a list of 7 shape names. They are listed in order starting from the "tonic" of the major key as indicated by the number of sharps or flats in the .Hr param.html#key key signature. There are pre-defined head shapes: norm, x, allx, diam, blank, righttri, isostri, rect, pie, semicirc, slash, and allslash. Additional head shapes can be defined in the .Hr shaped.html#hdshape headshapes context. See the examples below for the most common settings for this parameter. Head shape can be .Hr shaped.html#chord overridden on an individual chord by using [hs "shapename"] before the chord. It can also be .Hr shaped.html#note overridden on an individual note by putting hs "shapename" after the note. .Va a string containing either 1 or 7 head shape names .Df \&"norm" .Cn score, staff, voice .Nm .eS // This is the setting for the most common shaped note system using 4 shapes. .br noteheads = "righttri norm rect righttri norm rect diam" .br // This is the setting for a shaped notes system that uses 7 different shapes. .br noteheads = "isostri semicirc diam righttri norm rect pie" .Ix jG .eP .\"--------------- .bP .Na .Hm inputdir noteinputdir .De If set to "any," then when there are multiple notes in a chord, the notes can be entered in any order, but any notes not in the .Hr param.html#defoct default octave must have their octave specified, either by octave number, or the appropriate number of plus or minus signs, based on their distance from the default octave. When set to "up," notes in a chord must be entered in pitch order from bottom up. When set to "down," they must be entered in pitch order from top down. When in up or down mode, the first note's octave is specified as with any, but subsequent notes in the chord are relative to the previous note. Note letters less than or equal to an octave away from their preceding note's letter have no octave specified. For notes an octave or more away, in up mode, only plus signs can be used, and in down mode, only minus signs can be used, to specify how many octaves away they are. For example, for up mode, default octave of 4, and input of gbe, the b will be in octave 4, but the e will be in octave 5, because that is the next e that is upward from b4. In down mode with default octave of 4, and the same input of gbe, the b and e would both be in octave 3. This parameter is ignored on tablature staff input and when using chord-at-a-time input mode. .Va up, down, or any .Df any .Cn score, staff, voice .Nm .eX noteinputdir=up .eP .\"--------------- .bP .Na .Hm nummrpt numbermrpt .De If set to "y" .Hr chordinp.html#measdur measure repeats are numbered; if set to "n" they aren't. .Va y or n .Df y .Cn score, staff .Nm .eX numbermrpt = n .eP .\"--------------- .bP .Na .Hm nummultrpt numbermultrpt .De If set to "y" .Hr chordinp.html#multrpt dbl and quad measure repeats are numbered with "2" or "4" respectively, printed above the middle bar line of the group; if set to "n" they aren't. The number will be printed in the same font as a time signature. .Va y or n .Df y .Cn score, staff .Nm .eX numbermulrpt = n .eP .\"------------------- .bP .Na .Hm ontheline ontheline .De This parameter specifies whether notes for voices 1 and 2 on a 1-line staff are to be placed on the line. If this is set to n, notes with stem up will be placed above the line and notes with stem down will be placed below the line; otherwise both will be placed on the line. For notes that don't have a stem, the rules are applied using the direction the stem would be if there were a stem. This parameter has no effect on .Hr param.html#stlines 5-line staffs or .Hr tabstaff.html tablature staffs. Notes for voice 3 are always placed on the line on 1-line staffs, regardless of the value of this parameter. .Va y or n .Df y .Cn score, staff, voice .Nm .eX ontheline=n .Sa .Hr param.html#stlines stafflines .eP .\"------------------- .bP .Na .Hm packexp packexp .De This parameter sets note expansion factor. This factor controls spacing of notes relative to their time values. If set to 1.0, Mup will try to give a half note twice as much space as a quarter note, a whole note twice as much as a half note, etc. If set to 0.0, a chord's time value will have no impact on its placement. Intermediate values will cause relative spacing between the two extremes. Note that individual chords may get more space than they would theoretically "deserve" if they happen to need extra space to accommodate accidentals, dots, etc. .Va a number from 0.0 to 1.0 inclusive .Df 0.8 .Cn score .Nm .eX packexp = 0.95 .Sa .Hr param.html#packfact packfact, .Hr param.html#pad pad .Ix dU .Ix gT .Ix gW .Ix gX .Ix gZ .Ix hL .eP .\"----------------- .bP .Na .Hm packfact packfact .De This parameter specifies how tightly to pack notes together on output. The smaller the value, the more tightly notes are packed together. .Va a number from 0.0 to 10.0 .Df 1.0 .Cn score .Ns .eX packfact = 1.4 .Sa .Hr param.html#packexp packexp, .Hr param.html#pad pad .Ix dT .eP .\"------------------------- .bP .Na .Hm pad pad .De This parameter specifies the amount of padding to be added to notes. This can be used to control how tightly things are packed together. Especially if .Hr param.html#packexp packexp and .Hr param.html#packfact packfact are very small, notes can get placed very close together. This parameter can be used to always force a minimum amount of space between horizontally adjacent note groups. A value of zero means notes will be allowed to just touch. More positive values cause more space around notes. A negative value will let things actually overlap, so most people will probably never want to use a negative value, but the option is there if you want to do something unusual. This parameter works somewhat like .Hr chrdattr.html#pad the "pad" value that can be specified for individual note groups, except that it applies to all groups. .Va a number of stepsizes, -5.0 to 50.0 .Df 0.3333 .Cn score, staff, voice .Nm .eX pad = 1.76 .Sa .Hr param.html#packexp packexp, .Hr param.html#packfact packfact .eP .\"------------------------- .bP .Na .Hm pgheight pageheight .De This parameter sets the page height. If the .Hr param.html#units units parameter is inches, the value of pageheight is given in inches, or if the units parameter is cm, it is given in centimeters. This parameter can only be specified before any music or block input. If the .Hr param.html#pgwidth pagewidth and pageheight parameters are set to values that match a standard paper size in landscape mode, the Mup output will be rotated to print properly in landscape mode. If pageheight and pagesize are both set in the same context, whichever is specified last will override the previous. .Va 2.0 to 24.0 inches or 5.0 to 61.0 cm .Df 11.0 inches .Cn score .Oo .eX pageheight = 9 .Sa .Hr param.html#pgwidth pagewidth, .Hr param.html#botmar bottommargin .Hr param.html#topmar topmargin, .Hr param.html#units units .Ix hP .eP .\"------------------------- .bP .Na .Hm pgsize pagesize .De This parameter sets the page size. This is just an alternate way of specifying .Hr param.html#pgheight pageheight and .Hr param.html#pgwidth pagewidth using the common names for paper sizes rather than specifying in .Hr param.html#units inches or cm. An orientation (portrait or landscape) can also be specified; the default is portrait. This parameter can only be specified before any music or block input. If pageheight and/or pagewidth are set in the same context as pagesize, whichever is specified last will override the previous. .Va letter, legal, flsa, halfletter, a4, a5, a6; optionally followed by portrait or landscape. .Df letter .Cn score .Oo .eS pagesize = a4 .br pagesize = legal landscape .Sa .Hr param.html#pgheight pageheight, .Hr param.html#pgwidth pagewidth, .Hr param.html#panels panelsperpage .eP .\"------------------------- .bP .Na .Hm pgwidth pagewidth .De This parameter sets the page width. If the .Hr param.html#units units parameter is inches, the value of pagewidth is given in inches, or if the units parameter is cm, it is given in centimeters. This parameter can only be specified before any music or block input. If the pagewidth and .Hr param.html#pgheight pageheight parameters are set to values that match a standard paper size in landscape mode, the Mup output will be rotated to print properly in landscape mode. If pagewidth and pagesize are both set in the same context, whichever is specified last will override the previous. .Va 2.0 to 24.0 inches or 5.0 to 61.0 cm .Df 8.5 inches .Cn score .Oo .eX pagewidth = 6.5 .Sa .Hr param.html#pgheight pageheight, .Hr param.html#flipmarg flipmargins, .Hr param.html#leftmar leftmargin, .Hr param.html#rightmar rightmargin, .Hr param.html#units units .Ix hQ .eP .\"------------------------- .bP .Na .Hm panels panelsperpage .De This parameter specifies how many pages of music to print on each physical page. This parameter can only be specified before any music or block input. Note that the .Hr param.html#pgheight pageheight and .Hr param.html#pgwidth pagewidth parameters still apply to the physical paper size viewed in portrait mode, even when the panelsperpage value causes the printing to be landscape mode, so you should continue to leave those set as you normally would. The .Hr cmdargs.html#ooption -o command line option may be useful for getting pages printed in desired order. For example, to make a 4-page booklet from a single sheet of paper folded in half, you can use panelsperpage=2, then use -o4,1 to print one side of the paper, and -o2,3 to print the other side. When panelsperpage is 2, the first page side is always left. .Va 1 or 2 .Df 1 .Cn score .Oo .eX panelsperpage=2 .Sa .Hr param.html#firstpg firstpage, .Hr param.html#pgheight pageheight, .Hr param.html#pgwidth pagewidth .eP .\"------------------------- .bP .Na .Hm pedstyle pedstyle .De This parameter specifies whether to display .Hr pedal.html piano pedal marks with lines or with the word "Ped" and "*". With the "pedstar" style, a "bounce" of the pedal is shown by a "* Ped," whereas with the "alt pedstar" style, only a "Ped" is printed. .Va line, pedstar, or alt pedstar .Df line .Cn score, staff .Nm .eX pedstyle = pedstar .Ix dS .Ix fL .eP \"---------------------------------- .bP .Na .Hm printedtime printedtime .De This parameter defines what to print as a key signature, if you want that to be something other than the actual time signature. .Va There are three possible formats for the value. The first is just like for the "time" parameter, except that alternating time is not allowed. An example usage might be if most staffs are in 3/4 time, but one is really in 6/8, so you could set that staff's printedtime parameter to 6/8. Another example would be to set the actual time signature to 7/4, but set individual staffs to 3/4+4/4 or 4/4+3/4 as appropriate. The second format is a single string. One usage might be to set it to "3" and assume the reader can deduce what the time unit is. The third format is two strings, which will be centered one on top of the other. A possible usage would be to put a "3" for the numerator, and an actual note symbol for the "denominator." It is also possible to set to nothing, to revert to using the actual time signature. Default size and font are set to match what normal time signatures would be; you can change those inside the string(s) if you wish. .Df nothing .Cn score, staff .Nm .eS printedtime = 3/4 .br printedtime = 3/4+4/4 .br printedtime = "3" .br printedtime = "4" "\e(dn4n)" .br printedtime = // revert to actual time signature .Sa .Hr param.html#time time .eP .\"------------------------- .bP .Na .Hm prntkmap printkeymap .De This parameter specifies which keymap to use for .Hr prnttext.html print, left, right, center, and title commands. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, block .Im .eS printkeymap="Cyrillic" .br printkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"--------------- .bP .Na .Hm prmultn printmultnum .De If set to "y," .Hr multirst.html multirests are labeled with the number of measures of rest they represent; if set to "n," they aren't. This would allow you to print some other commentary in place of the number, print it in a different style, etc. .Va y or n .Df y .Cn score, staff .Nm .eX printmultnum = n .eP .bP .Na .Hm rehkmap rehearsalkeymap .De This parameter specifies which keymap to use for rehearsal mark strings. This does not apply to lettered or numbered rehersal marks. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Nm .eS rehearsalkeymap="Cyrillic" .br rehearsalkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#textkmap textkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"------------------------- .bP .Na .Hm rehstyle rehstyle .De This parameter specifies whether to enclose .Hr bars.html#reh rehearsal marks inside box, inside a circle, or just as plain text. .Va boxed, circled, or plain .Df boxed .Cn score, staff .Nm .eX rehstyle = circled .Sa .Hr param.html#endingst endingstyle .Ix aQ .eP .\"------------------------- .bP .Na .Hm release release .De This parameter specifies how soon (in milliseconds) before the full time value of note to release the note when generating .Hr midi.html MIDI output. This controls how legato (smooth) the music is. A value of 0 will make it very legato. The larger the value, the more detached notes will be. This parameter specifies a maximum amount to shorten notes; a note will never be shortened to less than 75% of its full value, unless it has a dot or wedge on it, it which case the shortening can be a maximum of half or 2/3 respectively. The release value can be changed in .Hr midmeas.html the middle of a measure, using a construct like <<score release=50>> before a note group. .Va 0 to 500 .Df 20 .Cn score, staff, voice .Ni .mM .eX release = 40 .eP .\"------------------------- .bP .Na .Hm rptdots repeatdots .De If set to "standard," repeat signs are printed using the standard convention of two dots. If set to "all," repeat signs are printed with dots between all the lines of the staff. .Va standard or all .Df standard .Cn score, staff .Nm .eX repeatdots = all .Sa .Hr param.html#brktrpts bracketrepeats .eP .\"------------------------- .bP .Na .Hm restcomb restcombine .De If the given number of measures of rest occur in a row, they will be replaced by a .Hr multirst.html multirest. This parameter can be overridden by the -c command line option. See the .Hr cmdargs.html#coption description of the -c option for more complete information on how the combining is done. .Va 2 to 1000 or nothing .Df not set .Cn score .Te whatever the value is at the end of a series of rest measures is what is used .eS restcombine = 5 .br restcombine = // turn off combining .eP .\"--------------- .bP .Na .Hm restsymm restsymmult .De This parameter specifies how to print multirests. Multirests are normally drawn as a horizontal line on the middle line of the staff, with two vertical lines at the end. But there is an alternate notation style that uses rest symbols (whole, double whole, and quad whole) when the number of measures is short. If this parameter is set to "y," that alternate style will be used for multirests of eight measures or less. .Va y or n .Df n .Cn score, staff .Te at next multirest. When used with restcombine, if you set this after the first rest measure, it has no effect .eX restsymmult = y .Sa .Hr param.html#prmultn printmultnum .eP .\"------------------------- .bP .Na .Hm rightmar rightmargin .De This parameter sets the amount of white space margin to put at the right side of each page. It is specified in inches if the .Hr param.html#units units parameter is set to inches, or in centimeters if the units parameter is set to cm. This parameter can only be specified before any music or block input. Margins are unaffected by .Hr param.html#scale the "scale" parameter. You can use the .Hr param.html#flipmarg flipmargins parameter to adjust alternating pages to allow room for book binding. .Va 0.0 to pagewidth minus 0.5 inches .Df 0.5 inches .Cn score .Oo .eX rightmargin = 0.3 .Sa .Hr param.html#botmar bottommargin, .Hr param.html#flipmarg flipmargins, .Hr param.html#leftmar leftmargin, .Hr param.html#topmar topmargin, .Hr param.html#pgwidth pagewidth, .Hr param.html#units units .Ix fY .Ix gR .Ix gS .eP .\"----------------- .bP .Na .Hm scale scale .De This parameter specifies by what factor to scale the printed output. For example, scale=2 prints everything twice as large as normal, while scale=0.5 prints everything at half size. This parameter can only be specified before any music or block input. .Va a number between 0.1 and 10.0 .Df 1.0 .Cn score .Oo .eX scale=0.95 .Sa .Hr param.html#packfact packfact, .Hr param.html#packexp packexp, .Hr param.html#stscale staffscale .Ix fV .eP .\"----------------- .bP .Na .Hm scorepad scorepad .De This parameter sets the amount of padding (white space) to leave between scores, accounting for all the things that protrude from both scores. Either a single number, giving a minimum amount, or two numbers, giving a minimum and maximum, can be specified. They are specified in stepsizes. If only the minimum is specified, and it is larger than the default maximum of 2.0, the maximum will be adjusted to equal the minimum. Depending on the setting of the .Hr param.html#scoresep scoresep parameter, the maximum may be exceeded; see the description of scoresep for how these parameters interact to determine the placement of the scores. If a negative value is specified for scorepad, some overlap may occur (subject to the interaction with scoresep). Specifying a negative value may be particularly useful when things protrude downward from the top score and upward from the bottom score, but at different places horizontally, such that it is actually safe to put the scores closer together without collision, even though Mup can't tell that it is safe. Note, however, that this overrides Mup's protection against real collisions, so this must be used with care to avoid undesired overlaps. .Va one or two numbers, in the range from negative the height of the page and the height of a page, in stepsizes. If there are two numbers, they are separated by a comma, and the second must be greater than or equal to the first. This parameter also applies to .Hr prnttext.html#block blocks, but is simpler in that case, since nothing can actually protrude from a block. .Df 2.0, 2.0 .Cn score .Bw .eS scorepad = 5 .br scorepad = -1 .br scorepad = 3.5,10.75 .Sa .Hr param.html#scoresep scoresep, .Hr param.html#staffpad staffpad, .Hr param.html#staffsep staffsep .Ix dQ .Ix fO .Ix gZ .Ix hJ .eP .\"------------------ .bP .Na .Hm scoresep scoresep .De This parameter sets how much space to leave between scores; i.e., between the bottom line of the bottom staff of one score and the top line of the top staff of the following score. Either a single number, giving a minimum amount, or two numbers, giving a minimum and maximum, can be specified. They are specified in stepsizes. If only the minimum is specified, and it is larger than the default maximum of 20.0, the maximum will be adjusted to equal the minimum. Depending on the setting of the .Hr param.html#scorepad scorepad parameter, the maximum may be exceeded. The parameters interact as follows in determining the layout of a page: As many scores are allocated to the page as will fit (or until .Hr newscore.html a "newpage" command is encountered). Initially, they are packed together as tightly as they can be without violating the minimum values of scorepad and scoresep between any neighboring scores. Next, if there is extra space available at the bottom of the page, the scores are spread out, increasing the white space between them, but not increasing any beyond the maximum scorepad value. (Some may, however, already be beyond the maximum scorepad value, because the minimum scoresep value required it.) This spreading is done without regard for the maximum scoresep value. If any of the inter-score gaps start narrower than others (because of the minimum scoresep), they are increased first, in an attempt to even out the differences. If the maximum scorepad value is reached or exceeded between all the scores, and there is still extra space available at the bottom of the page, then the scores are spread out some more, increasing the white space between them, this time ignoring the scorepad values, but not increasing any beyond the maximum scoresep value. (Some may however already be beyond the maximum scoresep value, because of the previous steps.) If still not all the space is used up, it remains as extra space at the bottom of the page. This parameter also applies to .Hr prnttext.html#block blocks, but is simpler in that case, since nothing can actually protrude from a block. .Va one or two numbers, in the range from 6.0 to the height of the page in stepsizes. If there are two numbers, they are separated by a comma, and the second must be greater than or equal to the first. .Df 12.0, 20.0 .Cn score .Bw .eS scoresep = 25 .br scoresep = 9.6, 15.3 .Sa .Hr param.html#scorepad scorepad, .Hr param.html#staffpad staffpad, .Hr param.html#staffsep staffsep .Ix dR .Ix fO .Ix gM .Ix gN .eP .\"---------------- .bP .Na .Hm size size .De This parameter specifies what point size to use for text in .Hr prnttext.html print, title, left, right, and center statements. It also provides the default for rom, bold, ital, and boldital statements. .Va a number from 1 to 100 inclusive .Df 12 .Cn score, staff, header, footer, header2, footer2, top, bottom, top2, bottom2, block .Im .eX size = 9 .Sa .Hr param.html#font font, .Hr param.html#fontfam fontfamily, .Hr param.html#lyrsize lyricssize, .Hr param.html#withsize withsize .Ix aS .Ix aT .Ix bH .Ix gW .Ix hA .Ix hB .eP .\"------------------------ .bP .Na .Hm slashbet slashesbetween .De This parameter specifies whether to put two thick slanted lines between scores at the left edge of the staffs. These are often used when there are a lot of staffs, or when the number of scores per page varies, to help the musicians see clearly where the next score begins. .Va y or n .Df n .Cn score .Bw .eX slashesbetween=y .eP .\"------------------------ .bP .Na .Hm stlines stafflines .De This parameter specifies how many lines to draw for the staff. Normally, there are 5 lines per staff, but a single-line staff is sometimes used for percussion, and tablature staffs for various instruments may have different numbers of lines. Setting this parameter to 1 will produce a single line staff. The number of lines can be followed by "n" to indicate that .Hr param.html#clef clef and .Hr param.html#key key signature are not to be printed. The "n" also implies that accidentals are to be ignored and that notes are never to be transposed. If the number of lines is 1, the clef and key signature are never printed, regardless of whether you add the "n," so the "n" is really only meaningful when used with 5. When stafflines=1, you can only have one note per chord, and the pitch of that note is irrelevant, except for .Hr midi.html MIDI output. .Ix iE Alternately, rather than specifying "n," you can specify "drum," which means to use the drum clef (also sometimes called the "neutral" clef). With the drum clef, no key signature is printed, accidentals are ignored, and notes are never transposed. The value used for the .Hr param.html#clef clef parameter is used to determine the pitch for placement of notes in this case, but the drum clef of two vertical lines is printed. .sp For a tablature staff, rather than specifying a number of staff lines as the value, the keyword "tab" is used, optionally followed by a list of strings in parentheses. The strings are listed in order from the top line of the tablature staff to the bottom. .Ix hU Each item in the list has at least a string pitch, which is a letter from a to g, optionally followed by # or &. If there is more than one string having the same letter/accidental, they are distinguished by adding one or more single quote marks ("ticks"). An octave number can also be specified. If the list of strings is omitted, standard guitar strings are used, which is tab( e5 b4 g4 d4 a3 e'3 ). Tablature can only be specified in staff context, not score or voice, and when a tablature staff is specified, the staff above it becomes a "tabnote" staff, which is a normal 5-line staff containing music derived from the tablature staff. The list of strings, if any, can optionally be followed by y or n. Using y will cause the word TAB to be printed vertically at the beginning of every score. Using n will cause that to never to be printed. Not specifying either will cause it to be printed only on the very first staff, which is the most common way of printing tablature. .Va 1 or 5, optionally followed by "n" or "drum"; or for tablature staff, the keyword "tab" optionally followed by a list of strings, in parentheses, optionally followed by y or n. Setting the stafflines parameter will also reinitialize other parameters: .Hr param.html#key key, .Hr param.html#xpose transpose, .Hr param.html#addxpose addtranspose, .Hr param.html#clef clef, .Hr param.html#beamstyl beamstyle, and .Hr param.html#defoct defoct. .Df 5 .Cn score, staff .Te immediately for purposes of checking for interactions with other parameters. Forces new score if the number part of it changed. In any case, the "n" part takes effect at the next score. .eS stafflines=1 .br stafflines=5n .br stafflines = tab // standard guitar tablature staff .br stafflines = tab ( g3 d3 a2 e2 ) // standard bass guitar .br stafflines = tab (d# g b3 g'3) .br stafflines = tab y // print TAB "clef" on every score .Sa .Hr param.html#clef clef, .Hr param.html#key key, .Hr param.html#xpose transpose, .Hr param.html#addxpose addtranspose .Ix cG .Ix gW .Ix hA .Ix aA .Ix bL .Ix bW .Ix cG .Ix fB .Ix fI .Ix fM .Ix fX .Ix gU .eP .\"----------------- .bP .Na .Hm staffpad staffpad .De This parameter sets the minimum amount of space to leave between staffs, accounting for all the things that protrude from both staffs. If a negative value is specified, some overlap may occur, although it will still be limited by the value of the .Hr param.html#staffsep staffsep parameter. Specifying a negative value may be particularly useful when things protrude downward from the top staff and upward from the bottom staff, but at different places horizontally, such that it is actually safe to put the staffs closer together without collision, even though Mup can't tell that it is safe. Note, however, that this overrides Mup's protection against real collisions, so this must be used with care to avoid undesired overlaps. If this parameter is set in staff context for staff N, it affects the distance from staff N to staff N+1. .Va a number between negative the height of the page and the height of a page, in stepsizes .Df 0 .Cn score, staff .Ns .eX staffpad = -2 .br staffpad = 1.6 .Sa .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep, .Hr param.html#staffsep staffsep .Ix jA .Ix fO .Ix gZ .Ix hK .eP .\"------------------------ .bP .Na .Hm staffs staffs .De This parameter specifies the number of staffs. It is possible that not all of these staffs will be printed (see .Hr param.html#visible the "visible" parameter below and .Hr cmdargs.html#soption the -s command line argument). Changing the number of staffs causes all parameters that had been set in staff and voice context to be set back to their default values. It is usually preferable to only set the staff parameter once at the beginning of a song, and use .Hr param.html#visible the "visible" parameter when you want to change which staffs are actually printed, rather than changing the number of staffs. .Va a number between 1 and 40 inclusive. .Df 1 .Cn score .Te forces new score if it changed .eX staffs = 12 .Sa .Hr param.html#visible visible .Ix gL .Ix hK .eP .\"------------------------ .bP .Na .Hm stscale staffscale .De This parameter specifies how to scale the size of a staff relative to the size of other staffs. A value of 1.0 yields the normal size, whereas 0.5 yields a staff that is half as high, and 2.0 one that is twice as high as normal, and so forth. This might be used, for example, for a piece written for two instruments, say piano and violin, where you want the piano part to be written in normal size, but want to show the violin part in smaller size, such that while the pianist will have the violin part available for reference, it won't take up a lot of space. Another possible use is to set staffscale in score context, to make all staff-related things a different size, but leave other things, like .Hr headfoot.html headers and footers, unaffected. .Va 0.1 to 10.0 .Df 1.0 .Cn score, staff .Te forces new score if it changed .eX staffscale=0.75 .Sa .Hr param.html#scale scale .eP .\"---------------------- .bP .Na .Hm staffsep staffsep .De This parameter specifies the minimum amount of space to leave between any two adjacent staffs within the same score. It is specified in stepsizes, and is measured from the bottom line of the staff above to the top line of the staff below. Staffs will be spread wider than this minimum if necessary to prevent things from colliding. If this parameter is set in staff context for staff N, it affects the distance from staff N to staff N+1. .Va a number from 6.0 to the height of the page in stepsizes .Df 10 .Cn score, staff .Ns .eX staffsep = 14 .br staffsep = 17.8 .Sa .Hr param.html#scorepad scorepad, .Hr param.html#scoresep scoresep, .Hr param.html#staffpad staffpad .Ix fA .Ix fO .Ix gM .Ix gN .eP .\"------------------------ .bP .Na .Hm stemlen stemlen .De This parameter specifies how long stems should be, in stepsizes. This is for normal-sized chords; grace or cue size chords will gets stems that are 5/7 of this length. This length can be overridden on specific chords, using .Hr chrdattr.html#stemlen the len attribute in brackets before the chord. Stem lengths can also be affected by the .Hr param.html#sshorten stemshorten parameter. .Va 0.0 to 100.0 .Df 7.0 .Cn score, staff, voice .Nm .eX stemlen = 0 // to make all notes stemless .Sa .Hr param.html#sshorten stemshorten .Ix iB .eP .\"------------------------ .bP .Na .Hm sshorten stemshorten .De There are several circumstances in which Mup normally shortens stems slightly in an attempt to improve appearance. This parameter will accept one, two, or four values to control how stems are affected in those cases. On beamed chords, Mup will sometimes shorten stems slightly. This first value of this parameter lets you control the maximum amount of shortening that will ever be done on beamed notes. It is specified in stepsizes. The remaining three (optional) values control how Mup shortens stems that protrude from the staff. Most publishers of music shorten such stems somewhat, but there is some inconsistency in exactly how much. The second value to this parameter specifies the maximum amount to shorten any protruding stem, in stepsizes. The third and fourth specify at what point to begin shortening and at what point to reach the maximum shortening. These are specified in number of stepsizes from the middle line of the staff. Note that Mup will still lengthen stems from this value if necessary to accommodate things like dots or flags. By default, Mup will use full-length stems (normally 7.0 stepsizes) for any stem-up note at or below the middle line of the staff, and for any stem-down note at or above the middle line of the staff. Beyond there, it will gradually shorten stems until they get down to 5.0 stepsizes in length (2.0 stepsizes worth of shortening) for notes 6 stepsizes or more away from the middle line. So using a treble clef staff as an example, stem-up notes b or lower will normally get stems 7.0 stepsizes long (or even longer if necessary), but the c right above there will be a little shorter, and so on until the a on the first ledger line above the staff is the maximum shortening of 2.0 stepsizes. You can always override on individual chords using .Hr chrdattr.html#stemlen [len=N] to force a particular length. .Va 0.0 to 2.0 for maximum beam shortening, 0.0 to 7.0 for maximum shortening of stems that protrude from the staff, and -4 to 50 for where to begin and end shortening of protruding stems .Df 1.0, 2.0, 1, 6 .Cn score, staff, voice .Nm .eS stemshorten = 0 // never shorten any beamed stems .br stemshorten = 0, 0 // never shorten any stems .br // For beams, allow shortening up to 1.5 stepsizes. .br // For protruding, start shortening 4 stepsizes from the .br // middle line (i.e., f+ assuming treble clef), .br // and reach maximum shortening of 3.5 stepsizes .br // at 12 stepsizes from the middle line (g++). .br stemshorten = 1.5, 3.5, 4, 12 .Sa .Hr param.html#stemlen stemlen .eP .\"------------------------ .bP .Na .Hm subbar subbarstyle .De This parameter controls where subdivisions of bars, if any, are drawn and how they look. You might consider using this instead of or in connection with an additive .Hr param.html#time time signature. .Va Multiple specifications can be given. Each specification optionally begins with a linestyle of "dashed" or "dotted." If neither is given, then normal solid lines will be used. Next is the bartype, which may be either "bar," for a single line, or "dblbar," for double lines. Next comes the appearance, which is two values in parentheses, and separated by the word "to." The first value in the pair tells where to start drawing relative to the top staff in each range, and the second tells where to stop drawing relative to the bottom staff in each range. Each of the values is the word "top" (meaning relative to the top line of the staff), "middle" (meaning relative to the middle line of the staff), or "bottom" (meaning relative to the bottom line of the staff), optionally followed by a plus or minus sign and a number of stepsizes to add or subtract to get to the endpoint. The appearance can instead be just the word "between," meaning to draw from the bottom line of a staff to the top line of the staff below it, and applies to all subsequent specifications on the line. Or the appearance can be omitted, which will result in something that looks like normal bar lines (in which case you'll likely want to be using dashed or dotted to distinguish from normal bars). The appearance is followed by one or more ranges of staffs, like for the .Hr param.html#barstyle barstyle parameter, so things like 1-3 or 1-4,5-8,9,12 or the word "all." Finally there is the keyword "time" followed by one or more counts at which to draw the subbars. The counts may include decimal parts. Note that subbars are only drawn on a staff when a note or rest actually occurs on that count on that staff. .Df not set .Cn score .Nm .eS subbarstyle=bar all time 4 .br subbarstyle=dotted dblbar (top-2 to bottom-2) 1-5 time 3.5 .br subbarstyle=bar 3-7 between time 2 dotted dblbar 1-2 time 3, 5.75 .Sa .Hr param.html#barstyle bar, .Hr param.html#time time .eP .\"------------------------ .bP .Na .Hm swing swingunit .De This parameter only affects .Hr midi.html MIDI output. Some styles of music are often written in "swing time," meaning the players are expected to play pairs of notes with the first twice as long as the second, even though they are written as if they were the same duration, or as if the first was three times as long as the second. The most common example would be where the written notation shows two eighth notes like 8;; or a dotted rhythm like 8.;16; but the musician "knows" that the composer really intended it to be played as if it were a triplet {4;8;}3; This parameter adjusts the Mup MIDI output to follow this performance convention. If this parameter is set, each measure is divided into segments of durations of "swingunit," starting at the beginning. (Usually the .Hr param.html#time time signature divided by swingunit will be a whole number, but if not, the last piece will be shorter.) Then within each segment, the time where one group ends and the next group starts will be altered in either of these two circumstances: (1) The current boundary time is halfway into a swingunit, and each group is at least half a swingunit long, or (2) The current boundary time is 3/4 of the way into a swingunit, and the first group is at least 3/4 of a swingunit long, and the second group is at least 1/4 of a swingunit long. In both of these cases, the durations are altered so that the meeting point is 2/3 of the way into the swingunit. .Va a time value, like 2, 4, or 8, or not set to anything. It can be a dotted value like 2. or 16.. although dotted values are rarely likely to be useful. It can even be a time expression like 2.-32 although that is even less likely to be useful. .Df not set .Cn score, staff, voice .Nm .eS swingunit = 4 .br swingunit = // turn off swing .Sa .Hr param.html#timeunit timeunit .Ix jH .eP .\"------------------------ .bP .Na .Hm sylpos sylposition .De A | can be used in lyrics at the beginning of a syllable (after anything in angle brackets) to indicate syllable alignment. This will override the .Hr param.html#lyralign lyricsalign parameter, and may be useful for aligning verse numbers or to make syllables at the beginning of poetic lines line up. If the | is not preceded by a number, the sylposition parameter specifies the default alignment value to use. It is the number of points (1 point is 1/72 of an inch) from the horizontal "middle" of the chord to place the left edge of the syllable. Negative values are to the left of the middle, positive to the right, so this value is usually negative. .Va -100 to 100 .Df -5 .Cn score, staff .Nm .eX sylposition = -4 .Sa .Hr param.html#lyralign lyricsalign .Ix jB .eP .\"------------------------ .bP .Na .Hm tabwhite tabwhitebox .De This parameter specifies whether or not to put a small white box behind each fret number on .Hr tabstaff.html tablature staffs. This may make the music a little easier to read, since the staff lines won't be going through the middle of the fret numbers. .Va y or n .Df n .Cn score, staff, voice .Nm .eS tabwhitebox = y .Sa .Hr param.html#stlines stafflines .eP .bP .Na .Hm textkmap textkeymap .De This parameter specifies which keymap to use for .Hr textmark.html rom, ital, bold, and boldital commands. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Nm .eS textkeymap="Cyrillic" .br textkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#withkmap withkeymap .Ix jL .eP .\"------------------------ .bP .Na .Hm time time .De This parameter sets the time signature. Music data for each measure is checked to ensure that the total time in the measure for each voice and verse adds up to exactly the time signature, though supplying too little will be allowed with a warning. Setting the time parameter will also reinitialize .Hr param.html#timeunit the timeunit parameter and .Hr param.html#beamstyl the beamstyle parameter to their most recent values for the same time signature (which would be their default values if they had never been explicitly set for this time signature), unless they are also set in the same context. The .Hr param.html#printedtime printedtime parameter value is not reset. .Va either a ratio of the form \fIN/D\fP or the word "cut" or "common." If the ratio form is used, \fIN\fP must be between 1 and 99 inclusive, and \fID\fP must be 1, 2, 4, 8, 16, 32, or 64. If followed by "y," the time signature will be printed even if it didn't change. The numerator of the time signature can be the sum of several numbers, as in 3+4/4 or 2+3+2/2. You can also have several fractions added together, as in 3/4 + 4/4. It is also possible to provide "alternating" time signatures, where you list two (or more, although two is typical) time signatures separated by white space. Each measure then uses the next time signature in the list. For example, for 3/4 4/4, the first measure would be in 3/4 time, the second measure in 4/4, the third back in 3/4, the fourth in 4/4, and so forth. It is possible to combine all the various complexities, with things like 3+4/8 + 2+3/4 4+3/4, although that would be very uncommon. The time signature can optionally be followed by the letter "n" to specify that the time signature is not to be printed. Or it can be followed by the letter "y," which causes alternating time signatures to be treated differently. By default, the alternating signatures are printed just once, as a list, and the performer has to remember that each subsequent measure has a different time signature. Using y forces Mup to print the appropriate time signature on each measure. .Df 4/4 .Cn score .Im .eS time = 6/8 .br time = cut .br time = 13/16n .br time = 2+3+4 / 8 // additive numerator .br time = 3/4 + 4/4 // fractions added together .br time = 4/4 3/4 // alternating .br time = 3/4 6/8 y // alternating, printing time sig on every measure .Sa .Hr param.html#beamstyl beamstyle, .Hr param.html#printedtime printedtime, .Hr param.html#subbar subbarstyle, .Hr param.html#timeunit timeunit .Ix gT .Ix gU .Ix hA .Ix hG .eP .\"------------------------- .bP .Na .Hm timeunit timeunit .De This parameter sets the default time unit. If the first note of a measure has no time value specified, the value of the timeunit parameter will be used. If the .Hr param.html#time time signature is changed in a context where timeunit is not also set, the timeunit parameter reverts back to its previous value for that time signature, which defaults to the value of the denominator (bottom number) of the new time signature. .Va 1/8, 1/4, 1/2, 1, 2, 4, 8, 16, 32, 64, 128, or 256 representing octuple whole, quadruple whole, double whole, whole, half, quarter, eighth, sixteenth, thirty-second, sixty-fourth, 128th, or 256th. (Each represents one half the time of the one before it in the list). This can be followed by zero or more dots. Each dot adds 50% of the previous note or dot to the time. It can also be a time expression, like 2+8 or 1-4+16. The time value must be less than or equal to the time signature. The timeunit value can be reinitialized indirectly by setting .Hr param.html#time the time parameter. Setting the time parameter will set the timeunit to the value used most recently for that time signature. .Df the denominator (bottom number) of the time signature .Cn score, staff, voice .Nm .eS timeunit = 2 .br timeunit = 4. .br timeunit = 2 + 8 .Sa .Hr param.html#swing swingunit, .Hr param.html#time time .Ix cT .Ix gN .Ix gX .eP .\"------------------------- .bP .Na .Hm topmar topmargin .De This parameter sets the amount of white space margin to put at the top of each page. It is specified in inches if the .Hr param.html#units units parameter is set to inches, or in centimeters if the units parameter is set to cm. This parameter can only be specified before any music or block input. Margins are unaffected by .Hr param.html#scale the "scale" parameter. .Va 0.0 to pageheight minus 0.5 inches .Df 0.5 inches .Cn score .Oo .eX topmargin = 0.8 .Sa .Hr param.html#botmar bottommargin, .Hr param.html#leftmar leftmargin, .Hr param.html#rightmar rightmargin, .Hr param.html#pgheight pageheight, .Hr param.html#units units .Ix gM .Ix gP .Ix gS .eP .\"------------------------- .bP .Na .Hm xpose transpose .De This parameter specify by what interval to transpose the music data. The interval can be larger than an octave, but must be a valid interval (e.g., there is no such thing as a perfect 6th). It is an error to specify a transposition value that would result in a key signature with more than 7 flats or sharps. .Ix cG It is also an error if transposition would result in a note requiring a triple sharp or triple flat. .Va the word "up" or "down," followed by an interval and a whole number greater than 0. You can optionally add the keyword "notes" or "chords" at the end, to restrict the transposition to just notes or just chord symbols; by default, both are transposed. The interval is one of major, minor, augmented, diminished, or perfect. .Ix iQ The intervals can be abbreviated to their first 3 letters (maj, min, aug, dim, or per). The .Hr trnspose.html section on transposition lists transposition intervals and gives further details. Depending on which key signature you are transposing from, some transposition intervals may not work because they result in more than 7 flats or sharps. There is also another parameter called .Hr param.html#addxpose addtranspose. Typically you would use the transpose parameter to change the key of individual staffs (for transposing instruments), and then use the addtranspose parameter if you want to change the key of the entire score. But either of these parameters can be used either way. In any case, for each staff, and for the score, the values of transpose and addtranspose are both applied, one after the other, to the current key signature, notes, and chords to determine their resulting values. .Df up perfect 1 (i.e., no transposition) .Cn score, staff .Nm .eS transpose = up minor 3 .br transpose = down perfect 4 .br transpose = up minor 3 chords .Sa .Hr param.html#a4freq a4freq, .Hr param.html#addxpose addtranspose, .Hr param.html#key key, .Hr param.html#useaccs useaccs .Ix fB .Ix fC .Ix gA .Ix cG .Ix hF .eP .\"------------------------- .bP .Na .Hm tuning tuning .De This parameter specifies what tuning system to use for the "white" notes" (a through g) and the standard accidentals. In equal temperament, each octave is divided into 12 equally spaced half steps, with the frequency of each note being the twelfth root of 2 times that of the note below it. In pythagorean tuning, perfect fifths have a ratio of 3/2. In meantone, major thirds have a ratio of 5/4. See the chapter on .Hr tuning.html Custom Accidentals and Alternate Tunings for more information. .Va equal, pythagorean, or meantone .Df equal .Cn score .Nm .eX tuning = meantone .Sa .Hr param.html#a4freq a4freq, .Hr param.html#acctable acctable .eP .\"---------------------------- .bP .Na .Hm tupslope tupletslope .De This parameter allows you to control the slope of tuplet brackets. Two values must be given, separated by a comma. Mup calculates an appropriate slope for tuplet brackets by applying a linear regression algorithm. The first value supplied for the beamslope parameter is a factor by which to multiply the default slope that Mup calculates. The minimum value of 0.0 would cause all brackets to be horizontal, whereas the maximum value of 1.0 will use the slope Mup calculates. Intermediate values will yield brackets that are less slanted than the default slope calculation. The second value given to the tupletslope parameter is the maximum angle for the bracket, in degrees. If the originally calculated value multiplied by the factor yields an angle of greater than this maximum angle, the maximum angle will be used. .Va 0.0 to 1.0 for the factor, and 0.0 to 45.0 for the maximum angle .Df 0.7, 20 .Cn score, staff, voice .Im .eX tupletslope=0.5,15 .Sa .Hr param.html#beamslp beamslope .eP .\"---------------------------- .bP .Na .Hm units units .De This parameter specifies whether margin and page size parameters are specified in inches or in centimeters. .Va inches or cm .Df inches .Cn score .Im .eX units = cm .Sa .Hr param.html#topmar topmargin, .Hr param.html#botmar bottommargin .Hr param.html#leftmar leftmargin, .Hr param.html#rightmar rightmargin, .Hr param.html#pgheight pageheight, .Hr param.html#pgwidth pagewidth .Ix hS .eP .\"---------------------------- .bP .Na .Hm useaccs useaccs .De This parameter specifies whether to use accidentals throughout rather than a normal .Hr param.html#key key signature. A value of "n" means to use a key signature, and only use accidentals where specified by the user. A value of "y none" means to not use a key signature, but instead add accidentals everywhere as would be required by the key signature, using the standard practice that an accidental remains in effect for the remainder of the current measure. A value of "y all" causes accidentals to be placed on every single note. A value of "y nonnat" causes accidentals to be placed on every single note except when the accidental would be a natural, with naturals only printed when they would be required when using none. A value of "y noneremuser" is like "y none" but removes unnecessary user accidentals. A value of "y nonnatremuser" is like "y nonnat" but removes unnecessary user accidentals. A "y" by itself without a qualifier is an abbreviation for the "y none" value. When using this parameter, you may sometimes want to use the .Hr param.html#carryacc carryaccs parameter as well. .Va n, y none, y all, y nonnat, y noneremuser, y nonnatremuser .Df n .Cn score, staff .Te at next music context. If you turn it on in the middle of a score, it prints a key signature of naturals to cancel the key signature. .eX useaccs = y all .Sa .Hr param.html#addxpose addtranspose, .Hr param.html#carryacc carryaccs, .Hr param.html#key key, .Hr param.html#canclkey cancelkey, .Hr param.html#xpose transpose .eP .\"--------------------------------- .bP .Na .Hm vcombine vcombine .De This parameter tells Mup to combine the specified voices onto a single stem whenever possible. One common use would be if you want multiple voices for .Hr midi.html MIDI purposes, but want them printed on the same stems. Another typical use would be to obtain a printing style common for hymns and certain other styles of music, where the two voices on each staff are printed on one common stem whenever possible, but when a note is shared between two voices, two opposing stems are used to make it clear the note is indeed shared. The value of this parameter is a list of voices plus an optional qualifier. The list format is like elsewhere for voices; common examples would be \f(CW1,2\fR or \f(CW1-3\fR or \f(CW2-3\fR. Order of voices is significant: sometimes Mup may have to choose between two possible combinations, so voices listed first get priority. The list of voices can be followed by a qualifier to specify what happens when voices overlap. If the qualifier is "nooverlap," voices will only be combined if the bottom note of the higher voice is higher than the top note of the lower voice. If the qualifier is "stepsapart," voices will only be combined if the bottom note of the higher voice is at least two steps higher than the top note of the lower voice. (That is the typical value for getting the hymn style described above.) If the qualifier is "shareone," the bottom note of the top voice must be no lower than than top note of the lower voice for combining to occur. If the qualifier is "overlap," combining will occur without regard for how the voices overlap. For the purpose of the qualifier, voice 1 is assumed to be the highest voice, voice 3 the middle voice, and voice 2 the lowest. If the qualifier is "restsonly", notes will never be combined, but rests will be combined whenever possible. If no qualifier is specified, the default is nooverlap. Finally, an independent qualifier of "bymeas" can be specified, in which case combining will only be done in measures where the combining can be done on all chords in the measure. While the vcombine parameter is allowed to be used with any .Hr param.html#vscheme vscheme parameter value, using it with vscheme=1 is pointless, and only vscheme values of 2f and 3f are really appropriate. This parameters can be used with both voice-at-a-time and chord-at-a-time input styles. It has no effect on tablature or 1-line staffs. Note that there are various cases where combining will not be done, such as when time values or beamings are different in different voices, and cases where combining would cause information loss, such as when a shared note is tied in one voice but not another. In such cases, the usual non-combined format will be used. .Va comma-separated list of voices or voice ranges, or nothing, optionally followed by nooverlap, stepsapart, shareone, overlap, or restsonly, optionally followed by bymeas .Df not set .Cn score, staff .mM .Nm .eS vcombine=3,1-2 shareone bymeas .br vcombine= // turn off combining .Sa .Hr param.html#vscheme vscheme .eP .\"---------------------------- .bP .Na .Hm visible visible .De This parameter specifies whether a staff or voice is actually to be printed. This can be useful for printing a subset of a full score. The value is either y or n, for yes or no, or whereused. When whereused is specified, if a staff has no notes or lyrics or other associated things on an entire score, that staff is not printed. This might be used, for example, to save paper on an orchestral score by only printing staffs for instruments when they are actually playing. At least one staff must be visible at all times. When an individual voice is made invisible, but the other voice(s) on that staff remains visible, all the .Hr stuff.html tempo, dynamics, and similar marks associated with the staff will still be printed, since Mup cannot know for sure whether you meant them to be associated with a particular voice or with the staff as a whole. When .Hr midi.html MIDI output is generated, this parameter controls whether the staff or voice is audible, so you can control which voices are played. .Hr cmdargs.html#soption The -s command line argument can also be used to control which staffs are printed or played. .Va y, n, or whereused .Df y .Cn score, staff, voice .Te at next music context. If it results in a staff becoming visible or invisible, it forces a new score. .eX visible = n .Sa .Hr param.html#brace brace, .Hr param.html#bracket bracket, .Hr param.html#endingst endingstyle, .Hr param.html#staffs staffs .Ix bN .Ix gL .Ix hA .Ix hK .eP .\"--------------------------------- .bP .Na .Hm vscheme vscheme .De This parameter sets voice scheme. A value of 1 means there is only a single voice on a staff. The direction of note stems will be determined based on how high or low the notes are on the staff. A value of 2o means there are two voices with "opposing" stems. In other words, the stems of voice 1 will always point upward, and the stems of voice 2 will always point downward, unless they are .Hr chrdattr.html#stemdir explicitly forced the other way. A value of 2f means there are two voices with "free" or "floating" stems. That means in places where there are notes or rests in both .Ix iH voices, stem directions will be as if 2o were set. However, if one of the voices has "space" where there are no notes or rests, the stem directions of the other voice will be determined as if there were only a single voice. 2o is useful if you want to force stem directions a certain way. 2f is generally preferable when there are two voices only part of the time. The values 3o and 3f are like 2o and 2f except that a third voice is allowed. The third voice's stem defaults to up, but the direction can be changed at any chord. The .Hr chrdattr.html#stemdir stem direction remains in effect on subsequent chords of voice 3 until explicitly changed. While there can be voice crossings, in general voice 1 should be the "top" voice, voice 2 the "bottom" voice, and voice 3 the "middle" or "extra" voice. Mup does not use voice 3 when associating things like phrase marks and lyrics with chords. Setting vscheme to a different number of voices will reinitialize all voice level parameters for the affected staffs. .Va 1, 2o, 2f, 3o, or 3f .Df 1 .Cn score, staff .eX vscheme = 2f .Pm .Sa .Hr param.html#vcombine vcombine .Ix bF .Ix cO .Ix gZ .Ix hC .Ix hI .Ix hJ .Ix hL .eP .\"--------------------------------- .bP .Na .Hm warn warn .De This parameter specifies whether to print warning messages or not. Normally, Mup will print warnings when it encounters input that it considers somewhat dubious. Sometimes, however, that input will really be what you want, so this parameter allows you to turn off warning messages. .Va y or n .Df y .Cn score .Im .eX warn = n .eP .\"--------------- .bP .Na .Hm withfont withfont .De This parameter specifies which font type to use for text strings printed with chords using [with "string"]. .Va rom, ital, bold, or boldital .Df rom .Cn score, staff, voice .Nm .eX withfont=boldital .Sa .Hr param.html#font font, .Hr param.html#fontfam fontfamily, .Hr param.html#size size, .Hr param.html#withfam withfontfamily, .Hr param.html#withsize withsize .eP .\"--------------- .bP .Na .Hm withfam withfontfamily .De This parameter specifies which font family to use for text strings printed with chords using [with "string"]. .Va avantgarde, bookman, courier, helvetica, newcentury, palatino, or times .Df times .Cn score, staff, voice .Nm .eX withfontfamily=helvetica .Sa .Hr param.html#font font, .Hr param.html#fontfam fontfamily, .Hr param.html#size size, .Hr param.html#withfont withfont, .Hr param.html#withsize withsize .eP .bP .Na .Hm withkmap withkeymap .De This parameter specifies which keymap to use for text strings printed with chords using [with "string"]. See the .Hr textstr.html#keymaps section on keymaps in the .Hr textstr.html Text Strings chapter for more details. .Va a string matching the name of a keymap defined earlier, or nothing. An empty string ("") means don't do any mapping. Setting to nothing unsets any previous value, which effectively causes the .Hr param.html#defkmap defaultkeymap value to be used. .Df nothing .Cn score, staff .Nm .eS withkeymap="Cyrillic" .br withkeymap= .Sa .Hr param.html#defkmap defaultkeymap, .Hr param.html#endkmap endingkeymap, .Hr param.html#labkmap labelkeymap, .Hr param.html#lyrkmap lyricskeymap, .Hr param.html#prntkmap printkeymap, .Hr param.html#rehkmap rehearsalkeymap, .Hr param.html#textkmap textkeymap .Ix jL .eP .\"--------------- .bP .Na .Hm withsize withsize .De This parameter specifies which size to use for text strings printed with chords using [with "string"], specified in points. .Va 1 to 100 .Df 12 .Cn score, staff, voice .Nm .eX withsize=15 .Sa .Hr param.html#font font, .Hr param.html#fontfam fontfamily, .Hr param.html#size size, .Hr param.html#withfont withfont, .Hr param.html#withfam withfontfamily .eP .Hi .H 1 "HINTS" .P This section contains hints on how you can use Mup to accomplish various things that have not been covered up to this point. It doesn't introduce any new language features, but describes some additional ways to apply what you have already learned, and mentions some other tools you may find useful. .He .Ht Mup debugging .Hd debug.html .H 2 Debugging .P .Ix aP Since Mup requires its input in a fairly strict format, when a song is put in, it may contain "typos." Generally, the error messages that Mup prints .Ix hF will give you an idea of what is wrong. However, sometimes Mup is not able to recognize that something is wrong until some distance beyond the actual error. If you can't find anything wrong with the line that Mup lists as being in error, try looking at the end of the previous line, or even earlier lines. Some of the most common problems are missing semicolons and missing .Ix hH quotes. Missing quote marks tend to be especially confusing to Mup, and may cause many error messages, even though there is only one problem. Another common problem that may cause a very large number of error messages is forgetting to state "music" to enter music context. .Ix fQ .Ix hM .P Often listening to .Hr midi.html MIDI output is much more effective at spotting things like wrong notes and missing accidentals than trying to find them by eye. .Ht Adjusting Mup output .Hd adjust.html .H 2 "Adjusting Output" .P .Ix cP Mup does its best to lay out the music in an aesthetically pleasing way. Often, however, you may want to make adjustments. Perhaps the last part of a piece spilled over onto a third page and you'd like to squeeze it all on two pages, or a page turn falls at an awkward spot. There are several mechanisms available for making adjustments. They have already been discussed individually in various sections of this document, but this section tries to pull things together. .P .Hr newscore.html The "newscore," "newpage," "samescorebegin / samescoreend," and "samepagebegin / samepageend" commands .Ix cC .Ix cD can be used to force where breaks do or do not occur. This may be useful for ensuring a section ends at the end of a score or page. .P If you want to get a little more or less on each page, it is usually best to start with changing the .Hr param.html#scale scale, .Hr param.html#stscale staffscale, .Ix fV .Hr param.html#packfact packfact, .Ix dT and/or .Hr param.html#packexp packexp .Ix dU parameters. .Ix aD You may want to experiment with changing these individually first, to get a feel for how they work, as trying to change all of them at once may lead to interactions that change things more radically than you might expect. Changing staffscale in score context lets you adjust the size of the music without affecting the size of the text in headers and footers. Adjusting the margins is sometimes helpful as well. Other parameters that .Ix gS might be useful in some situations are: .Hr param.html#maxscore maxscores, .Hr param.html#scorepad scorepad, .Ix dQ .Hr param.html#scoresep scoresep, .Ix jA .Hr param.html#staffpad staffpad, and .Hr param.html#staffsep staffsep. .Ix fA .P The .Hr param.html#dist dist, .Ix fK .Hr param.html#dyndist dyndist, and .Hr param.html#chdist chorddist .Ix dO parameters are useful if you want items to line up vertically. The "align" and "dist" option can be used on rom, bold, ital, boldital, octave, mussym, crescendo and decrescendo statements, to force something where you want it. (The "dist" option can be used on rehearsal marks as well.) .P The appearance of lyrics can be adjusted using the .Hr param.html#lyrdist lyricsdist, .Ix hT .Hr param.html#lyrfont lyricsfont, .Hr param.html#lyrfam lyricsfontfamily, .Hr param.html#lyrsize lyricssize, and .Hr param.html#lyralign lyricsalign parameters. .P Printers often cannot print all the way to the edges of the paper, and sometimes print at some fixed offset from the actual corner of the page. Ghostscript includes an "align.ps" file that you can print that gives you instructions on how to compensate for that, by adding a special "setpagedevice" line to your PostScript files. That special line can be added to Mup output using the postscript afterprolog hook. Since hooks are wrapped in save/restore blocks, and the setpagedevice has to not be in such a block, restore and save lines have to be used to undo the block that Mup adds: .Ex postscript afterprolog " restore << /.HWMargins [18 18 18 12.5] /Margins [-75 0] >> setpagedevice save" .Ee Replace the numbers with those calculated by following the align.ps instructions. Note that the spacing may need to be exactly as align.ps says. .Ht Special uses of invisbar .Hd invisbar.html .H 2 "Special uses of invisbar" .P .Ix fH The "invisbar" can be used to force Mup into doing something in the middle of a bar that it normally would allow to happen only at a bar line. Suppose, for example, you wish to place a .Hr bars.html#reh rehearsal letter in the middle of a measure. This could be accomplished as follows: .Ex 1 .\"score leftmargin=2;rightmargin=2 .\"music // assume we are in 4/4 time, but want // a rehearsal letter by count 3 // of the measure // do first part of measure and use "space" // for last part so time values will add up // properly to a full measure 1: 4c;d;2s; // put in invisible bar with rehearsal letter invisbar rehearsal let // now do the last half of the measure, // this time with space at the beginning 1: 2s;4e;c; bar .Ee .P As another example of invisbar use, suppose you want to add a "courtesy" key signature at the end of a repeated section to remind the player that the beginning of the repeated section is in a different key. This can be done by adding an empty measure whose sole purpose is to produce this key signature. .Ex 1 score key=3& .\"leftmargin=2 .\"rightmargin=2 music 1: g;f;e;d; repeatstart 1: c;e;f;g; dblbar score key=0& music 1: g;f;e;d; bar ending "1." 1: f;e;2c; // add a courtesy key signature, // to remind player the beginning // of the repeated section is in // a different key invisbar score key=3& music 1: ms; repeatend ending "2." 1: e;d;2c; endbar .Ee .P You can use a similar technique to insert time signatures, clefs, etc. at unusual places. .Ht Chant .Hd chant.html .H 2 Chant .P Chant typically uses an irregular number of beats per measure, or often no measures at all in the normal sense. Mup checks to make sure you provide enough notes to fill the time signature, but will allow you to use less, filling the remainder with space. So one possible approach to writing chant is to specify a large time signature\(emat least as big as you will ever have on any given line of music\(emand then supplying as many notes as you need, letting Mup pad with space as needed. If the warnings are annoying, you can set the .Hr param.html#warn warn parameter to turn the warnings off. .P Here is an example that shows some other techniques you might use when .Ix iK writing chant. .Ex 1 .\" score .\" leftmargin=1.7 .\" rightmargin=1.7 .\" music 1: 1a; lyrics 1: "This<^ is an example of one way>"; bar 1: d;e;2f; lyrics 1: "to do chant."; bar 1: 1f; lyrics 1: "when<^ there are many words for a>"; bar 1: d;f;2; lyrics 1: "sin-gle note."; dblbar newscore // Note use of 'n' to not print the time signature score time=7/4n music 1: a;;;b;g;2a; lyrics 1: "When there are man-y notes,"; bar score time=8/4n music 1: d;e;f;e;f;8e;;2; lyrics 1: "You might change the time sig-na-ture"; bar score time=5/4n music 1: a;e;;2d; lyrics 1: "on ev-ery bar,"; bar score time=7/4n music 1: e;f;e;d;c;2d; lyrics 1: "to match the syl-la-bles."; dblbar newscore score time=8/4n music // Note use of 'n' to not print tuplet number/bracket 1: {d;e;f;g;e;2d;;}10n,1/2; lyrics 1: "You can al-so use tup-lets,"; invisbar 1: {f;g;e;2d;e;2.d;}9n,1/2; lyrics 1: "A-long with in-vis-bars."; dblbar newscore score stemlen=0 music 1: d+;c+;b;g;2a;; lyrics 1: "Set stem-len to ze-ro,"; invisbar 1: {f;2e;4d;c;1d;}9n,1/2; lyrics 1: "to get stem-less notes."; endbar .Ee .Ht Forcing shared noteheads .Hd sharehd.html .H 2 "Forcing shared noteheads" .P Mup will automatically share noteheads when it can figure out it is safe and proper to do so. However, there may be some unusual cases where you would like to force the notes from two voices to share noteheads even when Mup would not do that. That can be done by specifying a horizontal offset of zero, i.e., [ho 0], on one or both of the voices. .Ht Manually placed tuplet numbers .Hd mantup.html .H 2 "Manually placed tuplet numbers" .P Generally, Mup will place .Hr tuplets.html tuplet .Ix aX numbers for you. However, you do need to print them yourself on .Hr ichdattr.html#crossbm cross-staff beams. .Ix iC And there may be cases where you choose to use 'n' to turn off Mup's automatic printing of tuplet numbers, .Ix fU in order to print them manually in a different place than Mup would. Mup normally uses newcentury boldital font for tuplet numbers, in 11-point size for regular notes and 9-point for cue notes. So to make your manually placed tuplet numbers look the same as automatic ones, you might use a .Hr macros.html macro something like this: .Ex define TUPNUM(NUM) "\ef(NX)\es(11)" +`NUM` @ 1: { 8c; d; e; } 3n; 2.us; rom above 1 dist0: 1.34 TUPNUM(3); bar .Ee Or another approach would be something like this: .Ex define TN(NUM,WHERE,D,N) newcentury boldital WHERE dist D: N `NUM`;@ 1: { 8c; d; e; } 3n; 2.us; TN(3,above 1,0,1.34) bar .Ee .Ht Manual placement of notes .Hd manual.html .H 2 "Manual placement of notes" .Ix fU .Ix hL .P Mup supports up to three voices per staff. If you need more than that, such as .Ix bF when 4 notes of different lengths occur on the same beat, it is possible .Ix dJ to position extra notes manually. Manually positioned notes will not be included in .Hr midi.html MIDI output. .Ix aA .P First of all, unless the fourth voice is vertically far away from the other two, you'll probably need to reserve some extra space to the left or right of the other chords. This can be done .Ix gZ by adding a bit of .Hr chrdattr.html#pad padding to the chord. .Ix bD If you want the extra note on the left of the regular voices, add padding to whichever regular voice is leftmost. If you want it on the right, the padding will have to go on the following note, or on the bar line if you are on the last chord of a measure. The amount of padding to add may have to be determined by trial and error; 5 stepsizes .Ix fO is a good first guess. Next, set a .Hr tags.html location tag .Ix bE .Hr noteattr.html#ntag on one of the notes in one of the regular groups. The manually positioned note will be placed relative to that location tag. The x will be slightly left or right of the west or east of the existing group; something like 3 stepsizes might be a good first guess. The y can be specified in terms of stepsizes up from the note you used for the location tag. You can use a .Hr prnttext.html print statement .Ix hA using one of the special .Hr textstr.html#symlist music characters, such as: dblwhole, 1n, up2n, dn2n, up4n, up32n, etc. If the note needs ledger lines, dots, or accidentals, these too have to be manually positioned, .Ix bL .Ix gX which can be a bit tricky. Here is a simple example: .Ex 1 score .\"leftmargin=1.6; rightmargin=1.6 vscheme=3o beamstyle=4,4,4,4 music 1 1: [pad 4] 4g =h; a; b; a; 1 2: 4.c;8;2; 1 3: [down] 8e;; [ho 0] 2.f; print (h.w - 2.3, h.y + 3) "\e(up2n)" bar .Ee In this example, 4 stepsizes of padding was added to the quarter note g of voice 1 on staff 1. A location tag "h" was set to this note. After the information about the second voice on staff 1, a half note was manually placed 2.3 stepsizes left of the first voice and at pitch c+ (3 steps up from the g). .P If you also need to place an accidental and/or dots, more padding should be requested, and additional print statements used for each item. For example, you could specify perhaps 5 stepsizes of padding, then add: .Ex 1 .\"score .\"leftmargin=1.6; rightmargin=1.6 .\"beamstyle=4,4,4,4 .\"vscheme=3o .\"music .\"1 1: [pad 5] 4g =h; a; b; a; .\"1 2: 4.c;8;2; .\"1 3: [down]... 8e;; [ho 0] 2.f; .\"print (h.w - 2.3, h.y + 3) "\e(up2n)" print (h.w - 5, h.y + 3) "\e(flat)" .\"bar .Ee to place a flat sign in front of the c. .P Ledger lines needed by the notes also have to be placed manually, using the "line" command. If the note is more than three steps above or below the staff, more than one ledger line would be needed, and each would need to be specified separately. The y coordinate of the each ledger line would be the same as the y coordinate of the note, plus or minus some number of step sizes. The length of the line depends on the notehead. About 4.5 stepsizes is a good estimate for most notes, but a double whole needs more like 6 stepsizes. .Ht Trill with accidental .Hd trillacc.html .H 2 "Trill with accidental" .P Sometimes when notating a trill, .Ix bX you may want to place an accidental between the "tr" and the wavy line. The typical way of getting a trill, something like .Ex mussym above 1: 1 "tr" til 3; .Ee doesn't allow for such an accidental. However, the desired output can be achieved with a slightly different input: .Ex rom above 1: 1 "\e(tr)\es(-2)\e(flat)~" til 3; .Ee The \es(-2) makes the flat a little smaller; you can adjust the actual size to your taste. The tilde at the end of the string tells Mup to use a wavy line for the til clause. .Ht Accidental on tied-to note .Hd tieacc.html .H 2 "Accidental on tied-to note" .P When a note with an accidental is tied across a bar line, the standard convention is to not print the accidental on the tied-to note, and Mup uses that convention. If you really want to have the accidental printed, you can specify a slur rather than a tie. If you want the MIDI output to be correct, you can use an .Hr macros.html ifdef to use slur for printing and tie for MIDI. .Ex 1 .\" score .\" leftmargin=2 .\" rightmargin=2 .\" music 1: 2c;e& ifdef MIDI ~ else <> endif ; bar 1: 1e&; bar .Ee .Ht Bracketing notes across staffs .Hd brackmac.html .H 2 "Bracketing notes across staffs" .P In keyboard music, sometimes a bracket is drawn to indicate that notes from two staffs are to be played .Ix dW with the same hand. The bracket is really just a vertical line with short horizontal lines at each end. But if you need to make lots of brackets, a macro with parameters can be very helpful. .Ex 1 score .\" rightmargin=2 .\" leftmargin=2 staffs=2 staff 2 clef=bass vscheme=2f // Define a macro to draw a bracket to show that notes on two // different staffs are to be played with the same hand. // The parameters are location tags for the top and bottom notes // to be included in the bracket. define BRACK(TOP, BOT) // Draw a short horizontal line 0.5 stepsizes above the top note line (TOP.w - 2, TOP.n + 0.5) to (TOP.w - 1, TOP.n + 0.5) // Draw a vertical line from 0.5 stepsizes above the top note // to 0.5 stepsizes below the bottom note. // Do all the 'x' coordinates relative to the same note (in // this case the top), so that if the top and bottom chord happen // to be different widths, the line will still be vertical. line (TOP.w - 2, TOP.n + 0.5) to (TOP.w - 2, BOT.s - 0.5) // Draw short horizontal line just below and left of the bottom note. line (TOP.w - 2, BOT.s - 0.5) to (TOP.w - 1, BOT.s - 0.5) @ music // For each chord that is to get a bracket, add some padding to // make sure there is enough room, and set a location tag // on the top and bottom notes. 1: [pad 2] ce =a;[] df =b; [] d =c; [] ce =d; 2: [pad 2] g =e; [] a =f; [] af =g; [] g =h; 2 2: 2cc-; 4g-; cc-; // Now draw the brackets, using the tags as parameters BRACK (a, e) BRACK (b, f) BRACK (c, g) BRACK (d, h) bar .Ee .P Note that Mup supports .Hr crossst.html cross-staff stems, which is another way to notate a chord that is split across two staffs, and may often be a better choice. .Ht Cross-bar beaming .Hd crossbar.html .H 2 "Cross-bar beaming" .P Generally, beams do not cross bar lines, and Mup follows that rule. However, if you want beams to cross a bar line, there are at least two possible approaches to getting the desired effect. The first is to explicitly specify .Hr chrdattr.html#stemlen stem lengths such that all the beams in the various measures will lie on the same line. You can then use the .Hr linecurv.html line command to fill in the gaps in the beams across the bar lines. .P The other approach is to draw in the bar line using the "line" construct. .Ix gG .Ix hG .Ix bA .Ix dE .Ix fE To do this you first tell Mup that a measure is twice as long as is really is, so that you can put two actual measures inside what Mup thinks is a single measure. Here is an example. .Ex 1 .\"score rightmargin=1.5; leftmargin=1.5 .\"music // First make an empty measure ending with an // invisible bar. This is for the sole purpose // of allowing the real time signature to be // printed and would not be necessary if we // wanted to cross a bar line other than // the very first bar line of the piece. 1: ms; invisbar // Now, make the effective time signature twice // as long as the real time signature, but use "n" so this fake // time signature is not actually printed. // Set up for beaming across the entire double-length measure. // (You could could use other beamstyles if you wish, or custom beaming.) score time=8/4n beamstyle=1/2 music // Now do the double-length measure. On the chord // just after where we want a bar line, add some extra // padding and set a location tag so that we can draw // a bar line relative to the tag. 1: 8c;e;f;d;g;e;f;a; [pad 3; =a]g;e;f;a;g;d+;4c+; // Also set a location tag on the next bar line, // so that we can get the vertical endpoints of the // bar line that we draw from the endpoints of the // normal Mup-supplied bar line. bar =b // Now draw the bar line that goes through the beam. // Use the horizontal position relative to the "a" // location tag on the chord in the second actual measure, // and get the vertical endpoints from the "b" tag // associated with the next bar line. line (a.w + 1, b.y + 4) to (a.w + 1, b.y - 4) .Ee .Ht Printing relative to lyric syllables .Hd lyrtag.html .H 2 "Printing relative to lyric syllables" .P Here is an example that shows how location tags associated with lyric syllables might be useful: .Ex 1 .\"score .\" leftmargin=2 .\" rightmargin=2 .\"music 1: g;a;2g; lyrics below 1 : 4;;2; "\ev(+40)Yo,\ev(-40)\e=(_yo) sin<^ tu a>\e=(_words)-mor"; // Print an alternate word with brackets. print (_yo.w, _yo.y - 2.5) "\e(E')l," print (_yo.w - 4, _yo.y - 1.3) "\es(+12){" print (_yo.e - 1, _yo.y - 1.3) "\es(+12)}" // print curve to join three syllables curve (_words.w, _words.y - 1) to (_words.e - 1, _words.y - 1) bulge -1 bar .Ee .Ht Printing slanted text .Hd slantxt.html .H 2 "Printing slanted text" .P While Mup doesn't have a command for directly printing text at some particular angle, it does allow printing text above a line, and that line can be at an angle. The original intent was to use that for printing "glissando," but it can be used for other things too. So to print arbitrary text at an arbitrary angle, you can make the line so tiny it can hardly be seen. Because of roundoff, it is generally not possible to make it so small that you can't see it at all, but it can be small enough to look like just a stray ink dot. By adjusting the relative location of the endpoints of the tiny line, you can control the angle. .Ex 1 .\" score .\" leftmargin=2 .\" rightmargin=2 .\" music 1: 2c =c; =q; line (c.x, c.y - 14) to (c.x + 0.05, c.y -14.05) with "Slanted text"; line (q.x, q.y - 14) to (q.x + 0.04, q.y -14.02) with "Different angle"; bar .Ee .Ht Mixed time signatures .Hd mixtsig.html .H 2 "Mixed time signatures" .P Once in a while, music is written with different .Ix gU time signatures on different staffs. Starting with Version 6.8, there is a .Hr param.html#printedtime printedtime parameter to do that, so this section is probably not really necessary anymore, but it provides an example of how to print things manually for the case where the time signatures reduce to the same value, for example, 3/4 and 6/8 time (since 6/8 taken as a fraction and reduced to lowest terms is 3/4). You can make the output use both 3/4 and 6/8 by using a non-printing time signature, then placing the time signatures manually. Here is an example of how to do that: .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 // set time signature to 3/4 but don't print it time=3/4n staffs=2 staff 1 // We want this staff to be in 3/4 time, // so beam things in groups of // quarter note times. beamstyle=4,4,4 staff 2 // We want this staff to effectively be // in 6/8 time, so we'll beam things // in groups of dotted quarters. beamstyle=4., 4. // In real 6/8 time, the time unit would // be eighth note, so make that the default timeunit=8 music // Add padding to the first chord on at least one // of the staffs, to make room for the manually placed // time signatures, and set location tags 1: [pad 5; =t] c; 8d; e; f; g; 2: [=s] g; f; g; 4.c; // Manually place the time signatures // They are printed in 16-point newcentury bold font, // relative to the location tags that were set. // First print the 3/4 print (t.w - 4, t.y) "\ef(newcentury bold)\es(16)3"; print (t.w - 4, t.y - 4) "\ef(newcentury bold)\es(16)4"; // Then print the 6/8 print (t.w - 4, s.y) "\ef(newcentury bold)\es(16)6"; print (t.w - 4, s.y - 4) "\ef(newcentury bold)\es(16)8"; bar .Ee .Ht Defining a macro inside another macro .Hd nestmac.html .H 2 "Defining a macro inside another macro" .P .Ix aM One possible use for defining one .Hr macros.html macro inside another is to make it act differently depending on how many times it has been called. .P .Ix fL Suppose you want to have .Hr pedal.html pedal on the first and third count of each measure, but instead of having that printed for the whole song, you'd rather just print pedal marks for a couple measures, and then say "simile." .In aA However, for .Hr midi.html MIDI, you would want the pedal to apply to the entire song, as well as both staffs, not just the one it is printed under. One way to accomplish that is given below. A PED macro is defined. Each time it is called, it defines another macro (ONCE, TWICE, and THRICE) to keep track of how many times it has been called. On the third time, it prints the "simile." In any case, if it is not doing MIDI and has not yet reached THRICE, it prints the pedal marks. If it is doing MIDI, it always applies pedal to both staffs. .Ex 1 score staffs=2 pedstyle=pedstar alignped=n .\" rightmargin=1.5 .\" leftmargin=1.5 staff 2 clef=bass define PED ifndef ONCE define ONCE \@ else ifndef TWICE define TWICE \@ else ifndef THRICE define THRICE \@ rom below 2: 1 "simile"; endif endif endif ifdef MIDI pedal below 1-2: 1;3; else ifndef THRICE pedal below 2: 1;3; endif endif @ music 1: c;e;f;a; 2: ceg;;cfa;; PED bar 1: e;g;f;a; 2: ceg;;cfa;; PED bar 1: c;e;f;a; 2: ceg;;cfa;; PED bar .Ee .Ht Marking complicated tempo changes .Hd tempochg.html .H 2 "Marking complicated tempo changes" .P Sometimes you may wish to indicate tempo changes by showing two note values with an equals sign between them. For simple cases, this is fairly straightforward, but if you want to include beamed notes or a triplet, a little more work is required. Another use of this notation is to show that the music is to be played in "swing time," as in this example, which has two ordinary eighth notes on one side of the equals sign, and a triplet made up of a quarter and eighth note on the other: .Ex 1 score // This example assumes "size" is set to 15 size=15 .\" leftmargin=2.3 .\" rightmargin=2.3 .\" time=2/4 beamstyle=4,4 music // set a location tag 1: [=c] 8c+;a;g;f; // set X and Y to where the first note will be placed define X c.x - 3 @ define Y c.y + 5 @ // print "straight 8ths = triplet quarter plus 8th" // print the basic notes and equal sign print (X, Y) "\e(smup4n) \e(smup4n) = \e(smup4n) \e(smup8n)" // print the beam between the straight 8th notes wide line (X + 2.1, Y + 5.5) to (X + 7.2, Y + 5.5) // now do the triplet bracket line (X + 14.7, Y + 7.0) to (X + 17.6, Y + 7.0) // horz left top segment line (X + 19.4, Y + 7.0) to (X + 22.5, Y + 7.0) // horz right top segment line (X + 14.7, Y + 7.05) to (X + 14.7, Y + 5.3) // vert left side segment line (X + 22.5, Y + 7.05) to (X + 22.5, Y + 5.3) // vert right side segment // print the 3 in the middle of the bracket print (X + 17.9, Y + 6.1) "\es(8)\ef(TI)3" // the 3 for the triplet bar .Ee .P Note that if you want a piece to be played in swing time, you may also want to set the .Hr param.html#swing swingunit parameter, which will make the MIDI output use swing time. .Ht Placing several songs on one page .Hd multsong.html .H 2 "Placing several songs on one page" .P Sometimes you may wish to print more than one song on the same page. While Mup considers all of its input to be a single song, it is possible to get the effect of separate songs. First of all, on the last bar line of first song, use "hidechanges." That way, if the key or anything is different in the next song, Mup won't print the changes at the end of the first song. Then .Ix jC .Hr prnttext.html#block use a "block" for printing the titles for the second song. Here is an example: .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 .\" packfact=2 scoresep=10,14 label="" header title (18) "Title for first song" music 1: c;d;e;f; bar 1: f;e;d;c; bar 1: c;d;e;f; bar 1: f;d;2c; endbar // force time signature to be printed on next score // by changing the time, but only for an invisible measure score time=5/4n music 1: ms; invisbar hidechanges // Force the block closer to next score, // so it will better match the spacing of // the title of the first song. score scoresep=6,6 // print title for second song block title (30) " " // Allow some extra room above title title (18) "Title for second song" score // Set up for second song time=4/4 key=1& music 1: d;e;2f; bar // Put score spacing back to original score scoresep=10,14 music 1: a;2g;4f; bar 1: 2e;4c;d; bar 1: 2g;f; endbar .Ee .P The use of .Hr param.html#saverest saveparms and restoreparms, and/or .Hr macros.html#saverest savemacs and restoremacs may be useful in some cases, particularly if you want similar settings for several songs that are separated by songs where you want different settings. .Ht Cadenzas .Hd cadenza.html .H 2 "Cadenzas" .P .Ix iZ Cadenzas or cadenza-like passages are often written with an arbitrary number of notes per measure. One way to accomplish this is to use a .Hr tuplets.html tuplet with the appropriate number of notes. .Ex 1 score .\" leftmargin=2 .\" rightmargin=2 time = 3/4 music 1: { [cue]... 16g- bm;b-;c;d;e;f;g;a;b;a;g;f;e;d;c;b-;g- ebm;} 17n,2.; bar .Ee .Ht Transposition .Hd trnspose.html .H 2 "Transposition" .P .Ix fB The .Hr param.html#xpose transpose and .Hr param.html#addxpose addtranspose parameters can be used to transpose the pitches for a staff or the whole score. The following table shows what transposition values to use for different intervals. .TS center, box; c|c|c l|l|l. \fBhalfsteps\fP \fBtransposition\fP \fBalternate transposition\fP _ 0 perfect 1 diminished 2 1 augmented 1 minor 2 2 major 2 diminished 3 3 augmented 2 minor 3 4 major 3 diminished 4 5 augmented 3 perfect 4 6 augmented 4 diminished 5 7 perfect 5 diminished 6 8 augmented 5 minor 6 9 major 6 diminished 7 10 augmented 6 minor 7 11 major 7 diminished 8 .TE .P This table continues in a similar way for intervals beyond an octave. For each number of halfsteps you want to transpose, there is more than one way the .Hr param.html#xpose transpose and .Hr param.html#addxpose addtranspose parameters can be specified, as shown by this table. This allows to you control whether a sharp key or a flat key is to be used in cases where there is a choice. For example, if the key signature has three sharps, and you want to transpose up two halfsteps, you could say either .Ex transpose = up maj 2 .Ee or .Ex transpose = up dim 3 .Ee The first will result in a key of five sharps, and the second will result in seven flats. These are equivalent keys; in major for example, they are B and C flat, which are the same note. It is up to you to choose the way you would like it to be printed. But no key is allowed to have more than seven sharps or flats, so in most cases only one of the ways will result in a valid key, and the other way will result in an error message. .P The transpose and addtranspose parameters are allowed in score and staff contexts, so they can be set to different values on different staffs, and on the score as a whole. This is useful for printing scores where some of the instruments are transposing instruments (like B-flat clarinet). You can set the transpose parameter on specific staffs to appropriate values for the transposing instruments. Then if you decide you want to move the entire score to a new key, you can set the addtranspose parameter in score context. You can enter all the music at true pitch, but print the score and/or the individual parts with the correct transposition. .P Another use for setting different transposition values is the following trick, useful in guitar music for printing both the real chords and chords .Ix hV for capo. Say, for example, you have a song that is in B flat, but the guitar is to use a capo on the third fret, and play in the key of G. You could define the following macro to print both versions of a chord, the capo version above the real version: .Ex define CHORD(COUNT, NAME) bold chord all: COUNT[-1.3] \(gaNAME\(ga; // chord for capo ital(8) chord 1: COUNT \(gaNAME\(ga; // real chord @ .Ee Then, set these transpositions: .Ex score transpose = down minor 3 // transpose score for capo staff 1 transpose = up perfect 1 // override score transposition .Ee and similarly for any other staffs. Then, wherever you want to print a chord, say (for example) .Ex CHORD(3,Dm) .Ee This will print both versions of the chord above count 3 of the measure. For the top chord it will transpose this to Bm, the capo chord. For the bottom chord it will leave it as Dm, the real chord. .P For .Hr midi.html MIDI purposes, if your MIDI player supports altered tunings, the .Hr param.html#a4freq a4freq parameter could be used to get the effect of transposing all the voices. See also the section on .Hr macros.html#concat Concatenating macro names for another approach. .Ht Placing verses below the scores .Hd verses.html .H 2 "Placing verses below the scores" .P Sometimes, particularly with songs that have a lot of verses, .Ix cJ you may want to put some verses of lyrics as blocks of text below the music. Probably the easiest way to do this is using "print" or "paragraph" statements inside .Ix jC .Hr prnttext.html#block a "block." .Ex block print (_win.w + 30, _win.n - 15) "2. " print "\e Here is the first line and the second line and the third line. \&" print (_win.w + 90, _win.n - 15) "3. " print "\e Here is another verse's first line and its second line and its third line. \&" .Ee .P You may need to use a little trial-and-error to determine the coordinates to use on the print statements, but you only have to determine one coordinate per verse, and with a bit of practice it gets easier to find the right values. Since the "print" statement is being used, the font and size will be determined by the .Hr param.html#size size parameter and .Hr param.html#font font parameter, rather than by .Hr param.html#lyrsize lyricssize and .Hr param.html#lyrfont lyricsfont. .P If you also want chord symbols with these verses, you can do that too. It is easiest if you use Courier font, as shown in the example below, since its constant-width characters make it easy to line things up. If you use a proportional-width font, you will have to determine how to place the chords by trial and error. .Ex print (_win.w + 50, _win.n - 35) "3. " print "\ef(CR)\e C D7 G7 This is the first line C F of the next verse B\e(smflat) of the song. \&" .Ee .Ht Automatic piano reduction .Hd pianored.html .H 2 "Automatic piano reduction" .P Perhaps you'd like a four part vocal piece written on four separate staffs, .Ix iU as well as a piano reduction on two staffs with two voices. This could be done using: .Ex 1 score .\" rightmargin=2 .\" leftmargin=2 staffs=6 bracket=1-4 brace=5-6 staff 3 clef=treble8 staff 4 clef=bass staff 5 vscheme=2o staffscale=0.75 // make piano staffs a little smaller staff 6 clef=bass vscheme=2o staffscale=0.75 // Define macros to put each voice on its own staff // plus the appropriate staff/voice of the piano staffs. define S 1 1 & 5 1: @ // soprano define A 2 1 & 5 2: @ // alto define T 3 1 & 6 1: @ // tenor define B 4 1 & 6 2: @ // bass music S 2c+;; A 2f;e; T 2a;g; B 2c;; bar .Ee .P This can also be done using .Hr altinp.html chord-at-a-time input style: .Ex // Define a macro to put each voice on its own staff // plus the appropriate staff/voice of the piano staffs. // This example assumes inputting notes from bottom to top. define M [ 4 1 & 6 2; \e 3 1 & 6 1; \e 2 1 & 5 2; \e 1 1 & 5 1 ] : @ music M 2cafc+;cgec+; bar .Ee .Ht Deriving cue notes from another staff .Hd autocue.html .H 2 "Deriving cue notes from another staff" .P Sometimes you may want to have the notes on one staff be used as cue notes on another staff, typically to help the players of one instrument know when they should come in, by showing what another instrument will be playing just before their entrance. One way to do this is to define a .Hr macros.html macro. In this example, the macro is called NAC, for "normal and cue." The first parameter is the staff/voice that should get normal sized notes, the second is the staff/voice that should get cue sized notes, and the third is the Mup input for the notes themselves. Since REG and CUE parameters could each be passed a list, if multiple instruments are playing in unison, they could all in be listed as REG, and if you wanted multiple staffs to get the same cues, they could all be listed as CUE, as shown in this example: .Ex 1 define NAC(REG, CUE, INPUT) REG: INPUT CUE: [cue]... INPUT @ score staffs=4 .\" leftmargin=2 .\" rightmargin=2 staff 3 // it's okay if some of the staffs are invisible visible=n music NAC(1&3, 2&4, c;f;a;g;) bar .Ee .Ht Diagonal slash marks .Hd slashmrk.html .H 2 "Diagonal slash marks" .P Sometimes, instead of a note or notes, .Ix cA a diagonal slash mark is printed on a staff. This is used for various purposes, .Ix iY such as strumming a chord (in a .Ix hY guitar part), or to mean that the previous beat should be .Ix dZ repeated or that a note should be improvised. You can get slash marks for all notes by setting the .Hr param.html#notehead noteheads parameter. .Ex noteheads = "allslash" .Ee or if you want to use hollow slashes for half notes and longer .Ex noteheads = "slash" .Ee Usually such slash marks do not include a stem, so you may wish to also set .Ex stemlen=0 .Ee .P If you just want specific chords to be slashes, you can use the chord head shape override: .Ex 1 .\" score leftmargin=2 ; rightmargin=2 .\" time=4/4n .\" music 1: b;[ hs "allslash"; len 0 ]... ;;; bar .Ee .Ht Breath marks .Hd breathmk.html .H 2 "Breath marks" .P A comma in a large font can be used as a breath mark. .Ix jK Something in the range of 20 to 30 points usually looks good; you can adjust to your preference. .Ex 1 .\" score .\" leftmargin=1.5 .\" rightmargin=1.5 .\" music .\" 1: c;d;2e; rom (24) above all dist 0: 4.5 ","; bar 1: e;d;2c; bar .Ee .Ht Breaks .Hd breaks.html .H 2 "Breaks" .P As an alternate to a breath mark, sometimes a short vertical line is drawn through the top line of the staff. Another thing that is sometimes seen is something like a short bar line, just spanning the two middle spaces. That might be used in music that wasn't originally written with true bar lines. It might also be used to subdivide a bar, when there are an odd number of beats, to show the intended grouping of beats. These could be done using .Hr macros.html macros. Here is one possible implementation. Note that you could apply to multiple staffs by setting the STAFF argument to the list of desired staffs. .Ex 1 // short vertical line through top line of staff define BREAK(X,STAFF) rom above STAFF dist -2.3 ! : X "|"; @ // line spanning two middle spaces of the staff define SB(X,STAFF) rom above STAFF dist -7.2 ! : X "|"; rom above STAFF dist -5.8 ! : X "|"; @ .\" score .\" rightmargin=2 .\" leftmargin=2 .\" music 1: f;g;a;c; BREAK(1.5,1) SB(3.5,1) bar .Ee .Ht Organ pedal heel/toe marks .Hd heeltoe.html .H 2 "Organ pedal heel and toe marks" .P Mup does not include characters specially for the standard organ pedal .Ix iD heel and toe indications, but a U in helvetica font and the acc_hat music symbol can be used. You may want to make them a bit smaller than the default size, so defining macros for them may be useful. .Ex 1 score .\" leftmargin=2 ; rightmargin=2 clef = bass // define strings for the organ pedal heel and toe marks define HEEL "\es(-3)\ef(HB)U" @ define TOE "\es(-1)\e(acc_hat)" @ music 1: a-;b-;e;f; rom below 1: 1 HEEL; 2 TOE; rom above 1: 3 TOE; 4 HEEL; bar .Ee .Ht Generating blank staff paper .Hd muspaper.html .H 2 "Generating blank staff paper" .P It is possible to use Mup to generate .Ix iF blank music staff paper. You simply use an input file that contains .Hr chordinp.html#measdur measure spaces, each ending with an .Hr invisbar.html invisbar. You can control whether you want .Hr param.html#clef clefs, .Hr param.html#time time signatures, .Hr param.html#brace braces, etc., and can control the spacing of staffs using .Hr param.html#scoresep the scoresep parameter. Here is a simple input that will generate a page with 8 completely blank staffs. .Ex score scoresep=9,100 // spread staffs out nicely stafflines=5n // don't print any clefs label="" // make sure left edges line up both on first label2="" // and on subsequent lines topmargin=1 // allow extra margin to write in header/footer bottommargin=1 time=4/4n // don't print any time signature music define SCORE 1: ms; invisbar // no bar line at the end of the staff @ define SCORE_NEWSCORE SCORE newscore @ // print 8 staffs, with newscore between each SCORE_NEWSCORE SCORE_NEWSCORE SCORE_NEWSCORE SCORE_NEWSCORE SCORE_NEWSCORE SCORE_NEWSCORE SCORE_NEWSCORE SCORE .Ee .Ht Passing multiple coordinates to PostScript .Hd pscoord.html .H 2 "Passing multiple coordinates to PostScript" .P Now that Mup supports exporting tag information to .Hr prnttext.html#postscript user PostScript code, this hint is probably mostly obsolete, but it may still be useful for demonstrating how to do some unusual things. .P When you use a "postscript" section to add arbitrary PostScript code to the Mup output, you specify a current point, but sometimes it would be useful for the PostScript code to know about the location of more than one thing on the page, for example, to draw a line between two points, or to draw a box or oval around several chords. One way to do that is to have one postscript section to save away the x,y values of each point of interest, and then have a final postscript section that uses the points to draw something. Since Mup puts the contents of postscript sections inside a save/restore block, saving coordinate information for later use is a little tricky, but the following example shows one way it can be done. Earlier, in the .Hr macros.html#arrow section on macros, we showed how to draw a line with an arrow using macros and arithmetic expressions. Here we will show how to accomplish a similar thing using a postscript section. .vs -1 .Ex 1 score staffs=2 .\" leftmargin=2 ; rightmargin=2 staff 2 clef=bass music 1: c =c;r;e;f; 2: r;e =e;g;d; // This PostScript saves the (X,Y) coordinate of a point // near c in PostScript variables beginX and beginY postscript (c.x + 3, c.y) " % Save current point on the stack currentpoint % Since Mup did a save operation, move that save object % to the top of the stack and do a restore, % leaving the currentpoint values on the stack, % so we can then save them in beginX and beginY. 3 -1 roll restore /beginY exch def /beginX exch def % Push a 'save' object for Mup's restore to use save"; // This PostScript retrieves the beginX and beginY that were saved by the // previous PostScript, along with the given current point coordinate, // and from that, calculates and prints an arrow. postscript (e.x - 3, e.y) " % Similar to above, save the specified coord in endX and endY currentpoint 3 -1 roll restore /endY exch def /endX exch def % Calculate length of the line, sin and cos to get arrowhead angle, etc. /fullX endX beginX sub def /fullY endY beginY sub def /fulllen fullX fullX mul fullY fullY mul add sqrt def /cosine fullX fulllen div def /sine fullY fulllen div def /headlen 15 def /headwidth 10 def /headX headlen cosine mul def /headY headlen sine mul def /hbX endX headX sub def /hbY endY headY sub def /thicklen headwidth 2.0 div def /thickX thicklen sine mul def /thickY thicklen cosine mul def /feathupx hbX thickX sub def /feathupy hbY thickY add def /feathdnx hbX thickX add def /feathdny hbY thickY sub def % Make the arrow wide, a shade of red, and with rounded ends gsave 3 setlinewidth 0.8 0.2 0.2 setrgbcolor 1 setlinecap % Draw the line and its arrowhead lines newpath beginX beginY moveto endX endY lineto stroke newpath endX endY moveto feathupx feathupy lineto stroke newpath endX endY moveto feathdnx feathdny lineto stroke grestore % Push a save object to match the one we undid earlier save"; bar .Ee .vs +1 .Ht Printing braces .Hd brace.html .H 2 "Printing braces" .P Mup prints braces to the left of scores via the brace parameter, but it may sometimes be desired to print a brace somewhere else, and have it scale appropriately for its height. This can be done using an escape to PostScript. Here is a macro definition that can be used to print a brace, and an example of how to use it: .Ex 1 // brace expects an x value and bottom and top y values define BRACE(TOP, BOTTOM) postscript (TOP.w - 1, BOTTOM.s) with _top.y = TOP.n " currentpoint Mup_top.y brace" @ score .\" leftmargin=2 ; rightmargin=2 staffs=2 music 1: c+ =_t;;;; 2: c =_b;;;; BRACE(_t, _b) bar .Ee .P A somewhat more complicated version, which would print a string before the brace, might be: .Ex 1 define BRACE(TOP, BOTTOM, STRING) postscript (TOP.w - 1, BOTTOM.s) with _top.y = TOP.n " currentpoint /yloc exch def /xloc exch def currentpoint Mup_top.y brace /TimesRoman findfont 12 scalefont setfont xloc 7.5 sub (" + STRING + ") stringwidth pop sub yloc Mup_top.y add 2 div 1.5 sub moveto (" + STRING +") show" @ score .\" leftmargin=1.7 ; rightmargin=1.7 staffs=2 music 1: [pad 10] c+ =_t;;;; 2: c =_b;;;; BRACE(_t, _b, "Label") bar .Ee .P That still wouldn't handle things like special characters in the string, or different font sizes, but could handle simple cases, and be a starting point for more complicated ones. .Ht Converting Mup files to other formats .Hd pstools.html .H 2 "Converting Mup files to other formats" .P Since Mup generates PostScript, almost any PostScript tool can be used on its output. In particular, the "ps2pdf" tool that comes with Ghostscript can convert Mup output to PDF format, and the "ps2epsi" tool, which also comes with Ghostscript, converts a PostScript file to an Encapsulated PostScript (EPS) file. Many text processing and graphics programs will let you import EPS files, so this can let you insert Mup output into some other document. .P There is a "psutils" package, available from most Linux archives, that contains various Postscript tools. These include "psnup," which lets you print multiple pages on one sheet of paper with more flexibility than Mup's .Hr param.html#panels panelsperpage parameter, and "psselect," which prints a subset of pages. .P You can check the .Hr http://www.arkkra.com/doc/userpgms.html user-donated programs page on Arkkra's website for other programs for processing Mup input or output. .Ht Mup MIDI output .Hd midi.html .H 1 "MIDI OUTPUT" .H 2 "Basic information" .P .Ix aA Mup will optionally produce MIDI output .Hr cmdargs.html#moption (using the -m or -M command line argument). .Ix bN Mup is first and foremost a music publication program, so its MIDI capabilities have a few limitations. However, the MIDI output is quite useful for "proofreading" (or perhaps we should say "proof-listening"). It is often easier to spot a typo in Mup input by listening to it than to look at the output. Mup provides enough MIDI control to do virtually all of what MIDI supports, and will be adequate for many people. Others, however, may find they want a separate MIDI editor for really serious MIDI work. .P The following section assumes a general knowledge of MIDI. If you are not familiar with MIDI, there are many books available on the subject at most music stores or computer book stores. There are also many online resources and tutorials. You could start at .Hi http://www.midi.org .He .ig .Hr http://www.midi.org http://www.midi.org .. or use your favorite search engine. .P Each .Hr param.html#vscheme voice .Ix bF is put on a separate MIDI track. The first track contains .Ix cI .Ix gU general information such as key and time signature. The next track will be for staff 1, voice 1. If staff 1 has a second voice, that will be the next .Ix hK track, otherwise it will be voice 1 of staff 2, if any, and so forth, one track for each voice, top to bottom. .Ix gM .Ix gN .P Output is in MIDI file format 1, with a default of 120 quarter notes per minute, 192 ticks per quarter note. MIDI channel 1 is used by default for all voices. If you want to use different instrument sounds for different voices, you will need to specify a different channel for each voice, then specify the MIDI "program" for that voice. This is demonstrated in some of the examples later in this section. .Ix cK .Ix hL .P Mup MIDI output will handle .Hr bars.html repeats .Ix dZ and .Hr bars.html#endings first and second endings, .Ix aR but it does not know anything about "D.S. al coda" or anything of that sort. .Ix hN It is possible to work around this limitation to some extent using .Hr macros.html macros. .Ix aM For example, a section between a "sign" and a "jump to coda" symbol could be put inside a macro definition; then the macro can be called. Then later in the piece, where the "D. S." occurs, the macro can be called again if MIDI is defined. For example: .Ex // an introductory section, ends with a sign 1: c;d;e;f; mussym above all: 5 "sign"; bar // define macro for section between sign and // symbol to "jump to coda" define SECTION 1: g;a;g;; mussym above all: 5 "coda"; bar @ // print/play the section just defined by // the macro SECTION // now do the music up to the D.S. 1: e;f;2g; ital above 1: 1 "D. S. al Coda"; dblbar // human player would now flip back to // the sign, so do the MIDI equivalent: // play that section again. ifdef MIDI SECTION endif // now do the coda 1: e;d;2c; rom above 1: 0 "Coda"; endbar .Ee .Ix aN .P Mup mainly just outputs the note information. Mup will recognize .Hr octave.html octave marks, .Ix gA .Ix hL and move notes up or down appropriately. It recognizes .Hr pedal.html piano pedal marks. .Ix fL It does not attempt to interpret tempo or dynamics marks .Ix cH .Ix fR .Ix fS specified by .Hr textmark.html \&"rom," "boldital," etc. or ornaments in .Hr mussym.html \&"mussym" statement. .Ix fT It does not handle ties to a different voice. It does interpret .Hr bars.html#reh rehearsal marks .Ix aQ as cue points. It handles .Hr chrdattr.html#chstyle grace notes, .Ix aL .Hr roll.html rolls, .Hr chrdattr.html#slashes slashes, .Ix cA and .Hr ichdattr.html#alt alternation groups. .Ix aZ You can control how legato the music is by using .Hr param.html#release the Mup "release" parameter. .P Some styles of music are often .Ix jH written in "swing time," meaning the players are expected to play pairs of notes with the first twice as long as the second, even though they are written as if they were the same duration, or as if the first were three times as long as the second. The most common example would be where the written notation shows two eighth notes like 8;; or a dotted rhythm like 8.;16; but the musician "knows" that the composer really intended it to be played as if it were a triplet {4;8;}3; The .Hr param.html#swing swingunit parameter can be used to get Mup MIDI output to automatically follow that performance convention. .P A separate MIDI editing program may be useful for adding really complicated effects, but it is possible to specify MIDI directives to do almost anything you want. They are of the form: .Ex \fBmidi\fP \fIS V\fP\fB:\fP \fIbegintime "keyword=value";\fP .Ee .Ix dK The \fIS\fP and \fIV\fP specify the staff and voice for which the directive is .Ix hK to apply. As elsewhere in Mup, an omitted voice will default to voice 1, and both staff and voice can be given as a list. Certain keywords apply to the entire score. In that case the form .Ix cQ .Ix hJ .Ex \fBmidi all:\fP \fIbegintime "keyword=value";\fP .Ee is used instead. The items specified using "all" are placed on the first track, the track containing score-wide information. They are not applied to the voices on the other tracks. .P The \fIbegintime\fP, as elsewhere in Mup, gives the beat into the measure where the MIDI output is to be placed. .Ix dJ .Ix hG If notes are to be turned on or off at the same instant in time as the \fIbegintime\fP, first all "note off" commands are generated, then the "midi" command events, then "note on" commands. .P The \fIkeyword=value\fP gives specific information of what MIDI output to generate. The following keywords are currently supported: .Hi .DS .He .ft R .TS c c c c c l l l c c. \fBkeyword\fP \fBvalues\fP \fBmeaning\fP \fBmidi S V\fP \fBmidi all\fP _ program 0-127 program change (new instrument) yes no parameter 0-127,0-127 parameter yes yes .Ix cK channel 1-16 channel yes no chanpressure 0-127 channel pressure (after touch) yes yes .Ix cH tempo 10-1000 tempo, quarter notes per minute no yes seqnum 0-65535 sequence number yes yes text text text meta event yes yes .Ix bO copyright text copyright notice yes yes name text sequence/track name yes yes instrument text instrument name yes yes marker text marker meta event yes yes cue text cue point yes yes port 0-127 MIDI port yes yes .Ix cN onvelocity 1-127 note on velocity yes no offvelocity 0-127 note off velocity yes no hex hex data arbitrary MIDI data yes yes .TE .Hi .DE .He .P The keywords can be abbreviated to their first three or more letters, except "chanpressure" which requires at least five letters to differentiate it from "channel" ("cha" or "chan" will be interpreted as channel). In most cases, the "=" is followed by either a number or some text. Exceptions to this are discussed in the next few paragraphs. .P The "parameter" keyword is followed by two numbers, separated by a comma. .Ix aD The first is the parameter number, the second is the parameter value. Thus to set parameter 7 (which is the volume parameter) to 90 for voice 2 of staff 3, starting at the beginning of the measure, you can use: .Ex midi 3 2: 0 "parameter=7,90"; .Ee .P The "onvelocity" and "offvelocity" keywords can have one or more values, separated by commas. If there is only one value, it applies to all notes in each chord. If there is more than one value, the first value applies to the top note of the chord, the second value to the second-from-the-top note, and so forth. If there are more notes in a chord than there are values specified, the last value specified applies to all of the remaining notes. So, for example, if you want to emphasize the top note of each chord because it is the melody, you can specify two values, as in .Ex midi 1: 1 "onvelocity=76, 60"; .Ee which would cause the top note to have a velocity of 76 and all other notes to have a velocity of 60. .P The "hex" form can be used to insert any arbitrary MIDI data into the MIDI file. The value consists of any even number of hexadecimal digits. Spaces and tabs can be included in the value field for readability. .P Note that Mup uses the MIDI standard, which numbers instruments from 0 through 127, but some MIDI playback programs follow a convention of numbering them from 1 through 128. .P Here are some examples: .Ex midi all: 0 "tempo=72"; midi 1-2 1-2: 0 "channel=2"; 0 "program=14"; 3.5 "program=76"; midi all: 3 "hex= ff 00 02 00 01"; // sequence number 1 midi 3,6: 0 "channel=5"; 0 "prog=15"; 0 "instr=dulcimer"; // set parameter 7 (usually volume) to 100 midi 2: "par = 7, 100"; .Ee .P Here is a more extensive example of how midi commands might be used in a song: .Ex score staffs=2 vscheme=2o staff 2 clef=bass voice 2 2 // Make the bottom voice more staccato release=50 music // Set the tempo. // Start out at 108 quarter notes per minute, // but on count 4, slow down to 96 per minute. midi all: 0 "tempo=108"; 4 "tempo=96"; // Put each voice on a different channel // using a different instrument sound. // The program numbers correspond to the // General MIDI sounds as noted. midi 1 1: 0 "channel=1"; 0 "program=68"; //oboe midi 1 2: 0 "channel=2"; 0 "program=11"; //vibraphone midi 2 1: 0 "channel=6"; 0 "program=60"; //french horn midi 2 2: 0 "channel=4"; 0 "program=35"; //fretless bass // Make the top voice louder, and put an // accent on the third beat midi 1 1: 0 "onvelocity=86"; 3 "onvelocity=100"; 4 "onvel=86"; // Set maximum reverb on french horn part, // starting at the second beat. // (Reverb is parameter 91) midi 2 1: 2 "parameter=91, 127"; // Set chorus on oboe to 75, from the beginning. // (Chorus is parameter 93) midi 1 1: 0 "param=93, 75"; // Pan the bass part to middle of left side. // (Pan is parameter 10, with a value of 0 being hard left, // 64 in the center, and 127 being hard right, so 32 is // half way to the left.) midi 2 2: 0 "parameter=10, 32"; // Now the music to be played... 1 1: e;d;2c; 1 2: c;b-;2g-; 2 1: g;f;2e; 2 2: c;g-;2c; bar .Ee .Ht Gradual MIDI changes .Hd gradmidi.html .H 2 "Gradual MIDI changes" .P Often you may like to have gradual changes in things like tempo or volume or onvelocity. You can, of course, tell Mup exactly what you want for each individual note, but you can also just specify beginning and ending values and optionally some intermediate values, and Mup will do interpolation, creating as many midi commands as necessary to produce smooth gradual changes. .P As a common example, suppose you want to do a ritard. You could do something like: .Ex midi all: 3 "tempo=120 to 96" til 1m+4; .Ee This would start the tempo at 120 quarter notes per minutes at beat 3 of the current measure and ritard to 96 per minutes at beat 4 of the following measure. If only two values are given, as in that example, the change is done linearly, but you can also specify multiple points that make up a curve. The curve is divided into equal segments: if there are three points, it will be treated as two equal segments; if four points, as three segments, etc. As an example, you could slow down and then speed back up: .Ex midi all: 2 "tempo = 112 to 92 to 112" til 2m+4; .Ee or increase onvelocity slowly at first and then more so: .Ex midi 1: 1 "onvelocity= 40 to 50 to 70 to 105" til 4.5; .Ee .P Changes in time signature are not allowed during a single gradual change, because it may not be entirely clear what is wanted in that case. So you have to tell Mup what you want by starting a new gradual change at each time signature change. .P Note that all midi commands must either include both a "to" and a "til" or neither. The to/til are only allowed on midi commands where the values are numbers, namely channel, chanpressure, offvelocity, onvelocity, parameter, port, program, and tempo. Note that a few of those may be of rather dubious usefulness, particularly channel and port, and perhaps program. For a parameter, the parameter number is specified just once, as in: .Ex midi 1: 1 "parameter=7, 40 to 60 to 70 to 90 to 65" til 4.5; .Ee In the case on onvelocity or offvelocity, the items between "to" can be lists that work like those without "to," with the first applying to the top note, and so forth. The number of comma-separated items does not need to be the same in all lists, since the last value in each list will apply to any remaining notes. So to play a C major chord, accenting each note in turn from bottom to top, you could do: .Ex midi 1: 1 "onvelocity=60,60,60,120 to 60,60,120,60 to 60,120,60 to 120,60" til 4; 1: cegc+;;;; bar .Ee .Hi .H 1 CONCLUSION .P .ig .\" special flag to tr2html to not process Ix items .Nx .. The Mup program provides a convenient way to produce high-quality musical scores. We hope you enjoy using it. .Ix hJ Appendix A gives a sample input file, demonstrating many of the features of Mup. You can download additional sample songs from the Arkkra Enterprises website listed below. The website also includes several programs written by Mup users that may make Mup even more useful for you. Once you've used Mup for a while, you may find the Quick Reference helpful for remembering details of the Mup language. .P If you have comments or questions, please contact: .Ix aF .Ix bM .in +1i Arkkra Enterprises .sp support@arkkra.com .sp http://www.arkkra.com .in -1i .SK \ \ \ .sp 3i .ps 16 .ft B .ce Appendix A .sp 3 .ce Example of a Mup input file .ft P .ps 10 .Ex 1 //!Mup-Arkkra // sample of a Mup input file header title (18) "The Star Spangled Banner" title ital (12) "(The United States National Anthem)" title (9) "Text: Francis Scott Key" "Tune: J. S. Smith" title (9) "" "arr: William J. Krauss" score topmargin = 0.5 bottommargin = 0.5 leftmargin = 0.65 rightmargin = 0.65 scale = 0.65 packfact = 1.3 key = 3# time = 3/4 staffs = 2 brace = 1-2 barstyle = 1-2 measnum = y vscheme = 2o beamstyle = 4,4,4 endingstyle = top staff 2 clef = bass define LYRICS lyrics between 1&2: @ music // Starts on a pickup, so use space // at beginning of measure. // Voices are in unison for the first // few notes, so specify two voices // at once. 1 1-2: 2s; 8.e<>; 16c; 2 1-2: 2s; 8.e<>; 16c; LYRICS 2s; 4; [1] "Oh_"; // Since the first two sections are // almost the same, use a repeat repeatstart 1 1: a-; c; e; 1 2: a-; c; b-; 2 1: a-; a; b; 2 2: a-; a; g; LYRICS [1] "say. can you"; \e [2] "stripes and bright"; bar 1 1: 2a; 8.c+; 16b; 1 2: 2c; 8.; 16; 2 1: 2a; 8.g; 16; 2 2: 2f; 8.e#; 16; LYRICS [1] "see, by the"; \e [2] "stars, through the"; bar 1 1: a; c; d#; 1 2: c; ; b-; 2 1: a; ; ; 2 2: f; ; b-; LYRICS [1] "dawn's ear-ly"; \e [2] "per-il-ous"; bar 1 1: e; r; 8e; ; 1 2: b-; r; 8b-; ; 2 1: g; r; 8g; ; 2 2: e; r; 8e; ; LYRICS [1] "light what so"; \e [2] "fight, o'er the"; bar 1 1: 4.c+; 8b; 4a; 1 2: 4.e; 8; 4; 2 1: 4.a; 8g; 4a; 2 2: 4.a-; 8b-; 4c; LYRICS [1] "proud-ly we"; \e [2] "ram-parts we"; bar 1 1: 2g; 8.f; 16g; 1 2: 2e; 8.; 16; 2 1: 2b; 8.; 16; 2 2: 2e; 8.d; 16; LYRICS [1] "hailed, At the"; \e [2] "watched, were so"; bar 1 1: a; ; e; 1 2: e; ; ; 2 1: a; ; e; 2 2: c; ; e; LYRICS [1] "twi-light's last"; \e [2] "gal-lant-ly"; bar ending "1." 1-2 1-2: c; 8a-; r; 8.e; 16c; LYRICS [1] "gleam-ing, whose broad"; repeatend ending "2." 1 1: c; 8a-; r; 8.c+; 16; 1 2: c; 8a-; r; 8.e; 16; 2 1: c; 8a-; r; 8.a; 16; 2 2: c; 8a-; r; 8.a-; 16; LYRICS [2] "stream-ing? And the"; bar endending 1 1: c+; d+; e+; 1 2: e; ; ; 2 1: a; b; c+; 2 2: a-; ; ; // continue to mark as verse 2 from now on, // so that the lyrics will line up properly // with the lyrics of the second ending. LYRICS [2] "rock-ets' red"; bar // Define a mapping, and use the chord-at-a-time input method for the // next several measures. Specify the voices in bottom to top order. define M [ 2 2; 2 1; 1 2; 1 1 ] @ M: a-c+ee+; rrrr; 8a-bed+; a-aec+; LYRICS [2] "glare, the bombs"; bar M: egeb; egec+; eged+; LYRICS [2] "burst-ing in"; bar M: eged+; rrrr; eged+; LYRICS [2] "air, gave"; bar M: 4.a-aec+; 8b-geb; 4caea; LYRICS [2] "proof through the"; bar M: 2ebeg; 8.ebdf; 16ebdg; LYRICS [2] "night that our"; bar M: faca; facc; b-ab-d#; LYRICS [2] "flag was still"; bar M: egb-e; rrrr; egb-e; LYRICS [2] "there. Oh"; bar 1 1: 4a; ; 8<>; g; 1 2: 4c; b-; 4a-; 2 1: e; ; ; 2 2: a-; b-; c; LYRICS [2] "say, does that"; bar 1 1: f; ; ; 1 2: d; ; e; 2 1: a; ; a#; 2 2: d; ; c; LYRICS [2] "star-span-gled"; bar 1 1: 4b; 8d+<>; c+; b<>; a; 1 2: 4d; 4f; ; 2 1: b; 8<>; a#; b<>; b#; 2 2: b-; 8<>; c; d<>; d#; LYRICS [2] "ban-ner yet"; bar mussym(12) 1-2: 2 "ferm"; 1 1: a<>; 8g; r; e; ; 1 2: 4.e; 8r; e; ; 2 1: c+<>; 8b; r; g; ; 2 2: 4.e; 8r; d; ; LYRICS [2] "wave_ o'er the"; bar 1 1: 4.a<>; 8b; c+; d+; 1 2: 4.e<>; 8; ; ; 2 1: 4.a<>; 8g; a; ; 2 2: 4.c<>; 8e; a-; b-; LYRICS [2] "land_ of the"; bar mussym(12) 1-2: 1 "ferm"; 1 1: e+; r; 8a; b; 1 2: e; r; 8d; ; 2 1: a; r; 8a; ; 2 2: c; r; 8f; fn; LYRICS [2] "free and the"; bar 1 1: 4.c+; 8d+; 4b; 1 2: 4.e; 8; 4d; 2 1: 4.a; 8; 4g; 2 2: 4.e; 8; 4; LYRICS [2] "home of the"; bar 1 1: 2a; 4s; 1 2: 2c; 4s; 2 1: 2e; 4s; 2 2: 2a-; 4s; LYRICS [2] "brave?"; endbar .Ee .br .ne 4i .ce .He INDEX .sp .nf .na .ta 6iR above\*(bJ accents\*(bK accidentals\*(bL adjusting output\*(cP alignment of lyrics\*(hT alignment of text\*(iP all\*(cQ alternation\*(aZ analysis\*(iM angle brackets\*(dX arguments, command line\*(bN Arkkra Enterprises\*(bM backslash\*(bC backspace\*(bI bar\*(gG barstyle\*(dD beaming\*(bA beamstyle\*(dE beats\*(dJ begintime\*(dK below\*(dL bend\*(hW between\*(dM block\*(jC bold\*(gH boldital\*(gI bottom\*(gN bottommargin\*(gO boxed text\*(iG brace\*(dV bracket\*(dW breath marks\*(jK cadenza\*(iZ cancelkey\*(iI capo\*(hV center\*(cV channel\*(cK chant\*(iK chord\*(gW chorddist\*(dO circled text\*(iG clef\*(fI coda\*(hN command line arguments\*(bN comments\*(aF concatenate strings\*(jM contexts\*(fQ copyright\*(bO crescendo\*(cL cross-staff beams\*(iC cross-staff stems\*(jI cue notes\*(bB _cur tag\*(jP curve\*(fD custom beaming\*(dI dashed line\*(fF dashed ties and slurs\*(iJ debugging\*(aP decrescendo\*(cM define\*(cS defoct\*(cU diacritical marks\*(cR diamond-shaped notes\*(bT diminished\*(iQ dist\*(fK division\*(bR dotted line\*(fG dotted note\*(gX dotted ties and slurs\*(iJ drum clef\*(iE D. S.\*(hN duration\*(fP dynamics\*(fR east\*(dA endings\*(aR endingstyle\*(dG error messages\*(hF even pages\*(dC figured bass\*(iN flags\*(dH flat\*(fC font\*(bG fontfamily\*(gB footer\*(aT fret\*(hZ Ghostscript\*(cE glissando\*(bQ grace notes\*(aL grids\*(iW guitar\*(hY header\*(aS heel\*(iD hidechanges\*(hR ifdef\*(aN improvisation\*(iY include\*(aO invisbar\*(fH italics\*(gK justification\*(dN key signature\*(cG keymap\*(jL labels\*(dP .\" left\*(cW leftmargin\*(gQ legato\*(bV length\*(iB line\*(fE lyrics\*(aE lyricsalign\*(hT macros\*(aM manual placement\*(fU map\*(iV margin\*(gS measure\*(hG measure numbers\*(dY measure repeat\*(hE measure rest\*(hD MIDI\*(aA mid-measure parameter changes\*(jF mordent\*(gD mouse\*(cX MS-DOS\*(aI multirest\*(aW mupdisp\*(aG mupprnt\*(aH music context\*(hM mussym\*(fT neutral clef\*(iE newpage\*(cC newscore\*(cD north\*(cY notes\*(hL numbering pages\*(aU octave\*(gA odd pages\*(dC ornaments\*(fS packexp\*(dU packfact\*(dT padding\*(bD _page tag\*(jN page footer\*(aT page header\*(aS pageheight\*(hP page number\*(aU pagewidth\*(hQ paragraph\*(jD parameters\*(aD parentheses\*(iA pedal\*(fL pedstyle\*(dS percussion\*(bW phrase\*(fJ piano reduction\*(iU pickup measure\*(aV piled text\*(iO pitch\*(fM PostScript\*(cF print\*(hA quoting\*(iT reduction\*(iU rehearsal marks\*(aQ release\*(jE repeat\*(dZ rest\*(hC restart\*(iS .\" right\*(fY rightmargin\*(gR roll\*(aY roman\*(gJ scale\*(fV _score tag\*(jQ score\*(hJ scorepad\*(dQ scoresep\*(dR scrolling\*(bZ semicolon\*(hH shaped notes\*(jG sharp\*(fC size\*(bH slash\*(cA slide\*(hX slope\*(jJ slur\*(cB small\*(gY south\*(cZ space\*(gZ spacing(see padding) staccato\*(bU _staff tags\*(jR staff\*(hK staff paper\*(iF stafflines\*(fX staffpad\*(jA staffsep\*(fA stem\*(hI stem direction\*(iH stem length\*(iB stepsize\*(fO strings\*(hB strum\*(iY subscript/superscript\*(iL swing time\*(jH syllable\*(gF sylposition\*(jB tablature\*(hU tag\*(bE tempo\*(cH text strings\*(hB tie\*(aK til\*(gV time\*(gT time signature\*(gU timeunit\*(cT title\*(gC toe.\*(iD top\*(gM topmargin\*(gP track\*(cI transpose\*(fB trill\*(bX triplets(see tuplets) tuplets\*(aX turn\*(gE uncollapsible space\*(iX undef\*(bY underline\*(hO underscore\*(fW units\*(hS UNIX\*(aJ velocity\*(cN verse\*(cJ visible\*(gL voice\*(bF vertical motion\*(iR vscheme\*(cO wavy lines\*(dF west\*(dB _win tag\*(jO with\*(fZ X-shaped notes\*(bS .\" next string to use is jS .fi .ad .if \n(.g \X'ps: exec %-marker2-' .TC 1 1 3
27.610625
197
0.743157
ed11af24bd52c85282c4c1e5dab0c54c33951358
489
t
Perl
t/apocalypse.t
gitpan/POE-Component-SSLify
979d24c36f1647fe5d03f5f162beb0502b982d15
[ "Artistic-1.0" ]
null
null
null
t/apocalypse.t
gitpan/POE-Component-SSLify
979d24c36f1647fe5d03f5f162beb0502b982d15
[ "Artistic-1.0" ]
null
null
null
t/apocalypse.t
gitpan/POE-Component-SSLify
979d24c36f1647fe5d03f5f162beb0502b982d15
[ "Artistic-1.0" ]
null
null
null
#!perl # # This file is part of POE-Component-SSLify # # This software is copyright (c) 2014 by Apocalypse. # # This is free software; you can redistribute it and/or modify it under # the same terms as the Perl 5 programming language system itself. # use strict; use warnings; use strict; use warnings; use Test::More; eval "use Test::Apocalypse 1.000"; if ( $@ ) { plan skip_all => 'Test::Apocalypse required for validating the distribution'; } else { is_apocalypse_here( { } ); }
22.227273
78
0.713701
ed5cd5e41ff00cdda3263309593c499a8dad61e9
9,958
pl
Perl
bin/prepare_evm_calls_from_maker_output.pl
genomecuration/JAM
8b834d3efe32f79c48887c2797005619ac2c3a1d
[ "BSD-3-Clause" ]
null
null
null
bin/prepare_evm_calls_from_maker_output.pl
genomecuration/JAM
8b834d3efe32f79c48887c2797005619ac2c3a1d
[ "BSD-3-Clause" ]
null
null
null
bin/prepare_evm_calls_from_maker_output.pl
genomecuration/JAM
8b834d3efe32f79c48887c2797005619ac2c3a1d
[ "BSD-3-Clause" ]
null
null
null
#!/usr/bin/env perl =pod =head1 USAGE Use EVM to call new Maker models Mandatory: -maker_output_dir :s Directory that hosts maker output -genome :s FASTA file with genome sequences Optional: -weights :s A weight file for EVM. Defaults created -verbose Be slighly verbose =head1 AUTHORS Brian Haas, Alexie Papanicolaou =cut use strict; use warnings; use Getopt::Long; use Pod::Usage; use POSIX qw(ceil); use FindBin qw($RealBin); use lib ("$RealBin/../PerlLib"); $ENV{PATH} .= ":$RealBin:$RealBin/../3rd_party/bin/:$RealBin:$RealBin/../3rd_party/evidencemodeler/"; use Gene_obj; use Gene_validator; my ( $maker_dir, $genome_sequence, $evm_weights_file, $debug ); my %allowed_types = ( 'augustus_masked' => 1, 'genemark' => 1, 'snap_masked' => 1 ); my $outdir = 'maker_output.' . $$; my ($evm_exec) = &check_program("evidence_modeler.pl"); pod2usage $! unless GetOptions( 'maker_output_dir:s' => \$maker_dir, 'genome:s' => \$genome_sequence, 'weights' => \$evm_weights_file, 'debug|verbose' => \$debug ); pod2usage "Cannot find $maker_dir\n" unless $maker_dir && -d $maker_dir; pod2usage "No genome provided...\n" unless $genome_sequence && -s $genome_sequence; $evm_weights_file = &create_evm_weights() unless -s $evm_weights_file && $evm_weights_file; mkdir $outdir unless -d $outdir; my $maker_gff = $maker_dir . '.gff'; &process_cmd("find . -name '*.gff' -exec cat '{}' \+ | cut -s -f 1-9 | grep -vP '\tcontig\t1' > $maker_gff"); open( IN, $maker_gff ) || die; my %hash; while ( my $ln = <IN> ) { next if $ln =~ /^#/; my @data = split( "\t", $ln ); next unless $data[8]; $ln = "\n" . $ln if $data[2] eq 'gene'; push( @{ $hash{ $data[1] } }, $ln ); } close IN; my (@abinitio_files); foreach my $type ( keys %hash ) { open( OUT, ">$outdir/$type" ); foreach my $ln ( @{ $hash{$type} } ) { print OUT $ln; } close OUT; next unless $allowed_types{$type}; my $gene_gff = &maker_match_gff_to_gene_gff3("$outdir/$type"); push( @abinitio_files, $gene_gff ); } %hash = (); open( OUTGP, ">$outdir/gene_predictions.gff3" ); foreach my $file (@abinitio_files) { open( IN, $file ); while ( my $ln = <IN> ) { print OUT $ln; } print "\n"; close IN; } close OUTGP; my $evm_output = $outdir . '/evm.out'; &process_cmd( $evm_exec . " --gene_predictions $outdir/gene_predictions.gff3 " . " --transcript_alignments $outdir/est2genome.gff " . " --protein_alignments $outdir/protein2genome.gff " . " --weights $evm_weights_file " . " --genome $genome_sequence " . " --trellis_search_limit 200 " . " > $evm_output " ); print "Done.\n See $evm_output\n\n"; ########################################################## sub read_fasta() { my $fasta = shift; my %hash; my $orig_sep = $/; $/ = '>'; open( IN, $fasta ) || confess( "Cannot open $fasta : " . $! ); while ( my $record = <IN> ) { chomp($record); next unless $record; my @lines = split( "\n", $record ); my $id = shift(@lines); my $seq = join( '', @lines ); $seq =~ s/\s+//g; if ( $id && $seq && $id =~ /^(\S+)/ ) { $hash{$1} = $seq; } } close IN; $/ = $orig_sep; return \%hash; } sub evm_to_gff_gtf() { my $evm_file = shift; my $genome_sequences_hashref = &read_fasta($genome_sequence); open( GFFOUT, ">$evm_file.gff" ); open( GTF, ">$evm_file.gtf" ); foreach my $contig_id ( keys @{$genome_sequences_hashref} ) { my ( %model_num_to_coords, %model_id_to_ev_type, %end5_to_phase ); my $model_id = 1; open( my $fh, $evm_file ) or die "Error, cannot open $evm_file\n"; while (<$fh>) { if (/^\!/) { next; } ## comment line if (/^\#/) { my $ev_type; if (/ELIMINATED/) { $ev_type = "EVM_elm"; } else { $ev_type = "EVM"; } $model_id_to_ev_type{$model_id} = $ev_type; next; } chomp; unless (/\w/) { $model_id++; next; } my @x = split(/\t/); if ( scalar(@x) == 6 && $x[0] =~ /^\d+$/ && $x[1] =~ /^\d+$/ ) { if ( $x[2] eq 'INTRON' ) { next; } my $coords_ref = $model_num_to_coords{$model_id}; unless ( ref $coords_ref ) { $coords_ref = $model_num_to_coords{$model_id} = {}; } $coords_ref->{ $x[0] } = $x[1]; $end5_to_phase{ $x[0] } = $x[3]; } } close $fh; my %phase_conversion = ( 1 => 0, 2 => 1, 3 => 2, 4 => 0, 5 => 1, 6 => 2 ); my @gene_objs; foreach my $model_id ( sort { $a <=> $b } keys %model_num_to_coords ) { my $ev_type = $model_id_to_ev_type{$model_id}; # if ($ev_type ne "EVM") { next; } #ignoring the EVM_elm for now. my $coords_ref = $model_num_to_coords{$model_id}; my $gene_obj = new Gene_obj(); $gene_obj->populate_gene_obj( $coords_ref, $coords_ref ); ## set phase: foreach my $exon ( $gene_obj->get_exons() ) { my $cds_obj = $exon->get_CDS_obj(); my ( $end5, $end3 ) = $cds_obj->get_coords(); $cds_obj->set_phase( $phase_conversion{ $end5_to_phase{$end5} } ); } $gene_obj->{Model_feat_name} = "evm.model.$contig_id.$model_id"; $gene_obj->{TU_feat_name} = "evm.TU.$contig_id.$model_id"; $gene_obj->{com_name} = "EVM prediction $contig_id.$model_id"; $gene_obj->{asmbl_id} = "$contig_id"; print GFFOUT $gene_obj->to_GFF3_format( source => $ev_type ) . "\n"; my $gtf_text = ""; eval { $gtf_text = $gene_obj->to_GTF_format( \$genome_sequences_hashref->$contig_id ); }; if ($@) { # do it in pseudogene mode - if not then UTR is printed as CDS... not good! $gene_obj->{is_pseudogene} = 1; $gtf_text = $gene_obj->to_GTF_format( \$genome_sequences_hashref->$contig_id ); } print GTF "$gtf_text\n"; } } close GFFOUT; close GTF; } sub process_cmd { my ($cmd) = @_; print "CMD: $cmd\n" if $debug; my $ret = system($cmd); if ( $ret && $ret != 256 ) { die "Error, cmd died with ret $ret\n"; } return $ret; } sub check_program() { my @paths; foreach my $prog (@_) { my $path = `which $prog`; die "Error, path to required $prog cannot be found\n" unless $path =~ /^\//; chomp($path); #$path = readlink($path) if -l $path; push( @paths, $path ); } return @paths; } sub splitfasta() { my @files; my $file2split = shift; my $outdir = shift; my $how_many_in_a_file = shift; my $pattern = shift; my $shuffle = shift; return unless $file2split && -s $file2split && $outdir && $how_many_in_a_file; return if -d $outdir; mkdir($outdir) unless -d $outdir; my $filecount; my $seqcount = int(0); my $shuffled_file = $shuffle ? &shuffle_fasta($file2split) : $file2split; open( FILE, $shuffled_file ) || die; my $orig_sep = $/; $/ = ">"; while ( my $record = <FILE> ) { chomp($record); next unless $record; my @lines = split( "\n", $record ); my $id = shift @lines; next if ( $pattern && $id !~ /$pattern/ ); $id =~ /^(\S+)/; $id = $1 || die "Cannot find ID for a sequence in $file2split"; chomp(@lines); my $seq = join( '', @lines ); $seq =~ s/\s+//g; $seq =~ s/\*$//; # for protein stop codons next unless $seq; $seqcount++; if ( !$filecount || $how_many_in_a_file == 1 || $seqcount > $how_many_in_a_file ) { $seqcount = int(0); $filecount++; my $outfile = $how_many_in_a_file == 1 ? $id : $file2split . "_" . $filecount; $outfile = $outdir . '/' . $outfile; close(OUT); open( OUT, ">$outfile" ) || die("Cannot open $outfile"); push( @files, $outfile ); } print OUT $/ . $id . "\n" . &wrap_text($seq); } close(FILE); close(OUT); $/ = $orig_sep; unlink($shuffled_file) if $shuffle; return \@files; } sub maker_match_gff_to_gene_gff3 { my $match_gff = shift; my $out = $match_gff . '.gene.gff3'; #from brian; my %genes; open( my $fh, $match_gff ) or die "Error, cannot open file $match_gff"; open( OUT, ">$out" ); while (<$fh>) { unless (/\w/) { next; } if (/^\#/) { next; } chomp; my @x = split(/\t/); my $scaff = $x[0]; my $source = $x[1]; my $feat_type = $x[2]; my $lend = $x[3]; my $rend = $x[4]; my $orient = $x[6]; my $info = $x[8]; ( $lend, $rend ) = sort { $a <=> $b } ( $lend, $rend ); my ( $end5, $end3 ) = ( $orient eq '+' ) ? ( $lend, $rend ) : ( $rend, $lend ); my %tags = &get_tags($info); if ( my $parent = $tags{Parent} ) { $genes{$parent}->{coords}->{$end5} = $end3; } elsif ( my $id = $tags{ID} ) { my $name = $tags{Name} || "No name"; $genes{$id}->{name} = $name; $genes{$id}->{scaffold} = $scaff; $genes{$id}->{source} = $source; } } close $fh; foreach my $gene_id ( keys %genes ) { my $data_href = $genes{$gene_id}; my $coords_href = $data_href->{coords}; my $gene_obj = new Gene_obj(); $gene_obj->populate_gene_object( $coords_href, $coords_href ); $gene_obj->{asmbl_id} = $data_href->{scaffold}; $gene_obj->{com_name} = $data_href->{name}; $gene_obj->{TU_feat_name} = $gene_id; $gene_obj->{Model_feat_name} = "m.$gene_id"; print OUT $gene_obj->to_GFF3_format( source => $data_href->{source} ) . "\n"; } return $out; } #### sub get_tags { my ($info) = @_; my %tags; my @fields = split( /;/, $info ); foreach my $field (@fields) { my ( $key, $val ) = split( /=/, $field ); $tags{$key} = $val; } return (%tags); } sub create_evm_weights() { my $out = "$outdir/evm_weights"; open( OUT, ">$out" ); print OUT "ABINITIO_PREDICTION\taugustus_masked\t1\nABINITIO_PREDICTION\tsnap_masked\t1\nABINITIO_PREDICTION\tgenemark\t1\nPROTEIN\tprotein2genome\t1\nTRANSCRIPT\test2genome\t1\n"; close OUT; return $out; }
24.832918
170
0.560554
73d9073235f30bc63bfae3d73dee2723c7b5b4c2
3,674
t
Perl
t/tar.t
BuildJet/MIP
f1f63117a7324e37dbcaa16c0298f4b4c857d44c
[ "MIT" ]
null
null
null
t/tar.t
BuildJet/MIP
f1f63117a7324e37dbcaa16c0298f4b4c857d44c
[ "MIT" ]
null
null
null
t/tar.t
BuildJet/MIP
f1f63117a7324e37dbcaa16c0298f4b4c857d44c
[ "MIT" ]
null
null
null
#!/usr/bin/env perl use 5.026; use Carp; use charnames qw{ :full :short }; use English qw{ -no_match_vars }; use File::Basename qw{ dirname }; use File::Spec::Functions qw{ catdir catfile }; use FindBin qw{ $Bin }; use open qw{ :encoding(UTF-8) :std }; use Params::Check qw{ allow check last_error }; use Test::More; use utf8; use warnings qw{ FATAL utf8 }; ## CPANM use autodie qw{ :all }; use Modern::Perl qw{ 2018 }; use Readonly; ## MIPs lib/ use lib catdir( dirname($Bin), q{lib} ); use MIP::Constants qw{ $COMMA $SPACE }; use MIP::Test::Commands qw{ test_function }; use MIP::Test::Fixtures qw{ test_standard_cli }; my $VERBOSE = 1; our $VERSION = 1.04; $VERBOSE = test_standard_cli( { verbose => $VERBOSE, version => $VERSION, } ); BEGIN { use MIP::Test::Fixtures qw{ test_import }; ### Check all internal dependency modules and imports ## Modules with import my %perl_module = ( q{MIP::Program::Tar} => [qw{ tar }], q{MIP::Test::Fixtures} => [qw{ test_standard_cli }], ); test_import( { perl_module_href => \%perl_module, } ); } use MIP::Program::Tar qw{ tar }; diag( q{Test tar from Tar.pm v} . $MIP::Program::Tar::VERSION . $COMMA . $SPACE . q{Perl} . $SPACE . $PERL_VERSION . $SPACE . $EXECUTABLE_NAME ); ## Base arguments my @function_base_commands = qw{ tar }; my %base_argument = ( filehandle => { input => undef, expected_output => \@function_base_commands, }, stderrfile_path => { input => q{stderrfile.test}, expected_output => q{2> stderrfile.test}, }, stderrfile_path_append => { input => q{stderrfile.test}, expected_output => q{2>> stderrfile.test}, }, stdoutfile_path => { input => q{stdoutfile.test}, expected_output => q{1> stdoutfile.test}, }, ); ## Can be duplicated with %base_argument and/or %specific_argument ## to enable testing of each individual argument my %required_argument = ( filehandle => { input => undef, expected_output => \@function_base_commands, }, ); my %specific_argument = ( create => { input => 1, expected_output => q{--create}, }, extract => { input => 1, expected_output => q{--extract}, }, filter_gzip => { input => 1, expected_output => q{-z}, }, file_path => { input => catfile(qw{ path to file }), expected_output => q{--file=} . catfile(qw{ path to file }), }, filehandle => { input => undef, expected_output => \@function_base_commands, }, in_paths_ref => { inputs_ref => [qw{file_1 file_2}], expected_output => q{file_1 file_2}, }, outdirectory_path => { input => catdir(qw{ a test dir }), expected_output => q{--directory=} . catdir(qw{a test dir}), }, ); ## Coderef - enables generalized use of generate call my $module_function_cref = \&tar; ## Test both base and function specific arguments my @arguments = ( \%base_argument, \%specific_argument ); ARGUMENT_HASH_REF: foreach my $argument_href (@arguments) { my @commands = test_function( { argument_href => $argument_href, do_test_base_command => 1, function_base_commands_ref => \@function_base_commands, module_function_cref => $module_function_cref, required_argument_href => \%required_argument, } ); } done_testing();
25.513889
68
0.573762
73edefcb189899c9a1f939ee10f11b9c9418fb76
6,374
pm
Perl
apps/automation/ansible/tower/mode/schedules.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
316
2015-01-18T20:37:21.000Z
2022-03-27T00:20:35.000Z
apps/automation/ansible/tower/mode/schedules.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
2,333
2015-04-26T19:10:19.000Z
2022-03-31T15:35:21.000Z
apps/automation/ansible/tower/mode/schedules.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
371
2015-01-18T20:37:23.000Z
2022-03-22T10:10:16.000Z
# # Copyright 2021 Centreon (http://www.centreon.com/) # # Centreon is a full-fledged industry-strength solution that meets # the needs in IT infrastructure and application monitoring for # service performance. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # package apps::automation::ansible::tower::mode::schedules; use base qw(centreon::plugins::templates::counter); use strict; use warnings; use centreon::plugins::templates::catalog_functions qw(catalog_status_threshold_ng); use DateTime; use centreon::plugins::misc; sub custom_start_output { my ($self, %options) = @_; return sprintf( 'last start: %s', $self->{result_values}->{start_last_time} >= 0 ? centreon::plugins::misc::change_seconds(value => $self->{result_values}->{start_last_time}) : 'never' ); } sub prefix_output_global { my ($self, %options) = @_; return 'Schedules '; } sub prefix_output_schedule { my ($self, %options) = @_; return "Schedule '" . $options{instance_value}->{display} . "' "; } sub set_counters { my ($self, %options) = @_; $self->{maps_counters_type} = [ { name => 'global', type => 0, cb_prefix_output => 'prefix_output_global' }, { name => 'schedules', type => 1, cb_prefix_output => 'prefix_output_schedule', message_multiple => 'All schedules are ok', skipped_code => { -10 => 1 } } ]; $self->{maps_counters}->{global} = [ { label => 'total', nlabel => 'schedules.total.count', set => { key_values => [ { name => 'total' } ], output_template => 'total: %d', perfdatas => [ { value => 'total', template => '%d', min => 0 } ] } } ]; foreach ((['successful', 1], ['failed', 1], ['running', 1], ['canceled', 0], ['pending', 0], ['default', 0], ['never', 0])) { push @{$self->{maps_counters}->{global}}, { label => $_->[0], nlabel => 'schedules.' . $_->[0] . '.count', display_ok => $_->[1], set => { key_values => [ { name => $_->[0] }, { name => 'total' } ], output_template => $_->[0] . ': %d', perfdatas => [ { template => '%d', min => 0, max => 'total' } ] } }; } $self->{maps_counters}->{schedules} = [ { label => 'job-status', type => 2, unknown_default => '%{last_job_status} =~ /default/', critical_default => '%{last_job_status} =~ /failed/', set => { key_values => [ { name => 'last_job_status' }, { name => 'display' } ], output_template => "last job status is '%s'", closure_custom_perfdata => sub { return 0; }, closure_custom_threshold_check => \&catalog_status_threshold_ng } }, { label => 'start-last-time', nlabel => 'schedule.start.last.time.seconds', set => { key_values => [ { name => 'start_last_time' }, { name => 'display' } ], closure_custom_output => $self->can('custom_start_output'), perfdatas => [ { template => '%d', min => 0, unit => 's', label_extra_instance => 1, instance_use => 'display' } ] } } ]; } sub new { my ($class, %options) = @_; my $self = $class->SUPER::new(package => __PACKAGE__, %options, force_new_perfdata => 1); bless $self, $class; $options{options}->add_options(arguments => { 'filter-name:s' => { name => 'filter_name' } }); return $self; } sub manage_selection { my ($self, %options) = @_; my $schedules = $options{custom}->tower_list_schedules(add_job_status => 1); $self->{global} = { total => 0, failed => 0, successful => 0, canceled => 0, default => 0, pending => 0, running => 0, never => 0 }; $self->{schedules} = {}; foreach my $schedule (@$schedules) { next if (defined($self->{option_results}->{filter_name}) && $self->{option_results}->{filter_name} ne '' && $schedule->{name} !~ /$self->{option_results}->{filter_name}/); my $start_last_time = -1; if (defined($schedule->{last_job}->{started})) { #2020-07-30T09:36:28.806283Z if ($schedule->{last_job}->{started} =~ /^(\d+)-(\d+)-(\d+)T(\d+):(\d+):(\d+)/) { my $dt = DateTime->new(year => $1, month => $2, day => $3, hour => $4, minute => $5, second => $6); $start_last_time = time() - $dt->epoch(); } } $self->{schedules}->{ $schedule->{id} } = { display => $schedule->{name}, last_job_status => defined($schedule->{last_job}->{status}) ? $schedule->{last_job}->{status} : 'never', start_last_time => $start_last_time }; $self->{global}->{total}++; if (defined($schedule->{last_job}->{status})) { $self->{global}->{ $schedule->{last_job}->{status} }++; } else { $self->{global}->{never}++; } } } 1; __END__ =head1 MODE Check schedules. =over 8 =item B<--filter-name> Filter schedule name (Can use regexp). =item B<--unknown-job-status> Set unknown threshold for status (Default: '%{last_job_status} =~ /default/'). Can used special variables like: %{last_job_status}, %{display} =item B<--warning-job-status> Set warning threshold for status. Can used special variables like: %{last_job_status}, %{display} =item B<--critical-job-status> Set critical threshold for status (Default: '%{last_job_status} =~ /failed/'). Can used special variables like: %{last_job_status}, %{display} =item B<--warning-*> B<--critical-*> Thresholds. Can be: 'total', 'successful', 'failed', 'running', 'canceled', 'pending', 'default', 'never', 'start-last-time' (s). =back =cut
33.547368
162
0.562127
ed1389c769a62555c8cfce2ab7add151416bff9d
2,595
pl
Perl
t/test_utils.pl
recogni/Verilog-Perl
0faa7e5faf9e93ef61d342bb57b431cd93c49e2b
[ "Artistic-2.0" ]
null
null
null
t/test_utils.pl
recogni/Verilog-Perl
0faa7e5faf9e93ef61d342bb57b431cd93c49e2b
[ "Artistic-2.0" ]
null
null
null
t/test_utils.pl
recogni/Verilog-Perl
0faa7e5faf9e93ef61d342bb57b431cd93c49e2b
[ "Artistic-2.0" ]
null
null
null
# DESCRIPTION: Perl ExtUtils: Common routines required by package tests # # Copyright 2000-2019 by Wilson Snyder. This program is free software; # you can redistribute it and/or modify it under the terms of either the GNU # Lesser General Public License Version 3 or the Perl Artistic License Version 2.0. use IO::File; use File::Copy; use strict; use vars qw($PERL); $PERL = "$^X -Iblib/arch -Iblib/lib -IPreproc/blib/arch -IPreproc/blib/lib"; mkdir 'test_dir',0777; unlink "test_dir/verilog"; # Symlink made in vpassert test will mess up others if (!$ENV{HARNESS_ACTIVE}) { use lib '.'; use lib '..'; use lib "blib/lib"; use lib "blib/arch"; use lib "Preproc/blib/lib"; use lib "Preproc/blib/arch"; } sub run_system { # Run a system command, check errors my $command = shift; print "\t$command\n"; system "$command"; my $status = $?; ($status == 0) or die "%Error: Command Failed $command, $status, stopped"; } sub run_system_no_die { # Run a system command, check errors my $command = shift; print "\t$command\n"; system "$command"; return $?; } sub wholefile { my $file = shift; my $fh = IO::File->new ($file) or die "%Error: $! $file"; my $wholefile = join('',$fh->getlines()); $fh->close(); return $wholefile; } sub files_identical { my $fn1 = shift; # got my $fn2 = shift; # expected my $f1 = IO::File->new ($fn1) or die "%Error: $! $fn1,"; my $f2 = IO::File->new ($fn2) or die "%Error: $! $fn2,"; my @l1 = $f1->getlines(); my @l2 = $f2->getlines(); my $nl = $#l1; $nl = $#l2 if ($#l2 > $nl); for (my $l=0; $l<=$nl; $l++) { $l1[$l] =~ s/\r\n/\n/g if defined $l1[$l]; # Cleanup if on Windows $l2[$l] =~ s/\r\n/\n/g if defined $l2[$l]; if (($l1[$l]||"") ne ($l2[$l]||"")) { next if ($l1[$l]||"") =~ /Generated by vrename on/; warn ("%Warning: Line ".($l+1)." mismatches; $fn1 $fn2\n" ."GOT: ".($l1[$l]||"*EOF*\n") ."EXP: ".($l2[$l]||"*EOF*\n")); if ($ENV{HARNESS_UPDATE_GOLDEN}) { # Update golden files with current warn "%Warning: HARNESS_UPDATE_GOLDEN set: cp $fn1 $fn2\n"; copy($fn1,$fn2); } else { warn "To update reference: HARNESS_UPDATE_GOLDEN=1 ".join(" ",$0,@ARGV)."\n"; } return 0; } } return 1; } sub get_memory_usage { # Return memory usage. Return 0 if the system doesn't look quite right. my $fh = IO::File->new("</proc/self/statm"); return 0 if !$fh; my $stat = $fh->getline || ""; my @stats = split /\s+/, $stat; return ($stats[0]||0)*4096; # vmsize } 1;
28.833333
83
0.581888
ed020894055df1024a2274e1a68efb8d90f6ebda
2,660
pm
Perl
lib/Chart/Plotly/Trace/Scatterpolargl/Stream.pm
hstejas/p5-Chart-Plotly
c1666613369ff44d0ec984935b02b4024638aacf
[ "MIT" ]
11
2017-01-08T12:08:24.000Z
2021-12-14T15:27:56.000Z
lib/Chart/Plotly/Trace/Scatterpolargl/Stream.pm
hstejas/p5-Chart-Plotly
c1666613369ff44d0ec984935b02b4024638aacf
[ "MIT" ]
28
2016-11-21T20:25:21.000Z
2021-04-20T16:58:38.000Z
lib/Chart/Plotly/Trace/Scatterpolargl/Stream.pm
hstejas/p5-Chart-Plotly
c1666613369ff44d0ec984935b02b4024638aacf
[ "MIT" ]
3
2016-12-14T15:59:41.000Z
2020-07-30T04:39:43.000Z
package Chart::Plotly::Trace::Scatterpolargl::Stream; use Moose; use MooseX::ExtraArgs; use Moose::Util::TypeConstraints qw(enum union); if (!defined Moose::Util::TypeConstraints::find_type_constraint('PDL')) { Moose::Util::TypeConstraints::type('PDL'); } # VERSION # ABSTRACT: This attribute is one of the possible options for the trace scatterpolargl. =encoding utf-8 =head1 SYNOPSIS # EXAMPLE: examples/traces/scatterpolargl.pl =head1 DESCRIPTION This attribute is part of the possible options for the trace scatterpolargl. This file has been autogenerated from the official plotly.js source. If you like Plotly, please support them: L<https://plot.ly/> Open source announcement: L<https://plot.ly/javascript/open-source-announcement/> Full reference: L<https://plot.ly/javascript/reference/#scatterpolargl> =head1 DISCLAIMER This is an unofficial Plotly Perl module. Currently I'm not affiliated in any way with Plotly. But I think plotly.js is a great library and I want to use it with perl. =head1 METHODS =cut =head2 TO_JSON Serialize the trace to JSON. This method should be called only by L<JSON> serializer. =cut sub TO_JSON { my $self = shift; my $extra_args = $self->extra_args // {}; my $meta = $self->meta; my %hash = %$self; for my $name (sort keys %hash) { my $attr = $meta->get_attribute($name); if (defined $attr) { my $value = $hash{$name}; my $type = $attr->type_constraint; if ($type && $type->equals('Bool')) { $hash{$name} = $value ? \1 : \ 0; } } } %hash = (%hash, %$extra_args); delete $hash{'extra_args'}; if ($self->can('type') && (!defined $hash{'type'})) { $hash{type} = $self->type(); } return \%hash; } =head1 ATTRIBUTES =over =cut =item * maxpoints Sets the maximum number of points to keep on the plots from an incoming stream. If `maxpoints` is set to *50*, only the newest 50 points will be displayed on the plot. =cut has maxpoints => ( is => "rw", isa => "Num", documentation => "Sets the maximum number of points to keep on the plots from an incoming stream. If `maxpoints` is set to *50*, only the newest 50 points will be displayed on the plot.", ); =item * token The stream id number links a data trace on a plot with a stream. See https://plot.ly/settings for more details. =cut has token => ( is => "rw", isa => "Str", documentation => "The stream id number links a data trace on a plot with a stream. See https://plot.ly/settings for more details.", ); =pod =back =cut __PACKAGE__->meta->make_immutable(); 1;
24.40367
191
0.664662
ed65cf7b06d565a77eee4a7ef6c2be7aaa39e127
2,365
pl
Perl
src/FR-Hit_cleanChimera.pl
dantaslab/parfums_dev
85d783077381fe945a23a48d16c8c8cece83e317
[ "MIT" ]
null
null
null
src/FR-Hit_cleanChimera.pl
dantaslab/parfums_dev
85d783077381fe945a23a48d16c8c8cece83e317
[ "MIT" ]
null
null
null
src/FR-Hit_cleanChimera.pl
dantaslab/parfums_dev
85d783077381fe945a23a48d16c8c8cece83e317
[ "MIT" ]
2
2017-04-25T13:44:31.000Z
2019-12-17T18:54:59.000Z
#!/usr/bin/perl -w use strict; die ("Usage: FR-Hit_cleanChimera.pl <Output_FR-Hit> <Contigs> > <output>\n") unless (scalar(@ARGV) == 2); my $file = shift @ARGV; my $fna = shift @ARGV; my $prefix = shift @ARGV; my @seqs=(); open (IN, "<$file") or die ("Couldn't open file: $file\n"); open (FNA, "<$fna") or die ("Couldn't open file: $fna\n"); my %length=(); my %seqs=(); my $name=""; while (my $j = <FNA>){ chomp($j); if ($j =~ /^>(.*)$/){ $name=$1; $name =~ s/\s+//; }else{ $seqs{$name}.=$j; $length{$name}=length($seqs{$name}); } } close FNA; my %genomes=(); my $old=""; my $n=""; while (my $l = <IN>){ chomp ($l); my @array = split /\t/, $l; $n = $array[0]; $n =~ s/\_\d$//; $array[7] =~ s/\%$//; $array[1] =~ s/nt$//; next if ($array[7] < 95); # Next if the percent id is less than 95% next unless ((($array[3]/$array[1]) >= 0.95) or ($array[-2]< 5) or ($array[-1] > ($length{$array[8]}-5))); # Next unless the percent covered is over 95% of the read or is in the first or last 30bp for (my $i=$array[-2]; $i<=$array[-1]; $i++){ $genomes{$array[8]}[$i-1][0]++; # Marks the coverage of all sequences if ($i > ($array[-2]+10) && $i < ($array[-1]-10)){ $genomes{$array[8]}[$i-1][1]++; }elsif (($i <= 12) && $i < ($array[-1]-10)){ $genomes{$array[8]}[$i-1][1]++; }elsif (($i > ($array[-2]+10)) && ($i > ($length{$array[8]}-15))){ $genomes{$array[8]}[$i-1][1]++; } } } close IN; foreach my $k (keys(%genomes)){ die ("Unknown genome >$k<\n") unless ($length{$k}); # print "\n$k\n"; #next unless ($k =~ /NODE_1_length_2354_cov_40.158878/); for (my $i=0; $i<$length{$k}; $i++){ $genomes{$k}[$i][0]=0 unless ($genomes{$k}[$i][0]); $genomes{$k}[$i][1]=1 unless ($genomes{$k}[$i][1]); $genomes{$k}[$i][2]=$genomes{$k}[$i][0]/$genomes{$k}[$i][1]; # print "$i\t$genomes{$k}[$i][0]\t$genomes{$k}[$i][1]\t$genomes{$k}[$i][2]\n"; substr $seqs{$k}, $i, 1, "N" if ((($genomes{$k}[$i][1] < 20) && ($genomes{$k}[$i][2] > 10)) or ($genomes{$k}[$i][2] > 100)); } my @split = split /N+/, $seqs{$k}; for (my $h =0; $h<@split; $h++){ print ">$k\_$h\n$split[$h]\n" if (length($split[$h]) > 50); } }
28.493976
219
0.463848
ed4de486424ca6f5c07619c261293357918d84a8
604
pl
Perl
BASL_tsp_etc/tabulate_basl_seqs_21nov2014.pl
SchwarzEM/ems_perl
0c20b1fe1d215689ee8db3677b23175bd968841f
[ "BSD-3-Clause" ]
2
2021-07-19T09:00:17.000Z
2021-08-30T02:45:18.000Z
BASL_tsp_etc/tabulate_basl_seqs_21nov2014.pl
Superboy666/ems_perl
ce78eb5c2120566e6e55a786ebd15382cb38736f
[ "BSD-3-Clause" ]
null
null
null
BASL_tsp_etc/tabulate_basl_seqs_21nov2014.pl
Superboy666/ems_perl
ce78eb5c2120566e6e55a786ebd15382cb38736f
[ "BSD-3-Clause" ]
1
2021-07-19T09:00:18.000Z
2021-07-19T09:00:18.000Z
#!/usr/bin/env perl use strict; use warnings; use autodie; while (my $input = <>) { chomp $input; my $species = 'TBD'; if ( $input =~ /\A > (\S+) \s+ (.+) \z/xms ) { my $name = $1; my $data = $2; if ( $data =~ /\A (.+) \s+ \[ (.+) \] \s* /xms ) { $species = $2; $data = $1; } elsif ( $name =~ /\A Aquca_ /xms ) { $species = 'Aquilegia coerulea'; } elsif ( $name =~ /\A Spipo /xms ) { $species = 'Spirodela polyrhiza'; } print "$name\t$data\t$species\n"; } }
22.37037
59
0.395695
ed84f2959521b528483f9fbb9c340eb168628d38
9,157
pm
Perl
Services/Email/Email.pm
kukam/PWE
104a80e0bdcc6ac4a12c807c6fbb85134718e844
[ "Apache-2.0" ]
null
null
null
Services/Email/Email.pm
kukam/PWE
104a80e0bdcc6ac4a12c807c6fbb85134718e844
[ "Apache-2.0" ]
null
null
null
Services/Email/Email.pm
kukam/PWE
104a80e0bdcc6ac4a12c807c6fbb85134718e844
[ "Apache-2.0" ]
null
null
null
package Services::Email::Email; use strict; use Libs::Send; use MIME::Base64; use Archive::Tar; my ($CONF, $LOG, $VALIDATE, $DBI, $ENTITIES, $USER, $WEB); sub new { my ($class, $conf, $log, $validate, $dbi, $entities, $user, $web) = @_; $DBI = $dbi; $LOG = $log; $WEB = $web; $CONF = $conf; $USER = $user; $VALIDATE = $validate; $ENTITIES = $entities; my $self = { 'timeout_for_result_E' => ((3600 * 24) * 3), # 3 days, za jak dlouhou dobu se email oznaci 'E' v pripade ze ho mailserver stale odmita. }; bless $self, $class; return $self; } =head2 B<[Public] sendAllEmail()> Metoda se pokusi odeslat vsechny maily ve fronte. =cut sub sendAllEmail { my $self = shift; # TODO : Metoda nerozlisuje nedostupnost postovniho servru a chyby pri konstrukci email (rejecting) # To muze zpusobit ze validni emaily pri dlouhodobem vypadku mailservru budou invalidovany a nasledne zahozeny!!! my $SQL = undef; my $error = undef; if (($DBI->getDbDriver("db1") eq "mysql") or ($DBI->getDbDriver("db1") eq "maria")) { $SQL = $DBI->select("db1", "mid,mailfrom,mailto,replyto,cc,bcc,returnpath,errorto,subject,text,textalt,attachment, TIME_TO_SEC(TIMEDIFF(NOW(),started)) as `timedif` FROM mailqueue WHERE sendstatus = ? AND started < NOW()", ["N"]); } elsif ($DBI->getDbDriver("db1") eq "Postgres") { # TODO : Slo by pouzit tuto funkci age(NOW(), started), ale nevim jak prevest tento format na secundy $SQL = $DBI->select("db1","mid,mailfrom,mailto,replyto,cc,bcc,returnpath,errorto,subject,text,textalt,attachment, (extract(epoch from NOW() at time zone 'utc' at time zone 'utc') - extract(epoch from started at time zone 'utc' at time zone 'utc')) as timedif FROM mailqueue WHERE sendstatus = ? AND started < NOW()",["N"]); } NEXT: while (my ($mid, $from, $to, $replyto, $cc, $bcc, $returnpath, $errorto, $sub, $text, $textalt, $attachment, $timedif) = $SQL->fetchrow()) { foreach my $smtp_server (@{$CONF->getValue("pwe", "smtp_servers", ["smtp_primary"])}) { my $config = $CONF->getValue($smtp_server, undef, undef); if (ref($config) ne "HASH") { $LOG->error("smtp server '$smtp_server' config is not defined"); next; } my $send = new Libs::Send($config); foreach (split(/,/, $from)) { $send->setFrom($_); } foreach (split(/,/, $to)) { $send->setTo($_); } foreach (split(/,/, $cc)) { $send->setCc($_); } foreach (split(/,/, $bcc)) { $send->setBcc($_); } foreach (split(/,/, $replyto)) { $send->setReplyTo($_); } foreach (split(/,/, $returnpath)) { $send->setReturnPath($_); } foreach (split(/,/, $errorto)) { $send->setErrorTo($_); } $send->setSubjectUTF8($sub); $send->setBody($textalt); $send->setBody($text); my @tarfiles; my $extract = $CONF->getValue('pwe', 'home', '/tmp/') . $CONF->getValue('pwe', 'upload_dir', 'upload/') . "extract/"; if ($attachment) { open(ZIP, '<', \decode_base64($attachment)); binmode ZIP; my $tar = Archive::Tar->new(\*ZIP); $tar->setcwd($extract); foreach my $oldpath ($tar->list_files()) { my $newpath = $oldpath; $newpath =~ s/.*\///; $tar->rename($oldpath,$newpath); $send->setAttachment($extract.$newpath); push(@tarfiles,$extract.$newpath); } $tar->extract(); close (ZIP); } my $result = $send->send(); # CLER ATTACHMENT foreach my $path (@tarfiles) { unlink($path); } if ($result) { $LOG->error("Traing send email to:$to id:$mid FAIL, msg:$result"); sleep(1); } else { $self->updateSendResult($mid, "Y"); $LOG->info("Send mail id:$mid to:$to is completed."); next NEXT; } } # POKUD SE EMAIL NEDARI ODESLAT DELSI DOBU, OZNACIME JEJ STAVEM 'E' + ODESLEME INFO ADMINISTRATOROVY. if ($timedif > $self->getValue('timeout_for_result_E', 3600)) { $self->updateSendResult($mid, "E"); $error->{$mid} = $to; $LOG->error("Send error report email to administrator. Error email is '$to' mid: $mid"); } } $SQL->finish; $self->sendErrorEmail($error) if (defined($error)); } =head2 B<[Public] addEmailToQueue(%HASH)> Metoda prida novy email do fronty. $EMAIL->addEmailToQueue( to => 'to@email.com', from => 'from@email.com', subject => "Sujbect", text => "Content-Type: text/plain; charset=UTF-8\n TEXT", # Nepovine hodnoty textalt => "ALTERNATIVE BODY", cc => 'cc@email.com', bcc => 'bcc@email.com', replyto => 'replyto@email.com', returnpath => 'returnpath@email.com', errorto => 'errorto@email.com', attachments => [ '/path/filename1.txt', '/path/filename2.txt' ], started => '2003-09-13 13:13:13' ); =cut sub addEmailToQueue { my ($self, %values) = @_; my $MAILQ = $ENTITIES->createEntityObject('MailQueue'); $MAILQ->mailfrom($values{'from'}); $MAILQ->mailto($values{'to'}); $MAILQ->subject($values{'subject'}); $MAILQ->text($values{'text'}); $MAILQ->replyto($values{'replyto'}); $MAILQ->cc($values{'cc'}); $MAILQ->bcc($values{'bcc'}); $MAILQ->returnpath($values{'returnpath'}); $MAILQ->errorto($values{'errorto'}); ($values{'started'} ? $MAILQ->started($values{'started'}) : $MAILQ->started('NOW()')); if (exists($values{'attachments'})) { my $tar = Archive::Tar->new; foreach my $file (@{$values{'attachments'}}) { if (-f $file) { $tar->add_files($file); } else { $LOG->error("File '$file' not exist!"); } } $MAILQ->attachment($tar->write); } $MAILQ->flush; $MAILQ->logit; if ($MAILQ->error) { $MAILQ->rollback; return undef; } else { $MAILQ->commit; $LOG->info("ADD email to queue from:$values{'from'} to:$values{'to'}"); return 1; } } =head2 B<[Public] updateSendResult($mid,$result)> Metoda prepne stav emailu. MID = id v mail_queue Stavy ($result): Y = "Email byl v poradku servrem prijat a je povazovany za odeslany. E = "Email se nepodarilo odeslat a byl vyrazen z fronty. N = "Email je novy, jeste neni odeslan. =cut sub updateSendResult { my ($self, $mid, $result) = @_; my $EMAIL = $ENTITIES->createEntityObject('MailQueue', $mid); $EMAIL->sendstatus($result); $EMAIL->flush; $EMAIL->logit; if ($EMAIL->error) { $EMAIL->rollback; } else { $EMAIL->commit; } } =head2 B<[Private] sendErrorEmail($error)> Metoda odesle informace o emailech ktere se nepodarilo odeslat po stanovenou dobu. $error = { id => email, .... }; =cut sub sendErrorEmail { my ($self, $error) = @_; my $from = $CONF->getValue("web", "email_admin", "root\@localhost"); my $to = $CONF->getValue("web", "email_admin", "root\@localhost"); my $sub = $CONF->getValue("web", "email_subtitle", "Pwe error Report") . " : Seznam emailu ktere se po nekolika pokusech nepodarilo odeslat!"; my $text = "\nTyto emaily nebylo mozne odeslat, jsou vyrazeny z fronty.\n"; $text .= "=========================================================\n\n"; while (my ($id, $email) = each(%{$error})) { $text .= "id: $id to: $email\n"; } $text .= "\nTimto prikaze vratis emaily zpet do fronty\n"; $text .= "==========================================\n\n"; while (my ($id, $email) = each(%{$error})) { $text .= "UPDATE mail_queue SET sendstatus = 'N', started = NOW() WHERE mid = $id;\n"; } $self->addEmailToQueue(to => $to, from => $from, subject => $sub, text => $text); } =head2 B<[Private] getValue($key,$def)> Metoda vraci obsah atributu ($key), pokud atribut neexistuje vraci metoda hodnotu $def. =cut sub getValue { my ($self, $key, $def) = @_; return $def unless (exists($self->{$key})); return $def unless ($self->{$key}); return $self->{$key}; } # KOMODO-IDE/KOMODO-EDIT sub KOMODO { return; require Libs::Config; require Libs::Log; require Libs::Validate; require Libs::DBI; require Libs::User; require Libs::Web; require Libs::Entities; $CONF = new Libs::Config; $LOG = new Libs::Log; $VALIDATE = new Libs::Validate; $DBI = new Libs::DBI; $USER = new Libs::User; $WEB = new Libs::Web; $ENTITIES = new Libs::Entities; } 1;
31.685121
331
0.537075
73e3b24021827302b246b002d14a75f6c1657de3
1,479
pl
Perl
examples/introspect_nb.pl
FGasper/p5-Protocol-DBus
8330c2414480fd0e8d2d48d139a3f9b1837aae4d
[ "Artistic-1.0-cl8" ]
11
2018-10-28T18:44:44.000Z
2021-03-03T20:02:19.000Z
examples/introspect_nb.pl
FGasper/p5-Protocol-DBus
8330c2414480fd0e8d2d48d139a3f9b1837aae4d
[ "Artistic-1.0-cl8" ]
7
2018-09-30T15:08:24.000Z
2021-04-18T12:27:56.000Z
examples/introspect_nb.pl
FGasper/p5-Protocol-DBus
8330c2414480fd0e8d2d48d139a3f9b1837aae4d
[ "Artistic-1.0-cl8" ]
3
2018-09-29T22:46:10.000Z
2021-04-18T08:35:23.000Z
#!/usr/bin/env perl use strict; use warnings; use autodie; use Socket; use Data::Dumper; use FindBin; use lib "$FindBin::Bin/../lib"; use Protocol::DBus::Client; my $dbus = $> ? Protocol::DBus::Client::login_session() : Protocol::DBus::Client::system(); $SIG{'PIPE'} = 'IGNORE'; # Just for demonstration purposes. Endianness # should not matter. $dbus->big_endian(1); $dbus->blocking(0); my $fileno = $dbus->fileno(); # You can use whatever polling method you prefer; # the following is quick and easy: vec( my $mask, $fileno, 1 ) = 1; while (!$dbus->initialize()) { if ($dbus->init_pending_send()) { select( undef, my $wout = $mask, undef, undef ); } else { select( my $rout = $mask, undef, undef, undef ); } } printf "done authn; unique bus name: %s\n", $dbus->get_unique_bus_name(); #---------------------------------------------------------------------- my $got_response; $dbus->send_call( path => '/org/freedesktop/DBus', interface => 'org.freedesktop.DBus.Properties', destination => 'org.freedesktop.DBus', signature => 's', member => 'GetAll', body => ['org.freedesktop.DBus'], )->then( sub { $got_response = 1; print "got getall response\n"; print Dumper shift; } ); while (!$got_response) { my $win = $dbus->pending_send() || q<>; $win &&= $mask; select( my $rout = $mask, $win, undef, undef ); $dbus->flush_write_queue() if $win; 1 while $dbus->get_message(); }
21.75
91
0.588911
ed5254647c4e191f5f108c4aefd6f21fd8bd20a7
1,465
pm
Perl
t/lib/t/MusicBrainz/Server/Edit/Artist/AddAlias.pm
kellnerd/musicbrainz-server
9e058e10219ea6b8942cfd64160ffe19769f747b
[ "BSD-2-Clause" ]
577
2015-01-15T12:18:50.000Z
2022-03-16T20:41:57.000Z
t/lib/t/MusicBrainz/Server/Edit/Artist/AddAlias.pm
kellnerd/musicbrainz-server
9e058e10219ea6b8942cfd64160ffe19769f747b
[ "BSD-2-Clause" ]
1,227
2015-04-16T01:00:29.000Z
2022-03-30T15:08:46.000Z
t/lib/t/MusicBrainz/Server/Edit/Artist/AddAlias.pm
kellnerd/musicbrainz-server
9e058e10219ea6b8942cfd64160ffe19769f747b
[ "BSD-2-Clause" ]
280
2015-01-04T08:39:41.000Z
2022-03-10T17:09:59.000Z
package t::MusicBrainz::Server::Edit::Artist::AddAlias; use Test::Routine; use Test::More; with 't::Edit'; with 't::Context'; BEGIN { use MusicBrainz::Server::Edit::Artist::AddAlias } use MusicBrainz::Server::Constants qw( $EDIT_ARTIST_ADD_ALIAS ); use MusicBrainz::Server::Test qw( accept_edit reject_edit ); test all => sub { my $test = shift; my $c = $test->c; MusicBrainz::Server::Test->prepare_test_database($c, '+artistalias'); my $alias_set = $c->model('Artist')->alias->find_by_entity_id(1); is(@$alias_set, 2); my $edit = _create_edit($c); isa_ok($edit, 'MusicBrainz::Server::Edit::Artist::AddAlias'); ok(defined $edit->alias_id); ok($edit->alias_id > 0); my ($edits) = $c->model('Edit')->find({ artist => 1 }, 10, 0); is(@$edits, 1); is($edits->[0]->id, $edit->id); $c->model('Edit')->load_all($edit); is($edit->display_data->{artist}{id}, 1); is($edit->display_data->{alias}, 'Another alias'); my $artist = $c->model('Artist')->get_by_id(1); is($artist->edits_pending, 0, 'Alias addition was an autoedit'); $alias_set = $c->model('Artist')->alias->find_by_entity_id(1); is(@$alias_set, 3); }; sub _create_edit { my $c = shift; return $c->model('Edit')->create( edit_type => $EDIT_ARTIST_ADD_ALIAS, editor_id => 1, entity => $c->model('Artist')->get_by_id(1), name => 'Another alias', sort_name => 'Another alias sort name', primary_for_locale => 0, ended => 0 ); } 1;
25.258621
69
0.634812
ed90d619da63a9d6ae6a1b37002018fb5b4b4e2e
7,960
pm
Perl
modules/Bio/EnsEMBL/Analysis/Runnable/Lastz.pm
jmgonzmart/ensembl-analysis
41c1d362bc0abce91a81a6615b3d61a6b82b7da5
[ "Apache-2.0" ]
null
null
null
modules/Bio/EnsEMBL/Analysis/Runnable/Lastz.pm
jmgonzmart/ensembl-analysis
41c1d362bc0abce91a81a6615b3d61a6b82b7da5
[ "Apache-2.0" ]
null
null
null
modules/Bio/EnsEMBL/Analysis/Runnable/Lastz.pm
jmgonzmart/ensembl-analysis
41c1d362bc0abce91a81a6615b3d61a6b82b7da5
[ "Apache-2.0" ]
null
null
null
=head1 LICENSE # Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute # Copyright [2016-2022] EMBL-European Bioinformatics Institute # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. =head1 CONTACT Please email comments or questions to the public Ensembl developers list at <http://lists.ensembl.org/mailman/listinfo/dev>. Questions may also be sent to the Ensembl help desk at <http://www.ensembl.org/Help/Contact>. =cut =head1 AUTHORS Abel Ureta-Vidal <abel@ebi.ac.uk> =head1 NAME Bio::EnsEMBL::Analysis::Runnable::Lastz - =head1 SYNOPSIS # To run a lastz job from scratch do the following. my $query = new Bio::SeqIO(-file => 'somefile.fa', -format => 'fasta')->next_seq; my $database = 'multifastafile.fa'; my $lastz = Bio::EnsEMBL::Analysis::Runnable::Lastz->new ('-query' => $query, '-database' => $database, '-options' => 'T=2'); $lastz->run(); @featurepairs = $last->output(); foreach my $fp (@featurepairs) { print $fp->gffstring . "\n"; } # Additionally if you have lastz runs lying around that need parsing # you can use the EnsEMBL blastz parser module # perldoc Bio::EnsEMBL::Analysis::Runnable::Parser::Blastz =head1 DESCRIPTION Lastz takes a Bio::Seq (or Bio::PrimarySeq) object and runs lastz with against the specified multi-FASTA file database. Tthe output is parsed by Bio::EnsEMBL::Analysis::Runnable::Parser::Lastz and stored as Bio::EnsEMBL::DnaDnaAlignFeature Other options can be passed to the lastz program using the -options method =head1 METHODS =cut package Bio::EnsEMBL::Analysis::Runnable::Lastz; use warnings ; use vars qw(@ISA); use strict; # Object preamble use Bio::EnsEMBL::Analysis::Runnable; use Bio::EnsEMBL::DnaDnaAlignFeature; use Bio::EnsEMBL::Analysis::Tools::Blastz; use Bio::EnsEMBL::Utils::Argument qw(rearrange); use Bio::EnsEMBL::Utils::Exception; @ISA = qw(Bio::EnsEMBL::Analysis::Runnable); sub new { my ($class,@args) = @_; my $self = $class->SUPER::new(@args); my ($database) = rearrange(['DATABASE'], @args); $self->database($database) if defined $database; throw("You must supply a database") if not $self->database; throw("You must supply a query") if not $self->query; $self->program("lastz") if not $self->program; return $self; } =head2 run Title : run Usage : $obj->run() Function: Runs lastz and BPLite and creates array of feature pairs Returns : none Args : none =cut sub run{ my ($self, $dir) = @_; $self->workdir($dir) if($dir); throw("Can't run ".$self." without a query sequence") unless($self->query); $self->write_seq_files(); $self->run_analysis(); $self->delete_files; return 1; } sub run_analysis { my $self = shift; my $cmd = $self->program ." ". $self->query ." ". $self->database ." ". $self->options; my $BlastzParser; my $blastz_output_pipe = undef; if($self->results_to_file) { if (not $self->resultsfile) { my $resfile = $self->create_filename("lastz", "results"); $self->resultsfile($resfile); $self->files_to_delete($resfile); } $cmd .= " > ". $self->resultsfile; info("Running lastz...\n$cmd\n"); throw("Error runing lastz cmd\n$cmd\n." . " Returned error $? LASTZ EXIT: '" . ($? >> 8) . "'," ." SIGNAL '" . ($? & 127) . "', There was " . ($? & 128 ? 'a' : 'no') . " core dump") unless(system($cmd) == 0); $BlastzParser = Bio::EnsEMBL::Analysis::Tools::Blastz-> new('-file' => $self->resultsfile); } else { info("Running lastz to pipe...\n$cmd\n"); my $stderr_file = $self->workdir()."/lastz_$$.stderr"; open($blastz_output_pipe, "$cmd 2>$stderr_file |") || throw("Error opening lasts cmd <$cmd>." . " Returned error $? LAST EXIT: '" . ($? >> 8) . "'," ." SIGNAL '" . ($? & 127) . "', There was " . ($? & 128 ? 'a' : 'no') . " core dump"); $BlastzParser = Bio::EnsEMBL::Analysis::Tools::Blastz-> new('-fh' => $blastz_output_pipe) || print_error($stderr_file, "Unable to parse blastz_output_pipe"); } my @results; while (defined (my $alignment = $BlastzParser->nextAlignment)) { # nextHSP-like push @results, $alignment; } close($blastz_output_pipe) if(defined($blastz_output_pipe)); $self->output(\@results); } sub print_error { my ($stderr_file, $text) = @_; my $msg; if (-e $stderr_file) { print "$stderr_file\n"; open FH, $stderr_file or die("Unable to open $stderr_file"); while (<FH>) { $msg .= $_; } unlink($stderr_file); } $msg .= $text; throw($msg); } ################# # get/set methods ################# =head2 query Title : query Usage : $self->query($seq) Function: Get/set method for query. If set with a Bio::Seq object it will get written to the local tmp directory Returns : filename Args : Bio::PrimarySeqI, or filename =cut sub query { my ($self, $val) = @_; if (defined $val) { if (not ref($val)) { throw("[$val] : file does not exist\n") unless -e $val; } elsif (not $val->isa("Bio::PrimarySeqI")) { throw("[$val] is neither a Bio::Seq not a file"); } $self->{_query} = $val; } return $self->{_query} } =head2 database Title : database Usage : $self->database($seq) Function: Get/set method for database. If set with a Bio::Seq object it will get written to the local tmp directory Returns : filename Args : Bio::PrimarySeqI, or filename =cut sub database { my ($self, $val) = @_; if (defined $val) { if ($val eq "--self") { $self->{_database} = $val; return $self->{_database}; } if (not ref($val)) { throw("[$val] : file does not exist\n") unless -e $val; } else { if (ref($val) eq 'ARRAY') { foreach my $el (@$val) { throw("All elements of given database array should be Bio::PrimarySeqs") if not ref($el) or not $el->isa("Bio::PrimarySeq"); } } elsif (not $val->isa("Bio::PrimarySeq")) { throw("[$val] is neither a file nor array of Bio::Seq"); } else { $val = [$val]; } } $self->{_database} = $val; } return $self->{_database}; } sub write_seq_files { my ($self) = @_; if (ref($self->query)) { # write the query my $query_file = $self->create_filename("lastz", "query"); my $seqio = Bio::SeqIO->new(-format => "fasta", -file => ">$query_file"); $seqio->write_seq($self->query); $seqio->close; $self->query($query_file); $self->files_to_delete($query_file); } if (ref($self->database)) { my $db_file = $self->create_filename("lastz", "database"); my $seqio = Bio::SeqIO->new(-format => "fasta", -file => ">$db_file"); foreach my $seq (@{$self->database}) { $seqio->write_seq($seq); } $seqio->close; $self->database($db_file); $self->files_to_delete($db_file); } } sub results_to_file { my ($self, $val) = @_; if (defined $val) { $self->{_results_to_file} = $val; } return $self->{_results_to_file}; } 1;
25.11041
109
0.59397
ed5c89d83e77cbf5b5e87774f0b9ef81436ecd9d
1,545
pm
Perl
auto-lib/Paws/DevOpsGuru/AnomalyTimeRange.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
164
2015-01-08T14:58:53.000Z
2022-02-20T19:16:24.000Z
auto-lib/Paws/DevOpsGuru/AnomalyTimeRange.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
348
2015-01-07T22:08:38.000Z
2022-01-27T14:34:44.000Z
auto-lib/Paws/DevOpsGuru/AnomalyTimeRange.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
87
2015-04-22T06:29:47.000Z
2021-09-29T14:45:55.000Z
# Generated by default/object.tt package Paws::DevOpsGuru::AnomalyTimeRange; use Moose; has EndTime => (is => 'ro', isa => 'Str'); has StartTime => (is => 'ro', isa => 'Str', required => 1); 1; ### main pod documentation begin ### =head1 NAME Paws::DevOpsGuru::AnomalyTimeRange =head1 USAGE This class represents one of two things: =head3 Arguments in a call to a service Use the attributes of this class as arguments to methods. You shouldn't make instances of this class. Each attribute should be used as a named argument in the calls that expect this type of object. As an example, if Att1 is expected to be a Paws::DevOpsGuru::AnomalyTimeRange object: $service_obj->Method(Att1 => { EndTime => $value, ..., StartTime => $value }); =head3 Results returned from an API call Use accessors for each attribute. If Att1 is expected to be an Paws::DevOpsGuru::AnomalyTimeRange object: $result = $service_obj->Method(...); $result->Att1->EndTime =head1 DESCRIPTION A time range that specifies when the observed unusual behavior in an anomaly started and ended. =head1 ATTRIBUTES =head2 EndTime => Str The time when the anomalous behavior ended. =head2 B<REQUIRED> StartTime => Str The time when the anomalous behavior started. =head1 SEE ALSO This class forms part of L<Paws>, describing an object used in L<Paws::DevOpsGuru> =head1 BUGS and CONTRIBUTIONS The source code is located here: L<https://github.com/pplu/aws-sdk-perl> Please report bugs to: L<https://github.com/pplu/aws-sdk-perl/issues> =cut
23.409091
105
0.732039
ed731d50d1de6b41867ff1e24674f6965abfd1de
1,142
ph
Perl
components/type/include/cgv/type/traits/function_pointer.ph
tobias-haenel/cgv-density-estimation
3be1b07a7b21d1cfd956fb19b5f0d83fb51bd308
[ "BSD-3-Clause" ]
null
null
null
components/type/include/cgv/type/traits/function_pointer.ph
tobias-haenel/cgv-density-estimation
3be1b07a7b21d1cfd956fb19b5f0d83fb51bd308
[ "BSD-3-Clause" ]
null
null
null
components/type/include/cgv/type/traits/function_pointer.ph
tobias-haenel/cgv-density-estimation
3be1b07a7b21d1cfd956fb19b5f0d83fb51bd308
[ "BSD-3-Clause" ]
null
null
null
#pragma once @exclude <components/config/ppp.ppp> #include <cgv/type/invalid_type.h> namespace cgv { namespace type { namespace traits { /** defines for a function_pointer pointer type the return type and the list of argument types. Only functions up to a maximum number of eight arguments are supported. */ template <typename T> struct function_pointer { static const bool is_function_pointer = false; typedef invalid_type return_type; static const unsigned int nr_arguments = 0; }; template <typename T, int> struct function_pointer_argument_list { typedef invalid_type type; }; @for (i=0; i<=N_ARG; i=i+1) @{ /// specialize function_pointer template for @(i) argument@if(i!=1)@{s@} template <typename R@[", typename T1"; ""; ", typename T".i]> struct function_pointer<R (*)(@["T1"; ","; "T".i])> { static const bool is_function_pointer = true; typedef R return_type; static const unsigned int nr_arguments = @(i); }; @for(j=1; j<=i; ++j)@{ template <typename R@[", typename T1"; ""; ", typename T".i]> struct function_pointer_argument_list<R (*)(@["T1"; ","; "T".i]), @(j-1)> { typedef T@(j) type; }; @} @} } } }
27.190476
98
0.687391
ed245e6502a4aaf5d24fd2bc58842ac0395a4b81
597
pl
Perl
perl/src/lib/Net/t/libnet_t.pl
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
2,293
2015-01-02T12:46:10.000Z
2022-03-29T09:45:43.000Z
perl/src/lib/Net/t/libnet_t.pl
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
315
2015-05-31T11:55:46.000Z
2022-01-12T08:36:37.000Z
perl/src/lib/Net/t/libnet_t.pl
nokibsarkar/sl4a
d3c17dca978cbeee545e12ea240a9dbf2a6999e9
[ "Apache-2.0" ]
1,033
2015-01-04T07:48:40.000Z
2022-03-24T09:34:37.000Z
my $number = 0; sub ok { my ($condition, $name) = @_; my $message = $condition ? "ok " : "not ok "; $message .= ++$number; $message .= " # $name" if defined $name; print $message, "\n"; return $condition; } sub is { my ($got, $expected, $name) = @_; for ($got, $expected) { $_ = 'undef' unless defined $_; } unless (ok($got eq $expected, $name)) { warn "Got: '$got'\nExpected: '$expected'\n" . join(' ', caller) . "\n"; } } sub skip { my ($reason, $num) = @_; $reason ||= ''; $number ||= 1; for (1 .. $num) { $number++; print "ok $number # skip $reason\n"; } } 1;
15.710526
73
0.520938
ed109fecdcd76085f292549db422518c5026dce4
4,027
pm
Perl
MT_systems/squoia/esde/addPronouns.pm
dan-zeman/squoia
096868f96bd4c19b45b1d69251321c85c71c6c3b
[ "Apache-2.0" ]
9
2016-04-27T16:48:58.000Z
2021-01-17T21:55:55.000Z
MT_systems/squoia/esde/addPronouns.pm
dan-zeman/squoia
096868f96bd4c19b45b1d69251321c85c71c6c3b
[ "Apache-2.0" ]
null
null
null
MT_systems/squoia/esde/addPronouns.pm
dan-zeman/squoia
096868f96bd4c19b45b1d69251321c85c71c6c3b
[ "Apache-2.0" ]
6
2016-03-29T22:26:50.000Z
2021-01-17T21:56:21.000Z
#!/usr/bin/perl # add pronoun chunks: add/guess the pronouns needed for German but absent in Spanish (pro-drop language) package squoia::esde::addPronouns; use strict; use utf8; sub main{ my $dom = ${$_[0]}; my $verbose = $_[1]; print STDERR "#VERBOSE ". (caller(0))[3]."\n" if $verbose; my $maxChunkRef = squoia::util::getMaxChunkRef($dom); my $subject = "suj"; # get the nodes of VP chunks with no dependent "subject" chunks my $xpathexpr = '//CHUNK[(@type="VP" or @type="CVP") and count(CHUNK[starts-with(@si,"'.$subject.'")])=0]/NODE'; my @specialnodes = $dom->findnodes($xpathexpr); foreach my $node (@specialnodes) { my $parentChunk = squoia::util::getParentChunk($node); # VP chunk if ($parentChunk->getAttribute('si') =~ /^S|sn/) { # TODO other possibilities? if ($node->exists('./NODE[@smi="CS" and @pos="KOUS"]')) { print STDERR "subordinated clause needs an extra pronoun\n" if $verbose; } else { # do not add any pronoun in a relative clause TODO if it is the subject, but it could be the object!!! print STDERR "relative clause does not necessarily need any extra pronoun\n" if $verbose; # get person of finite verb my $finverb = @{$node->findnodes('descendant-or-self::NODE[contains(@pos,"FIN") or contains(@spos,"FIN")]')}[0]; if ($finverb and $finverb->getAttribute('mi') =~ /^3\.(Sg|Pl)/) { my $verbperson = $1; print STDERR "verb in 3rd person $verbperson...\n" if $verbose; # TODO: the verb is in 3rd person; relative could be the object...CHECK antecedent: la casa que tienen : mismatch Sg/Pl => add pronoun my $antecedent = squoia::util::getParentChunk($parentChunk); print STDERR "antecedent: ". ${$antecedent->findnodes('NODE')}[0]->getAttribute('slem') ."\n" if $verbose; if ($antecedent->getAttribute('mi') =~ /\.$verbperson/) { print STDERR "antecedent of relative clause also $verbperson; relpronoun could still be the object...\n" if $verbose; next; } } # else the finite verb has no explicit subject but has the form of a 1st or 2nd person => add pronoun print STDERR "add subject pronoun anyway!\n" if $verbose; } } my $pronounChunk = XML::LibXML::Element->new('CHUNK'); $maxChunkRef++; $pronounChunk->setAttribute('ref',"$maxChunkRef"); $pronounChunk->setAttribute('type','NP'); $pronounChunk->setAttribute('si',$subject); $pronounChunk->setAttribute('comment','added pronoun'); my $pronounNode = XML::LibXML::Element->new('NODE'); $pronounNode->setAttribute('pos','PPER'); $pronounNode->setAttribute('cas','Nom'); my $finVerb; if ($node->getAttribute('pos') =~ m/FIN/ or ($node->getAttribute('pos') =~ m/VV/ and $node->hasAttribute('spos') and $node->getAttribute('spos')=~ m/VVFIN/) ) { # "spos" for reflexiv German verbs; example: charlar -> unterhalten_sich, where VP-CHUNK has 2 children that are sibling nodes after split $finVerb = $node; } else { my @children = $node->findnodes('descendant::NODE'); foreach my $child (@children) { if ($child->getAttribute('pos') =~ m/V.FIN/ or $child->getAttribute('spos') =~ m/V.FIN/) { # "spos" for verbs from periphrase whose pos tag has been switched; example: seguir|estar +gerund, where seguir|estar becomes an adverb $finVerb = $child; last; } } } if ($finVerb) { print STDERR "finite verb form " . $finVerb->getAttribute('sform') ."\n" if $verbose; my $verbMorph = "3.Sg.Pres.Ind"; # arbitrary default value if ($finVerb->hasAttribute('mi')) { $verbMorph = $finVerb->getAttribute('mi'); } else { print STDERR $finVerb->serialize."Finite verb node has no morphological information (mi attribute)... this shouldn't be the case! Please check your diccionary and transfer rules\n" if $verbose; } my ($pers,$num) = split(/\./,$verbMorph); my $pronounMorph = $pers . "." . $num; $pronounNode->setAttribute('mi',$pronounMorph); $node->parentNode->addChild($pronounChunk); $pronounChunk->addChild($pronounNode); } } } 1;
43.771739
162
0.659796
ed80b8b4aa0d98b3510d70cf6547b33b4406e705
2,908
pl
Perl
functional/MBCS_Tests/CLDR_11/tap_compare.pl
Haroon-Khel/openjdk-tests
565191efde062aa5337befdd943611c75aff6d42
[ "Apache-2.0" ]
null
null
null
functional/MBCS_Tests/CLDR_11/tap_compare.pl
Haroon-Khel/openjdk-tests
565191efde062aa5337befdd943611c75aff6d42
[ "Apache-2.0" ]
null
null
null
functional/MBCS_Tests/CLDR_11/tap_compare.pl
Haroon-Khel/openjdk-tests
565191efde062aa5337befdd943611c75aff6d42
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/perl ################################################################################ # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ################################################################################ use Test::Simple tests => 35; use File::Compare; @a = ('DEFAULT','CLDR','JRE','SPI'); $langtag = $ENV{'LANGTAG'}; $prefix = 'expected_'; $t1 = 'DecimalFormatSymbolsTest-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); } $t1 = 'DateFormatSymbolsTest-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); } $t1 = 'DecimalStyleTest-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $f2) == 0, 'diff '.$f.' '.$f2); } $t1 = 'CurrencyTest-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); } $t1 = 'LocaleTest-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); } $t1 = 'TimeZoneTestA-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (('DEFAULT','JRE')) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $f2) == 0, 'diff '.$f.' '.$f2); } ### Skip this testcase on 11.0.7 ### if ($ENV{'JAVAVERSION'} ge '11000007') { ok(1==1, 'Skip TimeZoneTestA SPI on 11.0.7'); } else { $f = $t1.$langtag.'-SPI.log'; ok(compare($f, $f2) == 0, 'diff '.$f.' '.$f2); } $f = $t1.$langtag.'-CLDR.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); $t1 = 'TimeZoneTestB-'; $f1 = $t1.$langtag.'-DEFAULT.log'; $f2 = $t1.$langtag.'-CLDR,JRE.log'; ok(compare($f1, $f2) == 0, $f2); foreach $s (@a) { $f = $t1.$langtag.'-'.$s.'.log'; ok(compare($f, $prefix.$f) == 0, 'diff '.$f.' '.$prefix.$f); }
30.610526
80
0.538171
73fa2068c6235e29fdd6552a0b7f1e93404415ca
2,561
pm
Perl
auto-lib/Paws/S3/GetObjectTorrent.pm
galenhuntington/aws-sdk-perl
13b775dcb5f0b3764f0a82f3679ed5c7721e67d3
[ "Apache-2.0" ]
null
null
null
auto-lib/Paws/S3/GetObjectTorrent.pm
galenhuntington/aws-sdk-perl
13b775dcb5f0b3764f0a82f3679ed5c7721e67d3
[ "Apache-2.0" ]
1
2021-05-26T19:13:58.000Z
2021-05-26T19:13:58.000Z
auto-lib/Paws/S3/GetObjectTorrent.pm
galenhuntington/aws-sdk-perl
13b775dcb5f0b3764f0a82f3679ed5c7721e67d3
[ "Apache-2.0" ]
null
null
null
package Paws::S3::GetObjectTorrent; use Moose; has Bucket => (is => 'ro', isa => 'Str', uri_name => 'Bucket', traits => ['ParamInURI'], required => 1); has Key => (is => 'ro', isa => 'Str', uri_name => 'Key', traits => ['ParamInURI'], required => 1); has RequestPayer => (is => 'ro', isa => 'Str', header_name => 'x-amz-request-payer', traits => ['ParamInHeader']); use MooseX::ClassAttribute; class_has _api_call => (isa => 'Str', is => 'ro', default => 'GetObjectTorrent'); class_has _api_uri => (isa => 'Str', is => 'ro', default => '/{Bucket}/{Key+}?torrent'); class_has _api_method => (isa => 'Str', is => 'ro', default => 'GET'); class_has _returns => (isa => 'Str', is => 'ro', default => 'Paws::S3::GetObjectTorrentOutput'); class_has _result_key => (isa => 'Str', is => 'ro'); 1; ### main pod documentation begin ### =head1 NAME Paws::S3::GetObjectTorrent - Arguments for method GetObjectTorrent on L<Paws::S3> =head1 DESCRIPTION This class represents the parameters used for calling the method GetObjectTorrent on the L<Amazon Simple Storage Service|Paws::S3> service. Use the attributes of this class as arguments to method GetObjectTorrent. You shouldn't make instances of this class. Each attribute should be used as a named argument in the call to GetObjectTorrent. =head1 SYNOPSIS my $s3 = Paws->service('S3'); my $GetObjectTorrentOutput = $s3->GetObjectTorrent( Bucket => 'MyBucketName', Key => 'MyObjectKey', RequestPayer => 'requester', # OPTIONAL ); # Results: my $Body = $GetObjectTorrentOutput->Body; my $RequestCharged = $GetObjectTorrentOutput->RequestCharged; # Returns a L<Paws::S3::GetObjectTorrentOutput> object. Values for attributes that are native types (Int, String, Float, etc) can passed as-is (scalar values). Values for complex Types (objects) can be passed as a HashRef. The keys and values of the hashref will be used to instance the underlying object. For the AWS API documentation, see L<https://docs.aws.amazon.com/goto/WebAPI/s3/GetObjectTorrent> =head1 ATTRIBUTES =head2 B<REQUIRED> Bucket => Str =head2 B<REQUIRED> Key => Str =head2 RequestPayer => Str Valid values are: C<"requester"> =head1 SEE ALSO This class forms part of L<Paws>, documenting arguments for method GetObjectTorrent in L<Paws::S3> =head1 BUGS and CONTRIBUTIONS The source code is located here: L<https://github.com/pplu/aws-sdk-perl> Please report bugs to: L<https://github.com/pplu/aws-sdk-perl/issues> =cut
30.488095
249
0.679422
ed0b0492ef0f47c14f9cca48fc2cda27bfae08b1
4,500
pm
Perl
lib/sdk/Com/Vmware/Esx/Settings/Clusters/Software/AddOn.pm
bince-criticalcase/vsphere-automation-sdk-perl
da3330bf66dc6c853e9a23062146d54afc299955
[ "MIT" ]
26
2017-04-24T19:20:08.000Z
2021-12-06T23:15:09.000Z
lib/sdk/Com/Vmware/Esx/Settings/Clusters/Software/AddOn.pm
bince-criticalcase/vsphere-automation-sdk-perl
da3330bf66dc6c853e9a23062146d54afc299955
[ "MIT" ]
7
2017-05-25T04:49:56.000Z
2020-10-12T09:13:16.000Z
lib/sdk/Com/Vmware/Esx/Settings/Clusters/Software/AddOn.pm
DamonLiang2021/vsphere-automation-sdk-perl
da3330bf66dc6c853e9a23062146d54afc299955
[ "MIT" ]
11
2017-05-05T11:52:12.000Z
2021-12-06T23:14:59.000Z
######################################################################## # Copyright (C) 2013 - 2014 VMware, Inc. ######################################################################## ## @file AddOn.pm # Auto generated vAPI skeleton file. # DO NOT MODIFY! # # #use Com::Vmware::Vapi::Std::Errors; #use Com::Vmware::Esx::Settings; ## @class Com::Vmware::Esx::Settings::Clusters::Software::AddOn # The ``Com::Vmware::Esx::Settings::Clusters::Software::AddOn`` *interface* provides # *methods* to manage desired OEM add-on specification for a given cluster. # # # Constant String::RESOURCE_TYPE # #Resource type for add-on resource package Com::Vmware::Esx::Settings::Clusters::Software::AddOn; # # Core Perl modules # use strict; use warnings; use Carp; # # Vapi Perl modules # use Com::Vmware::Vapi::Bindings::Type::StructType; use Com::Vmware::Esx::Settings::Clusters::Software::AddOnStub; # # Base class # use base qw(Com::Vmware::Vapi::Bindings::VapiInterface); # # Identifier of the service # use constant _VAPI_SERVICE_ID => 'com.vmware.esx.settings.clusters.software.add_on'; ## @method new () # Constructor to initialize the object # # @param api_provider - protocol connection to use with # stubs created by this factory # @param StubConfig - Stub's additional configuration # # @retval # Blessed object # sub new { my ($class, %args) = @_; $class = ref($class) || $class; my $stub_config = $args {stub_config}; my $api_provider = $args {api_provider}; my $self = $class->SUPER::new('stub_config' => $stub_config, 'api_provider' => $api_provider); bless $self, $class; return $self; } ## @method get () # Returns the desired OEM add-on specification for a given cluster. # # Note: # Privileges required for this operation are VcIntegrity.lifecycleSoftwareSpecification.Read. # # @param cluster [REQUIRED] Identifier of the cluster. # The value must be an identifier for the resource type # getQualifiedName(ClusterComputeResource). # . The value must be str. # # @retval # Desired OEM add-on specification. # The return type will be Com::Vmware::Esx::Settings::AddOnInfo # # @throw Com::Vmware::Vapi::Std::Errors::Error # If there is unknown internal error. The accompanying error message will give more # details about the failure. # # @throw Com::Vmware::Vapi::Std::Errors::NotFound # If there is no cluster associated with ``cluster`` in the system or if desired OEM # add-on specification is not found. # # @throw Com::Vmware::Vapi::Std::Errors::ServiceUnavailable # If the service is not available. # # @throw Com::Vmware::Vapi::Std::Errors::Unauthenticated # if the caller is not authenticated. # @throw Com::Vmware::Vapi::Std::Errors::Unauthorized # if you do not have all of the privileges described as follows: <ul> # <li> *Method* execution requires # ``VcIntegrity.lifecycleSoftwareSpecification.Read`` . </li> # <li> The resource ``ClusterComputeResource`` referenced by the *parameter* # ``cluster`` requires ``VcIntegrity.lifecycleSoftwareSpecification.Read`` . </li> # </ul> # sub get { my ($self, %args) = @_; my $cluster = $args {cluster}; $self->validate_args (method_name => 'get', method_args => \%args); return $self->invoke (method_name => 'get', method_args => \%args); } 1; ######################################################################################### # Begins enumerations for the Com::Vmware::Esx::Settings::Clusters::Software::AddOn service ######################################################################################### ######################################################################################### # Ends enumerations for the Com::Vmware::Esx::Settings::Clusters::Software::AddOn service ######################################################################################### ######################################################################################### # Begins structures for the Com::Vmware::Esx::Settings::Clusters::Software::AddOn service ######################################################################################### ######################################################################################### # Ends structures for the Com::Vmware::Esx::Settings::Clusters::Software::AddOn service #########################################################################################
32.846715
93
0.554222
ed85ef11234e0186bca9825ec8a14ac4e4400038
864
pm
Perl
lib/Moose/Meta/Method/Accessor/Native/Array.pm
dolmen/p5-Moose
77fe8566f8cf21712481e1208b002e142d643993
[ "Artistic-1.0" ]
null
null
null
lib/Moose/Meta/Method/Accessor/Native/Array.pm
dolmen/p5-Moose
77fe8566f8cf21712481e1208b002e142d643993
[ "Artistic-1.0" ]
null
null
null
lib/Moose/Meta/Method/Accessor/Native/Array.pm
dolmen/p5-Moose
77fe8566f8cf21712481e1208b002e142d643993
[ "Artistic-1.0" ]
null
null
null
package Moose::Meta::Method::Accessor::Native::Array; our $VERSION = '2.1606'; use strict; use warnings; use Moose::Role; sub _inline_check_var_is_valid_index { my $self = shift; my ($var) = @_; return ( 'if (!defined(' . $var . ') || ' . $var . ' !~ /^-?\d+$/) {', $self->_inline_throw_exception( InvalidArgumentToMethod => 'argument => '.$var.','. 'method_name => "'.$self->delegate_to_method.'",'. 'type_of_argument => "integer",'. 'type => "Int",'. 'argument_noun => "index"', ) . ';', '}', ); } no Moose::Role; 1;
29.793103
106
0.365741
73f55211e5bd8f52f667d53940e287f4b5db5be2
9,967
pl
Perl
scripts/misc/update_predicted_data.pl
fergalmartin/ensembl-variation
858de3ee083fd066bc0b8a78e8a449176dd51bce
[ "Apache-2.0" ]
null
null
null
scripts/misc/update_predicted_data.pl
fergalmartin/ensembl-variation
858de3ee083fd066bc0b8a78e8a449176dd51bce
[ "Apache-2.0" ]
1
2020-04-20T12:11:56.000Z
2020-04-20T12:11:56.000Z
scripts/misc/update_predicted_data.pl
dglemos/ensembl-variation
7cd20531835b45b1842476606b4fd0856e3843e0
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env perl # Copyright [1999-2015] Wellcome Trust Sanger Institute and the EMBL-European Bioinformatics Institute # Copyright [2016-2018] EMBL-European Bioinformatics Institute # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. =head1 CONTACT Please email comments or questions to the public Ensembl developers list at <http://lists.ensembl.org/mailman/listinfo/dev>. Questions may also be sent to the Ensembl help desk at <http://www.ensembl.org/Help/Contact>. =cut # Script to update the documentation page "Data description". use strict; use warnings; use Bio::EnsEMBL::Registry; use Getopt::Long; # Print the usage instructions if run without parameters usage() unless (scalar(@ARGV)); my ($version,$input_file,$output_file,$help,$hlist,$user,$port,$pswd,$species,$web_colour_file,$web_mapping_colour); GetOptions( 'v=i' => \$version, 'i=s' => \$input_file, 'o=s' => \$output_file, 'help!' => \$help, 'hlist=s' => \$hlist, 'user=s' => \$user, 'port=i' => \$port, 'species|s=s' => \$species, # 'colour_file=s' => \$web_colour_file, # 'mapping_file=s' => \$web_mapping_colour ); usage("input and output files must be specified") unless ($input_file && $output_file); usage("Hosts list, user must be specified") unless ($hlist && $user && $version); $species ||= 'Homo_sapiens'; $port ||= 3306; $pswd ||= ''; my @hostnames = split /,/, $hlist; my $tmp_file = 'predicted_data_tmp.html'; my $tmp_section = 'section_tmp.html'; `cp $input_file $tmp_file`; my $section; my ($content_before, $new_content, $content_after); # Generates the "List of consequences" table documentation #$section = 'consequences'; #$content_before = get_content($section,'start'); #$content_after = get_content($section,'end'); #`perl generate_consequence_table.pl -o $tmp_section -colour_file $web_colour_file -mapping_file $web_mapping_colour`; #$new_content = `cat $tmp_section`; #`rm -f $tmp_section`; #print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); ## SIFT and PolyPhen ## my @versions = ('sift_version', 'sift_protein_db_version', 'polyphen_version', 'polyphen_release'); my %tool_versions; my %sift_species; my %polyphen_species; my $sql = qq{SHOW DATABASES LIKE '\%variation\_$version%'}; my $sql2 = qq{SELECT meta_key,meta_value FROM meta WHERE meta_key IN ('}.join("','",@versions).qq{')}; my $sql3 = qq{SELECT meta_value FROM meta WHERE meta_key=?}; foreach my $hostname (@hostnames) { my $database = ""; my $sth = get_connection_and_query($database, $hostname, $sql); # loop over databases while (my ($dbname) = $sth->fetchrow_array) { next if ($dbname =~ /^master_schema/); next if ($dbname =~ /sample$/); print "$dbname\n"; $database = $dbname; $dbname =~ /^(.+)_variation/; my $s_name = $1; if ($s_name eq lc($species)) { my $sth2 = get_connection_and_query($database, $hostname, $sql2); while (my ($key,$value) = $sth2->fetchrow_array) { $tool_versions{$key} = $value; } $sth2->finish(); } # SIFT my $sth_sift = get_connection_and_query($database, $hostname, $sql3, [$versions[0]]); if ($sth_sift->fetchrow_array) { $sift_species{$s_name} = 1; } $sth_sift->finish(); # PolyPhen my $sth_polyphen = get_connection_and_query($database, $hostname, $sql3, [$versions[2]]); if ($sth_polyphen->fetchrow_array) { $polyphen_species{$s_name} = 1; } $sth_polyphen->finish(); } } # Update SIFT $section = 'sift_version'; if ($tool_versions{$section}) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); my $sift_version = $tool_versions{$section}; $sift_version =~ s/sift//; $new_content = $sift_version; print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } $section = 'sift_protein_db_version'; if ($tool_versions{$section}) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); my $sift_pr_version = $tool_versions{$section}; if ($sift_pr_version =~ /UniRef90/) { $sift_pr_version =~ s/UniRef90/UniRef90 (release/; $sift_pr_version .= ')'; } $new_content = $sift_pr_version; print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } # Update SIFT species list $section = 'sift_species'; if (scalar(%sift_species)) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); $new_content = print_list_of_species(\%sift_species); print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } # Update PolyPhen $section = 'polyphen_version'; if ($tool_versions{$section}) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); my $polyphen_version = $tool_versions{$section}; $new_content = $polyphen_version; print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } # Update PolyPhen $section = 'polyphen_release'; if ($tool_versions{$section}) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); my $polyphen_release = $tool_versions{$section}; $new_content = $polyphen_release; print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } # Update PolyPhen species list $section = 'polyphen_species'; if (scalar(%polyphen_species)) { $content_before = get_content($section,'start'); $content_after = get_content($section,'end'); $new_content = print_list_of_species(\%polyphen_species); print_into_tmp_file($tmp_file,$content_before,$new_content,$content_after); } `cp $tmp_file $output_file`; `rm -f $tmp_file`; sub get_content { my $section = shift; my $type = shift; my $anchor = "<!-- $section - $type -->"; my $line = `grep -m1 -n '$anchor' $tmp_file`; die "Can't find the anchor '$anchor' in the file" if (!$line || $line eq ''); $line =~ /^(\d+):/; my $line_number = $1; my $content; if ($type eq 'start') { $content = `head -n$line_number $tmp_file`; if ($content !~ /$anchor(\n?)$/) { $content = (split("$anchor", $content))[0].$anchor; } } else { my $lines_count = (split(' ',`wc -l $tmp_file`))[0]; $line_number = $lines_count - $line_number + 1; $content = `tail -n$line_number $tmp_file`; if ($content !~ /^$anchor/) { $content = $anchor.(split("$anchor", $content))[1]; } } return $content; } sub print_list_of_species { my $spe_list = shift; my $max_row = 5; my $header = qq{ <div style="float:left;font-style:italic"> <ul style="margin-bottom:0px">}; my $html = $header; my $count_row = 1; foreach my $species (sort(keys(%$spe_list))) { $species =~ s/_/ /g; $species = ucfirst($species); if ($count_row == $max_row) { $html .= qq{ </ul>\n</div>$header}; $count_row = 1; } $html .= ($count_row == 1) ? qq{ <li style="margin-top:0px">} : ' <li>'; $html .= qq{$species</li>}; $count_row ++; } $html .= qq{ </ul>\n</div>}; return $html; } sub print_into_tmp_file { my $tmp = shift; my $before = shift; my $new = shift; my $after = shift; open TMP, "> $tmp" or die $!; print TMP $before; print TMP $new; print TMP $after; } # Connects and execute a query sub get_connection_and_query { my $dbname = shift; my $host = shift; my $sql = shift; my $params = shift; # DBI connection my $dsn = "DBI:mysql:$dbname:$host:$port"; my $dbh = DBI->connect($dsn, $user, $pswd) or die "Connection failed"; my $sth = $dbh->prepare($sql); if ($params) { $sth->execute(join(',',@$params)); } else { $sth->execute; } return $sth; } sub usage { my $msg = shift; print qq{ $msg Usage: perl update_data_description.pl [OPTION] Update the page "data_description.html" (under public-plugins/ensembl/htdocs/info/genome/variation/). Options: -help Print this message -v Ensembl version, e.g. 65 (Required) -i Path to the data_description.html file (Required) -o An HTML output file name (Required) -species Species name. 'Homo_sapiens' by default (optional) -hlist The list of host names where the new databases are stored, separated by a coma, e.g. ensembldb.ensembl.org1, ensembldb.ensembl.org2 (Required) -user MySQL user name (Required) -port MySQL port. 3306 by default (optional) } . "\n"; # -colour_file If you want to use directly the colours from the web colours configuration file # instead of the almost-up-to-date-colour-hash \%colour hash. (optional) # Usually, you can find the colour configuration file in: # ensembl-webcode/conf/ini-files/COLOUR.ini # -mapping_file Web module to map the colour names to the corresponding hexadecimal code. (optional) # Useful because some colour names are internal to Ensembl and won't be displayed in the # documentation pages (i.e. not using the perl modules). # The module ColourMap.pm can be find in: # ensembl-webcode/modules/Sanger/Graphics/ColourMap.pm # } . "\n"; exit(0); }
31.541139
118
0.649945
ed795a2cf0b7174fd4f943ea8139fa4b32fca941
968
t
Perl
feedgenerator/t/feedgen.t
flaithbheartaigh/jaikuengine-mobile-client
c47100ec009d47a4045b3d98addc9b8ad887b132
[ "MIT" ]
null
null
null
feedgenerator/t/feedgen.t
flaithbheartaigh/jaikuengine-mobile-client
c47100ec009d47a4045b3d98addc9b8ad887b132
[ "MIT" ]
null
null
null
feedgenerator/t/feedgen.t
flaithbheartaigh/jaikuengine-mobile-client
c47100ec009d47a4045b3d98addc9b8ad887b132
[ "MIT" ]
null
null
null
#!/usr/bin/perl use Test::More tests=>8; use Jaiku::FeedGenerator; my @items; { package FeedTest; sub new { return bless {}, shift; } sub fetch_last_known { return ""; } sub new_item { my ($self, $nick, $type, $xml)=@_; push(@items, [ $nick, $type, $xml ]); } 1; } my $cb=new FeedTest; my $feedgen=new Jaiku::FeedGenerator($cb); ok(1, "created"); my $xml1="<presence><status>20060101T120000&lt;presencev2>&lt;/presencev2></status></presence>"; $feedgen->handle_next("mikie", $xml1); ok(1, "handle didn't crash"); ok($#items==-1, "no items yet"); my $xml2="<presence><status>20060101T120000&lt;presencev2>&lt;a>a&lt;/a>&lt;/presencev2></status></presence>"; $feedgen->handle_next("mikie", $xml2); ok($#items==0, "one item"); ok($items[0]->[0] eq "mikie", "right nick"); ok($items[0]->[1] eq "a", "right type"); ok($items[0]->[2] eq "<a>a</a>", "right content"); $feedgen->handle_next("mikie", $xml2); ok($#items==0, "no items from no change");
22.511628
110
0.629132
ed5ae4e40e666cb30954f56ebcf7067c07619c59
11,582
pl
Perl
utilities/page-test.pl
Ensembl/webvm
cd3d91bfa7ff953237320c0d2c7358cde369f366
[ "ECL-2.0", "Apache-2.0" ]
2
2022-02-03T00:20:01.000Z
2022-02-14T11:09:49.000Z
utilities/page-test.pl
Ensembl/webvm
cd3d91bfa7ff953237320c0d2c7358cde369f366
[ "ECL-2.0", "Apache-2.0" ]
1
2019-05-20T14:45:07.000Z
2019-06-20T12:55:45.000Z
utilities/page-test.pl
Ensembl/webvm
cd3d91bfa7ff953237320c0d2c7358cde369f366
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
#!/usr/bin/perl # Copyright [2018-2021] EMBL-European Bioinformatics Institute # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ## Look in SVN for all static content pages (.html) and then use CURL to request them all ## ## ## Author : js5 ## Maintainer : js5 ## Created : 2009-08-12 ## Last commit by : $Author: js5 $ ## Last modified : $Date: 2013-06-24 08:18:34 +0100 (Mon, 24 Jun 2013) $ ## Revision : $Revision: 804 $ ## Repository URL : $HeadURL: svn+ssh://pagesmith-core@web-wwwsvn.internal.sanger.ac.uk/repos/svn/pagesmith/pagesmith-core/trunk/utilities/page-test.pl $ use strict; use warnings; use utf8; use version qw(qv); our $VERSION = qv('0.1.0'); use HTML::Entities qw(encode_entities); use English qw(-no_match_vars $PROGRAM_NAME $EVAL_ERROR $INPUT_RECORD_SEPARATOR); use File::Basename qw(dirname basename); use Cwd qw(abs_path); use Readonly qw(Readonly); use Getopt::Long qw(GetOptions); use Time::HiRes qw(time sleep); use YAML::Loader; use Data::Dumper qw(Dumper); # Define constants and data-structures Readonly my $URL_MAX_LENGTH => 120; Readonly my $SLEEP_PERIOD => 0.001; Readonly my $RATE => 5; Readonly my $TIME_OUT => 60; Readonly my $MAX_TRIES => 5; my $ROOT_PATH; BEGIN { $ROOT_PATH = dirname(dirname(abs_path($PROGRAM_NAME))); } use lib "$ROOT_PATH/lib"; use Pagesmith::Utils::Core; use Pagesmith::Utils::Curl::Fetcher; my $help = 0; my $ajax = 0; my $flush = 0; my $rate = $RATE; my $time_out = $TIME_OUT; my $max_tries = $MAX_TRIES; my $xhtml = 0; my $verbose = 0; my $local = 0; my $dev = 0; my $staging = 0; my @headers; my @cookies; GetOptions( 'help' => \$help, 'flush+' => \$flush, 'ajax' => \$ajax, 'concurrency=i' => \$rate, 'timeout=i' => \$time_out, 'maxtries=i' => \$max_tries, 'verbose+' => \$verbose, 'xhtml' => \$xhtml, 'local' => \$local, 'dev' => \$dev, 'staging' => \$staging, ); my $type_to_test = $staging ? 'staging' : $dev ? 'dev' : $local ? 'local' : 'live' ; _docs() if $help; push @cookies, 'PageSmith=%7B%22a%22%3A%22e%22%7D' if $ajax; push @headers, 'Pragma: no-cache' if $flush; push @headers, $xhtml ? 'Accept: text/html,application/xhtml+xml,application/xml' : 'Accept: text/html'; my %return_vals; my @urls; if( opendir my $dh, "$ROOT_PATH/sites" ) { my @sites_list = grep { ! m{\A[.]}mxs && -e "$ROOT_PATH/sites/$_/data/urls" } readdir $dh; closedir $dh; _get_urls( \%return_vals, \@urls, @sites_list ); } else { die "Unable to open sites directory...\n"; } _munge_urls( $type_to_test, \@urls, \%return_vals ) unless $type_to_test eq 'live'; my $start_time = time; _fetch( { 'rate' => $rate, 'urls' => \@urls, 'cookies' => \@cookies, 'headers' => \@headers, 'timeout' => $time_out, }); ## no critic (ImplicitNewlines) printf ' -------------------------------------- Total: %10.3f -------------------------------------- ', time-$start_time if $verbose > 1; ## use critic ## no critic (DeepNests ExcessComplexity) sub _munge_urls { my( $type, $urls, $ret_vals ) = @_; my $local_sites = {}; $local_sites = get_yaml( "$ROOT_PATH/my-sites.yaml" ) if $type eq 'local'; my $apache = get_apache_sites( "$ROOT_PATH/apache2/sites-enabled" ); my $mapper = {}; my @new_urls; foreach my $url (@{$urls}) { if( $url =~m{\A(https?)://([^/]+)(/.*)}mxs ) { my( $protocol, $site, $rest ) = ($1,$2,$3); unless( exists $mapper->{$site} ) { if( $type eq 'local' ) { foreach my $local ( sort keys $local_sites ) { if( exists $apache->{$local} && $apache->{$local}[1] eq $site ) { $mapper->{$site} = $local; last; } else { ( my $munged = $local ) =~ s{\A\w+-}{*-}mxs; if( exists $apache->{$munged} && $apache->{$munged}[1] eq $site ) { $mapper->{$site} = $local; last; } } } } else { foreach my $s (sort keys %{$apache}) { next unless index $s, q(*); my $reg = '\A(?:\w+[.])?'.$type.'[.]'; if( $s =~ m{$reg}mxs && $apache->{$s}[1] eq $site ) { $mapper->{$site} = $s; last; } } } } $mapper->{$site}||=q(); unless( $mapper->{$site} ) { printf "-skip: : %s\n", $url if $verbose > 1; next; } my $new_url = "$protocol://$mapper->{$site}$rest"; push @new_urls, $new_url; next if $new_url eq $url; $ret_vals->{$new_url} = $ret_vals->{$url}; delete $ret_vals->{$url}; } } @{$urls} = @new_urls; return; } ## use critic sub _get_urls { my ($ref_ret, $ref_urls, @sites) = @_; foreach my $site ( @sites ) { my $dirname = "$ROOT_PATH/sites/$site/data/urls"; my $dh; unless( opendir $dh, $dirname ) { next; } my @files = grep { ! m{\A[.]}mxs && m{https?(?:-\S+)?[.]txt\Z}mxs } readdir $dh; foreach my $file (@files) { my ($protocol,$site_name) = $file =~ m{\A(https?)(?:-(\S+))?[.]txt}mxs ? ($1,$2) : ($file); $site_name ||= $site; my @url_details; if( open my $fh, q(<), "$dirname/$file" ) { @url_details = grep { m{\S}mxs && ! m{\A\s*[#]}mxs } <$fh>; close $fh; ## no critic (RequireChecked) } else { next; } chomp @url_details; my $det = shift @url_details; while( $det || @url_details ) { my( $url, $code ) = split m{[ ]}mxs, $det; $code ||= q(200); unless( $url ) { $det = shift @url_details; next; } $url = "$protocol://$site$url" unless $url =~ m{\Ahttps?://}mxs; push @{$ref_urls}, $url; $ref_ret->{ $url } = [ $code ]; $det = shift @url_details; while( defined $det && ! index $det, q( ) ) { $det =~ s{\A\s+}{}mxs; push @{$ref_ret->{$url}}, $det; $det = shift @url_details; } } } } return; } ## no critic (ExcessComplexity DeepNests) sub _fetch { my( $params ) = @_; my $c = Pagesmith::Utils::Curl::Fetcher->new(); my $init = time; my $failed_urls = {}; my $start = {}; ## no critic (LongChainsOfMethodCalls) foreach( 1..$params->{'rate'}) { last unless @{$params->{'urls'}}; my $url = $c->new_request( shift @{$params->{'urls'}} ) ->set_cookies( $params->{'cookies'} ) ->set_headers( $params->{'headers'} ) ->set_timeouts( $params->{'timeout'} ) ->init->url; next if $verbose <= 1; $start->{$url} = time; printf "-----: : %s\n", $url; } my $out = 0; while( $c->has_active ) { next if $c->active_transfers == $c->active_handles; while( my $req = $c->next_request ) { $out++; my $end = time; my $rc = $req->response->code; my ($exp_rc,@exp_content) = @{$return_vals{$req->url}}; if( $rc ) { delete $failed_urls->{ $req->url }; if( $exp_rc == $rc ) { (my $content = $req->response->body) =~ s{\s+}{ }mxsg; my $extra = $verbose > 1 ? sprintf ' %10.3f :', time-$start->{$req->url} : q(); printf "Match:%s %s\n", $extra, $req->url if $verbose; foreach my $exp ( @exp_content ) { if( 0 <= index $content, $exp ) { printf " Good:%s %s (%s)\n", $extra, $req->url, $exp if $verbose; } else { printf " Bad:%s %s (%s)\n", $extra, $req->url, $exp; } } } else { my $extra = $verbose > 1 ? sprintf ' %10.3f :', time-$start->{$req->url} : q(); printf "Error:%s %s [ %d != %d ]\n", $extra, $req->url, $rc, $exp_rc; } } else { push @{$params->{'urls'}}, $req->url if $failed_urls->{ $req->url }++ < $max_tries; } $c->remove( $req ); ## Retry a URL if failed with timeout! next unless @{$params->{'urls'}}; ## If we have any more URLs add the new one! my $url = $c->new_request( shift @{$params->{'urls'}} ) ->set_cookies( $params->{'cookies'} ) ->set_headers( $params->{'headers'} ) ->set_timeouts( $params->{'timeout'} ) ->init->url; if( $verbose > 1 ) { printf "-----: : %s\n", $url; $start->{$url} = time; } sleep $SLEEP_PERIOD; } } foreach ( sort keys %{$failed_urls} ) { printf "Fatal: : $_\n"; } return; } ## use critic sub _docs { ## no critic (ImplicitNewlines CheckedSyscalls) print ' Loads a list of URLS from a file... utilities/load-all-pages.pl -h|--help -f|--flush -a|--ajax -c|--concurrency {rate} -m|--maxtries {no} -t|--timeout {seconds} Options: -h, --help : Display this message -f, --flush : Send flush page header : If TWO -f are supplied flush template as well -a, --ajax : Send ajax cookie - so ajax page is cached -m, --maxtries : Max no of times to try each url if timed out... -c, --concurrency : Concurrency : default 5 -t, --timeout : cURL timeout : default 60 seconds '; ## use critic exit; } ## use critic sub get_yaml { my $filename = shift; if( open my $fh, '<', $filename ) { local $INPUT_RECORD_SEPARATOR = undef; my $contents = <$fh>; close $fh; ## no critic (RequireChecked) my $yl = YAML::Loader->new; my $hash = eval { $yl->load( $contents ); }; if( $EVAL_ERROR ) { warn "YAML error $filename - $EVAL_ERROR\n"; return; } return $hash; } warn "Unable to open config file\n"; return; } sub get_apache_sites { my $apache_sites_dir = shift; my $dh; opendir $dh, $apache_sites_dir; return unless $dh; my @conf_files = grep { ! m{\A[.]}mxs && ! -d "$apache_sites_dir/$_" } readdir $dh; closedir $dh; my $domains = {}; foreach my $fn ( @conf_files ) { ## no critic (BriefOpen) if( open my $fh, q(<), "$apache_sites_dir/$fn" ) { my $server_name; my $server_aliases = []; my $docroot = q(); while(<$fh>) { if( m{</VirtualHost>}mxs) { if( $server_name ) { $domains->{$_} = [ $docroot, $server_name ] foreach (@{$server_aliases},$server_name); } $server_name = undef; $server_aliases = []; $docroot = q(); } elsif( m{\A\s*Server(Name|Alias)\s+(.*?)\s+\Z}mxs ) { my ($type,$list) = ($1,$2); if( $type eq 'Name' ) { $server_name = $list; } else { push @{$server_aliases}, $_ foreach split m{\s+}mxs, $list; } } elsif( m{\A\s*DocumentRoot\s*\$[{]PAGESMITH_SERVER_PATH[}]/(\S+)}mxs ) { $docroot = $1; } } close $fh; ##no critic (RequireChecked) } ## use critic } return $domains; }
30.083117
153
0.521067
ed39f13f28b16a67fa28df583800c288704ff2c4
6,889
pm
Perl
hxnyclassifierMP/pipelines/lib/util/Random.pm
VirusBRC/Clade_Classification
61727e6da624ff241f702cbe8fb408c263d39b79
[ "MIT" ]
6
2019-07-19T05:34:16.000Z
2021-05-29T20:31:09.000Z
hxnyclassifierMP/pipelines/lib/util/Random.pm
DamieFC/Clade_Classification
c2f1cc552675bc34019b346d5b816dff70484abd
[ "MIT" ]
1
2020-07-27T05:22:13.000Z
2020-07-27T05:22:13.000Z
hxnyclassifierMP/pipelines/lib/util/Random.pm
DamieFC/Clade_Classification
c2f1cc552675bc34019b346d5b816dff70484abd
[ "MIT" ]
1
2020-12-22T23:30:31.000Z
2020-12-22T23:30:31.000Z
package util::Random; ################################################################################ # # Required Modules # ################################################################################ use strict; use FileHandle; use Pod::Usage; use util::Constants; use util::ErrMsgs; use util::PathSpecifics; use fields qw( error_mgr population population_size sample_size ); ################################################################################ # # Constants # ################################################################################ ### ### Error Class ### sub ERR_CAT { return util::ErrMsgs::RANDOM_CAT; } ### ### Mapping Record Tag ### sub SAMPLE_SIZE { return 2000; } ################################################################################ # # Private Methods # ################################################################################ sub _getPopulation { my util::Random $this = shift; my ($file) = @_; $file = getPath($file); $this->{error_mgr} ->exitProgram( ERR_CAT, 3, [$file], !-e $file || !-f $file || !-r $file ); my $fh = new FileHandle; $this->{error_mgr} ->exitProgram( ERR_CAT, 4, [$file], !$fh->open( $file, '<' ) ); my $whitespace = util::Constants::WHITESPACE; my $population = []; while ( !$fh->eof ) { my $input_line = $fh->getline; chomp($input_line); next if ( $input_line eq util::Constants::EMPTY_STR || $input_line =~ /^$whitespace$/ || $input_line =~ /^#/ ); push( @{$population}, $input_line ); } $fh->close; return $population; } sub _initClass { my util::Random $this = shift; my ($population) = @_; $this->{error_mgr}->exitProgram( ERR_CAT, 1, [], !defined($population) || ref($population) ne 'ARRAY' || @{$population} == 0 ); $this->{population_size} = scalar @{$population}; $this->{population} = [ @{$population} ]; $this->{sample_size} = SAMPLE_SIZE; } ################################################################################ # # Constructor Methods # ################################################################################ sub new { my util::Random $this = shift; my ( $population, $error_mgr ) = @_; $this = fields::new($this) unless ref($this); $this->{error_mgr} = $error_mgr; $this->_initClass($population); ### ### Return the object ### return $this; } sub newByFile { my util::Random $this = shift; my ( $file, $error_mgr ) = @_; $this = fields::new($this) unless ref($this); $this->{error_mgr} = $error_mgr; $this->_initClass( $this->_getPopulation($file) ); ### ### Return the object ### return $this; } ################################################################################ # # Setter Methods # ################################################################################ sub setSampleSize { my util::Random $this = shift; my ($sample_size) = @_; $this->{error_mgr}->exitProgram( ERR_CAT, 2, [$sample_size], !defined($sample_size) || $sample_size !~ /^\+?\d+$/ || int($sample_size) == 0 ); $this->{sample_size} = int($sample_size); } sub setPopulationToSample { my util::Random $this = shift; $this->{population} = [ $this->getSample ]; $this->{population_size} = scalar @{ $this->{population} }; } ################################################################################ # # Getter Methods # ################################################################################ sub population { my util::Random $this = shift; return @{ $this->{population} }; } sub populationByPrefix { my util::Random $this = shift; my ($prefix) = @_; my @population = (); foreach my $population_id ( @{ $this->{population} } ) { next if ( $population_id !~ /^$prefix/ ); $population_id =~ s/^$prefix//; push( @population, $population_id ); } return @population; } sub getSample { my util::Random $this = shift; return @{ $this->{population} } if ( $this->{sample_size} >= $this->{population_size} ); my %sample = (); my $sample_size = 0; while ( $sample_size < $this->{sample_size} ) { $sample{ $this->{population} ->[ int( rand( $this->{population_size} ) - 1 ) ] } = util::Constants::EMPTY_STR; my @keys = keys %sample; $sample_size = scalar @keys; } return keys %sample; } sub storeFile { my util::Random $this = shift; my ($file) = @_; $file = getPath($file); my $fh = new FileHandle; $this->{error_mgr} ->exitProgram( ERR_CAT, 5, [$file], !$fh->open( $file, '>' ) ); foreach my $pop_id ( @{ $this->{population} } ) { $fh->print("$pop_id\n"); } $fh->close; } ################################################################################ 1; __END__ =head1 NAME Random.pm =head1 DESCRIPTION This class defines the mechanism for determination of a random sample from a population of a given size. =head1 METHODS These methods are used for creating this class. =head2 B<new util::Random(population, error_mgr)> This method is the constructor for this class. The B<population> is a non empty referenced array of the entity identifiers composing the population. The B<error_mgr> is the the error messaging object of L<util::ErrMgr>. By default, the sample size is set to B<2000>. =head2 B<newByFile util::Random(file, error_mgr)> This method is the constructor for this class. The B<file> contains the population ids. Each population id is on a line and lines that are empty or whitespace or start with B<#> are ignored. It is a fatal error for the file to be inaccessible or contain no population ids. The B<error_mgr> is the the error messaging object of L<util::ErrMgr>. By default, the sample size is set to B<2000>. =head1 SETTER METHODS The following setter methods are exported for this class. =head2 B<setSampleSize(sample_size)> This method sets the sample_size of the object. B<sample_size> must be a positive integer. By default, the sample_size is set to B<2000>. =head2 B<setPopulationToSample> This special method sets the population to a random sample as generated by a call to L<"getSample">. =head1 GETTER METHODS The following getter methods are exported by this class. =head2 B<@sample = getSample> This method returns random sample of sample_size from the population. If the sample_size is larger than the size of the population, then the whole population is returned. =head2 B<@population = population> This method returns population as a list. =head2 B<@population = populationByPrefix(prefix)> This method returns sub-population with the given prefix as a list. Each population_id will have the prefix removed. =head2 B<storeFile(file)> This method stores the population into the file (one population id per line) so that it can be read by B<newByFile>. =cut
26.394636
80
0.551169
ed46464e566dd672e979bdaf0e4274f8aa75da25
12,360
pm
Perl
lib/Actium/DB/FileMaker_ODBC.pm
aaronpriven/actium
08b26b9372a302a1470e8387a8d8a96ed43df399
[ "Artistic-1.0" ]
1
2017-01-30T04:22:33.000Z
2017-01-30T04:22:33.000Z
lib/Actium/DB/FileMaker_ODBC.pm
aaronpriven/actium
08b26b9372a302a1470e8387a8d8a96ed43df399
[ "Artistic-1.0" ]
39
2015-07-10T22:52:17.000Z
2020-05-20T03:45:02.000Z
lib/Actium/DB/FileMaker_ODBC.pm
aaronpriven/actium
08b26b9372a302a1470e8387a8d8a96ed43df399
[ "Artistic-1.0" ]
null
null
null
package Actium::DB::FileMaker_ODBC 0.012; # FileMaker database read via ODBC # Specific databases will (usually) be subclasses of this one use Actium ('class'); const my $META_TABLES => 'FileMaker_Tables'; const my $META_FIELDS => 'FileMaker_Fields'; has [qw/db_name db_user db_password/] => ( is => 'ro', isa => 'Str', ); has keycolumns_of_table_r => ( traits => ['Hash'], is => 'rwp', isa => 'HashRef[Maybe[Str]]', handles => { keycolumn_of_table => 'get' }, ); method _connect { my $db_name = $self->db_name; my $cry = env->cry("Connecting to database $db_name"); my $dbh = DBI->connect( "dbi:ODBC:$db_name", $self->db_user, $self->db_password, { RaiseError => 1, PrintError => 1, AutoCommit => 0 } ); $dbh->{odbc_utf8_on} = 1; # ODBC driver has to be set to return utf-8 $cry->done; return $dbh; } # ActiumDB should use an "after connect" to populate keycolumns_of_table_r # from the FMTableKeys table in the ActiumDB method _fetch_table_names { my $statement = "SELECT TableName from $META_TABLES WHERE TableName = BaseTableName"; my $ary_ref = $self->dbh->selectall_arrayref($statement); my @tables = Actium::flatten $ary_ref; my %is_a_table = map { $_, undef } @tables; return \%is_a_table; } method _make_table_obj ($tablename, :$keycolumn? ) { croak "No such table $tablename in database " . $self->db_name unless $self->is_a_table($tablename); if ( not defined $keycolumn ) { $keycolumn = $self->keycolumn_of_table($tablename); } my $quoted_tablename = $self->quote_identifiers($tablename); my $dbh = $self->dbh; my $query = "SELECT FieldName from $META_FIELDS WHERE TableName = $quoted_tablename"; my $ary_ref = $dbh->selectall_arrayref($query); my @columns = Actium::flatten $ary_ref; my $class = $self->class_of_table($tablename); my %table_spec = ( name => $tablename, db => $self->dbh, columns => \@columns, ); $table_spec{keycolumn} = $keycolumn if $keycolumn; return $class->new(%table_spec); } method class_of_table { return 'Actium::DB::Table'; } # subclasses will override class_of_table to allow specific tables to # be associated with particular classes, e.g., Actium::DB::ActiumDB::Signs # or whatever with 'Actium::DB'; Actium::immut; __END__ =encoding utf8 =head1 NAME Actium::DB::FileMaker_ODBC - class for using FileMaker databases via ODBC drivers =head1 VERSION This documentation refers to version 0.015 =head1 SYNOPSIS use <name>; # do something with <name> =head1 DESCRIPTION A full description of the module and its features. =head1 SUBROUTINES or METHODS or ATTRIBUTES =head2 subroutine Description of subroutine. =back =head1 DIAGNOSTICS A list of every error and warning message that the application can generate (even the ones that will "never happen"), with a full explanation of each problem, one or more likely causes, and any suggested remedies. If the application generates exit status codes, then list the exit status associated with each error. =head1 CONFIGURATION AND ENVIRONMENT A full explanation of any configuration system(s) used by the application, including the names and locations of any configuration files, and the meaning of any environment variables or properties that can be se. These descriptions must also include details of any configuration language used. =head1 DEPENDENCIES The Actium system, and... =head1 INCOMPATIBILITIES None known. =head1 BUGS AND LIMITATIONS None known. Issues are tracked on Github at L<https://github.com/aaronpriven/actium/issues|https://github.com/aaronpriven/actium/issues>. =head1 AUTHOR Aaron Priven <apriven@actransit.org> =head1 COPYRIGHT & LICENSE Copyright 2018 This program is free software; you can redistribute it and/or modify it under the terms of either: =over 4 =item * the GNU General Public License as published by the Free Software Foundation; either version 1, or (at your option) any later version, or =item * the Artistic License version 2.0. =back This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. head1 NAME Actium::Files::FileMaker_ODBC - role for reading from a FileMaker database via ODBC drivers =head1 VERSION This documentation refers to version 0.003 =head1 SYNOPSIS use Actium::Files::RoleComposer; my $db = Actium::Files::RoleComposer->new(); $row_hr = $db->row('Column' , 'Keyvalue'); $othervalue = $row_hr->{OtherValue}; =head1 DESCRIPTION Actium::Files::FileMaker_ODBC is a role for reading data from a FileMaker database, over the network using ODBC. It uses L<DBI|DBI> and L<DBD::ODBC|DBD::ODBC>. =head1 METHODS =head2 Methods that must be provided by the consuming class =over =item B<db_name> The name used in the ODBC driver. =item B<db_user> The user name passed to the ODBC driver. =item B<db_password> The password passed to the ODBC driver. =item B<key_of_table(I<table>)> This method returns the name of the key column, if any, associated with he given table. It must be a regular column that comes from the data, although someday it may be allowed to provide multiple columns that are combined to form the key. This method, as defined in the consuming role, can assume that the database has been connected first. This allows the keys to be defined in the database itself rather than in the program or in other configuration files. =back =head2 Methods in Actium::Files::FileMaker_ODBC =over =item B<dbh()> Provides the database handle associated with this database. See L<DBI|DBI> for information on the database handle. =item B<row(I<table>, I<keyvalue>)> Fetches the row of the table where the value of the key column is the specified value. (DBI will be happy to provide the "first" row if there is more than one row with that value, but which row is first is undefined. It is recommended for use only on rows with unique values in the key.) The row is provided as a hash reference, where the keys are the column names and the values are the values for this row. =item B<each_row(I<table>)> =item B<each_row_eq(I<table>, I<column>, I<value>)> =item B<each_row_like(I<table>, I<column>, I<match>)> =item B<each_row_where(I<table>, I<where>, I<match> ...)> The each_row routines return an subroutine reference allowing iteration through each row. Intended for use in C<while> loops: my $eachtable = $database->each_row("table"); while (my $row_hr = $eachtable->() ) { do_something_with_value($row_hr->{SomeColumn}); } The rows are provided as hash references, where the keys are the column names and the values are the values for this row. each_row provides every row in the table. each_row_eq provides every row where the column specified is equal to the value specified. each_row_like provides every row where the column specified matches the SQL LIKE pattern matching characters. ("%" matches a sequence of zero or more characters, and "_" matches any single character.) each_row_where is more flexible, allowing the user to specify any WHERE clause. It accepts multiple values for matching. It is necessary to specify the WHERE keyword in the SQL. =item B<each_columns_in_row_where(I<...>)> Similar to the other I<each_> routines, I<each_columns_in_row_where> returns a subroutine reference allowing iteration through each row. Unlike those routines, this allows the specification of specific columns, and returns an array reference instead of a hash reference. (Note: the array reference is B<the same for each row>, so to retain the data between calls you must copy the data and not merely keep the a reference.) It takes a hash or a hashref of named parameters: =over =item table The required name of the SQL table. =item where An optional SQL "WHERE" clause. It accepts multiple values for matching. It is necessary to specify the WHERE keyword in the SQL. =item columns A (required) reference to an array of column names. =item bind_values Optional reference to array of values to be put into placeholders in the SQL WHERE statement. =back =item B<all_in_column_key(I<table>, I<column> )> =item B<all_in_column_key(I<hashref_of_arguments>)> all_in_column_key provides a convenient way of getting data in a hash. It is used where only one field is required from the database, and where the amount of data desired can be loaded into memory. It is normally used this way: my $hashref = $database->all_in_column_key(qw/table column/); $value = $hashref->{$row_value}; The method returns a hashref. The keys are the key value from the column, and the values are the values of the column specified. The results are undefined if there is no valid key for this table. Normally, it is invoked with a flat list of arguments: the first argument is the table and the remaining argument is a column from the table. Alternatively, it can be invoked with named arguments in a hash reference: my $hashref = $database->all_in_column_key( { TABLE => 'table' , COLUMN => 'column' , WHERE => 'COLUMN = ?', BIND_VALUES => [ $value ] , }); TABLE is the name of the table. COLUMN is the column from the table. WHERE is optional, and allows specifying a subset of rows using an SQLite WHERE clause. BIND_VALUES is also optional, but if present must be an array reference of one or more values, which will be passed through to SQLite unchanged. It is only useful if the WHERE clause will take advantage of the bound values. =item B<all_in_columns_key>(I<table>, I<column>, I<column> , ... ) =item B<all_in_columns_key>(I<hashref_of_arguments>) all_in_columns_key provides a convenient way of getting data in a two-level hash structure, and is commonly used where the amount of data desired can be loaded into memory. It is normally used this way: my $hashref = $database->all_in_columns_key(qw/table column_one column_two/); $column_one_value = $hashref->{$row_value}{'column_one'} The method returns a hashref. The keys are the key value from the column, and the values are themselves hashrefs. In that second layer hashref, the keys are the column names, and the values are the values. It can be thought of as a two-dimensional hash, where the first dimension is the key value of the row, and the second dimension the column name. The results are undefined if there is no valid key for this table. Normally, it is invoked with a flat list of arguments: the first argument is the table and the remaining arguments are columns from the table. Alternatively, it can be invoked with named arguments in a hash reference: my $hashref = $database->all_in_columns_key( { TABLE => 'table' , COLUMNS => [ qw/column_one column_two/ ] , WHERE => 'COLUMN = ?', BIND_VALUES => [ $value ] , }); TABLE is the name of the table. COLUMNS must be an array reference with a list of columns from the table. WHERE is optional, and allows specifying a subset of rows using an SQLite WHERE clause. BIND_VALUES is also optional, but if present must be an array reference of one or more values, which will be passed through to SQLite unchanged. It is only useful if the WHERE clause will take advantage of the bound values. =item load_tables Documentation to be done... Call with load_tables ( requests => { table1 => { index_field => 'index_field', array => \@array, hash => \%hash, ignoredupe => 0, # or 1 }, table2 => { etc. }, }, ) =back =head1 DIAGNOSTICS =over =item Can't use row() on table $table with no key Another module called the B<row> method, specifying a table with no key. This is not valid. =item Invalid column $column for table $table A request specified a column that was not found in the specified table. =item Invalid table $table for database $db_name A request specified a table that was not found for the specified database type. =back =head1 DEPENDENCIES =over =item perl 5.012 =item DBI =item DBD::ODBC =item Actium =item Moose and Moose::Role =item FileMaker Pro or FileMaker Server Advanced. Tested with version 12. =back
26.81128
93
0.730583
ed65ea52239ed81ee6a767838e1dad90cc36b656
8,777
al
Perl
benchmark/benchmarks/FASP-benchmarks/data/delaunay-3d-2/delaunay3d-0236-240-2223.al
krzysg/FaspHeuristic
1929c40e3fbc49e68b04acfc5522539a18758031
[ "MIT" ]
null
null
null
benchmark/benchmarks/FASP-benchmarks/data/delaunay-3d-2/delaunay3d-0236-240-2223.al
krzysg/FaspHeuristic
1929c40e3fbc49e68b04acfc5522539a18758031
[ "MIT" ]
null
null
null
benchmark/benchmarks/FASP-benchmarks/data/delaunay-3d-2/delaunay3d-0236-240-2223.al
krzysg/FaspHeuristic
1929c40e3fbc49e68b04acfc5522539a18758031
[ "MIT" ]
null
null
null
1 6 16 23 27 30 75 120 129 131 139 177 217 2 26 111 202 228 232 3 10 31 109 122 156 171 190 4 6 74 125 136 161 198 200 221 5 3 18 41 85 92 109 138 153 171 203 225 230 238 6 1 4 27 30 125 129 131 187 198 200 217 221 7 97 119 222 8 24 32 61 74 78 161 189 206 9 12 64 65 66 73 87 99 150 182 10 3 55 81 112 145 156 190 11 15 39 49 81 112 143 159 160 176 203 225 230 240 12 57 66 99 100 117 182 227 13 37 64 67 89 140 173 204 14 60 88 97 98 116 143 153 159 160 176 185 15 11 25 42 61 63 73 83 107 114 143 211 236 240 16 1 23 38 75 104 105 113 177 213 17 71 90 108 196 199 229 18 41 43 109 115 122 238 19 20 27 82 95 96 129 136 164 183 200 20 23 28 45 53 69 82 96 170 183 186 21 29 33 79 96 136 148 164 165 168 183 193 215 224 227 22 32 101 108 124 149 154 180 218 23 16 28 38 45 75 82 167 177 186 192 24 8 59 61 78 80 91 121 161 189 201 25 49 55 81 83 87 93 112 141 26 2 56 202 216 218 228 232 27 1 19 20 23 30 53 129 136 167 177 186 188 221 28 29 33 53 82 130 186 193 234 29 32 130 135 158 165 183 194 195 221 229 30 1 6 27 53 71 129 131 188 194 196 221 31 3 72 91 133 155 156 157 166 171 174 184 225 32 8 17 29 42 108 114 158 187 199 211 33 21 28 29 90 124 126 130 132 146 158 195 212 239 34 37 52 76 103 147 175 181 184 209 213 35 21 86 121 128 132 165 215 224 227 36 47 58 102 178 179 181 204 37 13 50 52 64 76 77 89 152 175 179 192 38 23 41 75 92 104 105 113 152 177 220 238 39 14 59 72 98 153 159 176 203 40 35 46 54 62 100 127 182 208 227 41 18 38 85 103 104 105 109 115 138 161 175 184 198 220 238 42 15 22 32 61 94 101 108 124 180 211 43 18 38 41 92 152 175 184 192 230 238 44 116 144 199 206 207 45 20 23 28 71 186 234 46 35 36 62 86 102 123 127 178 215 227 233 47 36 79 127 134 168 178 179 204 205 48 56 117 124 126 146 172 197 228 237 49 15 39 63 81 87 112 143 159 225 240 50 37 47 75 79 82 96 134 164 168 170 204 205 234 51 8 24 59 72 78 114 159 52 65 67 76 77 103 133 155 166 173 184 53 28 29 30 45 96 183 186 193 194 54 26 48 117 121 126 128 172 195 197 201 208 232 235 239 55 10 25 93 145 157 190 56 48 54 87 101 126 172 201 202 57 40 117 182 197 210 227 235 58 13 34 36 37 52 64 76 77 102 123 175 179 181 213 59 24 72 85 91 98 153 159 161 174 189 60 44 70 88 137 144 196 199 206 207 61 15 24 32 42 51 94 101 107 114 135 240 62 57 66 100 128 155 226 235 63 7 11 15 49 114 116 143 160 176 185 64 9 13 52 65 66 67 77 84 100 102 118 123 140 141 173 179 182 190 65 9 52 66 100 102 111 133 141 151 173 190 66 12 57 62 64 118 182 226 67 76 77 89 173 68 75 119 120 131 137 169 231 69 20 28 29 45 53 234 70 14 60 88 97 98 143 207 71 28 29 30 53 130 186 194 72 24 61 80 219 225 236 73 2 9 15 25 26 87 107 151 162 74 6 8 32 131 135 137 138 139 144 187 189 196 199 75 16 38 50 120 131 152 163 169 170 177 192 204 222 76 34 37 43 77 89 115 122 173 175 184 77 13 37 67 76 89 78 24 51 59 159 161 189 206 79 134 147 168 181 205 215 233 80 61 72 83 107 145 201 202 214 216 219 223 81 10 49 55 110 112 141 156 225 82 19 69 95 96 167 83 25 49 73 80 93 107 145 162 236 84 13 36 46 100 102 123 182 204 85 31 91 109 138 161 174 86 34 35 46 52 58 102 103 123 155 161 165 184 87 15 26 48 56 94 107 180 182 218 237 88 7 14 39 60 70 98 116 119 120 137 142 144 153 207 89 13 37 67 92 152 173 90 17 29 130 149 154 188 194 212 229 91 24 59 61 72 80 85 155 161 184 201 219 223 92 5 18 38 43 89 115 122 140 152 222 230 238 93 55 73 83 110 141 145 151 157 216 94 15 26 42 87 107 121 211 236 95 50 82 129 134 147 164 167 177 205 213 224 96 20 50 69 95 148 164 170 234 97 14 60 70 88 116 119 143 160 185 207 98 14 39 51 59 60 78 137 143 185 189 206 99 57 65 66 151 197 226 228 232 235 237 100 46 57 62 64 66 102 118 182 101 22 32 42 56 61 124 126 154 158 218 229 102 36 52 62 65 84 86 118 123 128 179 215 103 4 52 105 165 191 198 233 104 16 38 41 163 169 217 220 222 230 231 238 105 4 16 41 125 139 147 175 209 220 106 80 93 110 111 141 145 151 216 219 107 15 26 61 73 87 202 236 240 108 130 154 180 199 207 211 212 229 109 5 31 85 115 138 171 174 184 110 25 55 81 141 157 190 111 2 65 118 133 151 214 223 232 235 112 25 49 55 145 157 225 113 38 75 104 169 192 217 114 32 44 51 143 159 180 185 206 211 240 115 43 122 152 184 116 7 14 88 97 143 176 180 185 207 117 54 124 150 182 227 237 118 62 64 65 102 111 128 226 119 14 39 68 75 88 97 116 120 137 160 196 207 230 120 1 30 71 75 119 131 137 186 196 207 121 24 32 35 54 56 61 101 126 135 195 201 202 208 218 122 3 5 18 89 92 109 115 140 152 156 166 230 123 34 36 58 64 179 181 215 124 15 26 56 87 94 108 117 126 130 172 218 234 239 125 4 6 105 135 139 221 126 90 121 124 146 158 172 195 212 127 21 35 46 79 132 148 164 178 182 204 215 227 128 35 40 46 54 62 86 118 132 155 208 235 129 1 16 19 27 30 95 125 136 167 177 200 217 221 130 17 29 33 45 71 108 124 149 154 194 212 234 131 6 68 74 75 137 163 169 187 196 220 231 132 21 29 40 54 121 127 208 210 227 133 31 52 65 106 141 151 155 156 157 166 173 219 223 134 47 95 164 224 135 4 8 24 29 32 103 121 161 165 188 189 206 136 21 27 103 129 165 183 191 224 233 137 68 88 98 144 187 138 153 161 189 220 238 139 6 74 131 217 220 231 140 64 65 81 89 152 173 190 222 141 9 65 66 73 81 87 93 106 110 151 142 39 68 98 119 137 153 163 203 220 222 230 231 238 143 49 51 70 97 114 159 176 185 206 240 144 8 32 44 60 98 189 196 199 206 145 25 49 72 93 106 157 159 225 146 117 124 126 172 212 239 147 34 79 95 103 105 134 136 181 200 205 209 213 215 224 233 148 21 50 96 164 168 170 239 149 17 22 32 108 154 199 212 229 150 12 48 87 124 182 204 151 2 9 93 106 111 216 226 152 37 43 76 77 89 92 115 140 192 204 222 230 153 14 39 59 74 85 98 137 138 144 163 220 231 238 154 90 108 124 126 130 229 155 31 62 65 91 102 103 111 118 133 161 166 208 219 223 235 156 3 81 122 140 166 190 225 157 3 10 31 55 72 80 106 110 133 219 225 158 29 32 33 90 121 126 135 165 159 11 14 39 49 59 61 72 78 98 145 176 225 240 160 7 11 39 97 116 119 176 230 161 24 59 85 86 91 103 135 138 189 198 208 162 73 80 93 106 107 145 202 236 163 68 104 131 142 153 169 230 164 21 50 79 96 127 136 148 183 193 165 4 29 86 121 132 136 183 191 208 221 224 233 166 3 31 67 76 109 115 184 167 19 20 23 95 177 183 186 168 21 79 127 164 178 182 204 239 169 75 104 113 163 217 222 170 20 23 28 45 82 95 148 177 192 205 171 3 203 225 172 54 117 124 173 13 52 64 77 122 133 156 166 190 174 5 39 59 72 91 153 171 184 175 34 152 184 192 176 14 160 203 177 16 23 27 38 82 95 170 186 192 178 46 47 79 84 204 215 179 13 37 47 50 58 84 102 123 181 180 15 44 63 124 130 185 199 207 211 181 34 36 37 47 50 58 79 147 170 179 191 204 213 182 36 46 66 84 117 127 150 168 178 227 183 19 21 27 29 96 164 167 188 194 221 184 41 43 52 76 85 103 109 155 161 166 174 209 185 14 44 60 63 70 97 98 180 207 186 1 23 30 53 75 120 167 177 196 187 4 6 30 74 125 131 135 188 199 221 188 17 27 29 32 183 187 207 221 229 189 4 8 24 78 85 98 138 144 153 161 198 206 190 13 31 55 64 65 81 106 133 140 141 151 156 157 219 191 34 86 103 123 147 165 181 215 224 233 192 16 38 41 50 58 105 152 181 205 209 213 222 193 21 29 33 69 96 127 130 148 164 168 183 227 234 194 17 27 30 53 130 186 188 196 207 195 29 54 121 126 132 146 158 165 172 197 196 6 17 30 60 71 74 88 120 131 137 186 187 188 199 207 197 12 40 48 57 117 132 232 237 198 4 74 105 125 138 139 161 189 200 220 199 32 44 108 114 180 187 188 196 211 200 4 6 16 95 103 105 125 136 139 177 213 217 221 224 201 24 26 54 61 155 202 208 214 223 235 202 2 26 61 73 80 94 162 201 214 203 11 72 119 142 153 160 171 174 176 225 230 238 204 37 64 84 127 148 179 181 182 192 227 234 239 205 34 95 134 177 181 192 213 215 206 8 32 44 51 61 70 74 135 143 185 199 207 17 60 71 97 120 130 149 180 185 188 196 199 208 24 35 40 54 86 91 103 121 135 161 165 201 214 223 235 209 41 103 105 175 184 213 210 40 54 117 132 150 172 182 197 204 239 211 15 22 61 94 108 114 180 199 206 236 212 90 124 126 130 149 154 180 213 16 34 58 105 175 177 209 214 2 26 80 106 151 155 202 208 223 232 235 215 36 46 47 86 147 181 191 224 216 2 73 93 107 162 202 214 236 217 1 16 38 41 75 105 131 139 200 218 15 22 26 42 48 56 61 87 94 101 124 126 202 219 31 72 106 157 174 220 6 41 74 105 131 137 139 153 189 198 217 231 238 221 4 27 29 30 103 129 135 136 165 188 222 38 68 104 113 119 120 122 142 160 163 169 204 223 80 91 106 133 155 201 208 219 224 19 79 95 134 164 200 233 225 3 5 10 11 39 122 156 157 159 160 174 203 219 230 226 65 232 235 227 40 57 117 127 168 182 197 210 228 9 54 56 73 87 151 197 232 237 229 22 32 90 126 149 158 188 230 5 18 38 104 152 160 163 169 203 222 225 231 131 137 139 142 163 169 217 220 232 2 65 111 118 151 201 214 226 228 235 237 233 35 46 86 103 215 224 234 20 28 33 50 82 124 148 170 204 235 40 54 62 66 111 118 197 201 226 232 237 236 15 49 51 61 72 80 94 107 114 145 159 216 240 237 9 12 54 57 87 99 117 150 232 235 238 5 18 43 163 230 231 239 21 54 117 124 132 146 148 150 172 193 195 197 227 234 240 15 83 107 114 145
36.570833
65
0.719494
ed977c7084d5c81693031633155de5cc4eb4ab49
524
t
Perl
integration/passing-pair-class-to-sub.t
patrickbkr/roast
0a56b31fd42cf0acda2af1788d9ce091840047da
[ "Artistic-2.0" ]
null
null
null
integration/passing-pair-class-to-sub.t
patrickbkr/roast
0a56b31fd42cf0acda2af1788d9ce091840047da
[ "Artistic-2.0" ]
null
null
null
integration/passing-pair-class-to-sub.t
patrickbkr/roast
0a56b31fd42cf0acda2af1788d9ce091840047da
[ "Artistic-2.0" ]
null
null
null
use v6; use Test; # L<S02/Mutable types/A single key-to-value association> # There ought to be a better reference for this. # And this test is also a candidate to be moved with other subroutine tests. plan 2; { my sub foo ($x) { $x.raku } my $pair = (a => 1); my $Pair = $pair.WHAT; lives-ok { foo($Pair) }, "passing ::Pair to a sub works"; } { my sub foo ($x) { $x.raku } my $int = 42; my $Int = $int.WHAT; lives-ok { foo($Int) }, "passing ::Int to a sub works"; } # vim: ft=perl6
17.466667
76
0.585878
ed1d99c725e420db385198ee04f77aed89a59aac
5,003
pm
Perl
hardware/telephony/avaya/cm/snmp/mode/trunks.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
316
2015-01-18T20:37:21.000Z
2022-03-27T00:20:35.000Z
hardware/telephony/avaya/cm/snmp/mode/trunks.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
2,333
2015-04-26T19:10:19.000Z
2022-03-31T15:35:21.000Z
hardware/telephony/avaya/cm/snmp/mode/trunks.pm
petneli/centreon-plugins
d131e60a1859fdd0e959623de56e6e7512c669af
[ "Apache-2.0" ]
371
2015-01-18T20:37:23.000Z
2022-03-22T10:10:16.000Z
# # Copyright 2021 Centreon (http://www.centreon.com/) # # Centreon is a full-fledged industry-strength solution that meets # the needs in IT infrastructure and application monitoring for # service performance. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # package hardware::telephony::avaya::cm::snmp::mode::trunks; use base qw(centreon::plugins::templates::counter); use strict; use warnings; use centreon::plugins::templates::catalog_functions qw(catalog_status_threshold catalog_status_calc); sub custom_sig_status_output { my ($self, %options) = @_; my $msg = sprintf( "state: %s [far node: %s]", $self->{result_values}->{state}, $self->{result_values}->{far_node} ); return $msg; } sub set_counters { my ($self, %options) = @_; $self->{maps_counters_type} = [ { name => 'sig', type => 1, cb_prefix_output => 'prefix_sig_output', message_multiple => 'All signaling groups are ok', skipped_code => { -10 => 1 } }, ]; $self->{maps_counters}->{sig} = [ { label => 'sig-status', threshold => 0, set => { key_values => [ { name => 'state' }, { name => 'far_node' }, { name => 'display' } ], closure_custom_calc => \&catalog_status_calc, closure_custom_output => $self->can('custom_sig_status_output'), closure_custom_perfdata => sub { return 0; }, closure_custom_threshold_check => \&catalog_status_threshold, } }, ]; } sub prefix_sig_output { my ($self, %options) = @_; return "Signaling group '" . $options{instance_value}->{display} . "' "; } sub new { my ($class, %options) = @_; my $self = $class->SUPER::new(package => __PACKAGE__, %options, force_new_perfdata => 1); bless $self, $class; $options{options}->add_options(arguments => { 'filter-sigid:s' => { name => 'filter_sigid' }, 'unknown-sig-status:s' => { name => 'unknown_sig_status', default => '' }, 'warning-sig-status:s' => { name => 'warning_sig_status', default => '' }, 'critical-sig-status:s' => { name => 'critical_sig_status', default => '%{state} =~ /out-of-service/' }, }); return $self; } sub check_options { my ($self, %options) = @_; $self->SUPER::check_options(%options); $self->change_macros(macros => [ 'unknown_sig_status', 'warning_sig_status', 'critical_sig_status', ]); } my $mapping = { avCmListSigGrpFarNode => { oid => '.1.3.6.1.4.1.6889.2.73.8.1.84.1.1.12' }, avCmStatusSigGrpGrpState => { oid => '.1.3.6.1.4.1.6889.2.73.8.1.85.1.1.4' }, }; sub manage_selection { my ($self, %options) = @_; $self->{sig} = {}; my $snmp_result = $options{snmp}->get_multiple_table( oids => [ { oid => $mapping->{avCmListSigGrpFarNode}->{oid} }, { oid => $mapping->{avCmStatusSigGrpGrpState}->{oid} }, ], return_type => 1, nothing_quit => 1 ); foreach my $oid (keys %$snmp_result) { next if ($oid !~ /^$mapping->{avCmStatusSigGrpGrpState}->{oid}\.(.*)$/); my $instance = $1; my $result = $options{snmp}->map_instance(mapping => $mapping, results => $snmp_result, instance => $instance); if (defined($self->{option_results}->{filter_sigid}) && $self->{option_results}->{filter_sigid} ne '' && $instance !~ /$self->{option_results}->{filter_sigid}/) { $self->{output}->output_add(long_msg => "skipping signaling group '" . $instance . "': no matching filter.", debug => 1); next; } $self->{sig}->{$instance} = { display => $instance, state => $result->{avCmStatusSigGrpGrpState}, far_node => defined($result->{avCmListSigGrpFarNode}) && $result->{avCmListSigGrpFarNode} ne '' ? $result->{avCmListSigGrpFarNode} : '-', }; } } 1; __END__ =head1 MODE Check trunks. =over 8 =item B<--filter-sigid> Filter signaling group instance (can be a regexp). =item B<--unknown-sig-status> Set unknown threshold for status. Can used special variables like: %{state}, %{far_node}, %{display} =item B<--warning-sig-status> Set warning threshold for status. Can used special variables like: %{state}, %{far_node}, %{display} =item B<--critical-sig-status> Set critical threshold for status (Default: '%{state} =~ /out-of-service/'). Can used special variables like: %{state}, %{far_node}, %{display} =back =cut
31.465409
159
0.613432
ed5ebe9f1e20aec484cc1fa9748312e961368a9b
132
t
Perl
t6/21-test.t
lablua/Perlito
97c296f63f395ce6a9aa3cac1baeeed076b753a3
[ "Artistic-2.0" ]
279
2015-01-10T22:22:27.000Z
2022-03-11T00:00:26.000Z
t6/21-test.t
lablua/Perlito
97c296f63f395ce6a9aa3cac1baeeed076b753a3
[ "Artistic-2.0" ]
38
2015-07-12T20:06:59.000Z
2022-02-01T09:23:58.000Z
t6/21-test.t
lablua/Perlito
97c296f63f395ce6a9aa3cac1baeeed076b753a3
[ "Artistic-2.0" ]
31
2015-02-18T14:55:57.000Z
2022-02-24T16:53:19.000Z
use v6; class Main { use Perlito6::Test; Perlito6::Test::plan 1; Perlito6::Test::ok( 1==1, "Perlito6::Test works"); }
14.666667
54
0.598485
ed760b50697abd1bacf4f2efb27ccf3205f49b54
42
pl
Perl
examples/prolog/onlyRules.pl
fs191/secure-logic-programming
f7d5a7770ba6f322a12d47ddecb7844ef8a8c066
[ "MIT" ]
null
null
null
examples/prolog/onlyRules.pl
fs191/secure-logic-programming
f7d5a7770ba6f322a12d47ddecb7844ef8a8c066
[ "MIT" ]
1
2020-11-17T13:23:49.000Z
2020-11-17T13:23:49.000Z
examples/prolog/onlyRules.pl
fs191/secure-logic-programming
f7d5a7770ba6f322a12d47ddecb7844ef8a8c066
[ "MIT" ]
1
2020-10-26T11:52:47.000Z
2020-10-26T11:52:47.000Z
f(X,Y) :- X > Y, X < 10. ?-f(10, 3).
7
11
0.285714
73dac3c2d9db56442a55755dba76c7eee6ee1ac3
1,341
al
Perl
Apps/CZ/BankingDocumentsLocalization/app/Src/TableExtensions/BankExportImportSetup.TableExt.al
waldo1001/ALAppExtensions
935155845bf45b631d1c34b6bcd5aec54308d50f
[ "MIT" ]
337
2019-05-07T06:04:40.000Z
2022-03-31T10:07:42.000Z
Apps/CZ/BankingDocumentsLocalization/app/Src/TableExtensions/BankExportImportSetup.TableExt.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
14,850
2019-05-07T06:04:27.000Z
2022-03-31T19:53:28.000Z
Apps/CZ/BankingDocumentsLocalization/app/Src/TableExtensions/BankExportImportSetup.TableExt.al
snu-development/ALAppExtensions
371a27fe48483be776642dde19483a87ae27289c
[ "MIT" ]
374
2019-05-09T10:08:14.000Z
2022-03-31T17:48:32.000Z
tableextension 31284 "Bank Export/Import Setup CZB" extends "Bank Export/Import Setup" { fields { field(11710; "Processing Report ID CZB"; Integer) { Caption = 'Processing Report ID'; TableRelation = AllObjWithCaption."Object ID" where("Object Type" = const(Report)); DataClassification = CustomerContent; trigger OnValidate() begin CalcFields("Processing Report Name CZB"); end; } field(11711; "Processing Report Name CZB"; Text[249]) { CalcFormula = lookup(AllObjWithCaption."Object Caption" where("Object Type" = const(Report), "Object ID" = field("Processing Report ID CZB"))); Caption = 'Processing Report Name'; Editable = false; FieldClass = FlowField; } field(11712; "Default File Type CZB"; Text[10]) { Caption = 'Default File Type'; DataClassification = CustomerContent; } } procedure GetFilterTextCZB(): Text var FileManagement: Codeunit "File Management"; FileFilterTok: Label '*.%1', Comment = '%1 = Default File Type', Locked = true; begin exit(FileManagement.GetToFilterText('', StrSubstNo(FileFilterTok, "Default File Type CZB"))); end; }
35.289474
155
0.590604
ed859afecaa714e2cf6cf5853824015c6f512ceb
343
t
Perl
example-perl-psgi/.cpanm/work/1459817744.11/Devel-StackTrace-AsHTML-0.15/t/release-podspell.t
NINGONDA/apcera
60ccb872a56566bde41594546ba4e97e0d73eae0
[ "MIT" ]
null
null
null
example-perl-psgi/.cpanm/work/1459817744.11/Devel-StackTrace-AsHTML-0.15/t/release-podspell.t
NINGONDA/apcera
60ccb872a56566bde41594546ba4e97e0d73eae0
[ "MIT" ]
null
null
null
example-perl-psgi/.cpanm/work/1459817744.11/Devel-StackTrace-AsHTML-0.15/t/release-podspell.t
NINGONDA/apcera
60ccb872a56566bde41594546ba4e97e0d73eae0
[ "MIT" ]
null
null
null
BEGIN { unless ($ENV{RELEASE_TESTING}) { require Test::More; Test::More::plan(skip_all => 'these tests are for release candidate testing'); } } use Test::More; use Test::Spelling; add_stopwords(<DATA>); set_spell_cmd("aspell -l en list"); all_pod_files_spelling_ok('lib'); __DATA__ Tatsuhiko Miyagawa Kazuho Matsuno Oku Tokuhiro
16.333333
82
0.725948
ed1ee424856728d8b43f64552aae1d06e632ea46
6,067
pm
Perl
lib/CIHM/Meta/Hammer2/Worker.pm
crkn-rcdr/CIHM-Meta
0c78a83ad049900b4aba060595c9002967fdee21
[ "Artistic-2.0", "Unlicense" ]
null
null
null
lib/CIHM/Meta/Hammer2/Worker.pm
crkn-rcdr/CIHM-Meta
0c78a83ad049900b4aba060595c9002967fdee21
[ "Artistic-2.0", "Unlicense" ]
54
2019-02-14T15:40:03.000Z
2022-02-22T20:27:38.000Z
lib/CIHM/Meta/Hammer2/Worker.pm
crkn-rcdr/CIHM-Meta
0c78a83ad049900b4aba060595c9002967fdee21
[ "Artistic-2.0", "Unlicense" ]
null
null
null
package CIHM::Meta::Hammer2::Worker; use strict; use Carp; use AnyEvent; use Try::Tiny; use JSON; use Config::General; use Log::Log4perl; use CIHM::Swift::Client; use CIHM::Meta::REST::cantaloupe; use CIHM::Meta::REST::access; use CIHM::Meta::REST::canvas; use CIHM::Meta::REST::internalmeta; use CIHM::Meta::Hammer2::Process; our $self; sub initworker { my $configpath = shift; our $self; AE::log debug => "Initworker ($$): $configpath"; $self = bless {}; Log::Log4perl->init_once("/etc/canadiana/tdr/log4perl.conf"); $self->{logger} = Log::Log4perl::get_logger("CIHM::TDR"); my %confighash = new Config::General( -ConfigFile => $configpath, )->getall; # Undefined if no <cantaloupe> config block if ( exists $confighash{cantaloupe} ) { $self->{cantaloupe} = new CIHM::Meta::REST::cantaloupe( url => $confighash{cantaloupe}{url}, jwt_secret => $confighash{cantaloupe}{password}, jwt_payload => '{"uids":[".*"]}', type => 'application/json', conf => $configpath, clientattrs => { timeout => 3600 }, ); } else { croak "Missing <cantaloupe> configuration block in config\n"; } # Undefined if no <access> config block if ( exists $confighash{access} ) { $self->{accessdb} = new CIHM::Meta::REST::access( server => $confighash{access}{server}, database => $confighash{access}{database}, type => 'application/json', conf => $configpath, clientattrs => { timeout => 3600 }, ); } else { croak "Missing <access> configuration block in config\n"; } # Undefined if no <canvas> config block if ( exists $confighash{canvas} ) { $self->{canvasdb} = new CIHM::Meta::REST::canvas( server => $confighash{canvas}{server}, database => $confighash{canvas}{database}, type => 'application/json', conf => $configpath, clientattrs => { timeout => 3600 }, ); } else { croak "Missing <canvas> configuration block in config\n"; } # Undefined if no <swift> config block if ( exists $confighash{swift} ) { my %swiftopt = ( furl_options => { timeout => 120 } ); foreach ( "server", "user", "password", "account", "furl_options" ) { if ( exists $confighash{swift}{$_} ) { $swiftopt{$_} = $confighash{swift}{$_}; } } $self->{swift} = CIHM::Swift::Client->new(%swiftopt); $self->{preservation_files} = $confighash{swift}{container}; $self->{access_metadata} = $confighash{swift}{access_metadata}; $self->{access_files} = $confighash{swift}{access_files}; } else { croak "No <swift> configuration block in " . $self->configpath . "\n"; } # Undefined if no <internalmeta2> config block if ( exists $confighash{internalmeta2} ) { $self->{internalmetadb} = new CIHM::Meta::REST::internalmeta( server => $confighash{internalmeta2}{server}, database => $confighash{internalmeta2}{database}, type => 'application/json', conf => $configpath, clientattrs => { timeout => 3600 }, ); } else { croak "Missing <internalmeta2> configuration block in config\n"; } } # Simple accessors for now -- Do I want to Moo? sub log { my $self = shift; return $self->{logger}; } sub swift { my $self = shift; return $self->{swift}; } sub cantaloupe { my $self = shift; return $self->{cantaloupe}; } sub accessdb { my $self = shift; return $self->{accessdb}; } sub canvasdb { my $self = shift; return $self->{canvasdb}; } sub internalmetadb { my $self = shift; return $self->{internalmetadb}; } sub warnings { my $warning = shift; our $self; my $noid = "unknown"; # Strip wide characters before trying to log ( my $stripped = $warning ) =~ s/[^\x00-\x7f]//g; if ($self) { $self->{message} .= $warning; $noid = $self->{noid}; $self->log->warn( $noid . ": $stripped" ); } else { say STDERR "$warning\n"; } } sub swing { my ( $noid, $configpath ) = @_; our $self; # Capture warnings local $SIG{__WARN__} = sub { &warnings }; if ( !$self ) { initworker($configpath); } # Debugging: http://lists.schmorp.de/pipermail/anyevent/2017q2/000870.html # $SIG{CHLD} = 'IGNORE'; $self->{noid} = $noid; $self->{message} = ''; $self->log->info("Processing $noid"); AE::log debug => "$noid Before ($$)"; my $status; # Handle and record any errors try { $status = JSON::true; new CIHM::Meta::Hammer2::Process( { noid => $noid, log => $self->log, swift => $self->swift, preservation_files => $self->{preservation_files}, access_metadata => $self->{access_metadata}, access_files => $self->{access_files}, cantaloupe => $self->cantaloupe, accessdb => $self->accessdb, canvasdb => $self->canvasdb, internalmetadb => $self->internalmetadb, } )->process; } catch { $status = JSON::false; $self->log->error("$noid: $_"); $self->{message} .= "Caught: " . $_; }; $self->postResults( $noid, $status, $self->{message} ); AE::log debug => "$noid After ($$)"; return ($noid); } sub postResults { my ( $self, $noid, $status, $message ) = @_; $self->accessdb->hammerResult( $noid, { "succeeded" => $status, "message" => $message, } ); } 1;
27.206278
80
0.524147
73fe29d08efdbbdce14083edd79ba8b5974a8d77
4,022
t
Perl
t/11-b2revolutejoint.t
PerlGameDev/Box2D-perl
aa2eeb27fd41360d12c6c0200518aa22ed421a97
[ "Artistic-1.0" ]
3
2018-06-22T14:31:27.000Z
2022-03-06T15:17:08.000Z
t/11-b2revolutejoint.t
PerlGameDev/Box2D-perl
aa2eeb27fd41360d12c6c0200518aa22ed421a97
[ "Artistic-1.0" ]
null
null
null
t/11-b2revolutejoint.t
PerlGameDev/Box2D-perl
aa2eeb27fd41360d12c6c0200518aa22ed421a97
[ "Artistic-1.0" ]
3
2017-10-23T16:05:59.000Z
2022-02-01T18:19:06.000Z
use strict; use warnings; use Box2D; use Test::More; my $gravity = Box2D::b2Vec2->new( 0.0, 0.0 ); my $world = Box2D::b2World->new( $gravity, 1 ); my ( $xA, $yA, $xB, $yB ) = ( 10.0, 20.0, 30.0, 40.0 ); my $bodyDefA = Box2D::b2BodyDef->new(); $bodyDefA->position->Set( $xA, $yA ); my $bodyA = $world->CreateBody($bodyDefA); my $circleA = Box2D::b2CircleShape->new(); $circleA->m_radius(50.0); $bodyA->CreateFixture( $circleA, 0.0 ); my $bodyDefB = Box2D::b2BodyDef->new(); $bodyDefB->position->Set( $xB, $yB ); $bodyDefB->type(Box2D::b2_dynamicBody); my $bodyB = $world->CreateBody($bodyDefB); my $circleB = Box2D::b2CircleShape->new(); $circleB->m_radius(50.0); $bodyB->CreateFixture( $circleB, 1.0 ); my $anchor = Box2D::b2Vec2->new( ( $xA + $xB ) / 2.0, ( $yA + $yB ) / 2.0 ); my $jointDef = Box2D::b2RevoluteJointDef->new(); ok( $jointDef, "new" ); isa_ok( $jointDef, "Box2D::b2RevoluteJointDef" ); $jointDef->Initialize( $bodyA, $bodyB, $anchor ); pass("Initialize"); is( $jointDef->localAnchorA->x, $anchor->x - $bodyA->GetWorldCenter->x, "get localAnchorA->x" ); is( $jointDef->localAnchorA->y, $anchor->y - $bodyA->GetWorldCenter->y, "get localAnchorA->y" ); is( $jointDef->localAnchorB->x, $anchor->x - $bodyB->GetWorldCenter->x, "get localAnchorB->x" ); is( $jointDef->localAnchorB->y, $anchor->y - $bodyB->GetWorldCenter->y, "get localAnchorB->y" ); my ($referenceAngle, $lowerAngle, $upperAngle, $motorSpeed, $maxMotorTorque ) = ( 0.5, 1.0, 2.0, 11.0, 13.0 ); $jointDef->referenceAngle($referenceAngle); pass("set referenceAngle"); is( $jointDef->referenceAngle, $referenceAngle, "get referenceAngle" ); $jointDef->enableLimit(1); pass("set enableLimit"); ok( $jointDef->enableLimit, "get enableLimit" ); $jointDef->enableLimit(0); ok( !$jointDef->enableLimit, "get enableLimit" ); $jointDef->enableLimit(1); $jointDef->lowerAngle($lowerAngle); pass("set lowerAngle"); is( $jointDef->lowerAngle, $lowerAngle, "get lowerAngle" ); $jointDef->upperAngle($upperAngle); pass("set upperAngle"); is( $jointDef->upperAngle, $upperAngle, "get upperAngle" ); $jointDef->enableMotor(1); pass("set enableMotor"); ok( $jointDef->enableMotor, "get enableMotor" ); $jointDef->enableMotor(0); ok( !$jointDef->enableMotor, "get enableMotor" ); $jointDef->enableMotor(1); $jointDef->motorSpeed($motorSpeed); pass("set motorSpeed"); is( $jointDef->motorSpeed, $motorSpeed, "get motorSpeed" ); $jointDef->maxMotorTorque($maxMotorTorque); pass("set maxMotorTorque"); is( $jointDef->maxMotorTorque, $maxMotorTorque, "get maxMotorTorque" ); my $joint = $world->CreateJoint($jointDef); ok( $joint, "Box2D::b2World->CreateJoint" ); isa_ok( $joint, "Box2D::b2Joint" ); bless $joint, "Box2D::b2RevoluteJoint"; isa_ok( $joint, "Box2D::b2RevoluteJoint" ); is( $joint->GetAnchorA->x, $anchor->x, "GetAnchorA->x" ); is( $joint->GetAnchorA->y, $anchor->y, "GetAnchorA->y" ); is( $joint->GetAnchorB->x, $anchor->x, "GetAnchorB->x" ); is( $joint->GetAnchorB->y, $anchor->y, "GetAnchorB->y" ); ok( $joint->IsLimitEnabled(), "IsLimitEnabled" ); $joint->EnableLimit(0); pass("EnableLimit"); ok( !$joint->IsLimitEnabled(), "IsLimitEnabled" ); $joint->EnableLimit(1); ok( $joint->IsLimitEnabled(), "IsLimitEnabled" ); is( $joint->GetLowerLimit(), $lowerAngle, "GetLowerLimit" ); is( $joint->GetUpperLimit(), $upperAngle, "GetUpperLimit" ); my ( $lowerLimit, $upperLimit ) = ( 1.0, 2.0 ); $joint->SetLimits( $lowerLimit, $upperLimit ); is( $joint->GetLowerLimit(), $lowerLimit, "GetLowerLimit" ); is( $joint->GetUpperLimit(), $upperLimit, "GetUpperLimit" ); ok( $joint->IsMotorEnabled(), "IsMotorEnabled" ); $joint->EnableMotor(0); pass("EnableMotor"); ok( !$joint->IsMotorEnabled(), "IsMotorEnabled" ); $joint->EnableMotor(1); ok( $joint->IsMotorEnabled(), "IsMotorEnabled" ); is( $joint->GetMotorSpeed(), $motorSpeed, "GetMotorSpeed" ); my $speed = 15.0; $joint->SetMotorSpeed($speed); pass("SetMotorSpeed"); is( $joint->GetMotorSpeed(), $speed, "GetMotorSpeed" ); done_testing;
30.70229
76
0.676032
ed91bb508aed78166f866b06eda90d29cd5fbdf1
408
pl
Perl
ex-07-01.pl
ology/MIDI-Perl-HOWTO
96a42505c1398470e78ff8c8609bdc6d221d63ac
[ "Artistic-2.0" ]
10
2020-11-29T16:30:40.000Z
2022-02-05T11:06:44.000Z
ex-07-01.pl
ology/MIDI-Perl-HOWTO
96a42505c1398470e78ff8c8609bdc6d221d63ac
[ "Artistic-2.0" ]
null
null
null
ex-07-01.pl
ology/MIDI-Perl-HOWTO
96a42505c1398470e78ff8c8609bdc6d221d63ac
[ "Artistic-2.0" ]
null
null
null
#!/usr/bin/env perl use strict; use warnings; use Data::Dumper::Compact qw(ddc); use Music::Scales qw(get_scale_MIDI); use Music::VoiceGen; my @pitches = ( get_scale_MIDI('C', 4, 'minor'), get_scale_MIDI('C', 5, 'minor'), ); my $voice = Music::VoiceGen->new( pitches => \@pitches, intervals => [qw(-4 -3 -2 -1 1 2 3 4)], ); my @notes = map { $voice->rand } 1 .. 8; print ddc(\@notes);
18.545455
43
0.60049
ed85d872bd0202eea5f1b0beb46f3f6d0879bc2b
15,308
pl
Perl
examples/crypto.pl
flub78/FTF
4303d3106608a5228e14bdeae363c7fdbc81eff5
[ "MIT" ]
null
null
null
examples/crypto.pl
flub78/FTF
4303d3106608a5228e14bdeae363c7fdbc81eff5
[ "MIT" ]
null
null
null
examples/crypto.pl
flub78/FTF
4303d3106608a5228e14bdeae363c7fdbc81eff5
[ "MIT" ]
null
null
null
# ------------------------------------------------------------------------ # Title: Cryptography example # # Source - <file:../script.pl.html> # # Abstract: # # This is a script template. It derives from the <Script> class, look # to the script class documentation for details. # # This example parse directories and files to count the number of # occurence of a given pattern. # # Place to customize are identified by a "To customize: comment" # # API Example: # Fill this section to demonstrate how to use the code. # # (Start code) # (end) # # Usage: # (Start code) # usage: perl ServerTemplate.pl [options] [filenames]* # -verbose flag, switch on verbose mode. # -help flag, display the online help. # -outputDirectory string, directory for outputs # (end) # # Output: # (Start code) # (end) # ------------------------------------------------------------------------ # To customize: replace the package name package ScriptTemplate; use 5.010; use strict; use lib "$ENV{'FTF'}/lib"; use vars qw($VERSION @ISA @EXPORT); use Exporter; use Script; # Assertions are on. use Carp::Assert; $VERSION = 1; @ISA = qw(Script); # To customize: add your own libraries use Data::Dumper; use ExecutionContext; use ScriptConfiguration; use Protocol::Utilities; use Digest::SHA1 qw(sha1 sha1_hex sha1_base64); use Crypt::CBC; use Crypt::Ctr; use Crypt::OpenSSL::AES; use IPC::Open2; use Openssl; use Crypt::OpenSSL::RSA; use Crypt::OpenSSL::Random; use Crypt::OpenSSL::DSA; use Crypt::OpenSSL::X509; use Crypt::DES_EDE3; # ------------------------------------------------------------------------ # routine: random_ex # # Example of random generation # ------------------------------------------------------------------------ sub random_ex { print "Pseudo random generation\n"; my $range = 100; srand(100); for ( my $i = 0 ; $i < 10 ; $i++ ) { my $random_number = int( rand($range) ); print $random_number . ", "; } print "\n"; srand(100); for ( my $i = 0 ; $i < 10 ; $i++ ) { my $random_number = int( rand($range) ); print $random_number . ", "; } print "\n" x 2; } # ------------------------------------------------------------------------ # routine: sha1_ex # # Example of SHA1 computation # ------------------------------------------------------------------------ sub sha1_ex { print "SHA1\n"; my $data = "Hello world"; $data = hexa2bin("0123456789ABCDEF"); $data = ("0123456789ABCDEF"); my $sha1 = sha1($data); my $sha1_hexa = bin2hexa($sha1); print "sha1 length " . length($sha1) . "\n"; print "sha1_hexa length " . length($sha1_hexa) . "\n"; print( "data = " . bin2hexa($data) . "\n" ); print( "sha1 = " . $sha1_hexa . "\n" ); print( "sha1_hex = " . sha1_hex($data) . "\n" ); print( "sha1_base64 = " . sha1_base64($data) . "\n" x 2 ); } # ------------------------------------------------------------------------ # routine: aes_ecb # # Example of AES 128 in ECB mode # ------------------------------------------------------------------------ sub aes_ecb_ex { print "AES-ecb\n"; my $plaintext = "0123456789ABCDEF"; my $key = hexa2bin("000102030405060708090A0B0C0D0E0F"); my $cipher = new Crypt::OpenSSL::AES($key); my $encrypted = $cipher->encrypt($plaintext); print "plaintext = " . $plaintext . "\n"; print "encrypted = " . bin2hexa($encrypted) . "\n"; print "decrypted = " . $cipher->decrypt($encrypted) . "\n"; } # ------------------------------------------------------------------------ # routine: aes_cbc # # Example of AES 128 in CBC mode # ------------------------------------------------------------------------ sub aes_cbc_ex { my $plaintext = "0123456789ABCDEF"; my $key = hexa2bin("000102030405060708090A0B0C0D0E0F"); print "AES-cbc\n"; my $iv = hexa2bin("00000000000000000000000000000000"); my $cbcCipher = Crypt::CBC->new( -literal_key => 1, -key => $key, -iv => $iv, -header => "none", -keysize => 16, -cipher => "Crypt::OpenSSL::AES" ); print "iv = " . bin2hexa( $cbcCipher->iv() ) . "\n"; print "key = " . bin2hexa( $cbcCipher->key() ) . "\n"; $plaintext .= $plaintext . $plaintext; print "plaintext = " . $plaintext . "\n"; my $encrypted = $cbcCipher->encrypt($plaintext); print "encrypted = " . bin2hexa($encrypted) . "\n"; print "decrypted = " . $cbcCipher->decrypt($encrypted) . "\n"; } sub image { my $key = shift; my $res = ""; while ( length($key) > 16 ) { my $start = substr( $key, 0, 16 ); $res .= bin2hexa($start) . " "; $key = substr( $key, 16, length($key) - 16 ); } return $res . bin2hexa($key); } # ------------------------------------------------------------------------ # routine: aes_ctr_ex # # Example of AES 128 in CTR mode # ------------------------------------------------------------------------ sub aes_ctr_ex { print "\nAES-ctr\n"; my $plaintext = hexa2bin("00000000000000000000000000000000"); my $key = hexa2bin("5724C47024A1D44DC50C866FC59C21F7"); $key = hexa2bin("D17955D6B0F887D116FA635FF8D1024C"); my $iv = hexa2bin("00000000000000000000000000000000"); my $cipher = new Crypt::Ctr( $key, "Crypt::OpenSSL::AES" ); my $aes = new Crypt::OpenSSL::AES($key); my $ciphertext2 = $aes->encrypt($plaintext); print "ciphertext = " . image($ciphertext2) . "\n"; $plaintext = $plaintext x 4; my $ciphertext = $cipher->encrypt($plaintext); print "\nciphertext = " . image($ciphertext) . "\n"; $ciphertext = $cipher->encrypt($plaintext); print "\nciphertext a second time = " . image($ciphertext) . "\n"; $cipher->reset(); $ciphertext = $cipher->encrypt($plaintext); print "\nciphertext after reset = " . image($ciphertext) . "\n"; # Byte by byte # Warning! I had the erroneous assumption that with a stream cipher, the concatenation # of block of ciphered text was equal to the cipher of the concatenated block. It is wrong # and it even seems the different cryptographic libraries have different behaviors in this # case. So encryption have to be done for the whole block. # So the following test is useless # $ciphertext = ""; # for (my $i = 0; $i < length($plaintext); $i++) { # $ciphertext .= $cipher->encrypt(substr($plaintext, $i, 1)); # } # print "\nciphertext byte by byte = " . image($ciphertext) . "\n"; $cipher = new Crypt::Ctr( $key, "Crypt::OpenSSL::AES", 4 ); $ciphertext = $cipher->encrypt($plaintext); print "\nciphertext initialized at 4 = " . image($ciphertext) . "\n"; $cipher->reset(4); my $clear = $cipher->decrypt($ciphertext); print "\nclear = " . image($clear) . "\n"; } # ------------------------------------------------------------------------ # routine: rsa_ex # # Example of RSA # ------------------------------------------------------------------------ sub rsa_ex { print "\nRSA\n"; my ( $fd, $good_entropy ); open( $fd, "</dev/random" ) or die("cannot open /dev/random"); binmode( $fd, ":raw" ); read( $fd, $good_entropy, 16 ); close($fd); print "entropy=" . bin2hexa($good_entropy) . "\n"; Crypt::OpenSSL::Random::random_seed($good_entropy); Crypt::OpenSSL::RSA->import_random_seed(); print "Generation of a private/public key pair\n"; # ------------------------------------------------ my $rsa = Crypt::OpenSSL::RSA->generate_key(1024); # or # $rsa = Crypt::OpenSSL::RSA->generate_key( 1024, $prime ); print "private key is:\n", $rsa->get_private_key_string(), "\n"; print "public key (in PKCS1 format) is:\n", $rsa->get_public_key_string(), "\n"; print "public key (in X509 format) is:\n", $rsa->get_public_key_x509_string(); my $private = "-----BEGIN RSA PRIVATE KEY----- MIICXQIBAAKBgQC6/teAe7FfDKNHi+YEhKGujwKypcCrDhja/H0tpUlx0pj14jR8 9w7Bs1IYHN+3Rl2KcB0F4kxtZi4fFeoa2YDV2A1baX2FRcIDOePEkWcFpxfA+v8w CprKPgRJZTxe/CgtKjtKYxSpHtv2++pgH5UQ2eZIUyIFOsZEtWZOCk2YKwIDAQAB AoGAVzUqg70sB0v5ihBwgYLpdGM1uuMaa6vzY42FQ5hmHDM/Ks0H9Y+yzhs3Gg+9 NdgXH80RfAEB67NPpyetOkBdmJE1b6mGwa9dZ86xNiTDw4izJKKNryIOQeWrrjSk 7KxEca2ISHP9yCwhLDsXOymH7zYYzruPbtmiH/P51RYxiuECQQDhCZ+eDMieyc4X EbzlkaOv7e/cm758rS34Vtbbh3nCf7cMR/zvgFA9TYJw67S8r7QjeYtNuoEZnflC yHJ1cbTPAkEA1LlIFRggeYvl1R4K1maEZzXENKYZ8eyjpL9FtSJoP0+PdmqopUeo CKTMjeoDMUjtoa+ateHq6MNNTmr9llg15QJBAMbDNj1l8yj0+9e6bgqiiV5RnWNQ GH6Mg6buJJX/4dad8XKiftCXl8edl1HfjmJ+GnCe4SCFU5PpyQhofVgoV1cCQQDL SOjWp8DZBtUzbctDiqK7EwmWmqkupUrZNKSD7gabggeCTXkuwaSV5g9JCznTznKw 0eTSLbxUhdcJunruQwv1AkA0T3ywLpoJTk/bf8nBK7jtCe2jVvSltv7CORkZk78i +5YMlLgv65w2t6vcI8/qiUok3tluaWlwAqueS8+YDVI1 -----END RSA PRIVATE KEY-----"; my $public = "-----BEGIN RSA PUBLIC KEY----- MIGJAoGBALr+14B7sV8Mo0eL5gSEoa6PArKlwKsOGNr8fS2lSXHSmPXiNHz3DsGz Uhgc37dGXYpwHQXiTG1mLh8V6hrZgNXYDVtpfYVFwgM548SRZwWnF8D6/zAKmso+ BEllPF78KC0qO0pjFKke2/b76mAflRDZ5khTIgU6xkS1Zk4KTZgrAgMBAAE= -----END RSA PUBLIC KEY-----"; my $plaintext = "The quick brown fox jumps over the lazy dog"; # $plaintext = $plaintext x 8; print "plain text: " . " length=" . length($plaintext) . ", text = " . $plaintext . "\n"; # Encrypt a message using the public key my $rsa_pub = Crypt::OpenSSL::RSA->new_public_key($public); # $rsa_pub->use_sslv23_padding(); # use_pkcs1_oaep_padding is the default $rsa_pub->use_pkcs1_padding(); $rsa_pub->use_md5_hash(); my $ciphertext = $rsa_pub->encrypt($plaintext); print "cipher text: length=" . length($ciphertext) . "\n" . bin2hexa($ciphertext) . "\n"; # Decrypt it using the private key my $rsa_priv = Crypt::OpenSSL::RSA->new_private_key($private); $rsa_priv->use_pkcs1_padding(); $rsa_priv->use_md5_hash(); # use_sha1_hash is the default $plaintext = $rsa_priv->decrypt($ciphertext); print "plain text again = " . $plaintext . "\n"; # Sign the message my $signature = $rsa_priv->sign($plaintext); print "signature = " . length($signature) . "\n" . bin2hexa($signature) . "\n"; if ( $rsa_priv->verify( $plaintext, $signature ) ) { print "Signed correctly\n"; } else { print "bad signature\n"; } # Encrypt with private, decrypt with public $ciphertext = $rsa_priv->private_encrypt($plaintext); print "cipher text = " . length($ciphertext) . "\n" . bin2hexa($ciphertext) . "\n"; my $bin = $rsa_pub->public_decrypt($ciphertext); print "(clear again) $bin\n"; if ( $rsa_pub->verify( $bin, $signature ) ) { print "Signed correctly\n"; } else { print "bad signature\n"; } } # ------------------------------------------------------------------------ # routine: rsa_ex # # Example of DSA # ------------------------------------------------------------------------ sub dsa_ex { print "\nDSA\n"; my $dsa = Crypt::OpenSSL::DSA->generate_parameters(1024); $dsa->generate_key; $dsa->write_pub_key("pub.txt"); $dsa = Crypt::OpenSSL::DSA->read_pub_key("pub.txt"); $dsa->write_priv_key("priv.txt"); $dsa->write_params("params.txt"); my $pemfile = "cryptotestkey-cert.pem"; $pemfile = "pub.txt"; my $cmd = "cat $pemfile;"; print "reading $pemfile $cmd\n"; `$cmd`; $dsa = Crypt::OpenSSL::DSA->read_pub_key($pemfile); if ($@) { die "error $@"; } print Dumper($dsa); return; ( -e $pemfile ) or die "Cannot find $pemfile"; my $dsa_priv = Crypt::OpenSSL::DSA->read_priv_key($pemfile); print Dumper($dsa_priv); my $dsa_pub = Crypt::OpenSSL::DSA->read_pub_key($pemfile); if ($@) { die "error $@"; } print Dumper($dsa_pub); # c key from certificate = " . bin2hexa($pub_key) . "\n"; } # ------------------------------------------------------------------------ # routine: rsa_ex # # Example of DSA # ------------------------------------------------------------------------ sub x509_ex { print "\nX509\n"; my $pemfile = "cryptotestkey-cert.pem"; my $x509 = Crypt::OpenSSL::X509->new_from_file($pemfile); print "pubkey=" . $x509->pubkey() . "\n"; print "subject=" . $x509->subject() . "\n"; print "issuer=" . $x509->issuer() . "\n"; print "email=". $x509->email() . "\n"; print "hash=" . $x509->hash() . "\n"; print "notBefore=" . $x509->notBefore() . "\n"; print "notAfter=" . $x509->notAfter() . "\n"; print "modulus=" . $x509->modulus() . "\n"; # print $x509->exponent() . "\n"; print "fingerprint_sha1=" . $x509->fingerprint_sha1() . "\n"; print "fingerprint_md5=" . $x509->fingerprint_md5() . "\n"; # print "fingerprint_md2=" . $x509->fingerprint_md2() . "\n"; print "as_string=" . $x509->as_string(Crypt::OpenSSL::X509::FORMAT_TEXT) . "\n"; my $pubkey = $x509->pubkey(); print "pubkey = $pubkey\n"; my $rsa_pub = Crypt::OpenSSL::RSA->new_public_key($pubkey); print Dumper($rsa_pub); } # ------------------------------------------------------------------------ # routine: tdes # # Example of TDES # ------------------------------------------------------------------------ sub tdes { say "TDES"; my $clear = hexa2bin("CC0200CE0002181A"); my $key16 = hexa2bin("DE1A3AA37229FF4EB9B1AB04ECFC7D53"); my $key24 = hexa2bin("DE1A3AA37229FF4EB9B1AB04ECFC7D53DE1A3AA37229FF4E"); my $ede3 = Crypt::DES_EDE3->new($key24); say ("clear=" . bin2hexa($clear)); say ("TDES key =" . bin2hexa($key24)); say ("length=" . length($clear)); my $encrypted = $ede3->encrypt($clear); say("encrypted=" . bin2hexa($encrypted)); my $clear2 = $ede3->decrypt($encrypted); say ("decrypted=" . bin2hexa($clear2)); } # ------------------------------------------------------------------------ # routine: run # # Scrip main method. It is an example which recursively parse a # set of directories and apply a treatement to each file. # To customize: # ------------------------------------------------------------------------ sub run { my $Self = shift; my $name = ExecutionContext::basename(); print "Hello I am a cryptographic example\n\n"; $Self->info("starting $name"); assert( $name ne "" ); tdes(); return; random_ex(); sha1_ex(); aes_ecb_ex(); aes_cbc_ex(); aes_ctr_ex(); dsa_ex(); x509_ex(); rsa_ex(); $Self->info("$name is completed"); } # ------------------------------------------------------------------------ # On line help and options. # The full online help is the catenation of the header, # the parameters description and the footer. Parameters description # is automatically computed. # To customize: you can remove help specification, remove the # configuration file, remove additional parameters and even remove # everything related to configuration. my $help_header = ' Script template. usage: perl ScriptTemplate.pl [options]'; my $help_footer = " Exemple: perl ScriptTemplate.pl -help perl ScriptTemplate.pl -pattern 'o customize' my_script.pl "; # If you specify a configuration file, it must exist. my $configFile = ExecutionContext::configFile(); my $config = new ScriptConfiguration( 'header' => $help_header, 'footer' => $help_footer, 'scheme' => SCRIPT, 'parameters' => { pattern => { type => "string", description => "pattern to search", default => "pattern" }, fail => { type => "flag", description => "force some assertions to fail", } }, ); # create and run the script # To customize: replace by your package name my $script = new ScriptTemplate( pattern => $config->value('pattern') ); $script->{'fail'} = $config->value('fail'); $script->run();
29.609284
90
0.58329
73e6134fd7c9ef676de7ae8ee0c1a88e6fb52d6a
19,781
t
Perl
debian/modules/http-lua/t/120-re-find.t
Metztli/debian-modsecurity-nginx-connector
1993c8c9b1549915702d0de8df12d000673a9de0
[ "BSD-2-Clause" ]
16
2018-06-19T13:44:06.000Z
2021-07-06T02:39:12.000Z
debian/modules/http-lua/t/120-re-find.t
Metztli/debian-modsecurity-nginx-connector
1993c8c9b1549915702d0de8df12d000673a9de0
[ "BSD-2-Clause" ]
1
2019-03-07T09:15:47.000Z
2019-03-10T11:23:14.000Z
debian/modules/http-lua/t/120-re-find.t
Metztli/debian-modsecurity-nginx-connector
1993c8c9b1549915702d0de8df12d000673a9de0
[ "BSD-2-Clause" ]
9
2018-06-19T15:04:13.000Z
2021-07-06T02:39:17.000Z
# vim:set ft= ts=4 sw=4 et fdm=marker: use Test::Nginx::Socket::Lua; #worker_connections(1014); #master_on(); #workers(2); #log_level('warn'); repeat_each(2); plan tests => repeat_each() * (blocks() * 3 + 1); #no_diff(); no_long_string(); run_tests(); __DATA__ === TEST 1: sanity --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9]+)", "jo") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) end ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 8 to: 11 matched: 1234 --- no_error_log [error] === TEST 2: empty matched string --- config location /re { content_by_lua ' local s = "hello, world" local from, to, err = ngx.re.find(s, "[0-9]*") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) end ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 1 to: 0 matched: --- no_error_log [error] === TEST 3: multiple captures (with o) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([a-z]+).*?([0-9]{2})[0-9]+", "o") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 1 to: 11 matched: hello, 1234 --- no_error_log [error] === TEST 4: not matched --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "foo") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body not matched. --- no_error_log [error] === TEST 5: case sensitive by default --- config location /re { content_by_lua ' local from = ngx.re.find("hello, 1234", "HELLO") if from then ngx.say(from) else ngx.say("not matched.") end '; } --- request GET /re --- response_body not matched. --- no_error_log [error] === TEST 6: case insensitive --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "HELLO", "i") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 5 matched: hello --- no_error_log [error] === TEST 7: UTF-8 mode --- config location /re { content_by_lua ' local s = "hello章亦春" local from, to, err = ngx.re.find(s, "HELLO.{2}", "iu") if not from then ngx.say("FAIL: ", err) return end ngx.say(string.sub(s, from, to)) '; } --- request GET /re --- response_body_like chop ^(?:FAIL: bad argument \#2 to '\?' \(pcre_compile\(\) failed: this version of PCRE is not compiled with PCRE_UTF8 support in "HELLO\.\{2\}" at "HELLO\.\{2\}"\)|hello章亦)$ --- no_error_log [error] === TEST 8: multi-line mode (^ at line head) --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, "^world", "m") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 7 to: 11 matched: world --- no_error_log [error] === TEST 9: multi-line mode (. does not match \n) --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, ".*", "m") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 5 matched: hello --- no_error_log [error] === TEST 10: single-line mode (^ as normal) --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, "^world", "s") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body not matched. --- no_error_log [error] === TEST 11: single-line mode (dot all) --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, ".*", "s") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 11 matched: hello world --- no_error_log [error] === TEST 12: extended mode (ignore whitespaces) --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, "\\\\w \\\\w", "x") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 2 matched: he --- no_error_log [error] === TEST 13: bad pattern --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, "(abc") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) else ngx.say("not matched.") end end '; } --- request GET /re --- response_body error: pcre_compile() failed: missing ) in "(abc" --- no_error_log [error] === TEST 14: bad option --- config location /re { content_by_lua ' local s = "hello\\nworld" local from, to, err = ngx.re.find(s, ".*", "H") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched.") end '; } --- request GET /re --- response_body_like: 500 Internal Server Error --- error_code: 500 --- error_log unknown flag "H" === TEST 15: anchored match (failed) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9]+)", "a") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched.") end '; } --- request GET /re --- response_body not matched. --- no_error_log [error] === TEST 16: anchored match (succeeded) --- config location /re { content_by_lua ' local s = "1234, hello" local from, to, err = ngx.re.find(s, "([0-9]+)", "a") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 4 matched: 1234 --- no_error_log [error] === TEST 17: match with ctx but no pos --- config location /re { content_by_lua ' local ctx = {} local from, to = ngx.re.find("1234, hello", "([0-9]+)", "", ctx) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("pos: ", ctx.pos) else ngx.say("not matched!") ngx.say("pos: ", ctx.pos) end '; } --- request GET /re --- response_body from: 1 to: 4 pos: 5 --- no_error_log [error] === TEST 18: match with ctx and a pos --- config location /re { content_by_lua ' local ctx = { pos = 3 } local from, to, err = ngx.re.find("1234, hello", "([0-9]+)", "", ctx) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("pos: ", ctx.pos) else ngx.say("not matched!") ngx.say("pos: ", ctx.pos) end '; } --- request GET /re --- response_body from: 3 to: 4 pos: 5 --- no_error_log [error] === TEST 19: named subpatterns w/ extraction --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "(?<first>[a-z]+), [0-9]+") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched.") end '; } --- request GET /re --- response_body from: 1 to: 11 matched: hello, 1234 --- no_error_log [error] === TEST 20: bad UTF-8 --- config location = /t { content_by_lua ' local target = "你好" local regex = "你好" local from, to, err = ngx.re.find(string.sub(target, 1, 4), regex, "u") if err then ngx.say("error: ", err) return end if m then ngx.say("matched: ", from) else ngx.say("not matched") end '; } --- request GET /t --- response_body_like chop ^error: pcre_exec\(\) failed: -10$ --- no_error_log [error] === TEST 21: UTF-8 mode without UTF-8 sequence checks --- config location /re { content_by_lua ' local s = "你好" local from, to, err = ngx.re.find(s, ".", "U") if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else ngx.say("not matched.") end '; } --- stap probe process("$LIBPCRE_PATH").function("pcre_compile") { printf("compile opts: %x\n", $options) } probe process("$LIBPCRE_PATH").function("pcre_exec") { printf("exec opts: %x\n", $options) } --- stap_out compile opts: 800 exec opts: 2000 --- request GET /re --- response_body from: 1 to: 3 matched: 你 --- no_error_log [error] === TEST 22: just hit match limit --- http_config lua_regex_match_limit 5000; --- config location /re { content_by_lua_file html/a.lua; } --- user_files >>> a.lua local re = [==[(?i:([\s'\"`´’‘\(\)]*)?([\d\w]+)([\s'\"`´’‘\(\)]*)?(?:=|<=>|r?like|sounds\s+like|regexp)([\s'\"`´’‘\(\)]*)?\2|([\s'\"`´’‘\(\)]*)?([\d\w]+)([\s'\"`´’‘\(\)]*)?(?:!=|<=|>=|<>|<|>|\^|is\s+not|not\s+like|not\s+regexp)([\s'\"`´’‘\(\)]*)?(?!\6)([\d\w]+))]==] s = string.rep([[ABCDEFG]], 10) local start = ngx.now() local from, to, err = ngx.re.find(s, re, "o") --[[ ngx.update_time() local elapsed = ngx.now() - start ngx.say(elapsed, " sec elapsed.") ]] if not from then if err then ngx.say("error: ", err) return end ngx.say("failed to match.") return end --- request GET /re --- response_body error: pcre_exec() failed: -8 --- no_error_log [error] === TEST 23: just not hit match limit --- http_config lua_regex_match_limit 5100; --- config location /re { content_by_lua_file html/a.lua; } --- user_files >>> a.lua local re = [==[(?i:([\s'\"`´’‘\(\)]*)?([\d\w]+)([\s'\"`´’‘\(\)]*)?(?:=|<=>|r?like|sounds\s+like|regexp)([\s'\"`´’‘\(\)]*)?\2|([\s'\"`´’‘\(\)]*)?([\d\w]+)([\s'\"`´’‘\(\)]*)?(?:!=|<=|>=|<>|<|>|\^|is\s+not|not\s+like|not\s+regexp)([\s'\"`´’‘\(\)]*)?(?!\6)([\d\w]+))]==] s = string.rep([[ABCDEFG]], 10) local start = ngx.now() local from, to, err = ngx.re.find(s, re, "o") --[[ ngx.update_time() local elapsed = ngx.now() - start ngx.say(elapsed, " sec elapsed.") ]] if not from then if err then ngx.say("error: ", err) return end ngx.say("failed to match") return end --- request GET /re --- response_body failed to match --- no_error_log [error] === TEST 24: specify the group (1) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])([0-9]+)", "jo", nil, 1) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) end ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 8 to: 8 matched: 1 --- no_error_log [error] === TEST 25: specify the group (0) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])([0-9]+)", "jo", nil, 0) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) end ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 8 to: 11 matched: 1234 --- no_error_log [error] === TEST 26: specify the group (2) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])([0-9]+)", "jo", nil, 2) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) end ngx.say("not matched!") end '; } --- request GET /re --- response_body from: 9 to: 11 matched: 234 --- no_error_log [error] === TEST 27: specify the group (3) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])([0-9]+)", "jo", nil, 3) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched!") end '; } --- request GET /re --- response_body error: nth out of bound --- no_error_log [error] === TEST 28: specify the group (4) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])([0-9]+)", "jo", nil, 4) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched!") end '; } --- request GET /re --- response_body error: nth out of bound --- no_error_log [error] === TEST 29: nil submatch (2nd) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "([0-9])|(hello world)", "jo", nil, 2) if from or to then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched!") end '; } --- request GET /re --- response_body not matched! --- no_error_log [error] === TEST 30: nil submatch (1st) --- config location /re { content_by_lua ' local s = "hello, 1234" local from, to, err = ngx.re.find(s, "(hello world)|([0-9])", "jo", nil, 1) if from or to then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("matched: ", string.sub(s, from, to)) else if err then ngx.say("error: ", err) return end ngx.say("not matched!") end '; } --- request GET /re --- response_body not matched! --- no_error_log [error] === TEST 31: match with ctx and a pos (anchored by \G) --- config location /re { content_by_lua ' local ctx = { pos = 3 } local from, to, err = ngx.re.find("1234, hello", [[(\G[0-9]+)]], "", ctx) if from then ngx.say("from: ", from) ngx.say("to: ", to) ngx.say("pos: ", ctx.pos) else ngx.say("not matched!") ngx.say("pos: ", ctx.pos) end '; } --- request GET /re --- response_body from: 3 to: 4 pos: 5 --- no_error_log [error]
21.501087
266
0.446085
73e3bcd22f48401cbbe5873f4856055fd170cb41
1,762
pm
Perl
perl5/lib/perl5/HTML/FormHandler/Moose/Role.pm
jinnks/printevolve
8c54f130000cd6ded290f5905bdc2093d9f264da
[ "Apache-2.0" ]
null
null
null
perl5/lib/perl5/HTML/FormHandler/Moose/Role.pm
jinnks/printevolve
8c54f130000cd6ded290f5905bdc2093d9f264da
[ "Apache-2.0" ]
null
null
null
perl5/lib/perl5/HTML/FormHandler/Moose/Role.pm
jinnks/printevolve
8c54f130000cd6ded290f5905bdc2093d9f264da
[ "Apache-2.0" ]
null
null
null
package HTML::FormHandler::Moose::Role; # ABSTRACT: to add sugar to roles $HTML::FormHandler::Moose::Role::VERSION = '0.40068'; use Moose::Role; use Moose::Exporter; Moose::Exporter->setup_import_methods( with_caller => [ 'has_field', 'has_block', 'apply' ], also => 'Moose::Role', ); sub init_meta { my $class = shift; my %options = @_; Moose::Role->init_meta(%options); my $meta = Moose::Util::MetaRole::apply_metaroles( for => $options{for_class}, role_metaroles => { role => ['HTML::FormHandler::Meta::Role'] } ); return $meta; } sub has_field { my ( $class, $name, %options ) = @_; $class->meta->add_to_field_list( { name => $name, %options } ); } sub has_block { my ( $class, $name, %options ) = @_; $class->meta->add_to_block_list( { name => $name, %options } ); } sub apply { my ( $class, $arrayref ) = @_; $class->meta->add_to_apply_list( @{$arrayref} ); } use namespace::autoclean; 1; __END__ =pod =encoding UTF-8 =head1 NAME HTML::FormHandler::Moose::Role - to add sugar to roles =head1 VERSION version 0.40068 =head1 SYNOPSIS Enables the use of field specification sugar (has_field) in roles. Use this module instead of C< use Moose::Role; > package MyApp::Form::Foo; use HTML::FormHandler::Moose::Role; has_field 'username' => ( type => 'Text', ... ); has_field 'something_else' => ( ... ); no HTML::FormHandler::Moose::Role; 1; =head1 AUTHOR FormHandler Contributors - see HTML::FormHandler =head1 COPYRIGHT AND LICENSE This software is copyright (c) 2017 by Gerda Shank. This is free software; you can redistribute it and/or modify it under the same terms as the Perl 5 programming language system itself. =cut
20.729412
71
0.646992
ed31330e7323e11090ceb4a347890e95fd3cf992
1,898
pm
Perl
auto-lib/Paws/WorkMail/Member.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
164
2015-01-08T14:58:53.000Z
2022-02-20T19:16:24.000Z
auto-lib/Paws/WorkMail/Member.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
348
2015-01-07T22:08:38.000Z
2022-01-27T14:34:44.000Z
auto-lib/Paws/WorkMail/Member.pm
0leksii/aws-sdk-perl
b2132fe3c79a06fd15b6137e8a0eb628de722e0f
[ "Apache-2.0" ]
87
2015-04-22T06:29:47.000Z
2021-09-29T14:45:55.000Z
# Generated by default/object.tt package Paws::WorkMail::Member; use Moose; has DisabledDate => (is => 'ro', isa => 'Str'); has EnabledDate => (is => 'ro', isa => 'Str'); has Id => (is => 'ro', isa => 'Str'); has Name => (is => 'ro', isa => 'Str'); has State => (is => 'ro', isa => 'Str'); has Type => (is => 'ro', isa => 'Str'); 1; ### main pod documentation begin ### =head1 NAME Paws::WorkMail::Member =head1 USAGE This class represents one of two things: =head3 Arguments in a call to a service Use the attributes of this class as arguments to methods. You shouldn't make instances of this class. Each attribute should be used as a named argument in the calls that expect this type of object. As an example, if Att1 is expected to be a Paws::WorkMail::Member object: $service_obj->Method(Att1 => { DisabledDate => $value, ..., Type => $value }); =head3 Results returned from an API call Use accessors for each attribute. If Att1 is expected to be an Paws::WorkMail::Member object: $result = $service_obj->Method(...); $result->Att1->DisabledDate =head1 DESCRIPTION The representation of a user or group. =head1 ATTRIBUTES =head2 DisabledDate => Str The date indicating when the member was disabled from Amazon WorkMail use. =head2 EnabledDate => Str The date indicating when the member was enabled for Amazon WorkMail use. =head2 Id => Str The identifier of the member. =head2 Name => Str The name of the member. =head2 State => Str The state of the member, which can be ENABLED, DISABLED, or DELETED. =head2 Type => Str A member can be a user or group. =head1 SEE ALSO This class forms part of L<Paws>, describing an object used in L<Paws::WorkMail> =head1 BUGS and CONTRIBUTIONS The source code is located here: L<https://github.com/pplu/aws-sdk-perl> Please report bugs to: L<https://github.com/pplu/aws-sdk-perl/issues> =cut
20.857143
102
0.692835
ed45f1547f221e7df75a3623119155db5bb01230
4,425
pl
Perl
src/perl/FileConversionService/bin/fileconverter-service.pl
gaybro8777/CiteSeerX
49ecb503fb1ced8e2c2e94c3e100e5d4dc410ea6
[ "Apache-2.0" ]
108
2015-01-05T09:22:50.000Z
2022-03-15T23:59:53.000Z
src/perl/FileConversionService/bin/fileconverter-service.pl
gaybro8777/CiteSeerX
49ecb503fb1ced8e2c2e94c3e100e5d4dc410ea6
[ "Apache-2.0" ]
26
2015-01-04T10:35:53.000Z
2021-11-01T04:41:19.000Z
src/perl/FileConversionService/bin/fileconverter-service.pl
gaybro8777/CiteSeerX
49ecb503fb1ced8e2c2e94c3e100e5d4dc410ea6
[ "Apache-2.0" ]
48
2015-01-16T02:03:48.000Z
2022-03-15T23:59:55.000Z
#!/opt/ActivePerl-5.8/bin/perl # # Copyright 2007 Penn State University # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # # Starts a web service using SOAP::Lite that handles requests # for file conversion. For message details, see the WSDL file # in the wsdl/ directory of the FileConverter distribution. # # Input messages must include a pointer to the location of a # file to be converted. There must be local access to this # file via a standard or networked file system. # # Isaac Councill, 09/07/07 # exit(0) if fork; use strict; #use SOAP::Lite +trace=>'debug'; use SOAP::Transport::HTTP; use FindBin; use lib "$FindBin::Bin/../lib"; use FileConverter::Config; use Log::Log4perl qw(get_logger :levels); $SIG{'PIPE'} = $SIG{'INT'} = 'IGNORE'; open (STDERR, ">>$FindBin::Bin/../fileconv.err"); my $serverURL = $FileConverter::Config::serverURL; my $serverPort = $FileConverter::Config::serverPort; my $daemon = SOAP::Transport::HTTP::Daemon ->new ('LocalAddr' => $serverURL, 'LocalPort' => $serverPort) ->dispatch_to('FileConverter'); ## Initialize Logging my $logger = get_logger("FileConverter"); $logger->level($INFO); my $appender = Log::Log4perl::Appender ->new("Log::Dispatch::File", filename => "$FindBin::Bin/../fileconv.log", mode => "append", ); my $layout = Log::Log4perl::Layout::PatternLayout ->new("%d %p> %F{1}:%L - %m%n"); $appender->layout($layout); $logger->add_appender($appender); $logger->info("Server started at ".$daemon->url); $daemon->handle; ## # Service Module # # Passes control to the FileConverter::Controller module and provides # a SOAP wrapping for the response. # ## package FileConverter; use FindBin; use lib "$FindBin::Bin/../lib"; use FileConverter::Controller; use FileConverter::Config; use Time::HiRes qw(tv_interval gettimeofday); use Log::Log4perl qw(get_logger); sub extractText { my ($class, $filePath, $repositoryID) = @_; my $logger = get_logger("FileConverter"); my $t0 = [gettimeofday]; my $repositoryLocation; if ($repositoryID ne "LOCAL") { $repositoryLocation = $FileConverter::Config::repositories{$repositoryID}; if (!defined $repositoryLocation) { my $msg = "Unknown repository: $repositoryID"; $logger->error($msg); die_with_fileconvfault('Sender', $msg); } else { $filePath = "$repositoryLocation/$filePath"; } } if (! -e $filePath) { my $msg = "File does not exist: $filePath"; $logger->error($msg); die_with_fileconvfault('Sender', $msg); } if (-d $filePath) { my $msg = "Specified file is a directory: $filePath"; $logger->error($msg); die_with_fileconvfault('Sender', $msg); } my ($status, $msg, $textFilePath, $rTrace) = FileConverter::Controller::extractText($filePath); if ($status > 0) { my $relTextPath = makeRelative($textFilePath, $repositoryLocation); my $trace = join ",", @$rTrace; my $elapsed = tv_interval($t0, [gettimeofday]); $logger->info("extractText: $elapsed"); my $uri = $FileConverter::Config::URI; return SOAP::Data->name('filePath' => $relTextPath), SOAP::Data->name('conversionTrace' => $trace); } else { $logger->error($msg); die_with_fileconvfault('Receiver', $msg); } } # extractText sub die_with_fileconvfault { my ($faultcode, $msg) = @_; my $uri = $FileConverter::Config::URI; my $obj = SOAP::Data ->name('FileConversionFault' => \SOAP::Data->value(SOAP::Data->name('message' => $msg))) ->uri($uri); my $serverURL = $FileConverter::Config::serverURL; die SOAP::Fault ->faultcode($faultcode) ->faultstring($msg) ->faultdetail($obj) ->faultactor($serverURL); } # die_with_fileconvfault sub makeRelative { my ($fpath, $repLoc) = @_; if (!defined $repLoc || $repLoc =~ /^\s*$/) { return $fpath; } my $newPath = substr $fpath, length($repLoc); $newPath =~ s/^\/+//; return $newPath; } # makeRelative 1;
26.029412
74
0.672542
ed216dea9855f6f3932f8f416d4ba71f78637b2e
2,416
t
Perl
t/sass.t
Martchus/mojolicious-plugin-assetpack
347b7e6dd9a8c5813d02e02e44440f2c9eec1bef
[ "ClArtistic" ]
null
null
null
t/sass.t
Martchus/mojolicious-plugin-assetpack
347b7e6dd9a8c5813d02e02e44440f2c9eec1bef
[ "ClArtistic" ]
null
null
null
t/sass.t
Martchus/mojolicious-plugin-assetpack
347b7e6dd9a8c5813d02e02e44440f2c9eec1bef
[ "ClArtistic" ]
null
null
null
use lib '.'; use t::Helper; plan skip_all => 'cpanm CSS::Sass' unless eval 'use CSS::Sass 3.3.0;1'; my $t = t::Helper->t(pipes => [qw(Sass Css)]); $t->app->asset->process('app.css' => ('sass-one.sass', 'sass-two.scss')); $t->get_ok('/')->status_is(200)->element_exists(qq(link[href="/asset/5660087922/sass-one.css"])) ->element_exists(qq(link[href="/asset/a2245cadf4/sass-two.css"])); my $html = $t->tx->res->dom; $t->get_ok($html->at('link:nth-of-child(1)')->{href})->status_is(200)->content_like(qr{\.sass\W+color:\s+\#aaa}s); $t->get_ok($html->at('link:nth-of-child(2)')->{href})->status_is(200) ->content_like(qr{body\W+background:.*\.scss \.nested\W+color:\s+\#9\d9\d9\d}s); $ENV{MOJO_MODE} = 'Test_minify_from_here'; # Assets from __DATA__ $t = t::Helper->t(pipes => [qw(Sass Css Combine)]); $t->app->asset->process('app.css' => ('sass-one.sass', 'sass-two.scss')); $t->get_ok('/')->status_is(200)->element_exists(qq(link[href="/asset/08eb78e42a/app.css"])); $t->get_ok($t->tx->res->dom->at('link')->{href})->status_is(200)->content_like(qr/\nbody\{background:#fff\}/); if (-e '.test-everything') { my @content = split /[\r?\n]/, $t->tx->res->text; is $content[0], '.sass{color:#aaa}', 'line1'; is $content[1], 'body{background:#fff}.scss{color:#aaa}.scss .nested{color:#939393}', 'line2'; } Mojo::Util::monkey_patch('CSS::Sass', sass2scss => sub { die 'Nope!' }); $t = t::Helper->t(pipes => [qw(Sass Css Combine)]); ok eval { $t->app->asset->process('app.css' => ('sass-one.sass', 'sass-two.scss')) }, 'using cached assets' or diag $@; # Assets from disk $t = t::Helper->t(pipes => [qw(Sass Css Combine)]); $t->app->asset->process('app.css' => 'sass/sass-1.scss'); $t->get_ok('/')->status_is(200)->element_exists(qq(link[href="/asset/4abbb4a8c8/app.css"])); $t->get_ok($t->tx->res->dom->at('link')->{href})->status_is(200)->content_like(qr{footer.*\#aaa.*body.*\#222}s); # Duplicate @import $t = t::Helper->t(pipes => [qw(Sass Css Combine)]); ok eval { $t->app->asset->process('dup.css' => 'sass/sass-2-dup.scss') }, 'sass with duplicate @imports' or diag $@; done_testing; __DATA__ @@ index.html.ep %= asset 'app.css' @@ sass-one.sass $color: #aaa; .sass color: $color; @@ sass-two.scss // .foo { @import "sass-two.scss"; }`). @import "sass-0-include"; $color: #aaa; .scss { color: $color; .nested { color: darken($color, 9%); } } @@ sass-0-include.scss body { background: #fff; }
38.349206
119
0.625414
ed6d1618819c7e5252aebb96c12d6d58a383086b
129,742
t
Perl
S15-normalization/nfkc-7.t
mryan/perl6-roast
513da79cd0522e041d76c0845b3069f28e7d8e6c
[ "Artistic-2.0" ]
null
null
null
S15-normalization/nfkc-7.t
mryan/perl6-roast
513da79cd0522e041d76c0845b3069f28e7d8e6c
[ "Artistic-2.0" ]
null
null
null
S15-normalization/nfkc-7.t
mryan/perl6-roast
513da79cd0522e041d76c0845b3069f28e7d8e6c
[ "Artistic-2.0" ]
null
null
null
use v6; # Unicode normalization tests, generated from NormalizationTests.txt in the # Unicode database by S15-normalization/test-gen.p6. # Generated from Unicode version 9.0.0. use Test; plan 2000; ok Uni.new(0xFAD9).NFKC.list ~~ (0x9F8E,), 'FAD9 -> 9F8E'; ok Uni.new(0xFB00).NFKC.list ~~ (0x0066, 0x0066,), 'FB00 -> 0066 0066'; ok Uni.new(0xFB01).NFKC.list ~~ (0x0066, 0x0069,), 'FB01 -> 0066 0069'; ok Uni.new(0xFB02).NFKC.list ~~ (0x0066, 0x006C,), 'FB02 -> 0066 006C'; ok Uni.new(0xFB03).NFKC.list ~~ (0x0066, 0x0066, 0x0069,), 'FB03 -> 0066 0066 0069'; ok Uni.new(0xFB04).NFKC.list ~~ (0x0066, 0x0066, 0x006C,), 'FB04 -> 0066 0066 006C'; ok Uni.new(0xFB05).NFKC.list ~~ (0x0073, 0x0074,), 'FB05 -> 0073 0074'; ok Uni.new(0xFB06).NFKC.list ~~ (0x0073, 0x0074,), 'FB06 -> 0073 0074'; ok Uni.new(0xFB13).NFKC.list ~~ (0x0574, 0x0576,), 'FB13 -> 0574 0576'; ok Uni.new(0xFB14).NFKC.list ~~ (0x0574, 0x0565,), 'FB14 -> 0574 0565'; ok Uni.new(0xFB15).NFKC.list ~~ (0x0574, 0x056B,), 'FB15 -> 0574 056B'; ok Uni.new(0xFB16).NFKC.list ~~ (0x057E, 0x0576,), 'FB16 -> 057E 0576'; ok Uni.new(0xFB17).NFKC.list ~~ (0x0574, 0x056D,), 'FB17 -> 0574 056D'; ok Uni.new(0xFB1D).NFKC.list ~~ (0x05D9, 0x05B4,), 'FB1D -> 05D9 05B4'; ok Uni.new(0xFB1F).NFKC.list ~~ (0x05F2, 0x05B7,), 'FB1F -> 05F2 05B7'; ok Uni.new(0xFB20).NFKC.list ~~ (0x05E2,), 'FB20 -> 05E2'; ok Uni.new(0xFB21).NFKC.list ~~ (0x05D0,), 'FB21 -> 05D0'; ok Uni.new(0xFB22).NFKC.list ~~ (0x05D3,), 'FB22 -> 05D3'; ok Uni.new(0xFB23).NFKC.list ~~ (0x05D4,), 'FB23 -> 05D4'; ok Uni.new(0xFB24).NFKC.list ~~ (0x05DB,), 'FB24 -> 05DB'; ok Uni.new(0xFB25).NFKC.list ~~ (0x05DC,), 'FB25 -> 05DC'; ok Uni.new(0xFB26).NFKC.list ~~ (0x05DD,), 'FB26 -> 05DD'; ok Uni.new(0xFB27).NFKC.list ~~ (0x05E8,), 'FB27 -> 05E8'; ok Uni.new(0xFB28).NFKC.list ~~ (0x05EA,), 'FB28 -> 05EA'; ok Uni.new(0xFB29).NFKC.list ~~ (0x002B,), 'FB29 -> 002B'; ok Uni.new(0xFB2A).NFKC.list ~~ (0x05E9, 0x05C1,), 'FB2A -> 05E9 05C1'; ok Uni.new(0xFB2B).NFKC.list ~~ (0x05E9, 0x05C2,), 'FB2B -> 05E9 05C2'; ok Uni.new(0xFB2C).NFKC.list ~~ (0x05E9, 0x05BC, 0x05C1,), 'FB2C -> 05E9 05BC 05C1'; ok Uni.new(0xFB2D).NFKC.list ~~ (0x05E9, 0x05BC, 0x05C2,), 'FB2D -> 05E9 05BC 05C2'; ok Uni.new(0xFB2E).NFKC.list ~~ (0x05D0, 0x05B7,), 'FB2E -> 05D0 05B7'; ok Uni.new(0xFB2F).NFKC.list ~~ (0x05D0, 0x05B8,), 'FB2F -> 05D0 05B8'; ok Uni.new(0xFB30).NFKC.list ~~ (0x05D0, 0x05BC,), 'FB30 -> 05D0 05BC'; ok Uni.new(0xFB31).NFKC.list ~~ (0x05D1, 0x05BC,), 'FB31 -> 05D1 05BC'; ok Uni.new(0xFB32).NFKC.list ~~ (0x05D2, 0x05BC,), 'FB32 -> 05D2 05BC'; ok Uni.new(0xFB33).NFKC.list ~~ (0x05D3, 0x05BC,), 'FB33 -> 05D3 05BC'; ok Uni.new(0xFB34).NFKC.list ~~ (0x05D4, 0x05BC,), 'FB34 -> 05D4 05BC'; ok Uni.new(0xFB35).NFKC.list ~~ (0x05D5, 0x05BC,), 'FB35 -> 05D5 05BC'; ok Uni.new(0xFB36).NFKC.list ~~ (0x05D6, 0x05BC,), 'FB36 -> 05D6 05BC'; ok Uni.new(0xFB38).NFKC.list ~~ (0x05D8, 0x05BC,), 'FB38 -> 05D8 05BC'; ok Uni.new(0xFB39).NFKC.list ~~ (0x05D9, 0x05BC,), 'FB39 -> 05D9 05BC'; ok Uni.new(0xFB3A).NFKC.list ~~ (0x05DA, 0x05BC,), 'FB3A -> 05DA 05BC'; ok Uni.new(0xFB3B).NFKC.list ~~ (0x05DB, 0x05BC,), 'FB3B -> 05DB 05BC'; ok Uni.new(0xFB3C).NFKC.list ~~ (0x05DC, 0x05BC,), 'FB3C -> 05DC 05BC'; ok Uni.new(0xFB3E).NFKC.list ~~ (0x05DE, 0x05BC,), 'FB3E -> 05DE 05BC'; ok Uni.new(0xFB40).NFKC.list ~~ (0x05E0, 0x05BC,), 'FB40 -> 05E0 05BC'; ok Uni.new(0xFB41).NFKC.list ~~ (0x05E1, 0x05BC,), 'FB41 -> 05E1 05BC'; ok Uni.new(0xFB43).NFKC.list ~~ (0x05E3, 0x05BC,), 'FB43 -> 05E3 05BC'; ok Uni.new(0xFB44).NFKC.list ~~ (0x05E4, 0x05BC,), 'FB44 -> 05E4 05BC'; ok Uni.new(0xFB46).NFKC.list ~~ (0x05E6, 0x05BC,), 'FB46 -> 05E6 05BC'; ok Uni.new(0xFB47).NFKC.list ~~ (0x05E7, 0x05BC,), 'FB47 -> 05E7 05BC'; ok Uni.new(0xFB48).NFKC.list ~~ (0x05E8, 0x05BC,), 'FB48 -> 05E8 05BC'; ok Uni.new(0xFB49).NFKC.list ~~ (0x05E9, 0x05BC,), 'FB49 -> 05E9 05BC'; ok Uni.new(0xFB4A).NFKC.list ~~ (0x05EA, 0x05BC,), 'FB4A -> 05EA 05BC'; ok Uni.new(0xFB4B).NFKC.list ~~ (0x05D5, 0x05B9,), 'FB4B -> 05D5 05B9'; ok Uni.new(0xFB4C).NFKC.list ~~ (0x05D1, 0x05BF,), 'FB4C -> 05D1 05BF'; ok Uni.new(0xFB4D).NFKC.list ~~ (0x05DB, 0x05BF,), 'FB4D -> 05DB 05BF'; ok Uni.new(0xFB4E).NFKC.list ~~ (0x05E4, 0x05BF,), 'FB4E -> 05E4 05BF'; ok Uni.new(0xFB4F).NFKC.list ~~ (0x05D0, 0x05DC,), 'FB4F -> 05D0 05DC'; ok Uni.new(0xFB50).NFKC.list ~~ (0x0671,), 'FB50 -> 0671'; ok Uni.new(0xFB51).NFKC.list ~~ (0x0671,), 'FB51 -> 0671'; ok Uni.new(0xFB52).NFKC.list ~~ (0x067B,), 'FB52 -> 067B'; ok Uni.new(0xFB53).NFKC.list ~~ (0x067B,), 'FB53 -> 067B'; ok Uni.new(0xFB54).NFKC.list ~~ (0x067B,), 'FB54 -> 067B'; ok Uni.new(0xFB55).NFKC.list ~~ (0x067B,), 'FB55 -> 067B'; ok Uni.new(0xFB56).NFKC.list ~~ (0x067E,), 'FB56 -> 067E'; ok Uni.new(0xFB57).NFKC.list ~~ (0x067E,), 'FB57 -> 067E'; ok Uni.new(0xFB58).NFKC.list ~~ (0x067E,), 'FB58 -> 067E'; ok Uni.new(0xFB59).NFKC.list ~~ (0x067E,), 'FB59 -> 067E'; ok Uni.new(0xFB5A).NFKC.list ~~ (0x0680,), 'FB5A -> 0680'; ok Uni.new(0xFB5B).NFKC.list ~~ (0x0680,), 'FB5B -> 0680'; ok Uni.new(0xFB5C).NFKC.list ~~ (0x0680,), 'FB5C -> 0680'; ok Uni.new(0xFB5D).NFKC.list ~~ (0x0680,), 'FB5D -> 0680'; ok Uni.new(0xFB5E).NFKC.list ~~ (0x067A,), 'FB5E -> 067A'; ok Uni.new(0xFB5F).NFKC.list ~~ (0x067A,), 'FB5F -> 067A'; ok Uni.new(0xFB60).NFKC.list ~~ (0x067A,), 'FB60 -> 067A'; ok Uni.new(0xFB61).NFKC.list ~~ (0x067A,), 'FB61 -> 067A'; ok Uni.new(0xFB62).NFKC.list ~~ (0x067F,), 'FB62 -> 067F'; ok Uni.new(0xFB63).NFKC.list ~~ (0x067F,), 'FB63 -> 067F'; ok Uni.new(0xFB64).NFKC.list ~~ (0x067F,), 'FB64 -> 067F'; ok Uni.new(0xFB65).NFKC.list ~~ (0x067F,), 'FB65 -> 067F'; ok Uni.new(0xFB66).NFKC.list ~~ (0x0679,), 'FB66 -> 0679'; ok Uni.new(0xFB67).NFKC.list ~~ (0x0679,), 'FB67 -> 0679'; ok Uni.new(0xFB68).NFKC.list ~~ (0x0679,), 'FB68 -> 0679'; ok Uni.new(0xFB69).NFKC.list ~~ (0x0679,), 'FB69 -> 0679'; ok Uni.new(0xFB6A).NFKC.list ~~ (0x06A4,), 'FB6A -> 06A4'; ok Uni.new(0xFB6B).NFKC.list ~~ (0x06A4,), 'FB6B -> 06A4'; ok Uni.new(0xFB6C).NFKC.list ~~ (0x06A4,), 'FB6C -> 06A4'; ok Uni.new(0xFB6D).NFKC.list ~~ (0x06A4,), 'FB6D -> 06A4'; ok Uni.new(0xFB6E).NFKC.list ~~ (0x06A6,), 'FB6E -> 06A6'; ok Uni.new(0xFB6F).NFKC.list ~~ (0x06A6,), 'FB6F -> 06A6'; ok Uni.new(0xFB70).NFKC.list ~~ (0x06A6,), 'FB70 -> 06A6'; ok Uni.new(0xFB71).NFKC.list ~~ (0x06A6,), 'FB71 -> 06A6'; ok Uni.new(0xFB72).NFKC.list ~~ (0x0684,), 'FB72 -> 0684'; ok Uni.new(0xFB73).NFKC.list ~~ (0x0684,), 'FB73 -> 0684'; ok Uni.new(0xFB74).NFKC.list ~~ (0x0684,), 'FB74 -> 0684'; ok Uni.new(0xFB75).NFKC.list ~~ (0x0684,), 'FB75 -> 0684'; ok Uni.new(0xFB76).NFKC.list ~~ (0x0683,), 'FB76 -> 0683'; ok Uni.new(0xFB77).NFKC.list ~~ (0x0683,), 'FB77 -> 0683'; ok Uni.new(0xFB78).NFKC.list ~~ (0x0683,), 'FB78 -> 0683'; ok Uni.new(0xFB79).NFKC.list ~~ (0x0683,), 'FB79 -> 0683'; ok Uni.new(0xFB7A).NFKC.list ~~ (0x0686,), 'FB7A -> 0686'; ok Uni.new(0xFB7B).NFKC.list ~~ (0x0686,), 'FB7B -> 0686'; ok Uni.new(0xFB7C).NFKC.list ~~ (0x0686,), 'FB7C -> 0686'; ok Uni.new(0xFB7D).NFKC.list ~~ (0x0686,), 'FB7D -> 0686'; ok Uni.new(0xFB7E).NFKC.list ~~ (0x0687,), 'FB7E -> 0687'; ok Uni.new(0xFB7F).NFKC.list ~~ (0x0687,), 'FB7F -> 0687'; ok Uni.new(0xFB80).NFKC.list ~~ (0x0687,), 'FB80 -> 0687'; ok Uni.new(0xFB81).NFKC.list ~~ (0x0687,), 'FB81 -> 0687'; ok Uni.new(0xFB82).NFKC.list ~~ (0x068D,), 'FB82 -> 068D'; ok Uni.new(0xFB83).NFKC.list ~~ (0x068D,), 'FB83 -> 068D'; ok Uni.new(0xFB84).NFKC.list ~~ (0x068C,), 'FB84 -> 068C'; ok Uni.new(0xFB85).NFKC.list ~~ (0x068C,), 'FB85 -> 068C'; ok Uni.new(0xFB86).NFKC.list ~~ (0x068E,), 'FB86 -> 068E'; ok Uni.new(0xFB87).NFKC.list ~~ (0x068E,), 'FB87 -> 068E'; ok Uni.new(0xFB88).NFKC.list ~~ (0x0688,), 'FB88 -> 0688'; ok Uni.new(0xFB89).NFKC.list ~~ (0x0688,), 'FB89 -> 0688'; ok Uni.new(0xFB8A).NFKC.list ~~ (0x0698,), 'FB8A -> 0698'; ok Uni.new(0xFB8B).NFKC.list ~~ (0x0698,), 'FB8B -> 0698'; ok Uni.new(0xFB8C).NFKC.list ~~ (0x0691,), 'FB8C -> 0691'; ok Uni.new(0xFB8D).NFKC.list ~~ (0x0691,), 'FB8D -> 0691'; ok Uni.new(0xFB8E).NFKC.list ~~ (0x06A9,), 'FB8E -> 06A9'; ok Uni.new(0xFB8F).NFKC.list ~~ (0x06A9,), 'FB8F -> 06A9'; ok Uni.new(0xFB90).NFKC.list ~~ (0x06A9,), 'FB90 -> 06A9'; ok Uni.new(0xFB91).NFKC.list ~~ (0x06A9,), 'FB91 -> 06A9'; ok Uni.new(0xFB92).NFKC.list ~~ (0x06AF,), 'FB92 -> 06AF'; ok Uni.new(0xFB93).NFKC.list ~~ (0x06AF,), 'FB93 -> 06AF'; ok Uni.new(0xFB94).NFKC.list ~~ (0x06AF,), 'FB94 -> 06AF'; ok Uni.new(0xFB95).NFKC.list ~~ (0x06AF,), 'FB95 -> 06AF'; ok Uni.new(0xFB96).NFKC.list ~~ (0x06B3,), 'FB96 -> 06B3'; ok Uni.new(0xFB97).NFKC.list ~~ (0x06B3,), 'FB97 -> 06B3'; ok Uni.new(0xFB98).NFKC.list ~~ (0x06B3,), 'FB98 -> 06B3'; ok Uni.new(0xFB99).NFKC.list ~~ (0x06B3,), 'FB99 -> 06B3'; ok Uni.new(0xFB9A).NFKC.list ~~ (0x06B1,), 'FB9A -> 06B1'; ok Uni.new(0xFB9B).NFKC.list ~~ (0x06B1,), 'FB9B -> 06B1'; ok Uni.new(0xFB9C).NFKC.list ~~ (0x06B1,), 'FB9C -> 06B1'; ok Uni.new(0xFB9D).NFKC.list ~~ (0x06B1,), 'FB9D -> 06B1'; ok Uni.new(0xFB9E).NFKC.list ~~ (0x06BA,), 'FB9E -> 06BA'; ok Uni.new(0xFB9F).NFKC.list ~~ (0x06BA,), 'FB9F -> 06BA'; ok Uni.new(0xFBA0).NFKC.list ~~ (0x06BB,), 'FBA0 -> 06BB'; ok Uni.new(0xFBA1).NFKC.list ~~ (0x06BB,), 'FBA1 -> 06BB'; ok Uni.new(0xFBA2).NFKC.list ~~ (0x06BB,), 'FBA2 -> 06BB'; ok Uni.new(0xFBA3).NFKC.list ~~ (0x06BB,), 'FBA3 -> 06BB'; ok Uni.new(0xFBA4).NFKC.list ~~ (0x06C0,), 'FBA4 -> 06C0'; ok Uni.new(0xFBA5).NFKC.list ~~ (0x06C0,), 'FBA5 -> 06C0'; ok Uni.new(0xFBA6).NFKC.list ~~ (0x06C1,), 'FBA6 -> 06C1'; ok Uni.new(0xFBA7).NFKC.list ~~ (0x06C1,), 'FBA7 -> 06C1'; ok Uni.new(0xFBA8).NFKC.list ~~ (0x06C1,), 'FBA8 -> 06C1'; ok Uni.new(0xFBA9).NFKC.list ~~ (0x06C1,), 'FBA9 -> 06C1'; ok Uni.new(0xFBAA).NFKC.list ~~ (0x06BE,), 'FBAA -> 06BE'; ok Uni.new(0xFBAB).NFKC.list ~~ (0x06BE,), 'FBAB -> 06BE'; ok Uni.new(0xFBAC).NFKC.list ~~ (0x06BE,), 'FBAC -> 06BE'; ok Uni.new(0xFBAD).NFKC.list ~~ (0x06BE,), 'FBAD -> 06BE'; ok Uni.new(0xFBAE).NFKC.list ~~ (0x06D2,), 'FBAE -> 06D2'; ok Uni.new(0xFBAF).NFKC.list ~~ (0x06D2,), 'FBAF -> 06D2'; ok Uni.new(0xFBB0).NFKC.list ~~ (0x06D3,), 'FBB0 -> 06D3'; ok Uni.new(0xFBB1).NFKC.list ~~ (0x06D3,), 'FBB1 -> 06D3'; ok Uni.new(0xFBD3).NFKC.list ~~ (0x06AD,), 'FBD3 -> 06AD'; ok Uni.new(0xFBD4).NFKC.list ~~ (0x06AD,), 'FBD4 -> 06AD'; ok Uni.new(0xFBD5).NFKC.list ~~ (0x06AD,), 'FBD5 -> 06AD'; ok Uni.new(0xFBD6).NFKC.list ~~ (0x06AD,), 'FBD6 -> 06AD'; ok Uni.new(0xFBD7).NFKC.list ~~ (0x06C7,), 'FBD7 -> 06C7'; ok Uni.new(0xFBD8).NFKC.list ~~ (0x06C7,), 'FBD8 -> 06C7'; ok Uni.new(0xFBD9).NFKC.list ~~ (0x06C6,), 'FBD9 -> 06C6'; ok Uni.new(0xFBDA).NFKC.list ~~ (0x06C6,), 'FBDA -> 06C6'; ok Uni.new(0xFBDB).NFKC.list ~~ (0x06C8,), 'FBDB -> 06C8'; ok Uni.new(0xFBDC).NFKC.list ~~ (0x06C8,), 'FBDC -> 06C8'; ok Uni.new(0xFBDD).NFKC.list ~~ (0x06C7, 0x0674,), 'FBDD -> 06C7 0674'; ok Uni.new(0xFBDE).NFKC.list ~~ (0x06CB,), 'FBDE -> 06CB'; ok Uni.new(0xFBDF).NFKC.list ~~ (0x06CB,), 'FBDF -> 06CB'; ok Uni.new(0xFBE0).NFKC.list ~~ (0x06C5,), 'FBE0 -> 06C5'; ok Uni.new(0xFBE1).NFKC.list ~~ (0x06C5,), 'FBE1 -> 06C5'; ok Uni.new(0xFBE2).NFKC.list ~~ (0x06C9,), 'FBE2 -> 06C9'; ok Uni.new(0xFBE3).NFKC.list ~~ (0x06C9,), 'FBE3 -> 06C9'; ok Uni.new(0xFBE4).NFKC.list ~~ (0x06D0,), 'FBE4 -> 06D0'; ok Uni.new(0xFBE5).NFKC.list ~~ (0x06D0,), 'FBE5 -> 06D0'; ok Uni.new(0xFBE6).NFKC.list ~~ (0x06D0,), 'FBE6 -> 06D0'; ok Uni.new(0xFBE7).NFKC.list ~~ (0x06D0,), 'FBE7 -> 06D0'; ok Uni.new(0xFBE8).NFKC.list ~~ (0x0649,), 'FBE8 -> 0649'; ok Uni.new(0xFBE9).NFKC.list ~~ (0x0649,), 'FBE9 -> 0649'; ok Uni.new(0xFBEA).NFKC.list ~~ (0x0626, 0x0627,), 'FBEA -> 0626 0627'; ok Uni.new(0xFBEB).NFKC.list ~~ (0x0626, 0x0627,), 'FBEB -> 0626 0627'; ok Uni.new(0xFBEC).NFKC.list ~~ (0x0626, 0x06D5,), 'FBEC -> 0626 06D5'; ok Uni.new(0xFBED).NFKC.list ~~ (0x0626, 0x06D5,), 'FBED -> 0626 06D5'; ok Uni.new(0xFBEE).NFKC.list ~~ (0x0626, 0x0648,), 'FBEE -> 0626 0648'; ok Uni.new(0xFBEF).NFKC.list ~~ (0x0626, 0x0648,), 'FBEF -> 0626 0648'; ok Uni.new(0xFBF0).NFKC.list ~~ (0x0626, 0x06C7,), 'FBF0 -> 0626 06C7'; ok Uni.new(0xFBF1).NFKC.list ~~ (0x0626, 0x06C7,), 'FBF1 -> 0626 06C7'; ok Uni.new(0xFBF2).NFKC.list ~~ (0x0626, 0x06C6,), 'FBF2 -> 0626 06C6'; ok Uni.new(0xFBF3).NFKC.list ~~ (0x0626, 0x06C6,), 'FBF3 -> 0626 06C6'; ok Uni.new(0xFBF4).NFKC.list ~~ (0x0626, 0x06C8,), 'FBF4 -> 0626 06C8'; ok Uni.new(0xFBF5).NFKC.list ~~ (0x0626, 0x06C8,), 'FBF5 -> 0626 06C8'; ok Uni.new(0xFBF6).NFKC.list ~~ (0x0626, 0x06D0,), 'FBF6 -> 0626 06D0'; ok Uni.new(0xFBF7).NFKC.list ~~ (0x0626, 0x06D0,), 'FBF7 -> 0626 06D0'; ok Uni.new(0xFBF8).NFKC.list ~~ (0x0626, 0x06D0,), 'FBF8 -> 0626 06D0'; ok Uni.new(0xFBF9).NFKC.list ~~ (0x0626, 0x0649,), 'FBF9 -> 0626 0649'; ok Uni.new(0xFBFA).NFKC.list ~~ (0x0626, 0x0649,), 'FBFA -> 0626 0649'; ok Uni.new(0xFBFB).NFKC.list ~~ (0x0626, 0x0649,), 'FBFB -> 0626 0649'; ok Uni.new(0xFBFC).NFKC.list ~~ (0x06CC,), 'FBFC -> 06CC'; ok Uni.new(0xFBFD).NFKC.list ~~ (0x06CC,), 'FBFD -> 06CC'; ok Uni.new(0xFBFE).NFKC.list ~~ (0x06CC,), 'FBFE -> 06CC'; ok Uni.new(0xFBFF).NFKC.list ~~ (0x06CC,), 'FBFF -> 06CC'; ok Uni.new(0xFC00).NFKC.list ~~ (0x0626, 0x062C,), 'FC00 -> 0626 062C'; ok Uni.new(0xFC01).NFKC.list ~~ (0x0626, 0x062D,), 'FC01 -> 0626 062D'; ok Uni.new(0xFC02).NFKC.list ~~ (0x0626, 0x0645,), 'FC02 -> 0626 0645'; ok Uni.new(0xFC03).NFKC.list ~~ (0x0626, 0x0649,), 'FC03 -> 0626 0649'; ok Uni.new(0xFC04).NFKC.list ~~ (0x0626, 0x064A,), 'FC04 -> 0626 064A'; ok Uni.new(0xFC05).NFKC.list ~~ (0x0628, 0x062C,), 'FC05 -> 0628 062C'; ok Uni.new(0xFC06).NFKC.list ~~ (0x0628, 0x062D,), 'FC06 -> 0628 062D'; ok Uni.new(0xFC07).NFKC.list ~~ (0x0628, 0x062E,), 'FC07 -> 0628 062E'; ok Uni.new(0xFC08).NFKC.list ~~ (0x0628, 0x0645,), 'FC08 -> 0628 0645'; ok Uni.new(0xFC09).NFKC.list ~~ (0x0628, 0x0649,), 'FC09 -> 0628 0649'; ok Uni.new(0xFC0A).NFKC.list ~~ (0x0628, 0x064A,), 'FC0A -> 0628 064A'; ok Uni.new(0xFC0B).NFKC.list ~~ (0x062A, 0x062C,), 'FC0B -> 062A 062C'; ok Uni.new(0xFC0C).NFKC.list ~~ (0x062A, 0x062D,), 'FC0C -> 062A 062D'; ok Uni.new(0xFC0D).NFKC.list ~~ (0x062A, 0x062E,), 'FC0D -> 062A 062E'; ok Uni.new(0xFC0E).NFKC.list ~~ (0x062A, 0x0645,), 'FC0E -> 062A 0645'; ok Uni.new(0xFC0F).NFKC.list ~~ (0x062A, 0x0649,), 'FC0F -> 062A 0649'; ok Uni.new(0xFC10).NFKC.list ~~ (0x062A, 0x064A,), 'FC10 -> 062A 064A'; ok Uni.new(0xFC11).NFKC.list ~~ (0x062B, 0x062C,), 'FC11 -> 062B 062C'; ok Uni.new(0xFC12).NFKC.list ~~ (0x062B, 0x0645,), 'FC12 -> 062B 0645'; ok Uni.new(0xFC13).NFKC.list ~~ (0x062B, 0x0649,), 'FC13 -> 062B 0649'; ok Uni.new(0xFC14).NFKC.list ~~ (0x062B, 0x064A,), 'FC14 -> 062B 064A'; ok Uni.new(0xFC15).NFKC.list ~~ (0x062C, 0x062D,), 'FC15 -> 062C 062D'; ok Uni.new(0xFC16).NFKC.list ~~ (0x062C, 0x0645,), 'FC16 -> 062C 0645'; ok Uni.new(0xFC17).NFKC.list ~~ (0x062D, 0x062C,), 'FC17 -> 062D 062C'; ok Uni.new(0xFC18).NFKC.list ~~ (0x062D, 0x0645,), 'FC18 -> 062D 0645'; ok Uni.new(0xFC19).NFKC.list ~~ (0x062E, 0x062C,), 'FC19 -> 062E 062C'; ok Uni.new(0xFC1A).NFKC.list ~~ (0x062E, 0x062D,), 'FC1A -> 062E 062D'; ok Uni.new(0xFC1B).NFKC.list ~~ (0x062E, 0x0645,), 'FC1B -> 062E 0645'; ok Uni.new(0xFC1C).NFKC.list ~~ (0x0633, 0x062C,), 'FC1C -> 0633 062C'; ok Uni.new(0xFC1D).NFKC.list ~~ (0x0633, 0x062D,), 'FC1D -> 0633 062D'; ok Uni.new(0xFC1E).NFKC.list ~~ (0x0633, 0x062E,), 'FC1E -> 0633 062E'; ok Uni.new(0xFC1F).NFKC.list ~~ (0x0633, 0x0645,), 'FC1F -> 0633 0645'; ok Uni.new(0xFC20).NFKC.list ~~ (0x0635, 0x062D,), 'FC20 -> 0635 062D'; ok Uni.new(0xFC21).NFKC.list ~~ (0x0635, 0x0645,), 'FC21 -> 0635 0645'; ok Uni.new(0xFC22).NFKC.list ~~ (0x0636, 0x062C,), 'FC22 -> 0636 062C'; ok Uni.new(0xFC23).NFKC.list ~~ (0x0636, 0x062D,), 'FC23 -> 0636 062D'; ok Uni.new(0xFC24).NFKC.list ~~ (0x0636, 0x062E,), 'FC24 -> 0636 062E'; ok Uni.new(0xFC25).NFKC.list ~~ (0x0636, 0x0645,), 'FC25 -> 0636 0645'; ok Uni.new(0xFC26).NFKC.list ~~ (0x0637, 0x062D,), 'FC26 -> 0637 062D'; ok Uni.new(0xFC27).NFKC.list ~~ (0x0637, 0x0645,), 'FC27 -> 0637 0645'; ok Uni.new(0xFC28).NFKC.list ~~ (0x0638, 0x0645,), 'FC28 -> 0638 0645'; ok Uni.new(0xFC29).NFKC.list ~~ (0x0639, 0x062C,), 'FC29 -> 0639 062C'; ok Uni.new(0xFC2A).NFKC.list ~~ (0x0639, 0x0645,), 'FC2A -> 0639 0645'; ok Uni.new(0xFC2B).NFKC.list ~~ (0x063A, 0x062C,), 'FC2B -> 063A 062C'; ok Uni.new(0xFC2C).NFKC.list ~~ (0x063A, 0x0645,), 'FC2C -> 063A 0645'; ok Uni.new(0xFC2D).NFKC.list ~~ (0x0641, 0x062C,), 'FC2D -> 0641 062C'; ok Uni.new(0xFC2E).NFKC.list ~~ (0x0641, 0x062D,), 'FC2E -> 0641 062D'; ok Uni.new(0xFC2F).NFKC.list ~~ (0x0641, 0x062E,), 'FC2F -> 0641 062E'; ok Uni.new(0xFC30).NFKC.list ~~ (0x0641, 0x0645,), 'FC30 -> 0641 0645'; ok Uni.new(0xFC31).NFKC.list ~~ (0x0641, 0x0649,), 'FC31 -> 0641 0649'; ok Uni.new(0xFC32).NFKC.list ~~ (0x0641, 0x064A,), 'FC32 -> 0641 064A'; ok Uni.new(0xFC33).NFKC.list ~~ (0x0642, 0x062D,), 'FC33 -> 0642 062D'; ok Uni.new(0xFC34).NFKC.list ~~ (0x0642, 0x0645,), 'FC34 -> 0642 0645'; ok Uni.new(0xFC35).NFKC.list ~~ (0x0642, 0x0649,), 'FC35 -> 0642 0649'; ok Uni.new(0xFC36).NFKC.list ~~ (0x0642, 0x064A,), 'FC36 -> 0642 064A'; ok Uni.new(0xFC37).NFKC.list ~~ (0x0643, 0x0627,), 'FC37 -> 0643 0627'; ok Uni.new(0xFC38).NFKC.list ~~ (0x0643, 0x062C,), 'FC38 -> 0643 062C'; ok Uni.new(0xFC39).NFKC.list ~~ (0x0643, 0x062D,), 'FC39 -> 0643 062D'; ok Uni.new(0xFC3A).NFKC.list ~~ (0x0643, 0x062E,), 'FC3A -> 0643 062E'; ok Uni.new(0xFC3B).NFKC.list ~~ (0x0643, 0x0644,), 'FC3B -> 0643 0644'; ok Uni.new(0xFC3C).NFKC.list ~~ (0x0643, 0x0645,), 'FC3C -> 0643 0645'; ok Uni.new(0xFC3D).NFKC.list ~~ (0x0643, 0x0649,), 'FC3D -> 0643 0649'; ok Uni.new(0xFC3E).NFKC.list ~~ (0x0643, 0x064A,), 'FC3E -> 0643 064A'; ok Uni.new(0xFC3F).NFKC.list ~~ (0x0644, 0x062C,), 'FC3F -> 0644 062C'; ok Uni.new(0xFC40).NFKC.list ~~ (0x0644, 0x062D,), 'FC40 -> 0644 062D'; ok Uni.new(0xFC41).NFKC.list ~~ (0x0644, 0x062E,), 'FC41 -> 0644 062E'; ok Uni.new(0xFC42).NFKC.list ~~ (0x0644, 0x0645,), 'FC42 -> 0644 0645'; ok Uni.new(0xFC43).NFKC.list ~~ (0x0644, 0x0649,), 'FC43 -> 0644 0649'; ok Uni.new(0xFC44).NFKC.list ~~ (0x0644, 0x064A,), 'FC44 -> 0644 064A'; ok Uni.new(0xFC45).NFKC.list ~~ (0x0645, 0x062C,), 'FC45 -> 0645 062C'; ok Uni.new(0xFC46).NFKC.list ~~ (0x0645, 0x062D,), 'FC46 -> 0645 062D'; ok Uni.new(0xFC47).NFKC.list ~~ (0x0645, 0x062E,), 'FC47 -> 0645 062E'; ok Uni.new(0xFC48).NFKC.list ~~ (0x0645, 0x0645,), 'FC48 -> 0645 0645'; ok Uni.new(0xFC49).NFKC.list ~~ (0x0645, 0x0649,), 'FC49 -> 0645 0649'; ok Uni.new(0xFC4A).NFKC.list ~~ (0x0645, 0x064A,), 'FC4A -> 0645 064A'; ok Uni.new(0xFC4B).NFKC.list ~~ (0x0646, 0x062C,), 'FC4B -> 0646 062C'; ok Uni.new(0xFC4C).NFKC.list ~~ (0x0646, 0x062D,), 'FC4C -> 0646 062D'; ok Uni.new(0xFC4D).NFKC.list ~~ (0x0646, 0x062E,), 'FC4D -> 0646 062E'; ok Uni.new(0xFC4E).NFKC.list ~~ (0x0646, 0x0645,), 'FC4E -> 0646 0645'; ok Uni.new(0xFC4F).NFKC.list ~~ (0x0646, 0x0649,), 'FC4F -> 0646 0649'; ok Uni.new(0xFC50).NFKC.list ~~ (0x0646, 0x064A,), 'FC50 -> 0646 064A'; ok Uni.new(0xFC51).NFKC.list ~~ (0x0647, 0x062C,), 'FC51 -> 0647 062C'; ok Uni.new(0xFC52).NFKC.list ~~ (0x0647, 0x0645,), 'FC52 -> 0647 0645'; ok Uni.new(0xFC53).NFKC.list ~~ (0x0647, 0x0649,), 'FC53 -> 0647 0649'; ok Uni.new(0xFC54).NFKC.list ~~ (0x0647, 0x064A,), 'FC54 -> 0647 064A'; ok Uni.new(0xFC55).NFKC.list ~~ (0x064A, 0x062C,), 'FC55 -> 064A 062C'; ok Uni.new(0xFC56).NFKC.list ~~ (0x064A, 0x062D,), 'FC56 -> 064A 062D'; ok Uni.new(0xFC57).NFKC.list ~~ (0x064A, 0x062E,), 'FC57 -> 064A 062E'; ok Uni.new(0xFC58).NFKC.list ~~ (0x064A, 0x0645,), 'FC58 -> 064A 0645'; ok Uni.new(0xFC59).NFKC.list ~~ (0x064A, 0x0649,), 'FC59 -> 064A 0649'; ok Uni.new(0xFC5A).NFKC.list ~~ (0x064A, 0x064A,), 'FC5A -> 064A 064A'; ok Uni.new(0xFC5B).NFKC.list ~~ (0x0630, 0x0670,), 'FC5B -> 0630 0670'; ok Uni.new(0xFC5C).NFKC.list ~~ (0x0631, 0x0670,), 'FC5C -> 0631 0670'; ok Uni.new(0xFC5D).NFKC.list ~~ (0x0649, 0x0670,), 'FC5D -> 0649 0670'; ok Uni.new(0xFC5E).NFKC.list ~~ (0x0020, 0x064C, 0x0651,), 'FC5E -> 0020 064C 0651'; ok Uni.new(0xFC5F).NFKC.list ~~ (0x0020, 0x064D, 0x0651,), 'FC5F -> 0020 064D 0651'; ok Uni.new(0xFC60).NFKC.list ~~ (0x0020, 0x064E, 0x0651,), 'FC60 -> 0020 064E 0651'; ok Uni.new(0xFC61).NFKC.list ~~ (0x0020, 0x064F, 0x0651,), 'FC61 -> 0020 064F 0651'; ok Uni.new(0xFC62).NFKC.list ~~ (0x0020, 0x0650, 0x0651,), 'FC62 -> 0020 0650 0651'; ok Uni.new(0xFC63).NFKC.list ~~ (0x0020, 0x0651, 0x0670,), 'FC63 -> 0020 0651 0670'; ok Uni.new(0xFC64).NFKC.list ~~ (0x0626, 0x0631,), 'FC64 -> 0626 0631'; ok Uni.new(0xFC65).NFKC.list ~~ (0x0626, 0x0632,), 'FC65 -> 0626 0632'; ok Uni.new(0xFC66).NFKC.list ~~ (0x0626, 0x0645,), 'FC66 -> 0626 0645'; ok Uni.new(0xFC67).NFKC.list ~~ (0x0626, 0x0646,), 'FC67 -> 0626 0646'; ok Uni.new(0xFC68).NFKC.list ~~ (0x0626, 0x0649,), 'FC68 -> 0626 0649'; ok Uni.new(0xFC69).NFKC.list ~~ (0x0626, 0x064A,), 'FC69 -> 0626 064A'; ok Uni.new(0xFC6A).NFKC.list ~~ (0x0628, 0x0631,), 'FC6A -> 0628 0631'; ok Uni.new(0xFC6B).NFKC.list ~~ (0x0628, 0x0632,), 'FC6B -> 0628 0632'; ok Uni.new(0xFC6C).NFKC.list ~~ (0x0628, 0x0645,), 'FC6C -> 0628 0645'; ok Uni.new(0xFC6D).NFKC.list ~~ (0x0628, 0x0646,), 'FC6D -> 0628 0646'; ok Uni.new(0xFC6E).NFKC.list ~~ (0x0628, 0x0649,), 'FC6E -> 0628 0649'; ok Uni.new(0xFC6F).NFKC.list ~~ (0x0628, 0x064A,), 'FC6F -> 0628 064A'; ok Uni.new(0xFC70).NFKC.list ~~ (0x062A, 0x0631,), 'FC70 -> 062A 0631'; ok Uni.new(0xFC71).NFKC.list ~~ (0x062A, 0x0632,), 'FC71 -> 062A 0632'; ok Uni.new(0xFC72).NFKC.list ~~ (0x062A, 0x0645,), 'FC72 -> 062A 0645'; ok Uni.new(0xFC73).NFKC.list ~~ (0x062A, 0x0646,), 'FC73 -> 062A 0646'; ok Uni.new(0xFC74).NFKC.list ~~ (0x062A, 0x0649,), 'FC74 -> 062A 0649'; ok Uni.new(0xFC75).NFKC.list ~~ (0x062A, 0x064A,), 'FC75 -> 062A 064A'; ok Uni.new(0xFC76).NFKC.list ~~ (0x062B, 0x0631,), 'FC76 -> 062B 0631'; ok Uni.new(0xFC77).NFKC.list ~~ (0x062B, 0x0632,), 'FC77 -> 062B 0632'; ok Uni.new(0xFC78).NFKC.list ~~ (0x062B, 0x0645,), 'FC78 -> 062B 0645'; ok Uni.new(0xFC79).NFKC.list ~~ (0x062B, 0x0646,), 'FC79 -> 062B 0646'; ok Uni.new(0xFC7A).NFKC.list ~~ (0x062B, 0x0649,), 'FC7A -> 062B 0649'; ok Uni.new(0xFC7B).NFKC.list ~~ (0x062B, 0x064A,), 'FC7B -> 062B 064A'; ok Uni.new(0xFC7C).NFKC.list ~~ (0x0641, 0x0649,), 'FC7C -> 0641 0649'; ok Uni.new(0xFC7D).NFKC.list ~~ (0x0641, 0x064A,), 'FC7D -> 0641 064A'; ok Uni.new(0xFC7E).NFKC.list ~~ (0x0642, 0x0649,), 'FC7E -> 0642 0649'; ok Uni.new(0xFC7F).NFKC.list ~~ (0x0642, 0x064A,), 'FC7F -> 0642 064A'; ok Uni.new(0xFC80).NFKC.list ~~ (0x0643, 0x0627,), 'FC80 -> 0643 0627'; ok Uni.new(0xFC81).NFKC.list ~~ (0x0643, 0x0644,), 'FC81 -> 0643 0644'; ok Uni.new(0xFC82).NFKC.list ~~ (0x0643, 0x0645,), 'FC82 -> 0643 0645'; ok Uni.new(0xFC83).NFKC.list ~~ (0x0643, 0x0649,), 'FC83 -> 0643 0649'; ok Uni.new(0xFC84).NFKC.list ~~ (0x0643, 0x064A,), 'FC84 -> 0643 064A'; ok Uni.new(0xFC85).NFKC.list ~~ (0x0644, 0x0645,), 'FC85 -> 0644 0645'; ok Uni.new(0xFC86).NFKC.list ~~ (0x0644, 0x0649,), 'FC86 -> 0644 0649'; ok Uni.new(0xFC87).NFKC.list ~~ (0x0644, 0x064A,), 'FC87 -> 0644 064A'; ok Uni.new(0xFC88).NFKC.list ~~ (0x0645, 0x0627,), 'FC88 -> 0645 0627'; ok Uni.new(0xFC89).NFKC.list ~~ (0x0645, 0x0645,), 'FC89 -> 0645 0645'; ok Uni.new(0xFC8A).NFKC.list ~~ (0x0646, 0x0631,), 'FC8A -> 0646 0631'; ok Uni.new(0xFC8B).NFKC.list ~~ (0x0646, 0x0632,), 'FC8B -> 0646 0632'; ok Uni.new(0xFC8C).NFKC.list ~~ (0x0646, 0x0645,), 'FC8C -> 0646 0645'; ok Uni.new(0xFC8D).NFKC.list ~~ (0x0646, 0x0646,), 'FC8D -> 0646 0646'; ok Uni.new(0xFC8E).NFKC.list ~~ (0x0646, 0x0649,), 'FC8E -> 0646 0649'; ok Uni.new(0xFC8F).NFKC.list ~~ (0x0646, 0x064A,), 'FC8F -> 0646 064A'; ok Uni.new(0xFC90).NFKC.list ~~ (0x0649, 0x0670,), 'FC90 -> 0649 0670'; ok Uni.new(0xFC91).NFKC.list ~~ (0x064A, 0x0631,), 'FC91 -> 064A 0631'; ok Uni.new(0xFC92).NFKC.list ~~ (0x064A, 0x0632,), 'FC92 -> 064A 0632'; ok Uni.new(0xFC93).NFKC.list ~~ (0x064A, 0x0645,), 'FC93 -> 064A 0645'; ok Uni.new(0xFC94).NFKC.list ~~ (0x064A, 0x0646,), 'FC94 -> 064A 0646'; ok Uni.new(0xFC95).NFKC.list ~~ (0x064A, 0x0649,), 'FC95 -> 064A 0649'; ok Uni.new(0xFC96).NFKC.list ~~ (0x064A, 0x064A,), 'FC96 -> 064A 064A'; ok Uni.new(0xFC97).NFKC.list ~~ (0x0626, 0x062C,), 'FC97 -> 0626 062C'; ok Uni.new(0xFC98).NFKC.list ~~ (0x0626, 0x062D,), 'FC98 -> 0626 062D'; ok Uni.new(0xFC99).NFKC.list ~~ (0x0626, 0x062E,), 'FC99 -> 0626 062E'; ok Uni.new(0xFC9A).NFKC.list ~~ (0x0626, 0x0645,), 'FC9A -> 0626 0645'; ok Uni.new(0xFC9B).NFKC.list ~~ (0x0626, 0x0647,), 'FC9B -> 0626 0647'; ok Uni.new(0xFC9C).NFKC.list ~~ (0x0628, 0x062C,), 'FC9C -> 0628 062C'; ok Uni.new(0xFC9D).NFKC.list ~~ (0x0628, 0x062D,), 'FC9D -> 0628 062D'; ok Uni.new(0xFC9E).NFKC.list ~~ (0x0628, 0x062E,), 'FC9E -> 0628 062E'; ok Uni.new(0xFC9F).NFKC.list ~~ (0x0628, 0x0645,), 'FC9F -> 0628 0645'; ok Uni.new(0xFCA0).NFKC.list ~~ (0x0628, 0x0647,), 'FCA0 -> 0628 0647'; ok Uni.new(0xFCA1).NFKC.list ~~ (0x062A, 0x062C,), 'FCA1 -> 062A 062C'; ok Uni.new(0xFCA2).NFKC.list ~~ (0x062A, 0x062D,), 'FCA2 -> 062A 062D'; ok Uni.new(0xFCA3).NFKC.list ~~ (0x062A, 0x062E,), 'FCA3 -> 062A 062E'; ok Uni.new(0xFCA4).NFKC.list ~~ (0x062A, 0x0645,), 'FCA4 -> 062A 0645'; ok Uni.new(0xFCA5).NFKC.list ~~ (0x062A, 0x0647,), 'FCA5 -> 062A 0647'; ok Uni.new(0xFCA6).NFKC.list ~~ (0x062B, 0x0645,), 'FCA6 -> 062B 0645'; ok Uni.new(0xFCA7).NFKC.list ~~ (0x062C, 0x062D,), 'FCA7 -> 062C 062D'; ok Uni.new(0xFCA8).NFKC.list ~~ (0x062C, 0x0645,), 'FCA8 -> 062C 0645'; ok Uni.new(0xFCA9).NFKC.list ~~ (0x062D, 0x062C,), 'FCA9 -> 062D 062C'; ok Uni.new(0xFCAA).NFKC.list ~~ (0x062D, 0x0645,), 'FCAA -> 062D 0645'; ok Uni.new(0xFCAB).NFKC.list ~~ (0x062E, 0x062C,), 'FCAB -> 062E 062C'; ok Uni.new(0xFCAC).NFKC.list ~~ (0x062E, 0x0645,), 'FCAC -> 062E 0645'; ok Uni.new(0xFCAD).NFKC.list ~~ (0x0633, 0x062C,), 'FCAD -> 0633 062C'; ok Uni.new(0xFCAE).NFKC.list ~~ (0x0633, 0x062D,), 'FCAE -> 0633 062D'; ok Uni.new(0xFCAF).NFKC.list ~~ (0x0633, 0x062E,), 'FCAF -> 0633 062E'; ok Uni.new(0xFCB0).NFKC.list ~~ (0x0633, 0x0645,), 'FCB0 -> 0633 0645'; ok Uni.new(0xFCB1).NFKC.list ~~ (0x0635, 0x062D,), 'FCB1 -> 0635 062D'; ok Uni.new(0xFCB2).NFKC.list ~~ (0x0635, 0x062E,), 'FCB2 -> 0635 062E'; ok Uni.new(0xFCB3).NFKC.list ~~ (0x0635, 0x0645,), 'FCB3 -> 0635 0645'; ok Uni.new(0xFCB4).NFKC.list ~~ (0x0636, 0x062C,), 'FCB4 -> 0636 062C'; ok Uni.new(0xFCB5).NFKC.list ~~ (0x0636, 0x062D,), 'FCB5 -> 0636 062D'; ok Uni.new(0xFCB6).NFKC.list ~~ (0x0636, 0x062E,), 'FCB6 -> 0636 062E'; ok Uni.new(0xFCB7).NFKC.list ~~ (0x0636, 0x0645,), 'FCB7 -> 0636 0645'; ok Uni.new(0xFCB8).NFKC.list ~~ (0x0637, 0x062D,), 'FCB8 -> 0637 062D'; ok Uni.new(0xFCB9).NFKC.list ~~ (0x0638, 0x0645,), 'FCB9 -> 0638 0645'; ok Uni.new(0xFCBA).NFKC.list ~~ (0x0639, 0x062C,), 'FCBA -> 0639 062C'; ok Uni.new(0xFCBB).NFKC.list ~~ (0x0639, 0x0645,), 'FCBB -> 0639 0645'; ok Uni.new(0xFCBC).NFKC.list ~~ (0x063A, 0x062C,), 'FCBC -> 063A 062C'; ok Uni.new(0xFCBD).NFKC.list ~~ (0x063A, 0x0645,), 'FCBD -> 063A 0645'; ok Uni.new(0xFCBE).NFKC.list ~~ (0x0641, 0x062C,), 'FCBE -> 0641 062C'; ok Uni.new(0xFCBF).NFKC.list ~~ (0x0641, 0x062D,), 'FCBF -> 0641 062D'; ok Uni.new(0xFCC0).NFKC.list ~~ (0x0641, 0x062E,), 'FCC0 -> 0641 062E'; ok Uni.new(0xFCC1).NFKC.list ~~ (0x0641, 0x0645,), 'FCC1 -> 0641 0645'; ok Uni.new(0xFCC2).NFKC.list ~~ (0x0642, 0x062D,), 'FCC2 -> 0642 062D'; ok Uni.new(0xFCC3).NFKC.list ~~ (0x0642, 0x0645,), 'FCC3 -> 0642 0645'; ok Uni.new(0xFCC4).NFKC.list ~~ (0x0643, 0x062C,), 'FCC4 -> 0643 062C'; ok Uni.new(0xFCC5).NFKC.list ~~ (0x0643, 0x062D,), 'FCC5 -> 0643 062D'; ok Uni.new(0xFCC6).NFKC.list ~~ (0x0643, 0x062E,), 'FCC6 -> 0643 062E'; ok Uni.new(0xFCC7).NFKC.list ~~ (0x0643, 0x0644,), 'FCC7 -> 0643 0644'; ok Uni.new(0xFCC8).NFKC.list ~~ (0x0643, 0x0645,), 'FCC8 -> 0643 0645'; ok Uni.new(0xFCC9).NFKC.list ~~ (0x0644, 0x062C,), 'FCC9 -> 0644 062C'; ok Uni.new(0xFCCA).NFKC.list ~~ (0x0644, 0x062D,), 'FCCA -> 0644 062D'; ok Uni.new(0xFCCB).NFKC.list ~~ (0x0644, 0x062E,), 'FCCB -> 0644 062E'; ok Uni.new(0xFCCC).NFKC.list ~~ (0x0644, 0x0645,), 'FCCC -> 0644 0645'; ok Uni.new(0xFCCD).NFKC.list ~~ (0x0644, 0x0647,), 'FCCD -> 0644 0647'; ok Uni.new(0xFCCE).NFKC.list ~~ (0x0645, 0x062C,), 'FCCE -> 0645 062C'; ok Uni.new(0xFCCF).NFKC.list ~~ (0x0645, 0x062D,), 'FCCF -> 0645 062D'; ok Uni.new(0xFCD0).NFKC.list ~~ (0x0645, 0x062E,), 'FCD0 -> 0645 062E'; ok Uni.new(0xFCD1).NFKC.list ~~ (0x0645, 0x0645,), 'FCD1 -> 0645 0645'; ok Uni.new(0xFCD2).NFKC.list ~~ (0x0646, 0x062C,), 'FCD2 -> 0646 062C'; ok Uni.new(0xFCD3).NFKC.list ~~ (0x0646, 0x062D,), 'FCD3 -> 0646 062D'; ok Uni.new(0xFCD4).NFKC.list ~~ (0x0646, 0x062E,), 'FCD4 -> 0646 062E'; ok Uni.new(0xFCD5).NFKC.list ~~ (0x0646, 0x0645,), 'FCD5 -> 0646 0645'; ok Uni.new(0xFCD6).NFKC.list ~~ (0x0646, 0x0647,), 'FCD6 -> 0646 0647'; ok Uni.new(0xFCD7).NFKC.list ~~ (0x0647, 0x062C,), 'FCD7 -> 0647 062C'; ok Uni.new(0xFCD8).NFKC.list ~~ (0x0647, 0x0645,), 'FCD8 -> 0647 0645'; ok Uni.new(0xFCD9).NFKC.list ~~ (0x0647, 0x0670,), 'FCD9 -> 0647 0670'; ok Uni.new(0xFCDA).NFKC.list ~~ (0x064A, 0x062C,), 'FCDA -> 064A 062C'; ok Uni.new(0xFCDB).NFKC.list ~~ (0x064A, 0x062D,), 'FCDB -> 064A 062D'; ok Uni.new(0xFCDC).NFKC.list ~~ (0x064A, 0x062E,), 'FCDC -> 064A 062E'; ok Uni.new(0xFCDD).NFKC.list ~~ (0x064A, 0x0645,), 'FCDD -> 064A 0645'; ok Uni.new(0xFCDE).NFKC.list ~~ (0x064A, 0x0647,), 'FCDE -> 064A 0647'; ok Uni.new(0xFCDF).NFKC.list ~~ (0x0626, 0x0645,), 'FCDF -> 0626 0645'; ok Uni.new(0xFCE0).NFKC.list ~~ (0x0626, 0x0647,), 'FCE0 -> 0626 0647'; ok Uni.new(0xFCE1).NFKC.list ~~ (0x0628, 0x0645,), 'FCE1 -> 0628 0645'; ok Uni.new(0xFCE2).NFKC.list ~~ (0x0628, 0x0647,), 'FCE2 -> 0628 0647'; ok Uni.new(0xFCE3).NFKC.list ~~ (0x062A, 0x0645,), 'FCE3 -> 062A 0645'; ok Uni.new(0xFCE4).NFKC.list ~~ (0x062A, 0x0647,), 'FCE4 -> 062A 0647'; ok Uni.new(0xFCE5).NFKC.list ~~ (0x062B, 0x0645,), 'FCE5 -> 062B 0645'; ok Uni.new(0xFCE6).NFKC.list ~~ (0x062B, 0x0647,), 'FCE6 -> 062B 0647'; ok Uni.new(0xFCE7).NFKC.list ~~ (0x0633, 0x0645,), 'FCE7 -> 0633 0645'; ok Uni.new(0xFCE8).NFKC.list ~~ (0x0633, 0x0647,), 'FCE8 -> 0633 0647'; ok Uni.new(0xFCE9).NFKC.list ~~ (0x0634, 0x0645,), 'FCE9 -> 0634 0645'; ok Uni.new(0xFCEA).NFKC.list ~~ (0x0634, 0x0647,), 'FCEA -> 0634 0647'; ok Uni.new(0xFCEB).NFKC.list ~~ (0x0643, 0x0644,), 'FCEB -> 0643 0644'; ok Uni.new(0xFCEC).NFKC.list ~~ (0x0643, 0x0645,), 'FCEC -> 0643 0645'; ok Uni.new(0xFCED).NFKC.list ~~ (0x0644, 0x0645,), 'FCED -> 0644 0645'; ok Uni.new(0xFCEE).NFKC.list ~~ (0x0646, 0x0645,), 'FCEE -> 0646 0645'; ok Uni.new(0xFCEF).NFKC.list ~~ (0x0646, 0x0647,), 'FCEF -> 0646 0647'; ok Uni.new(0xFCF0).NFKC.list ~~ (0x064A, 0x0645,), 'FCF0 -> 064A 0645'; ok Uni.new(0xFCF1).NFKC.list ~~ (0x064A, 0x0647,), 'FCF1 -> 064A 0647'; ok Uni.new(0xFCF2).NFKC.list ~~ (0x0640, 0x064E, 0x0651,), 'FCF2 -> 0640 064E 0651'; ok Uni.new(0xFCF3).NFKC.list ~~ (0x0640, 0x064F, 0x0651,), 'FCF3 -> 0640 064F 0651'; ok Uni.new(0xFCF4).NFKC.list ~~ (0x0640, 0x0650, 0x0651,), 'FCF4 -> 0640 0650 0651'; ok Uni.new(0xFCF5).NFKC.list ~~ (0x0637, 0x0649,), 'FCF5 -> 0637 0649'; ok Uni.new(0xFCF6).NFKC.list ~~ (0x0637, 0x064A,), 'FCF6 -> 0637 064A'; ok Uni.new(0xFCF7).NFKC.list ~~ (0x0639, 0x0649,), 'FCF7 -> 0639 0649'; ok Uni.new(0xFCF8).NFKC.list ~~ (0x0639, 0x064A,), 'FCF8 -> 0639 064A'; ok Uni.new(0xFCF9).NFKC.list ~~ (0x063A, 0x0649,), 'FCF9 -> 063A 0649'; ok Uni.new(0xFCFA).NFKC.list ~~ (0x063A, 0x064A,), 'FCFA -> 063A 064A'; ok Uni.new(0xFCFB).NFKC.list ~~ (0x0633, 0x0649,), 'FCFB -> 0633 0649'; ok Uni.new(0xFCFC).NFKC.list ~~ (0x0633, 0x064A,), 'FCFC -> 0633 064A'; ok Uni.new(0xFCFD).NFKC.list ~~ (0x0634, 0x0649,), 'FCFD -> 0634 0649'; ok Uni.new(0xFCFE).NFKC.list ~~ (0x0634, 0x064A,), 'FCFE -> 0634 064A'; ok Uni.new(0xFCFF).NFKC.list ~~ (0x062D, 0x0649,), 'FCFF -> 062D 0649'; ok Uni.new(0xFD00).NFKC.list ~~ (0x062D, 0x064A,), 'FD00 -> 062D 064A'; ok Uni.new(0xFD01).NFKC.list ~~ (0x062C, 0x0649,), 'FD01 -> 062C 0649'; ok Uni.new(0xFD02).NFKC.list ~~ (0x062C, 0x064A,), 'FD02 -> 062C 064A'; ok Uni.new(0xFD03).NFKC.list ~~ (0x062E, 0x0649,), 'FD03 -> 062E 0649'; ok Uni.new(0xFD04).NFKC.list ~~ (0x062E, 0x064A,), 'FD04 -> 062E 064A'; ok Uni.new(0xFD05).NFKC.list ~~ (0x0635, 0x0649,), 'FD05 -> 0635 0649'; ok Uni.new(0xFD06).NFKC.list ~~ (0x0635, 0x064A,), 'FD06 -> 0635 064A'; ok Uni.new(0xFD07).NFKC.list ~~ (0x0636, 0x0649,), 'FD07 -> 0636 0649'; ok Uni.new(0xFD08).NFKC.list ~~ (0x0636, 0x064A,), 'FD08 -> 0636 064A'; ok Uni.new(0xFD09).NFKC.list ~~ (0x0634, 0x062C,), 'FD09 -> 0634 062C'; ok Uni.new(0xFD0A).NFKC.list ~~ (0x0634, 0x062D,), 'FD0A -> 0634 062D'; ok Uni.new(0xFD0B).NFKC.list ~~ (0x0634, 0x062E,), 'FD0B -> 0634 062E'; ok Uni.new(0xFD0C).NFKC.list ~~ (0x0634, 0x0645,), 'FD0C -> 0634 0645'; ok Uni.new(0xFD0D).NFKC.list ~~ (0x0634, 0x0631,), 'FD0D -> 0634 0631'; ok Uni.new(0xFD0E).NFKC.list ~~ (0x0633, 0x0631,), 'FD0E -> 0633 0631'; ok Uni.new(0xFD0F).NFKC.list ~~ (0x0635, 0x0631,), 'FD0F -> 0635 0631'; ok Uni.new(0xFD10).NFKC.list ~~ (0x0636, 0x0631,), 'FD10 -> 0636 0631'; ok Uni.new(0xFD11).NFKC.list ~~ (0x0637, 0x0649,), 'FD11 -> 0637 0649'; ok Uni.new(0xFD12).NFKC.list ~~ (0x0637, 0x064A,), 'FD12 -> 0637 064A'; ok Uni.new(0xFD13).NFKC.list ~~ (0x0639, 0x0649,), 'FD13 -> 0639 0649'; ok Uni.new(0xFD14).NFKC.list ~~ (0x0639, 0x064A,), 'FD14 -> 0639 064A'; ok Uni.new(0xFD15).NFKC.list ~~ (0x063A, 0x0649,), 'FD15 -> 063A 0649'; ok Uni.new(0xFD16).NFKC.list ~~ (0x063A, 0x064A,), 'FD16 -> 063A 064A'; ok Uni.new(0xFD17).NFKC.list ~~ (0x0633, 0x0649,), 'FD17 -> 0633 0649'; ok Uni.new(0xFD18).NFKC.list ~~ (0x0633, 0x064A,), 'FD18 -> 0633 064A'; ok Uni.new(0xFD19).NFKC.list ~~ (0x0634, 0x0649,), 'FD19 -> 0634 0649'; ok Uni.new(0xFD1A).NFKC.list ~~ (0x0634, 0x064A,), 'FD1A -> 0634 064A'; ok Uni.new(0xFD1B).NFKC.list ~~ (0x062D, 0x0649,), 'FD1B -> 062D 0649'; ok Uni.new(0xFD1C).NFKC.list ~~ (0x062D, 0x064A,), 'FD1C -> 062D 064A'; ok Uni.new(0xFD1D).NFKC.list ~~ (0x062C, 0x0649,), 'FD1D -> 062C 0649'; ok Uni.new(0xFD1E).NFKC.list ~~ (0x062C, 0x064A,), 'FD1E -> 062C 064A'; ok Uni.new(0xFD1F).NFKC.list ~~ (0x062E, 0x0649,), 'FD1F -> 062E 0649'; ok Uni.new(0xFD20).NFKC.list ~~ (0x062E, 0x064A,), 'FD20 -> 062E 064A'; ok Uni.new(0xFD21).NFKC.list ~~ (0x0635, 0x0649,), 'FD21 -> 0635 0649'; ok Uni.new(0xFD22).NFKC.list ~~ (0x0635, 0x064A,), 'FD22 -> 0635 064A'; ok Uni.new(0xFD23).NFKC.list ~~ (0x0636, 0x0649,), 'FD23 -> 0636 0649'; ok Uni.new(0xFD24).NFKC.list ~~ (0x0636, 0x064A,), 'FD24 -> 0636 064A'; ok Uni.new(0xFD25).NFKC.list ~~ (0x0634, 0x062C,), 'FD25 -> 0634 062C'; ok Uni.new(0xFD26).NFKC.list ~~ (0x0634, 0x062D,), 'FD26 -> 0634 062D'; ok Uni.new(0xFD27).NFKC.list ~~ (0x0634, 0x062E,), 'FD27 -> 0634 062E'; ok Uni.new(0xFD28).NFKC.list ~~ (0x0634, 0x0645,), 'FD28 -> 0634 0645'; ok Uni.new(0xFD29).NFKC.list ~~ (0x0634, 0x0631,), 'FD29 -> 0634 0631'; ok Uni.new(0xFD2A).NFKC.list ~~ (0x0633, 0x0631,), 'FD2A -> 0633 0631'; ok Uni.new(0xFD2B).NFKC.list ~~ (0x0635, 0x0631,), 'FD2B -> 0635 0631'; ok Uni.new(0xFD2C).NFKC.list ~~ (0x0636, 0x0631,), 'FD2C -> 0636 0631'; ok Uni.new(0xFD2D).NFKC.list ~~ (0x0634, 0x062C,), 'FD2D -> 0634 062C'; ok Uni.new(0xFD2E).NFKC.list ~~ (0x0634, 0x062D,), 'FD2E -> 0634 062D'; ok Uni.new(0xFD2F).NFKC.list ~~ (0x0634, 0x062E,), 'FD2F -> 0634 062E'; ok Uni.new(0xFD30).NFKC.list ~~ (0x0634, 0x0645,), 'FD30 -> 0634 0645'; ok Uni.new(0xFD31).NFKC.list ~~ (0x0633, 0x0647,), 'FD31 -> 0633 0647'; ok Uni.new(0xFD32).NFKC.list ~~ (0x0634, 0x0647,), 'FD32 -> 0634 0647'; ok Uni.new(0xFD33).NFKC.list ~~ (0x0637, 0x0645,), 'FD33 -> 0637 0645'; ok Uni.new(0xFD34).NFKC.list ~~ (0x0633, 0x062C,), 'FD34 -> 0633 062C'; ok Uni.new(0xFD35).NFKC.list ~~ (0x0633, 0x062D,), 'FD35 -> 0633 062D'; ok Uni.new(0xFD36).NFKC.list ~~ (0x0633, 0x062E,), 'FD36 -> 0633 062E'; ok Uni.new(0xFD37).NFKC.list ~~ (0x0634, 0x062C,), 'FD37 -> 0634 062C'; ok Uni.new(0xFD38).NFKC.list ~~ (0x0634, 0x062D,), 'FD38 -> 0634 062D'; ok Uni.new(0xFD39).NFKC.list ~~ (0x0634, 0x062E,), 'FD39 -> 0634 062E'; ok Uni.new(0xFD3A).NFKC.list ~~ (0x0637, 0x0645,), 'FD3A -> 0637 0645'; ok Uni.new(0xFD3B).NFKC.list ~~ (0x0638, 0x0645,), 'FD3B -> 0638 0645'; ok Uni.new(0xFD3C).NFKC.list ~~ (0x0627, 0x064B,), 'FD3C -> 0627 064B'; ok Uni.new(0xFD3D).NFKC.list ~~ (0x0627, 0x064B,), 'FD3D -> 0627 064B'; ok Uni.new(0xFD50).NFKC.list ~~ (0x062A, 0x062C, 0x0645,), 'FD50 -> 062A 062C 0645'; ok Uni.new(0xFD51).NFKC.list ~~ (0x062A, 0x062D, 0x062C,), 'FD51 -> 062A 062D 062C'; ok Uni.new(0xFD52).NFKC.list ~~ (0x062A, 0x062D, 0x062C,), 'FD52 -> 062A 062D 062C'; ok Uni.new(0xFD53).NFKC.list ~~ (0x062A, 0x062D, 0x0645,), 'FD53 -> 062A 062D 0645'; ok Uni.new(0xFD54).NFKC.list ~~ (0x062A, 0x062E, 0x0645,), 'FD54 -> 062A 062E 0645'; ok Uni.new(0xFD55).NFKC.list ~~ (0x062A, 0x0645, 0x062C,), 'FD55 -> 062A 0645 062C'; ok Uni.new(0xFD56).NFKC.list ~~ (0x062A, 0x0645, 0x062D,), 'FD56 -> 062A 0645 062D'; ok Uni.new(0xFD57).NFKC.list ~~ (0x062A, 0x0645, 0x062E,), 'FD57 -> 062A 0645 062E'; ok Uni.new(0xFD58).NFKC.list ~~ (0x062C, 0x0645, 0x062D,), 'FD58 -> 062C 0645 062D'; ok Uni.new(0xFD59).NFKC.list ~~ (0x062C, 0x0645, 0x062D,), 'FD59 -> 062C 0645 062D'; ok Uni.new(0xFD5A).NFKC.list ~~ (0x062D, 0x0645, 0x064A,), 'FD5A -> 062D 0645 064A'; ok Uni.new(0xFD5B).NFKC.list ~~ (0x062D, 0x0645, 0x0649,), 'FD5B -> 062D 0645 0649'; ok Uni.new(0xFD5C).NFKC.list ~~ (0x0633, 0x062D, 0x062C,), 'FD5C -> 0633 062D 062C'; ok Uni.new(0xFD5D).NFKC.list ~~ (0x0633, 0x062C, 0x062D,), 'FD5D -> 0633 062C 062D'; ok Uni.new(0xFD5E).NFKC.list ~~ (0x0633, 0x062C, 0x0649,), 'FD5E -> 0633 062C 0649'; ok Uni.new(0xFD5F).NFKC.list ~~ (0x0633, 0x0645, 0x062D,), 'FD5F -> 0633 0645 062D'; ok Uni.new(0xFD60).NFKC.list ~~ (0x0633, 0x0645, 0x062D,), 'FD60 -> 0633 0645 062D'; ok Uni.new(0xFD61).NFKC.list ~~ (0x0633, 0x0645, 0x062C,), 'FD61 -> 0633 0645 062C'; ok Uni.new(0xFD62).NFKC.list ~~ (0x0633, 0x0645, 0x0645,), 'FD62 -> 0633 0645 0645'; ok Uni.new(0xFD63).NFKC.list ~~ (0x0633, 0x0645, 0x0645,), 'FD63 -> 0633 0645 0645'; ok Uni.new(0xFD64).NFKC.list ~~ (0x0635, 0x062D, 0x062D,), 'FD64 -> 0635 062D 062D'; ok Uni.new(0xFD65).NFKC.list ~~ (0x0635, 0x062D, 0x062D,), 'FD65 -> 0635 062D 062D'; ok Uni.new(0xFD66).NFKC.list ~~ (0x0635, 0x0645, 0x0645,), 'FD66 -> 0635 0645 0645'; ok Uni.new(0xFD67).NFKC.list ~~ (0x0634, 0x062D, 0x0645,), 'FD67 -> 0634 062D 0645'; ok Uni.new(0xFD68).NFKC.list ~~ (0x0634, 0x062D, 0x0645,), 'FD68 -> 0634 062D 0645'; ok Uni.new(0xFD69).NFKC.list ~~ (0x0634, 0x062C, 0x064A,), 'FD69 -> 0634 062C 064A'; ok Uni.new(0xFD6A).NFKC.list ~~ (0x0634, 0x0645, 0x062E,), 'FD6A -> 0634 0645 062E'; ok Uni.new(0xFD6B).NFKC.list ~~ (0x0634, 0x0645, 0x062E,), 'FD6B -> 0634 0645 062E'; ok Uni.new(0xFD6C).NFKC.list ~~ (0x0634, 0x0645, 0x0645,), 'FD6C -> 0634 0645 0645'; ok Uni.new(0xFD6D).NFKC.list ~~ (0x0634, 0x0645, 0x0645,), 'FD6D -> 0634 0645 0645'; ok Uni.new(0xFD6E).NFKC.list ~~ (0x0636, 0x062D, 0x0649,), 'FD6E -> 0636 062D 0649'; ok Uni.new(0xFD6F).NFKC.list ~~ (0x0636, 0x062E, 0x0645,), 'FD6F -> 0636 062E 0645'; ok Uni.new(0xFD70).NFKC.list ~~ (0x0636, 0x062E, 0x0645,), 'FD70 -> 0636 062E 0645'; ok Uni.new(0xFD71).NFKC.list ~~ (0x0637, 0x0645, 0x062D,), 'FD71 -> 0637 0645 062D'; ok Uni.new(0xFD72).NFKC.list ~~ (0x0637, 0x0645, 0x062D,), 'FD72 -> 0637 0645 062D'; ok Uni.new(0xFD73).NFKC.list ~~ (0x0637, 0x0645, 0x0645,), 'FD73 -> 0637 0645 0645'; ok Uni.new(0xFD74).NFKC.list ~~ (0x0637, 0x0645, 0x064A,), 'FD74 -> 0637 0645 064A'; ok Uni.new(0xFD75).NFKC.list ~~ (0x0639, 0x062C, 0x0645,), 'FD75 -> 0639 062C 0645'; ok Uni.new(0xFD76).NFKC.list ~~ (0x0639, 0x0645, 0x0645,), 'FD76 -> 0639 0645 0645'; ok Uni.new(0xFD77).NFKC.list ~~ (0x0639, 0x0645, 0x0645,), 'FD77 -> 0639 0645 0645'; ok Uni.new(0xFD78).NFKC.list ~~ (0x0639, 0x0645, 0x0649,), 'FD78 -> 0639 0645 0649'; ok Uni.new(0xFD79).NFKC.list ~~ (0x063A, 0x0645, 0x0645,), 'FD79 -> 063A 0645 0645'; ok Uni.new(0xFD7A).NFKC.list ~~ (0x063A, 0x0645, 0x064A,), 'FD7A -> 063A 0645 064A'; ok Uni.new(0xFD7B).NFKC.list ~~ (0x063A, 0x0645, 0x0649,), 'FD7B -> 063A 0645 0649'; ok Uni.new(0xFD7C).NFKC.list ~~ (0x0641, 0x062E, 0x0645,), 'FD7C -> 0641 062E 0645'; ok Uni.new(0xFD7D).NFKC.list ~~ (0x0641, 0x062E, 0x0645,), 'FD7D -> 0641 062E 0645'; ok Uni.new(0xFD7E).NFKC.list ~~ (0x0642, 0x0645, 0x062D,), 'FD7E -> 0642 0645 062D'; ok Uni.new(0xFD7F).NFKC.list ~~ (0x0642, 0x0645, 0x0645,), 'FD7F -> 0642 0645 0645'; ok Uni.new(0xFD80).NFKC.list ~~ (0x0644, 0x062D, 0x0645,), 'FD80 -> 0644 062D 0645'; ok Uni.new(0xFD81).NFKC.list ~~ (0x0644, 0x062D, 0x064A,), 'FD81 -> 0644 062D 064A'; ok Uni.new(0xFD82).NFKC.list ~~ (0x0644, 0x062D, 0x0649,), 'FD82 -> 0644 062D 0649'; ok Uni.new(0xFD83).NFKC.list ~~ (0x0644, 0x062C, 0x062C,), 'FD83 -> 0644 062C 062C'; ok Uni.new(0xFD84).NFKC.list ~~ (0x0644, 0x062C, 0x062C,), 'FD84 -> 0644 062C 062C'; ok Uni.new(0xFD85).NFKC.list ~~ (0x0644, 0x062E, 0x0645,), 'FD85 -> 0644 062E 0645'; ok Uni.new(0xFD86).NFKC.list ~~ (0x0644, 0x062E, 0x0645,), 'FD86 -> 0644 062E 0645'; ok Uni.new(0xFD87).NFKC.list ~~ (0x0644, 0x0645, 0x062D,), 'FD87 -> 0644 0645 062D'; ok Uni.new(0xFD88).NFKC.list ~~ (0x0644, 0x0645, 0x062D,), 'FD88 -> 0644 0645 062D'; ok Uni.new(0xFD89).NFKC.list ~~ (0x0645, 0x062D, 0x062C,), 'FD89 -> 0645 062D 062C'; ok Uni.new(0xFD8A).NFKC.list ~~ (0x0645, 0x062D, 0x0645,), 'FD8A -> 0645 062D 0645'; ok Uni.new(0xFD8B).NFKC.list ~~ (0x0645, 0x062D, 0x064A,), 'FD8B -> 0645 062D 064A'; ok Uni.new(0xFD8C).NFKC.list ~~ (0x0645, 0x062C, 0x062D,), 'FD8C -> 0645 062C 062D'; ok Uni.new(0xFD8D).NFKC.list ~~ (0x0645, 0x062C, 0x0645,), 'FD8D -> 0645 062C 0645'; ok Uni.new(0xFD8E).NFKC.list ~~ (0x0645, 0x062E, 0x062C,), 'FD8E -> 0645 062E 062C'; ok Uni.new(0xFD8F).NFKC.list ~~ (0x0645, 0x062E, 0x0645,), 'FD8F -> 0645 062E 0645'; ok Uni.new(0xFD92).NFKC.list ~~ (0x0645, 0x062C, 0x062E,), 'FD92 -> 0645 062C 062E'; ok Uni.new(0xFD93).NFKC.list ~~ (0x0647, 0x0645, 0x062C,), 'FD93 -> 0647 0645 062C'; ok Uni.new(0xFD94).NFKC.list ~~ (0x0647, 0x0645, 0x0645,), 'FD94 -> 0647 0645 0645'; ok Uni.new(0xFD95).NFKC.list ~~ (0x0646, 0x062D, 0x0645,), 'FD95 -> 0646 062D 0645'; ok Uni.new(0xFD96).NFKC.list ~~ (0x0646, 0x062D, 0x0649,), 'FD96 -> 0646 062D 0649'; ok Uni.new(0xFD97).NFKC.list ~~ (0x0646, 0x062C, 0x0645,), 'FD97 -> 0646 062C 0645'; ok Uni.new(0xFD98).NFKC.list ~~ (0x0646, 0x062C, 0x0645,), 'FD98 -> 0646 062C 0645'; ok Uni.new(0xFD99).NFKC.list ~~ (0x0646, 0x062C, 0x0649,), 'FD99 -> 0646 062C 0649'; ok Uni.new(0xFD9A).NFKC.list ~~ (0x0646, 0x0645, 0x064A,), 'FD9A -> 0646 0645 064A'; ok Uni.new(0xFD9B).NFKC.list ~~ (0x0646, 0x0645, 0x0649,), 'FD9B -> 0646 0645 0649'; ok Uni.new(0xFD9C).NFKC.list ~~ (0x064A, 0x0645, 0x0645,), 'FD9C -> 064A 0645 0645'; ok Uni.new(0xFD9D).NFKC.list ~~ (0x064A, 0x0645, 0x0645,), 'FD9D -> 064A 0645 0645'; ok Uni.new(0xFD9E).NFKC.list ~~ (0x0628, 0x062E, 0x064A,), 'FD9E -> 0628 062E 064A'; ok Uni.new(0xFD9F).NFKC.list ~~ (0x062A, 0x062C, 0x064A,), 'FD9F -> 062A 062C 064A'; ok Uni.new(0xFDA0).NFKC.list ~~ (0x062A, 0x062C, 0x0649,), 'FDA0 -> 062A 062C 0649'; ok Uni.new(0xFDA1).NFKC.list ~~ (0x062A, 0x062E, 0x064A,), 'FDA1 -> 062A 062E 064A'; ok Uni.new(0xFDA2).NFKC.list ~~ (0x062A, 0x062E, 0x0649,), 'FDA2 -> 062A 062E 0649'; ok Uni.new(0xFDA3).NFKC.list ~~ (0x062A, 0x0645, 0x064A,), 'FDA3 -> 062A 0645 064A'; ok Uni.new(0xFDA4).NFKC.list ~~ (0x062A, 0x0645, 0x0649,), 'FDA4 -> 062A 0645 0649'; ok Uni.new(0xFDA5).NFKC.list ~~ (0x062C, 0x0645, 0x064A,), 'FDA5 -> 062C 0645 064A'; ok Uni.new(0xFDA6).NFKC.list ~~ (0x062C, 0x062D, 0x0649,), 'FDA6 -> 062C 062D 0649'; ok Uni.new(0xFDA7).NFKC.list ~~ (0x062C, 0x0645, 0x0649,), 'FDA7 -> 062C 0645 0649'; ok Uni.new(0xFDA8).NFKC.list ~~ (0x0633, 0x062E, 0x0649,), 'FDA8 -> 0633 062E 0649'; ok Uni.new(0xFDA9).NFKC.list ~~ (0x0635, 0x062D, 0x064A,), 'FDA9 -> 0635 062D 064A'; ok Uni.new(0xFDAA).NFKC.list ~~ (0x0634, 0x062D, 0x064A,), 'FDAA -> 0634 062D 064A'; ok Uni.new(0xFDAB).NFKC.list ~~ (0x0636, 0x062D, 0x064A,), 'FDAB -> 0636 062D 064A'; ok Uni.new(0xFDAC).NFKC.list ~~ (0x0644, 0x062C, 0x064A,), 'FDAC -> 0644 062C 064A'; ok Uni.new(0xFDAD).NFKC.list ~~ (0x0644, 0x0645, 0x064A,), 'FDAD -> 0644 0645 064A'; ok Uni.new(0xFDAE).NFKC.list ~~ (0x064A, 0x062D, 0x064A,), 'FDAE -> 064A 062D 064A'; ok Uni.new(0xFDAF).NFKC.list ~~ (0x064A, 0x062C, 0x064A,), 'FDAF -> 064A 062C 064A'; ok Uni.new(0xFDB0).NFKC.list ~~ (0x064A, 0x0645, 0x064A,), 'FDB0 -> 064A 0645 064A'; ok Uni.new(0xFDB1).NFKC.list ~~ (0x0645, 0x0645, 0x064A,), 'FDB1 -> 0645 0645 064A'; ok Uni.new(0xFDB2).NFKC.list ~~ (0x0642, 0x0645, 0x064A,), 'FDB2 -> 0642 0645 064A'; ok Uni.new(0xFDB3).NFKC.list ~~ (0x0646, 0x062D, 0x064A,), 'FDB3 -> 0646 062D 064A'; ok Uni.new(0xFDB4).NFKC.list ~~ (0x0642, 0x0645, 0x062D,), 'FDB4 -> 0642 0645 062D'; ok Uni.new(0xFDB5).NFKC.list ~~ (0x0644, 0x062D, 0x0645,), 'FDB5 -> 0644 062D 0645'; ok Uni.new(0xFDB6).NFKC.list ~~ (0x0639, 0x0645, 0x064A,), 'FDB6 -> 0639 0645 064A'; ok Uni.new(0xFDB7).NFKC.list ~~ (0x0643, 0x0645, 0x064A,), 'FDB7 -> 0643 0645 064A'; ok Uni.new(0xFDB8).NFKC.list ~~ (0x0646, 0x062C, 0x062D,), 'FDB8 -> 0646 062C 062D'; ok Uni.new(0xFDB9).NFKC.list ~~ (0x0645, 0x062E, 0x064A,), 'FDB9 -> 0645 062E 064A'; ok Uni.new(0xFDBA).NFKC.list ~~ (0x0644, 0x062C, 0x0645,), 'FDBA -> 0644 062C 0645'; ok Uni.new(0xFDBB).NFKC.list ~~ (0x0643, 0x0645, 0x0645,), 'FDBB -> 0643 0645 0645'; ok Uni.new(0xFDBC).NFKC.list ~~ (0x0644, 0x062C, 0x0645,), 'FDBC -> 0644 062C 0645'; ok Uni.new(0xFDBD).NFKC.list ~~ (0x0646, 0x062C, 0x062D,), 'FDBD -> 0646 062C 062D'; ok Uni.new(0xFDBE).NFKC.list ~~ (0x062C, 0x062D, 0x064A,), 'FDBE -> 062C 062D 064A'; ok Uni.new(0xFDBF).NFKC.list ~~ (0x062D, 0x062C, 0x064A,), 'FDBF -> 062D 062C 064A'; ok Uni.new(0xFDC0).NFKC.list ~~ (0x0645, 0x062C, 0x064A,), 'FDC0 -> 0645 062C 064A'; ok Uni.new(0xFDC1).NFKC.list ~~ (0x0641, 0x0645, 0x064A,), 'FDC1 -> 0641 0645 064A'; ok Uni.new(0xFDC2).NFKC.list ~~ (0x0628, 0x062D, 0x064A,), 'FDC2 -> 0628 062D 064A'; ok Uni.new(0xFDC3).NFKC.list ~~ (0x0643, 0x0645, 0x0645,), 'FDC3 -> 0643 0645 0645'; ok Uni.new(0xFDC4).NFKC.list ~~ (0x0639, 0x062C, 0x0645,), 'FDC4 -> 0639 062C 0645'; ok Uni.new(0xFDC5).NFKC.list ~~ (0x0635, 0x0645, 0x0645,), 'FDC5 -> 0635 0645 0645'; ok Uni.new(0xFDC6).NFKC.list ~~ (0x0633, 0x062E, 0x064A,), 'FDC6 -> 0633 062E 064A'; ok Uni.new(0xFDC7).NFKC.list ~~ (0x0646, 0x062C, 0x064A,), 'FDC7 -> 0646 062C 064A'; ok Uni.new(0xFDF0).NFKC.list ~~ (0x0635, 0x0644, 0x06D2,), 'FDF0 -> 0635 0644 06D2'; ok Uni.new(0xFDF1).NFKC.list ~~ (0x0642, 0x0644, 0x06D2,), 'FDF1 -> 0642 0644 06D2'; ok Uni.new(0xFDF2).NFKC.list ~~ (0x0627, 0x0644, 0x0644, 0x0647,), 'FDF2 -> 0627 0644 0644 0647'; ok Uni.new(0xFDF3).NFKC.list ~~ (0x0627, 0x0643, 0x0628, 0x0631,), 'FDF3 -> 0627 0643 0628 0631'; ok Uni.new(0xFDF4).NFKC.list ~~ (0x0645, 0x062D, 0x0645, 0x062F,), 'FDF4 -> 0645 062D 0645 062F'; ok Uni.new(0xFDF5).NFKC.list ~~ (0x0635, 0x0644, 0x0639, 0x0645,), 'FDF5 -> 0635 0644 0639 0645'; ok Uni.new(0xFDF6).NFKC.list ~~ (0x0631, 0x0633, 0x0648, 0x0644,), 'FDF6 -> 0631 0633 0648 0644'; ok Uni.new(0xFDF7).NFKC.list ~~ (0x0639, 0x0644, 0x064A, 0x0647,), 'FDF7 -> 0639 0644 064A 0647'; ok Uni.new(0xFDF8).NFKC.list ~~ (0x0648, 0x0633, 0x0644, 0x0645,), 'FDF8 -> 0648 0633 0644 0645'; ok Uni.new(0xFDF9).NFKC.list ~~ (0x0635, 0x0644, 0x0649,), 'FDF9 -> 0635 0644 0649'; ok Uni.new(0xFDFA).NFKC.list ~~ (0x0635, 0x0644, 0x0649, 0x0020, 0x0627, 0x0644, 0x0644, 0x0647, 0x0020, 0x0639, 0x0644, 0x064A, 0x0647, 0x0020, 0x0648, 0x0633, 0x0644, 0x0645,), 'FDFA -> 0635 0644 0649 0020 0627 0644 0644 0647 0020 0639 0644 064A 0647 0020 0648 0633 0644 0645'; ok Uni.new(0xFDFB).NFKC.list ~~ (0x062C, 0x0644, 0x0020, 0x062C, 0x0644, 0x0627, 0x0644, 0x0647,), 'FDFB -> 062C 0644 0020 062C 0644 0627 0644 0647'; ok Uni.new(0xFDFC).NFKC.list ~~ (0x0631, 0x06CC, 0x0627, 0x0644,), 'FDFC -> 0631 06CC 0627 0644'; ok Uni.new(0xFE10).NFKC.list ~~ (0x002C,), 'FE10 -> 002C'; ok Uni.new(0xFE11).NFKC.list ~~ (0x3001,), 'FE11 -> 3001'; ok Uni.new(0xFE12).NFKC.list ~~ (0x3002,), 'FE12 -> 3002'; ok Uni.new(0xFE13).NFKC.list ~~ (0x003A,), 'FE13 -> 003A'; ok Uni.new(0xFE14).NFKC.list ~~ (0x003B,), 'FE14 -> 003B'; ok Uni.new(0xFE15).NFKC.list ~~ (0x0021,), 'FE15 -> 0021'; ok Uni.new(0xFE16).NFKC.list ~~ (0x003F,), 'FE16 -> 003F'; ok Uni.new(0xFE17).NFKC.list ~~ (0x3016,), 'FE17 -> 3016'; ok Uni.new(0xFE18).NFKC.list ~~ (0x3017,), 'FE18 -> 3017'; ok Uni.new(0xFE19).NFKC.list ~~ (0x002E, 0x002E, 0x002E,), 'FE19 -> 002E 002E 002E'; ok Uni.new(0xFE30).NFKC.list ~~ (0x002E, 0x002E,), 'FE30 -> 002E 002E'; ok Uni.new(0xFE31).NFKC.list ~~ (0x2014,), 'FE31 -> 2014'; ok Uni.new(0xFE32).NFKC.list ~~ (0x2013,), 'FE32 -> 2013'; ok Uni.new(0xFE33).NFKC.list ~~ (0x005F,), 'FE33 -> 005F'; ok Uni.new(0xFE34).NFKC.list ~~ (0x005F,), 'FE34 -> 005F'; ok Uni.new(0xFE35).NFKC.list ~~ (0x0028,), 'FE35 -> 0028'; ok Uni.new(0xFE36).NFKC.list ~~ (0x0029,), 'FE36 -> 0029'; ok Uni.new(0xFE37).NFKC.list ~~ (0x007B,), 'FE37 -> 007B'; ok Uni.new(0xFE38).NFKC.list ~~ (0x007D,), 'FE38 -> 007D'; ok Uni.new(0xFE39).NFKC.list ~~ (0x3014,), 'FE39 -> 3014'; ok Uni.new(0xFE3A).NFKC.list ~~ (0x3015,), 'FE3A -> 3015'; ok Uni.new(0xFE3B).NFKC.list ~~ (0x3010,), 'FE3B -> 3010'; ok Uni.new(0xFE3C).NFKC.list ~~ (0x3011,), 'FE3C -> 3011'; ok Uni.new(0xFE3D).NFKC.list ~~ (0x300A,), 'FE3D -> 300A'; ok Uni.new(0xFE3E).NFKC.list ~~ (0x300B,), 'FE3E -> 300B'; ok Uni.new(0xFE3F).NFKC.list ~~ (0x3008,), 'FE3F -> 3008'; ok Uni.new(0xFE40).NFKC.list ~~ (0x3009,), 'FE40 -> 3009'; ok Uni.new(0xFE41).NFKC.list ~~ (0x300C,), 'FE41 -> 300C'; ok Uni.new(0xFE42).NFKC.list ~~ (0x300D,), 'FE42 -> 300D'; ok Uni.new(0xFE43).NFKC.list ~~ (0x300E,), 'FE43 -> 300E'; ok Uni.new(0xFE44).NFKC.list ~~ (0x300F,), 'FE44 -> 300F'; ok Uni.new(0xFE47).NFKC.list ~~ (0x005B,), 'FE47 -> 005B'; ok Uni.new(0xFE48).NFKC.list ~~ (0x005D,), 'FE48 -> 005D'; ok Uni.new(0xFE49).NFKC.list ~~ (0x0020, 0x0305,), 'FE49 -> 0020 0305'; ok Uni.new(0xFE4A).NFKC.list ~~ (0x0020, 0x0305,), 'FE4A -> 0020 0305'; ok Uni.new(0xFE4B).NFKC.list ~~ (0x0020, 0x0305,), 'FE4B -> 0020 0305'; ok Uni.new(0xFE4C).NFKC.list ~~ (0x0020, 0x0305,), 'FE4C -> 0020 0305'; ok Uni.new(0xFE4D).NFKC.list ~~ (0x005F,), 'FE4D -> 005F'; ok Uni.new(0xFE4E).NFKC.list ~~ (0x005F,), 'FE4E -> 005F'; ok Uni.new(0xFE4F).NFKC.list ~~ (0x005F,), 'FE4F -> 005F'; ok Uni.new(0xFE50).NFKC.list ~~ (0x002C,), 'FE50 -> 002C'; ok Uni.new(0xFE51).NFKC.list ~~ (0x3001,), 'FE51 -> 3001'; ok Uni.new(0xFE52).NFKC.list ~~ (0x002E,), 'FE52 -> 002E'; ok Uni.new(0xFE54).NFKC.list ~~ (0x003B,), 'FE54 -> 003B'; ok Uni.new(0xFE55).NFKC.list ~~ (0x003A,), 'FE55 -> 003A'; ok Uni.new(0xFE56).NFKC.list ~~ (0x003F,), 'FE56 -> 003F'; ok Uni.new(0xFE57).NFKC.list ~~ (0x0021,), 'FE57 -> 0021'; ok Uni.new(0xFE58).NFKC.list ~~ (0x2014,), 'FE58 -> 2014'; ok Uni.new(0xFE59).NFKC.list ~~ (0x0028,), 'FE59 -> 0028'; ok Uni.new(0xFE5A).NFKC.list ~~ (0x0029,), 'FE5A -> 0029'; ok Uni.new(0xFE5B).NFKC.list ~~ (0x007B,), 'FE5B -> 007B'; ok Uni.new(0xFE5C).NFKC.list ~~ (0x007D,), 'FE5C -> 007D'; ok Uni.new(0xFE5D).NFKC.list ~~ (0x3014,), 'FE5D -> 3014'; ok Uni.new(0xFE5E).NFKC.list ~~ (0x3015,), 'FE5E -> 3015'; ok Uni.new(0xFE5F).NFKC.list ~~ (0x0023,), 'FE5F -> 0023'; ok Uni.new(0xFE60).NFKC.list ~~ (0x0026,), 'FE60 -> 0026'; ok Uni.new(0xFE61).NFKC.list ~~ (0x002A,), 'FE61 -> 002A'; ok Uni.new(0xFE62).NFKC.list ~~ (0x002B,), 'FE62 -> 002B'; ok Uni.new(0xFE63).NFKC.list ~~ (0x002D,), 'FE63 -> 002D'; ok Uni.new(0xFE64).NFKC.list ~~ (0x003C,), 'FE64 -> 003C'; ok Uni.new(0xFE65).NFKC.list ~~ (0x003E,), 'FE65 -> 003E'; ok Uni.new(0xFE66).NFKC.list ~~ (0x003D,), 'FE66 -> 003D'; ok Uni.new(0xFE68).NFKC.list ~~ (0x005C,), 'FE68 -> 005C'; ok Uni.new(0xFE69).NFKC.list ~~ (0x0024,), 'FE69 -> 0024'; ok Uni.new(0xFE6A).NFKC.list ~~ (0x0025,), 'FE6A -> 0025'; ok Uni.new(0xFE6B).NFKC.list ~~ (0x0040,), 'FE6B -> 0040'; ok Uni.new(0xFE70).NFKC.list ~~ (0x0020, 0x064B,), 'FE70 -> 0020 064B'; ok Uni.new(0xFE71).NFKC.list ~~ (0x0640, 0x064B,), 'FE71 -> 0640 064B'; ok Uni.new(0xFE72).NFKC.list ~~ (0x0020, 0x064C,), 'FE72 -> 0020 064C'; ok Uni.new(0xFE74).NFKC.list ~~ (0x0020, 0x064D,), 'FE74 -> 0020 064D'; ok Uni.new(0xFE76).NFKC.list ~~ (0x0020, 0x064E,), 'FE76 -> 0020 064E'; ok Uni.new(0xFE77).NFKC.list ~~ (0x0640, 0x064E,), 'FE77 -> 0640 064E'; ok Uni.new(0xFE78).NFKC.list ~~ (0x0020, 0x064F,), 'FE78 -> 0020 064F'; ok Uni.new(0xFE79).NFKC.list ~~ (0x0640, 0x064F,), 'FE79 -> 0640 064F'; ok Uni.new(0xFE7A).NFKC.list ~~ (0x0020, 0x0650,), 'FE7A -> 0020 0650'; ok Uni.new(0xFE7B).NFKC.list ~~ (0x0640, 0x0650,), 'FE7B -> 0640 0650'; ok Uni.new(0xFE7C).NFKC.list ~~ (0x0020, 0x0651,), 'FE7C -> 0020 0651'; ok Uni.new(0xFE7D).NFKC.list ~~ (0x0640, 0x0651,), 'FE7D -> 0640 0651'; ok Uni.new(0xFE7E).NFKC.list ~~ (0x0020, 0x0652,), 'FE7E -> 0020 0652'; ok Uni.new(0xFE7F).NFKC.list ~~ (0x0640, 0x0652,), 'FE7F -> 0640 0652'; ok Uni.new(0xFE80).NFKC.list ~~ (0x0621,), 'FE80 -> 0621'; ok Uni.new(0xFE81).NFKC.list ~~ (0x0622,), 'FE81 -> 0622'; ok Uni.new(0xFE82).NFKC.list ~~ (0x0622,), 'FE82 -> 0622'; ok Uni.new(0xFE83).NFKC.list ~~ (0x0623,), 'FE83 -> 0623'; ok Uni.new(0xFE84).NFKC.list ~~ (0x0623,), 'FE84 -> 0623'; ok Uni.new(0xFE85).NFKC.list ~~ (0x0624,), 'FE85 -> 0624'; ok Uni.new(0xFE86).NFKC.list ~~ (0x0624,), 'FE86 -> 0624'; ok Uni.new(0xFE87).NFKC.list ~~ (0x0625,), 'FE87 -> 0625'; ok Uni.new(0xFE88).NFKC.list ~~ (0x0625,), 'FE88 -> 0625'; ok Uni.new(0xFE89).NFKC.list ~~ (0x0626,), 'FE89 -> 0626'; ok Uni.new(0xFE8A).NFKC.list ~~ (0x0626,), 'FE8A -> 0626'; ok Uni.new(0xFE8B).NFKC.list ~~ (0x0626,), 'FE8B -> 0626'; ok Uni.new(0xFE8C).NFKC.list ~~ (0x0626,), 'FE8C -> 0626'; ok Uni.new(0xFE8D).NFKC.list ~~ (0x0627,), 'FE8D -> 0627'; ok Uni.new(0xFE8E).NFKC.list ~~ (0x0627,), 'FE8E -> 0627'; ok Uni.new(0xFE8F).NFKC.list ~~ (0x0628,), 'FE8F -> 0628'; ok Uni.new(0xFE90).NFKC.list ~~ (0x0628,), 'FE90 -> 0628'; ok Uni.new(0xFE91).NFKC.list ~~ (0x0628,), 'FE91 -> 0628'; ok Uni.new(0xFE92).NFKC.list ~~ (0x0628,), 'FE92 -> 0628'; ok Uni.new(0xFE93).NFKC.list ~~ (0x0629,), 'FE93 -> 0629'; ok Uni.new(0xFE94).NFKC.list ~~ (0x0629,), 'FE94 -> 0629'; ok Uni.new(0xFE95).NFKC.list ~~ (0x062A,), 'FE95 -> 062A'; ok Uni.new(0xFE96).NFKC.list ~~ (0x062A,), 'FE96 -> 062A'; ok Uni.new(0xFE97).NFKC.list ~~ (0x062A,), 'FE97 -> 062A'; ok Uni.new(0xFE98).NFKC.list ~~ (0x062A,), 'FE98 -> 062A'; ok Uni.new(0xFE99).NFKC.list ~~ (0x062B,), 'FE99 -> 062B'; ok Uni.new(0xFE9A).NFKC.list ~~ (0x062B,), 'FE9A -> 062B'; ok Uni.new(0xFE9B).NFKC.list ~~ (0x062B,), 'FE9B -> 062B'; ok Uni.new(0xFE9C).NFKC.list ~~ (0x062B,), 'FE9C -> 062B'; ok Uni.new(0xFE9D).NFKC.list ~~ (0x062C,), 'FE9D -> 062C'; ok Uni.new(0xFE9E).NFKC.list ~~ (0x062C,), 'FE9E -> 062C'; ok Uni.new(0xFE9F).NFKC.list ~~ (0x062C,), 'FE9F -> 062C'; ok Uni.new(0xFEA0).NFKC.list ~~ (0x062C,), 'FEA0 -> 062C'; ok Uni.new(0xFEA1).NFKC.list ~~ (0x062D,), 'FEA1 -> 062D'; ok Uni.new(0xFEA2).NFKC.list ~~ (0x062D,), 'FEA2 -> 062D'; ok Uni.new(0xFEA3).NFKC.list ~~ (0x062D,), 'FEA3 -> 062D'; ok Uni.new(0xFEA4).NFKC.list ~~ (0x062D,), 'FEA4 -> 062D'; ok Uni.new(0xFEA5).NFKC.list ~~ (0x062E,), 'FEA5 -> 062E'; ok Uni.new(0xFEA6).NFKC.list ~~ (0x062E,), 'FEA6 -> 062E'; ok Uni.new(0xFEA7).NFKC.list ~~ (0x062E,), 'FEA7 -> 062E'; ok Uni.new(0xFEA8).NFKC.list ~~ (0x062E,), 'FEA8 -> 062E'; ok Uni.new(0xFEA9).NFKC.list ~~ (0x062F,), 'FEA9 -> 062F'; ok Uni.new(0xFEAA).NFKC.list ~~ (0x062F,), 'FEAA -> 062F'; ok Uni.new(0xFEAB).NFKC.list ~~ (0x0630,), 'FEAB -> 0630'; ok Uni.new(0xFEAC).NFKC.list ~~ (0x0630,), 'FEAC -> 0630'; ok Uni.new(0xFEAD).NFKC.list ~~ (0x0631,), 'FEAD -> 0631'; ok Uni.new(0xFEAE).NFKC.list ~~ (0x0631,), 'FEAE -> 0631'; ok Uni.new(0xFEAF).NFKC.list ~~ (0x0632,), 'FEAF -> 0632'; ok Uni.new(0xFEB0).NFKC.list ~~ (0x0632,), 'FEB0 -> 0632'; ok Uni.new(0xFEB1).NFKC.list ~~ (0x0633,), 'FEB1 -> 0633'; ok Uni.new(0xFEB2).NFKC.list ~~ (0x0633,), 'FEB2 -> 0633'; ok Uni.new(0xFEB3).NFKC.list ~~ (0x0633,), 'FEB3 -> 0633'; ok Uni.new(0xFEB4).NFKC.list ~~ (0x0633,), 'FEB4 -> 0633'; ok Uni.new(0xFEB5).NFKC.list ~~ (0x0634,), 'FEB5 -> 0634'; ok Uni.new(0xFEB6).NFKC.list ~~ (0x0634,), 'FEB6 -> 0634'; ok Uni.new(0xFEB7).NFKC.list ~~ (0x0634,), 'FEB7 -> 0634'; ok Uni.new(0xFEB8).NFKC.list ~~ (0x0634,), 'FEB8 -> 0634'; ok Uni.new(0xFEB9).NFKC.list ~~ (0x0635,), 'FEB9 -> 0635'; ok Uni.new(0xFEBA).NFKC.list ~~ (0x0635,), 'FEBA -> 0635'; ok Uni.new(0xFEBB).NFKC.list ~~ (0x0635,), 'FEBB -> 0635'; ok Uni.new(0xFEBC).NFKC.list ~~ (0x0635,), 'FEBC -> 0635'; ok Uni.new(0xFEBD).NFKC.list ~~ (0x0636,), 'FEBD -> 0636'; ok Uni.new(0xFEBE).NFKC.list ~~ (0x0636,), 'FEBE -> 0636'; ok Uni.new(0xFEBF).NFKC.list ~~ (0x0636,), 'FEBF -> 0636'; ok Uni.new(0xFEC0).NFKC.list ~~ (0x0636,), 'FEC0 -> 0636'; ok Uni.new(0xFEC1).NFKC.list ~~ (0x0637,), 'FEC1 -> 0637'; ok Uni.new(0xFEC2).NFKC.list ~~ (0x0637,), 'FEC2 -> 0637'; ok Uni.new(0xFEC3).NFKC.list ~~ (0x0637,), 'FEC3 -> 0637'; ok Uni.new(0xFEC4).NFKC.list ~~ (0x0637,), 'FEC4 -> 0637'; ok Uni.new(0xFEC5).NFKC.list ~~ (0x0638,), 'FEC5 -> 0638'; ok Uni.new(0xFEC6).NFKC.list ~~ (0x0638,), 'FEC6 -> 0638'; ok Uni.new(0xFEC7).NFKC.list ~~ (0x0638,), 'FEC7 -> 0638'; ok Uni.new(0xFEC8).NFKC.list ~~ (0x0638,), 'FEC8 -> 0638'; ok Uni.new(0xFEC9).NFKC.list ~~ (0x0639,), 'FEC9 -> 0639'; ok Uni.new(0xFECA).NFKC.list ~~ (0x0639,), 'FECA -> 0639'; ok Uni.new(0xFECB).NFKC.list ~~ (0x0639,), 'FECB -> 0639'; ok Uni.new(0xFECC).NFKC.list ~~ (0x0639,), 'FECC -> 0639'; ok Uni.new(0xFECD).NFKC.list ~~ (0x063A,), 'FECD -> 063A'; ok Uni.new(0xFECE).NFKC.list ~~ (0x063A,), 'FECE -> 063A'; ok Uni.new(0xFECF).NFKC.list ~~ (0x063A,), 'FECF -> 063A'; ok Uni.new(0xFED0).NFKC.list ~~ (0x063A,), 'FED0 -> 063A'; ok Uni.new(0xFED1).NFKC.list ~~ (0x0641,), 'FED1 -> 0641'; ok Uni.new(0xFED2).NFKC.list ~~ (0x0641,), 'FED2 -> 0641'; ok Uni.new(0xFED3).NFKC.list ~~ (0x0641,), 'FED3 -> 0641'; ok Uni.new(0xFED4).NFKC.list ~~ (0x0641,), 'FED4 -> 0641'; ok Uni.new(0xFED5).NFKC.list ~~ (0x0642,), 'FED5 -> 0642'; ok Uni.new(0xFED6).NFKC.list ~~ (0x0642,), 'FED6 -> 0642'; ok Uni.new(0xFED7).NFKC.list ~~ (0x0642,), 'FED7 -> 0642'; ok Uni.new(0xFED8).NFKC.list ~~ (0x0642,), 'FED8 -> 0642'; ok Uni.new(0xFED9).NFKC.list ~~ (0x0643,), 'FED9 -> 0643'; ok Uni.new(0xFEDA).NFKC.list ~~ (0x0643,), 'FEDA -> 0643'; ok Uni.new(0xFEDB).NFKC.list ~~ (0x0643,), 'FEDB -> 0643'; ok Uni.new(0xFEDC).NFKC.list ~~ (0x0643,), 'FEDC -> 0643'; ok Uni.new(0xFEDD).NFKC.list ~~ (0x0644,), 'FEDD -> 0644'; ok Uni.new(0xFEDE).NFKC.list ~~ (0x0644,), 'FEDE -> 0644'; ok Uni.new(0xFEDF).NFKC.list ~~ (0x0644,), 'FEDF -> 0644'; ok Uni.new(0xFEE0).NFKC.list ~~ (0x0644,), 'FEE0 -> 0644'; ok Uni.new(0xFEE1).NFKC.list ~~ (0x0645,), 'FEE1 -> 0645'; ok Uni.new(0xFEE2).NFKC.list ~~ (0x0645,), 'FEE2 -> 0645'; ok Uni.new(0xFEE3).NFKC.list ~~ (0x0645,), 'FEE3 -> 0645'; ok Uni.new(0xFEE4).NFKC.list ~~ (0x0645,), 'FEE4 -> 0645'; ok Uni.new(0xFEE5).NFKC.list ~~ (0x0646,), 'FEE5 -> 0646'; ok Uni.new(0xFEE6).NFKC.list ~~ (0x0646,), 'FEE6 -> 0646'; ok Uni.new(0xFEE7).NFKC.list ~~ (0x0646,), 'FEE7 -> 0646'; ok Uni.new(0xFEE8).NFKC.list ~~ (0x0646,), 'FEE8 -> 0646'; ok Uni.new(0xFEE9).NFKC.list ~~ (0x0647,), 'FEE9 -> 0647'; ok Uni.new(0xFEEA).NFKC.list ~~ (0x0647,), 'FEEA -> 0647'; ok Uni.new(0xFEEB).NFKC.list ~~ (0x0647,), 'FEEB -> 0647'; ok Uni.new(0xFEEC).NFKC.list ~~ (0x0647,), 'FEEC -> 0647'; ok Uni.new(0xFEED).NFKC.list ~~ (0x0648,), 'FEED -> 0648'; ok Uni.new(0xFEEE).NFKC.list ~~ (0x0648,), 'FEEE -> 0648'; ok Uni.new(0xFEEF).NFKC.list ~~ (0x0649,), 'FEEF -> 0649'; ok Uni.new(0xFEF0).NFKC.list ~~ (0x0649,), 'FEF0 -> 0649'; ok Uni.new(0xFEF1).NFKC.list ~~ (0x064A,), 'FEF1 -> 064A'; ok Uni.new(0xFEF2).NFKC.list ~~ (0x064A,), 'FEF2 -> 064A'; ok Uni.new(0xFEF3).NFKC.list ~~ (0x064A,), 'FEF3 -> 064A'; ok Uni.new(0xFEF4).NFKC.list ~~ (0x064A,), 'FEF4 -> 064A'; ok Uni.new(0xFEF5).NFKC.list ~~ (0x0644, 0x0622,), 'FEF5 -> 0644 0622'; ok Uni.new(0xFEF6).NFKC.list ~~ (0x0644, 0x0622,), 'FEF6 -> 0644 0622'; ok Uni.new(0xFEF7).NFKC.list ~~ (0x0644, 0x0623,), 'FEF7 -> 0644 0623'; ok Uni.new(0xFEF8).NFKC.list ~~ (0x0644, 0x0623,), 'FEF8 -> 0644 0623'; ok Uni.new(0xFEF9).NFKC.list ~~ (0x0644, 0x0625,), 'FEF9 -> 0644 0625'; ok Uni.new(0xFEFA).NFKC.list ~~ (0x0644, 0x0625,), 'FEFA -> 0644 0625'; ok Uni.new(0xFEFB).NFKC.list ~~ (0x0644, 0x0627,), 'FEFB -> 0644 0627'; ok Uni.new(0xFEFC).NFKC.list ~~ (0x0644, 0x0627,), 'FEFC -> 0644 0627'; ok Uni.new(0xFF01).NFKC.list ~~ (0x0021,), 'FF01 -> 0021'; ok Uni.new(0xFF02).NFKC.list ~~ (0x0022,), 'FF02 -> 0022'; ok Uni.new(0xFF03).NFKC.list ~~ (0x0023,), 'FF03 -> 0023'; ok Uni.new(0xFF04).NFKC.list ~~ (0x0024,), 'FF04 -> 0024'; ok Uni.new(0xFF05).NFKC.list ~~ (0x0025,), 'FF05 -> 0025'; ok Uni.new(0xFF06).NFKC.list ~~ (0x0026,), 'FF06 -> 0026'; ok Uni.new(0xFF07).NFKC.list ~~ (0x0027,), 'FF07 -> 0027'; ok Uni.new(0xFF08).NFKC.list ~~ (0x0028,), 'FF08 -> 0028'; ok Uni.new(0xFF09).NFKC.list ~~ (0x0029,), 'FF09 -> 0029'; ok Uni.new(0xFF0A).NFKC.list ~~ (0x002A,), 'FF0A -> 002A'; ok Uni.new(0xFF0B).NFKC.list ~~ (0x002B,), 'FF0B -> 002B'; ok Uni.new(0xFF0C).NFKC.list ~~ (0x002C,), 'FF0C -> 002C'; ok Uni.new(0xFF0D).NFKC.list ~~ (0x002D,), 'FF0D -> 002D'; ok Uni.new(0xFF0E).NFKC.list ~~ (0x002E,), 'FF0E -> 002E'; ok Uni.new(0xFF0F).NFKC.list ~~ (0x002F,), 'FF0F -> 002F'; ok Uni.new(0xFF10).NFKC.list ~~ (0x0030,), 'FF10 -> 0030'; ok Uni.new(0xFF11).NFKC.list ~~ (0x0031,), 'FF11 -> 0031'; ok Uni.new(0xFF12).NFKC.list ~~ (0x0032,), 'FF12 -> 0032'; ok Uni.new(0xFF13).NFKC.list ~~ (0x0033,), 'FF13 -> 0033'; ok Uni.new(0xFF14).NFKC.list ~~ (0x0034,), 'FF14 -> 0034'; ok Uni.new(0xFF15).NFKC.list ~~ (0x0035,), 'FF15 -> 0035'; ok Uni.new(0xFF16).NFKC.list ~~ (0x0036,), 'FF16 -> 0036'; ok Uni.new(0xFF17).NFKC.list ~~ (0x0037,), 'FF17 -> 0037'; ok Uni.new(0xFF18).NFKC.list ~~ (0x0038,), 'FF18 -> 0038'; ok Uni.new(0xFF19).NFKC.list ~~ (0x0039,), 'FF19 -> 0039'; ok Uni.new(0xFF1A).NFKC.list ~~ (0x003A,), 'FF1A -> 003A'; ok Uni.new(0xFF1B).NFKC.list ~~ (0x003B,), 'FF1B -> 003B'; ok Uni.new(0xFF1C).NFKC.list ~~ (0x003C,), 'FF1C -> 003C'; ok Uni.new(0xFF1D).NFKC.list ~~ (0x003D,), 'FF1D -> 003D'; ok Uni.new(0xFF1E).NFKC.list ~~ (0x003E,), 'FF1E -> 003E'; ok Uni.new(0xFF1F).NFKC.list ~~ (0x003F,), 'FF1F -> 003F'; ok Uni.new(0xFF20).NFKC.list ~~ (0x0040,), 'FF20 -> 0040'; ok Uni.new(0xFF21).NFKC.list ~~ (0x0041,), 'FF21 -> 0041'; ok Uni.new(0xFF22).NFKC.list ~~ (0x0042,), 'FF22 -> 0042'; ok Uni.new(0xFF23).NFKC.list ~~ (0x0043,), 'FF23 -> 0043'; ok Uni.new(0xFF24).NFKC.list ~~ (0x0044,), 'FF24 -> 0044'; ok Uni.new(0xFF25).NFKC.list ~~ (0x0045,), 'FF25 -> 0045'; ok Uni.new(0xFF26).NFKC.list ~~ (0x0046,), 'FF26 -> 0046'; ok Uni.new(0xFF27).NFKC.list ~~ (0x0047,), 'FF27 -> 0047'; ok Uni.new(0xFF28).NFKC.list ~~ (0x0048,), 'FF28 -> 0048'; ok Uni.new(0xFF29).NFKC.list ~~ (0x0049,), 'FF29 -> 0049'; ok Uni.new(0xFF2A).NFKC.list ~~ (0x004A,), 'FF2A -> 004A'; ok Uni.new(0xFF2B).NFKC.list ~~ (0x004B,), 'FF2B -> 004B'; ok Uni.new(0xFF2C).NFKC.list ~~ (0x004C,), 'FF2C -> 004C'; ok Uni.new(0xFF2D).NFKC.list ~~ (0x004D,), 'FF2D -> 004D'; ok Uni.new(0xFF2E).NFKC.list ~~ (0x004E,), 'FF2E -> 004E'; ok Uni.new(0xFF2F).NFKC.list ~~ (0x004F,), 'FF2F -> 004F'; ok Uni.new(0xFF30).NFKC.list ~~ (0x0050,), 'FF30 -> 0050'; ok Uni.new(0xFF31).NFKC.list ~~ (0x0051,), 'FF31 -> 0051'; ok Uni.new(0xFF32).NFKC.list ~~ (0x0052,), 'FF32 -> 0052'; ok Uni.new(0xFF33).NFKC.list ~~ (0x0053,), 'FF33 -> 0053'; ok Uni.new(0xFF34).NFKC.list ~~ (0x0054,), 'FF34 -> 0054'; ok Uni.new(0xFF35).NFKC.list ~~ (0x0055,), 'FF35 -> 0055'; ok Uni.new(0xFF36).NFKC.list ~~ (0x0056,), 'FF36 -> 0056'; ok Uni.new(0xFF37).NFKC.list ~~ (0x0057,), 'FF37 -> 0057'; ok Uni.new(0xFF38).NFKC.list ~~ (0x0058,), 'FF38 -> 0058'; ok Uni.new(0xFF39).NFKC.list ~~ (0x0059,), 'FF39 -> 0059'; ok Uni.new(0xFF3A).NFKC.list ~~ (0x005A,), 'FF3A -> 005A'; ok Uni.new(0xFF3B).NFKC.list ~~ (0x005B,), 'FF3B -> 005B'; ok Uni.new(0xFF3C).NFKC.list ~~ (0x005C,), 'FF3C -> 005C'; ok Uni.new(0xFF3D).NFKC.list ~~ (0x005D,), 'FF3D -> 005D'; ok Uni.new(0xFF3E).NFKC.list ~~ (0x005E,), 'FF3E -> 005E'; ok Uni.new(0xFF3F).NFKC.list ~~ (0x005F,), 'FF3F -> 005F'; ok Uni.new(0xFF40).NFKC.list ~~ (0x0060,), 'FF40 -> 0060'; ok Uni.new(0xFF41).NFKC.list ~~ (0x0061,), 'FF41 -> 0061'; ok Uni.new(0xFF42).NFKC.list ~~ (0x0062,), 'FF42 -> 0062'; ok Uni.new(0xFF43).NFKC.list ~~ (0x0063,), 'FF43 -> 0063'; ok Uni.new(0xFF44).NFKC.list ~~ (0x0064,), 'FF44 -> 0064'; ok Uni.new(0xFF45).NFKC.list ~~ (0x0065,), 'FF45 -> 0065'; ok Uni.new(0xFF46).NFKC.list ~~ (0x0066,), 'FF46 -> 0066'; ok Uni.new(0xFF47).NFKC.list ~~ (0x0067,), 'FF47 -> 0067'; ok Uni.new(0xFF48).NFKC.list ~~ (0x0068,), 'FF48 -> 0068'; ok Uni.new(0xFF49).NFKC.list ~~ (0x0069,), 'FF49 -> 0069'; ok Uni.new(0xFF4A).NFKC.list ~~ (0x006A,), 'FF4A -> 006A'; ok Uni.new(0xFF4B).NFKC.list ~~ (0x006B,), 'FF4B -> 006B'; ok Uni.new(0xFF4C).NFKC.list ~~ (0x006C,), 'FF4C -> 006C'; ok Uni.new(0xFF4D).NFKC.list ~~ (0x006D,), 'FF4D -> 006D'; ok Uni.new(0xFF4E).NFKC.list ~~ (0x006E,), 'FF4E -> 006E'; ok Uni.new(0xFF4F).NFKC.list ~~ (0x006F,), 'FF4F -> 006F'; ok Uni.new(0xFF50).NFKC.list ~~ (0x0070,), 'FF50 -> 0070'; ok Uni.new(0xFF51).NFKC.list ~~ (0x0071,), 'FF51 -> 0071'; ok Uni.new(0xFF52).NFKC.list ~~ (0x0072,), 'FF52 -> 0072'; ok Uni.new(0xFF53).NFKC.list ~~ (0x0073,), 'FF53 -> 0073'; ok Uni.new(0xFF54).NFKC.list ~~ (0x0074,), 'FF54 -> 0074'; ok Uni.new(0xFF55).NFKC.list ~~ (0x0075,), 'FF55 -> 0075'; ok Uni.new(0xFF56).NFKC.list ~~ (0x0076,), 'FF56 -> 0076'; ok Uni.new(0xFF57).NFKC.list ~~ (0x0077,), 'FF57 -> 0077'; ok Uni.new(0xFF58).NFKC.list ~~ (0x0078,), 'FF58 -> 0078'; ok Uni.new(0xFF59).NFKC.list ~~ (0x0079,), 'FF59 -> 0079'; ok Uni.new(0xFF5A).NFKC.list ~~ (0x007A,), 'FF5A -> 007A'; ok Uni.new(0xFF5B).NFKC.list ~~ (0x007B,), 'FF5B -> 007B'; ok Uni.new(0xFF5C).NFKC.list ~~ (0x007C,), 'FF5C -> 007C'; ok Uni.new(0xFF5D).NFKC.list ~~ (0x007D,), 'FF5D -> 007D'; ok Uni.new(0xFF5E).NFKC.list ~~ (0x007E,), 'FF5E -> 007E'; ok Uni.new(0xFF5F).NFKC.list ~~ (0x2985,), 'FF5F -> 2985'; ok Uni.new(0xFF60).NFKC.list ~~ (0x2986,), 'FF60 -> 2986'; ok Uni.new(0xFF61).NFKC.list ~~ (0x3002,), 'FF61 -> 3002'; ok Uni.new(0xFF62).NFKC.list ~~ (0x300C,), 'FF62 -> 300C'; ok Uni.new(0xFF63).NFKC.list ~~ (0x300D,), 'FF63 -> 300D'; ok Uni.new(0xFF64).NFKC.list ~~ (0x3001,), 'FF64 -> 3001'; ok Uni.new(0xFF65).NFKC.list ~~ (0x30FB,), 'FF65 -> 30FB'; ok Uni.new(0xFF66).NFKC.list ~~ (0x30F2,), 'FF66 -> 30F2'; ok Uni.new(0xFF67).NFKC.list ~~ (0x30A1,), 'FF67 -> 30A1'; ok Uni.new(0xFF68).NFKC.list ~~ (0x30A3,), 'FF68 -> 30A3'; ok Uni.new(0xFF69).NFKC.list ~~ (0x30A5,), 'FF69 -> 30A5'; ok Uni.new(0xFF6A).NFKC.list ~~ (0x30A7,), 'FF6A -> 30A7'; ok Uni.new(0xFF6B).NFKC.list ~~ (0x30A9,), 'FF6B -> 30A9'; ok Uni.new(0xFF6C).NFKC.list ~~ (0x30E3,), 'FF6C -> 30E3'; ok Uni.new(0xFF6D).NFKC.list ~~ (0x30E5,), 'FF6D -> 30E5'; ok Uni.new(0xFF6E).NFKC.list ~~ (0x30E7,), 'FF6E -> 30E7'; ok Uni.new(0xFF6F).NFKC.list ~~ (0x30C3,), 'FF6F -> 30C3'; ok Uni.new(0xFF70).NFKC.list ~~ (0x30FC,), 'FF70 -> 30FC'; ok Uni.new(0xFF71).NFKC.list ~~ (0x30A2,), 'FF71 -> 30A2'; ok Uni.new(0xFF72).NFKC.list ~~ (0x30A4,), 'FF72 -> 30A4'; ok Uni.new(0xFF73).NFKC.list ~~ (0x30A6,), 'FF73 -> 30A6'; ok Uni.new(0xFF74).NFKC.list ~~ (0x30A8,), 'FF74 -> 30A8'; ok Uni.new(0xFF75).NFKC.list ~~ (0x30AA,), 'FF75 -> 30AA'; ok Uni.new(0xFF76).NFKC.list ~~ (0x30AB,), 'FF76 -> 30AB'; ok Uni.new(0xFF77).NFKC.list ~~ (0x30AD,), 'FF77 -> 30AD'; ok Uni.new(0xFF78).NFKC.list ~~ (0x30AF,), 'FF78 -> 30AF'; ok Uni.new(0xFF79).NFKC.list ~~ (0x30B1,), 'FF79 -> 30B1'; ok Uni.new(0xFF7A).NFKC.list ~~ (0x30B3,), 'FF7A -> 30B3'; ok Uni.new(0xFF7B).NFKC.list ~~ (0x30B5,), 'FF7B -> 30B5'; ok Uni.new(0xFF7C).NFKC.list ~~ (0x30B7,), 'FF7C -> 30B7'; ok Uni.new(0xFF7D).NFKC.list ~~ (0x30B9,), 'FF7D -> 30B9'; ok Uni.new(0xFF7E).NFKC.list ~~ (0x30BB,), 'FF7E -> 30BB'; ok Uni.new(0xFF7F).NFKC.list ~~ (0x30BD,), 'FF7F -> 30BD'; ok Uni.new(0xFF80).NFKC.list ~~ (0x30BF,), 'FF80 -> 30BF'; ok Uni.new(0xFF81).NFKC.list ~~ (0x30C1,), 'FF81 -> 30C1'; ok Uni.new(0xFF82).NFKC.list ~~ (0x30C4,), 'FF82 -> 30C4'; ok Uni.new(0xFF83).NFKC.list ~~ (0x30C6,), 'FF83 -> 30C6'; ok Uni.new(0xFF84).NFKC.list ~~ (0x30C8,), 'FF84 -> 30C8'; ok Uni.new(0xFF85).NFKC.list ~~ (0x30CA,), 'FF85 -> 30CA'; ok Uni.new(0xFF86).NFKC.list ~~ (0x30CB,), 'FF86 -> 30CB'; ok Uni.new(0xFF87).NFKC.list ~~ (0x30CC,), 'FF87 -> 30CC'; ok Uni.new(0xFF88).NFKC.list ~~ (0x30CD,), 'FF88 -> 30CD'; ok Uni.new(0xFF89).NFKC.list ~~ (0x30CE,), 'FF89 -> 30CE'; ok Uni.new(0xFF8A).NFKC.list ~~ (0x30CF,), 'FF8A -> 30CF'; ok Uni.new(0xFF8B).NFKC.list ~~ (0x30D2,), 'FF8B -> 30D2'; ok Uni.new(0xFF8C).NFKC.list ~~ (0x30D5,), 'FF8C -> 30D5'; ok Uni.new(0xFF8D).NFKC.list ~~ (0x30D8,), 'FF8D -> 30D8'; ok Uni.new(0xFF8E).NFKC.list ~~ (0x30DB,), 'FF8E -> 30DB'; ok Uni.new(0xFF8F).NFKC.list ~~ (0x30DE,), 'FF8F -> 30DE'; ok Uni.new(0xFF90).NFKC.list ~~ (0x30DF,), 'FF90 -> 30DF'; ok Uni.new(0xFF91).NFKC.list ~~ (0x30E0,), 'FF91 -> 30E0'; ok Uni.new(0xFF92).NFKC.list ~~ (0x30E1,), 'FF92 -> 30E1'; ok Uni.new(0xFF93).NFKC.list ~~ (0x30E2,), 'FF93 -> 30E2'; ok Uni.new(0xFF94).NFKC.list ~~ (0x30E4,), 'FF94 -> 30E4'; ok Uni.new(0xFF95).NFKC.list ~~ (0x30E6,), 'FF95 -> 30E6'; ok Uni.new(0xFF96).NFKC.list ~~ (0x30E8,), 'FF96 -> 30E8'; ok Uni.new(0xFF97).NFKC.list ~~ (0x30E9,), 'FF97 -> 30E9'; ok Uni.new(0xFF98).NFKC.list ~~ (0x30EA,), 'FF98 -> 30EA'; ok Uni.new(0xFF99).NFKC.list ~~ (0x30EB,), 'FF99 -> 30EB'; ok Uni.new(0xFF9A).NFKC.list ~~ (0x30EC,), 'FF9A -> 30EC'; ok Uni.new(0xFF9B).NFKC.list ~~ (0x30ED,), 'FF9B -> 30ED'; ok Uni.new(0xFF9C).NFKC.list ~~ (0x30EF,), 'FF9C -> 30EF'; ok Uni.new(0xFF9D).NFKC.list ~~ (0x30F3,), 'FF9D -> 30F3'; ok Uni.new(0xFF9E).NFKC.list ~~ (0x3099,), 'FF9E -> 3099'; ok Uni.new(0xFF9F).NFKC.list ~~ (0x309A,), 'FF9F -> 309A'; ok Uni.new(0xFFA0).NFKC.list ~~ (0x1160,), 'FFA0 -> 1160'; ok Uni.new(0xFFA1).NFKC.list ~~ (0x1100,), 'FFA1 -> 1100'; ok Uni.new(0xFFA2).NFKC.list ~~ (0x1101,), 'FFA2 -> 1101'; ok Uni.new(0xFFA3).NFKC.list ~~ (0x11AA,), 'FFA3 -> 11AA'; ok Uni.new(0xFFA4).NFKC.list ~~ (0x1102,), 'FFA4 -> 1102'; ok Uni.new(0xFFA5).NFKC.list ~~ (0x11AC,), 'FFA5 -> 11AC'; ok Uni.new(0xFFA6).NFKC.list ~~ (0x11AD,), 'FFA6 -> 11AD'; ok Uni.new(0xFFA7).NFKC.list ~~ (0x1103,), 'FFA7 -> 1103'; ok Uni.new(0xFFA8).NFKC.list ~~ (0x1104,), 'FFA8 -> 1104'; ok Uni.new(0xFFA9).NFKC.list ~~ (0x1105,), 'FFA9 -> 1105'; ok Uni.new(0xFFAA).NFKC.list ~~ (0x11B0,), 'FFAA -> 11B0'; ok Uni.new(0xFFAB).NFKC.list ~~ (0x11B1,), 'FFAB -> 11B1'; ok Uni.new(0xFFAC).NFKC.list ~~ (0x11B2,), 'FFAC -> 11B2'; ok Uni.new(0xFFAD).NFKC.list ~~ (0x11B3,), 'FFAD -> 11B3'; ok Uni.new(0xFFAE).NFKC.list ~~ (0x11B4,), 'FFAE -> 11B4'; ok Uni.new(0xFFAF).NFKC.list ~~ (0x11B5,), 'FFAF -> 11B5'; ok Uni.new(0xFFB0).NFKC.list ~~ (0x111A,), 'FFB0 -> 111A'; ok Uni.new(0xFFB1).NFKC.list ~~ (0x1106,), 'FFB1 -> 1106'; ok Uni.new(0xFFB2).NFKC.list ~~ (0x1107,), 'FFB2 -> 1107'; ok Uni.new(0xFFB3).NFKC.list ~~ (0x1108,), 'FFB3 -> 1108'; ok Uni.new(0xFFB4).NFKC.list ~~ (0x1121,), 'FFB4 -> 1121'; ok Uni.new(0xFFB5).NFKC.list ~~ (0x1109,), 'FFB5 -> 1109'; ok Uni.new(0xFFB6).NFKC.list ~~ (0x110A,), 'FFB6 -> 110A'; ok Uni.new(0xFFB7).NFKC.list ~~ (0x110B,), 'FFB7 -> 110B'; ok Uni.new(0xFFB8).NFKC.list ~~ (0x110C,), 'FFB8 -> 110C'; ok Uni.new(0xFFB9).NFKC.list ~~ (0x110D,), 'FFB9 -> 110D'; ok Uni.new(0xFFBA).NFKC.list ~~ (0x110E,), 'FFBA -> 110E'; ok Uni.new(0xFFBB).NFKC.list ~~ (0x110F,), 'FFBB -> 110F'; ok Uni.new(0xFFBC).NFKC.list ~~ (0x1110,), 'FFBC -> 1110'; ok Uni.new(0xFFBD).NFKC.list ~~ (0x1111,), 'FFBD -> 1111'; ok Uni.new(0xFFBE).NFKC.list ~~ (0x1112,), 'FFBE -> 1112'; ok Uni.new(0xFFC2).NFKC.list ~~ (0x1161,), 'FFC2 -> 1161'; ok Uni.new(0xFFC3).NFKC.list ~~ (0x1162,), 'FFC3 -> 1162'; ok Uni.new(0xFFC4).NFKC.list ~~ (0x1163,), 'FFC4 -> 1163'; ok Uni.new(0xFFC5).NFKC.list ~~ (0x1164,), 'FFC5 -> 1164'; ok Uni.new(0xFFC6).NFKC.list ~~ (0x1165,), 'FFC6 -> 1165'; ok Uni.new(0xFFC7).NFKC.list ~~ (0x1166,), 'FFC7 -> 1166'; ok Uni.new(0xFFCA).NFKC.list ~~ (0x1167,), 'FFCA -> 1167'; ok Uni.new(0xFFCB).NFKC.list ~~ (0x1168,), 'FFCB -> 1168'; ok Uni.new(0xFFCC).NFKC.list ~~ (0x1169,), 'FFCC -> 1169'; ok Uni.new(0xFFCD).NFKC.list ~~ (0x116A,), 'FFCD -> 116A'; ok Uni.new(0xFFCE).NFKC.list ~~ (0x116B,), 'FFCE -> 116B'; ok Uni.new(0xFFCF).NFKC.list ~~ (0x116C,), 'FFCF -> 116C'; ok Uni.new(0xFFD2).NFKC.list ~~ (0x116D,), 'FFD2 -> 116D'; ok Uni.new(0xFFD3).NFKC.list ~~ (0x116E,), 'FFD3 -> 116E'; ok Uni.new(0xFFD4).NFKC.list ~~ (0x116F,), 'FFD4 -> 116F'; ok Uni.new(0xFFD5).NFKC.list ~~ (0x1170,), 'FFD5 -> 1170'; ok Uni.new(0xFFD6).NFKC.list ~~ (0x1171,), 'FFD6 -> 1171'; ok Uni.new(0xFFD7).NFKC.list ~~ (0x1172,), 'FFD7 -> 1172'; ok Uni.new(0xFFDA).NFKC.list ~~ (0x1173,), 'FFDA -> 1173'; ok Uni.new(0xFFDB).NFKC.list ~~ (0x1174,), 'FFDB -> 1174'; ok Uni.new(0xFFDC).NFKC.list ~~ (0x1175,), 'FFDC -> 1175'; ok Uni.new(0xFFE0).NFKC.list ~~ (0x00A2,), 'FFE0 -> 00A2'; ok Uni.new(0xFFE1).NFKC.list ~~ (0x00A3,), 'FFE1 -> 00A3'; ok Uni.new(0xFFE2).NFKC.list ~~ (0x00AC,), 'FFE2 -> 00AC'; ok Uni.new(0xFFE3).NFKC.list ~~ (0x0020, 0x0304,), 'FFE3 -> 0020 0304'; ok Uni.new(0xFFE4).NFKC.list ~~ (0x00A6,), 'FFE4 -> 00A6'; ok Uni.new(0xFFE5).NFKC.list ~~ (0x00A5,), 'FFE5 -> 00A5'; ok Uni.new(0xFFE6).NFKC.list ~~ (0x20A9,), 'FFE6 -> 20A9'; ok Uni.new(0xFFE8).NFKC.list ~~ (0x2502,), 'FFE8 -> 2502'; ok Uni.new(0xFFE9).NFKC.list ~~ (0x2190,), 'FFE9 -> 2190'; ok Uni.new(0xFFEA).NFKC.list ~~ (0x2191,), 'FFEA -> 2191'; ok Uni.new(0xFFEB).NFKC.list ~~ (0x2192,), 'FFEB -> 2192'; ok Uni.new(0xFFEC).NFKC.list ~~ (0x2193,), 'FFEC -> 2193'; ok Uni.new(0xFFED).NFKC.list ~~ (0x25A0,), 'FFED -> 25A0'; ok Uni.new(0xFFEE).NFKC.list ~~ (0x25CB,), 'FFEE -> 25CB'; ok Uni.new(0x1109A).NFKC.list ~~ (0x1109A,), '1109A -> 1109A'; ok Uni.new(0x1109C).NFKC.list ~~ (0x1109C,), '1109C -> 1109C'; ok Uni.new(0x110AB).NFKC.list ~~ (0x110AB,), '110AB -> 110AB'; ok Uni.new(0x1112E).NFKC.list ~~ (0x1112E,), '1112E -> 1112E'; ok Uni.new(0x1112F).NFKC.list ~~ (0x1112F,), '1112F -> 1112F'; ok Uni.new(0x1134B).NFKC.list ~~ (0x1134B,), '1134B -> 1134B'; ok Uni.new(0x1134C).NFKC.list ~~ (0x1134C,), '1134C -> 1134C'; ok Uni.new(0x114BB).NFKC.list ~~ (0x114BB,), '114BB -> 114BB'; ok Uni.new(0x114BC).NFKC.list ~~ (0x114BC,), '114BC -> 114BC'; ok Uni.new(0x114BE).NFKC.list ~~ (0x114BE,), '114BE -> 114BE'; ok Uni.new(0x115BA).NFKC.list ~~ (0x115BA,), '115BA -> 115BA'; ok Uni.new(0x115BB).NFKC.list ~~ (0x115BB,), '115BB -> 115BB'; ok Uni.new(0x1D15E).NFKC.list ~~ (0x1D157, 0x1D165,), '1D15E -> 1D157 1D165'; ok Uni.new(0x1D15F).NFKC.list ~~ (0x1D158, 0x1D165,), '1D15F -> 1D158 1D165'; ok Uni.new(0x1D160).NFKC.list ~~ (0x1D158, 0x1D165, 0x1D16E,), '1D160 -> 1D158 1D165 1D16E'; ok Uni.new(0x1D161).NFKC.list ~~ (0x1D158, 0x1D165, 0x1D16F,), '1D161 -> 1D158 1D165 1D16F'; ok Uni.new(0x1D162).NFKC.list ~~ (0x1D158, 0x1D165, 0x1D170,), '1D162 -> 1D158 1D165 1D170'; ok Uni.new(0x1D163).NFKC.list ~~ (0x1D158, 0x1D165, 0x1D171,), '1D163 -> 1D158 1D165 1D171'; ok Uni.new(0x1D164).NFKC.list ~~ (0x1D158, 0x1D165, 0x1D172,), '1D164 -> 1D158 1D165 1D172'; ok Uni.new(0x1D1BB).NFKC.list ~~ (0x1D1B9, 0x1D165,), '1D1BB -> 1D1B9 1D165'; ok Uni.new(0x1D1BC).NFKC.list ~~ (0x1D1BA, 0x1D165,), '1D1BC -> 1D1BA 1D165'; ok Uni.new(0x1D1BD).NFKC.list ~~ (0x1D1B9, 0x1D165, 0x1D16E,), '1D1BD -> 1D1B9 1D165 1D16E'; ok Uni.new(0x1D1BE).NFKC.list ~~ (0x1D1BA, 0x1D165, 0x1D16E,), '1D1BE -> 1D1BA 1D165 1D16E'; ok Uni.new(0x1D1BF).NFKC.list ~~ (0x1D1B9, 0x1D165, 0x1D16F,), '1D1BF -> 1D1B9 1D165 1D16F'; ok Uni.new(0x1D1C0).NFKC.list ~~ (0x1D1BA, 0x1D165, 0x1D16F,), '1D1C0 -> 1D1BA 1D165 1D16F'; ok Uni.new(0x1D400).NFKC.list ~~ (0x0041,), '1D400 -> 0041'; ok Uni.new(0x1D401).NFKC.list ~~ (0x0042,), '1D401 -> 0042'; ok Uni.new(0x1D402).NFKC.list ~~ (0x0043,), '1D402 -> 0043'; ok Uni.new(0x1D403).NFKC.list ~~ (0x0044,), '1D403 -> 0044'; ok Uni.new(0x1D404).NFKC.list ~~ (0x0045,), '1D404 -> 0045'; ok Uni.new(0x1D405).NFKC.list ~~ (0x0046,), '1D405 -> 0046'; ok Uni.new(0x1D406).NFKC.list ~~ (0x0047,), '1D406 -> 0047'; ok Uni.new(0x1D407).NFKC.list ~~ (0x0048,), '1D407 -> 0048'; ok Uni.new(0x1D408).NFKC.list ~~ (0x0049,), '1D408 -> 0049'; ok Uni.new(0x1D409).NFKC.list ~~ (0x004A,), '1D409 -> 004A'; ok Uni.new(0x1D40A).NFKC.list ~~ (0x004B,), '1D40A -> 004B'; ok Uni.new(0x1D40B).NFKC.list ~~ (0x004C,), '1D40B -> 004C'; ok Uni.new(0x1D40C).NFKC.list ~~ (0x004D,), '1D40C -> 004D'; ok Uni.new(0x1D40D).NFKC.list ~~ (0x004E,), '1D40D -> 004E'; ok Uni.new(0x1D40E).NFKC.list ~~ (0x004F,), '1D40E -> 004F'; ok Uni.new(0x1D40F).NFKC.list ~~ (0x0050,), '1D40F -> 0050'; ok Uni.new(0x1D410).NFKC.list ~~ (0x0051,), '1D410 -> 0051'; ok Uni.new(0x1D411).NFKC.list ~~ (0x0052,), '1D411 -> 0052'; ok Uni.new(0x1D412).NFKC.list ~~ (0x0053,), '1D412 -> 0053'; ok Uni.new(0x1D413).NFKC.list ~~ (0x0054,), '1D413 -> 0054'; ok Uni.new(0x1D414).NFKC.list ~~ (0x0055,), '1D414 -> 0055'; ok Uni.new(0x1D415).NFKC.list ~~ (0x0056,), '1D415 -> 0056'; ok Uni.new(0x1D416).NFKC.list ~~ (0x0057,), '1D416 -> 0057'; ok Uni.new(0x1D417).NFKC.list ~~ (0x0058,), '1D417 -> 0058'; ok Uni.new(0x1D418).NFKC.list ~~ (0x0059,), '1D418 -> 0059'; ok Uni.new(0x1D419).NFKC.list ~~ (0x005A,), '1D419 -> 005A'; ok Uni.new(0x1D41A).NFKC.list ~~ (0x0061,), '1D41A -> 0061'; ok Uni.new(0x1D41B).NFKC.list ~~ (0x0062,), '1D41B -> 0062'; ok Uni.new(0x1D41C).NFKC.list ~~ (0x0063,), '1D41C -> 0063'; ok Uni.new(0x1D41D).NFKC.list ~~ (0x0064,), '1D41D -> 0064'; ok Uni.new(0x1D41E).NFKC.list ~~ (0x0065,), '1D41E -> 0065'; ok Uni.new(0x1D41F).NFKC.list ~~ (0x0066,), '1D41F -> 0066'; ok Uni.new(0x1D420).NFKC.list ~~ (0x0067,), '1D420 -> 0067'; ok Uni.new(0x1D421).NFKC.list ~~ (0x0068,), '1D421 -> 0068'; ok Uni.new(0x1D422).NFKC.list ~~ (0x0069,), '1D422 -> 0069'; ok Uni.new(0x1D423).NFKC.list ~~ (0x006A,), '1D423 -> 006A'; ok Uni.new(0x1D424).NFKC.list ~~ (0x006B,), '1D424 -> 006B'; ok Uni.new(0x1D425).NFKC.list ~~ (0x006C,), '1D425 -> 006C'; ok Uni.new(0x1D426).NFKC.list ~~ (0x006D,), '1D426 -> 006D'; ok Uni.new(0x1D427).NFKC.list ~~ (0x006E,), '1D427 -> 006E'; ok Uni.new(0x1D428).NFKC.list ~~ (0x006F,), '1D428 -> 006F'; ok Uni.new(0x1D429).NFKC.list ~~ (0x0070,), '1D429 -> 0070'; ok Uni.new(0x1D42A).NFKC.list ~~ (0x0071,), '1D42A -> 0071'; ok Uni.new(0x1D42B).NFKC.list ~~ (0x0072,), '1D42B -> 0072'; ok Uni.new(0x1D42C).NFKC.list ~~ (0x0073,), '1D42C -> 0073'; ok Uni.new(0x1D42D).NFKC.list ~~ (0x0074,), '1D42D -> 0074'; ok Uni.new(0x1D42E).NFKC.list ~~ (0x0075,), '1D42E -> 0075'; ok Uni.new(0x1D42F).NFKC.list ~~ (0x0076,), '1D42F -> 0076'; ok Uni.new(0x1D430).NFKC.list ~~ (0x0077,), '1D430 -> 0077'; ok Uni.new(0x1D431).NFKC.list ~~ (0x0078,), '1D431 -> 0078'; ok Uni.new(0x1D432).NFKC.list ~~ (0x0079,), '1D432 -> 0079'; ok Uni.new(0x1D433).NFKC.list ~~ (0x007A,), '1D433 -> 007A'; ok Uni.new(0x1D434).NFKC.list ~~ (0x0041,), '1D434 -> 0041'; ok Uni.new(0x1D435).NFKC.list ~~ (0x0042,), '1D435 -> 0042'; ok Uni.new(0x1D436).NFKC.list ~~ (0x0043,), '1D436 -> 0043'; ok Uni.new(0x1D437).NFKC.list ~~ (0x0044,), '1D437 -> 0044'; ok Uni.new(0x1D438).NFKC.list ~~ (0x0045,), '1D438 -> 0045'; ok Uni.new(0x1D439).NFKC.list ~~ (0x0046,), '1D439 -> 0046'; ok Uni.new(0x1D43A).NFKC.list ~~ (0x0047,), '1D43A -> 0047'; ok Uni.new(0x1D43B).NFKC.list ~~ (0x0048,), '1D43B -> 0048'; ok Uni.new(0x1D43C).NFKC.list ~~ (0x0049,), '1D43C -> 0049'; ok Uni.new(0x1D43D).NFKC.list ~~ (0x004A,), '1D43D -> 004A'; ok Uni.new(0x1D43E).NFKC.list ~~ (0x004B,), '1D43E -> 004B'; ok Uni.new(0x1D43F).NFKC.list ~~ (0x004C,), '1D43F -> 004C'; ok Uni.new(0x1D440).NFKC.list ~~ (0x004D,), '1D440 -> 004D'; ok Uni.new(0x1D441).NFKC.list ~~ (0x004E,), '1D441 -> 004E'; ok Uni.new(0x1D442).NFKC.list ~~ (0x004F,), '1D442 -> 004F'; ok Uni.new(0x1D443).NFKC.list ~~ (0x0050,), '1D443 -> 0050'; ok Uni.new(0x1D444).NFKC.list ~~ (0x0051,), '1D444 -> 0051'; ok Uni.new(0x1D445).NFKC.list ~~ (0x0052,), '1D445 -> 0052'; ok Uni.new(0x1D446).NFKC.list ~~ (0x0053,), '1D446 -> 0053'; ok Uni.new(0x1D447).NFKC.list ~~ (0x0054,), '1D447 -> 0054'; ok Uni.new(0x1D448).NFKC.list ~~ (0x0055,), '1D448 -> 0055'; ok Uni.new(0x1D449).NFKC.list ~~ (0x0056,), '1D449 -> 0056'; ok Uni.new(0x1D44A).NFKC.list ~~ (0x0057,), '1D44A -> 0057'; ok Uni.new(0x1D44B).NFKC.list ~~ (0x0058,), '1D44B -> 0058'; ok Uni.new(0x1D44C).NFKC.list ~~ (0x0059,), '1D44C -> 0059'; ok Uni.new(0x1D44D).NFKC.list ~~ (0x005A,), '1D44D -> 005A'; ok Uni.new(0x1D44E).NFKC.list ~~ (0x0061,), '1D44E -> 0061'; ok Uni.new(0x1D44F).NFKC.list ~~ (0x0062,), '1D44F -> 0062'; ok Uni.new(0x1D450).NFKC.list ~~ (0x0063,), '1D450 -> 0063'; ok Uni.new(0x1D451).NFKC.list ~~ (0x0064,), '1D451 -> 0064'; ok Uni.new(0x1D452).NFKC.list ~~ (0x0065,), '1D452 -> 0065'; ok Uni.new(0x1D453).NFKC.list ~~ (0x0066,), '1D453 -> 0066'; ok Uni.new(0x1D454).NFKC.list ~~ (0x0067,), '1D454 -> 0067'; ok Uni.new(0x1D456).NFKC.list ~~ (0x0069,), '1D456 -> 0069'; ok Uni.new(0x1D457).NFKC.list ~~ (0x006A,), '1D457 -> 006A'; ok Uni.new(0x1D458).NFKC.list ~~ (0x006B,), '1D458 -> 006B'; ok Uni.new(0x1D459).NFKC.list ~~ (0x006C,), '1D459 -> 006C'; ok Uni.new(0x1D45A).NFKC.list ~~ (0x006D,), '1D45A -> 006D'; ok Uni.new(0x1D45B).NFKC.list ~~ (0x006E,), '1D45B -> 006E'; ok Uni.new(0x1D45C).NFKC.list ~~ (0x006F,), '1D45C -> 006F'; ok Uni.new(0x1D45D).NFKC.list ~~ (0x0070,), '1D45D -> 0070'; ok Uni.new(0x1D45E).NFKC.list ~~ (0x0071,), '1D45E -> 0071'; ok Uni.new(0x1D45F).NFKC.list ~~ (0x0072,), '1D45F -> 0072'; ok Uni.new(0x1D460).NFKC.list ~~ (0x0073,), '1D460 -> 0073'; ok Uni.new(0x1D461).NFKC.list ~~ (0x0074,), '1D461 -> 0074'; ok Uni.new(0x1D462).NFKC.list ~~ (0x0075,), '1D462 -> 0075'; ok Uni.new(0x1D463).NFKC.list ~~ (0x0076,), '1D463 -> 0076'; ok Uni.new(0x1D464).NFKC.list ~~ (0x0077,), '1D464 -> 0077'; ok Uni.new(0x1D465).NFKC.list ~~ (0x0078,), '1D465 -> 0078'; ok Uni.new(0x1D466).NFKC.list ~~ (0x0079,), '1D466 -> 0079'; ok Uni.new(0x1D467).NFKC.list ~~ (0x007A,), '1D467 -> 007A'; ok Uni.new(0x1D468).NFKC.list ~~ (0x0041,), '1D468 -> 0041'; ok Uni.new(0x1D469).NFKC.list ~~ (0x0042,), '1D469 -> 0042'; ok Uni.new(0x1D46A).NFKC.list ~~ (0x0043,), '1D46A -> 0043'; ok Uni.new(0x1D46B).NFKC.list ~~ (0x0044,), '1D46B -> 0044'; ok Uni.new(0x1D46C).NFKC.list ~~ (0x0045,), '1D46C -> 0045'; ok Uni.new(0x1D46D).NFKC.list ~~ (0x0046,), '1D46D -> 0046'; ok Uni.new(0x1D46E).NFKC.list ~~ (0x0047,), '1D46E -> 0047'; ok Uni.new(0x1D46F).NFKC.list ~~ (0x0048,), '1D46F -> 0048'; ok Uni.new(0x1D470).NFKC.list ~~ (0x0049,), '1D470 -> 0049'; ok Uni.new(0x1D471).NFKC.list ~~ (0x004A,), '1D471 -> 004A'; ok Uni.new(0x1D472).NFKC.list ~~ (0x004B,), '1D472 -> 004B'; ok Uni.new(0x1D473).NFKC.list ~~ (0x004C,), '1D473 -> 004C'; ok Uni.new(0x1D474).NFKC.list ~~ (0x004D,), '1D474 -> 004D'; ok Uni.new(0x1D475).NFKC.list ~~ (0x004E,), '1D475 -> 004E'; ok Uni.new(0x1D476).NFKC.list ~~ (0x004F,), '1D476 -> 004F'; ok Uni.new(0x1D477).NFKC.list ~~ (0x0050,), '1D477 -> 0050'; ok Uni.new(0x1D478).NFKC.list ~~ (0x0051,), '1D478 -> 0051'; ok Uni.new(0x1D479).NFKC.list ~~ (0x0052,), '1D479 -> 0052'; ok Uni.new(0x1D47A).NFKC.list ~~ (0x0053,), '1D47A -> 0053'; ok Uni.new(0x1D47B).NFKC.list ~~ (0x0054,), '1D47B -> 0054'; ok Uni.new(0x1D47C).NFKC.list ~~ (0x0055,), '1D47C -> 0055'; ok Uni.new(0x1D47D).NFKC.list ~~ (0x0056,), '1D47D -> 0056'; ok Uni.new(0x1D47E).NFKC.list ~~ (0x0057,), '1D47E -> 0057'; ok Uni.new(0x1D47F).NFKC.list ~~ (0x0058,), '1D47F -> 0058'; ok Uni.new(0x1D480).NFKC.list ~~ (0x0059,), '1D480 -> 0059'; ok Uni.new(0x1D481).NFKC.list ~~ (0x005A,), '1D481 -> 005A'; ok Uni.new(0x1D482).NFKC.list ~~ (0x0061,), '1D482 -> 0061'; ok Uni.new(0x1D483).NFKC.list ~~ (0x0062,), '1D483 -> 0062'; ok Uni.new(0x1D484).NFKC.list ~~ (0x0063,), '1D484 -> 0063'; ok Uni.new(0x1D485).NFKC.list ~~ (0x0064,), '1D485 -> 0064'; ok Uni.new(0x1D486).NFKC.list ~~ (0x0065,), '1D486 -> 0065'; ok Uni.new(0x1D487).NFKC.list ~~ (0x0066,), '1D487 -> 0066'; ok Uni.new(0x1D488).NFKC.list ~~ (0x0067,), '1D488 -> 0067'; ok Uni.new(0x1D489).NFKC.list ~~ (0x0068,), '1D489 -> 0068'; ok Uni.new(0x1D48A).NFKC.list ~~ (0x0069,), '1D48A -> 0069'; ok Uni.new(0x1D48B).NFKC.list ~~ (0x006A,), '1D48B -> 006A'; ok Uni.new(0x1D48C).NFKC.list ~~ (0x006B,), '1D48C -> 006B'; ok Uni.new(0x1D48D).NFKC.list ~~ (0x006C,), '1D48D -> 006C'; ok Uni.new(0x1D48E).NFKC.list ~~ (0x006D,), '1D48E -> 006D'; ok Uni.new(0x1D48F).NFKC.list ~~ (0x006E,), '1D48F -> 006E'; ok Uni.new(0x1D490).NFKC.list ~~ (0x006F,), '1D490 -> 006F'; ok Uni.new(0x1D491).NFKC.list ~~ (0x0070,), '1D491 -> 0070'; ok Uni.new(0x1D492).NFKC.list ~~ (0x0071,), '1D492 -> 0071'; ok Uni.new(0x1D493).NFKC.list ~~ (0x0072,), '1D493 -> 0072'; ok Uni.new(0x1D494).NFKC.list ~~ (0x0073,), '1D494 -> 0073'; ok Uni.new(0x1D495).NFKC.list ~~ (0x0074,), '1D495 -> 0074'; ok Uni.new(0x1D496).NFKC.list ~~ (0x0075,), '1D496 -> 0075'; ok Uni.new(0x1D497).NFKC.list ~~ (0x0076,), '1D497 -> 0076'; ok Uni.new(0x1D498).NFKC.list ~~ (0x0077,), '1D498 -> 0077'; ok Uni.new(0x1D499).NFKC.list ~~ (0x0078,), '1D499 -> 0078'; ok Uni.new(0x1D49A).NFKC.list ~~ (0x0079,), '1D49A -> 0079'; ok Uni.new(0x1D49B).NFKC.list ~~ (0x007A,), '1D49B -> 007A'; ok Uni.new(0x1D49C).NFKC.list ~~ (0x0041,), '1D49C -> 0041'; ok Uni.new(0x1D49E).NFKC.list ~~ (0x0043,), '1D49E -> 0043'; ok Uni.new(0x1D49F).NFKC.list ~~ (0x0044,), '1D49F -> 0044'; ok Uni.new(0x1D4A2).NFKC.list ~~ (0x0047,), '1D4A2 -> 0047'; ok Uni.new(0x1D4A5).NFKC.list ~~ (0x004A,), '1D4A5 -> 004A'; ok Uni.new(0x1D4A6).NFKC.list ~~ (0x004B,), '1D4A6 -> 004B'; ok Uni.new(0x1D4A9).NFKC.list ~~ (0x004E,), '1D4A9 -> 004E'; ok Uni.new(0x1D4AA).NFKC.list ~~ (0x004F,), '1D4AA -> 004F'; ok Uni.new(0x1D4AB).NFKC.list ~~ (0x0050,), '1D4AB -> 0050'; ok Uni.new(0x1D4AC).NFKC.list ~~ (0x0051,), '1D4AC -> 0051'; ok Uni.new(0x1D4AE).NFKC.list ~~ (0x0053,), '1D4AE -> 0053'; ok Uni.new(0x1D4AF).NFKC.list ~~ (0x0054,), '1D4AF -> 0054'; ok Uni.new(0x1D4B0).NFKC.list ~~ (0x0055,), '1D4B0 -> 0055'; ok Uni.new(0x1D4B1).NFKC.list ~~ (0x0056,), '1D4B1 -> 0056'; ok Uni.new(0x1D4B2).NFKC.list ~~ (0x0057,), '1D4B2 -> 0057'; ok Uni.new(0x1D4B3).NFKC.list ~~ (0x0058,), '1D4B3 -> 0058'; ok Uni.new(0x1D4B4).NFKC.list ~~ (0x0059,), '1D4B4 -> 0059'; ok Uni.new(0x1D4B5).NFKC.list ~~ (0x005A,), '1D4B5 -> 005A'; ok Uni.new(0x1D4B6).NFKC.list ~~ (0x0061,), '1D4B6 -> 0061'; ok Uni.new(0x1D4B7).NFKC.list ~~ (0x0062,), '1D4B7 -> 0062'; ok Uni.new(0x1D4B8).NFKC.list ~~ (0x0063,), '1D4B8 -> 0063'; ok Uni.new(0x1D4B9).NFKC.list ~~ (0x0064,), '1D4B9 -> 0064'; ok Uni.new(0x1D4BB).NFKC.list ~~ (0x0066,), '1D4BB -> 0066'; ok Uni.new(0x1D4BD).NFKC.list ~~ (0x0068,), '1D4BD -> 0068'; ok Uni.new(0x1D4BE).NFKC.list ~~ (0x0069,), '1D4BE -> 0069'; ok Uni.new(0x1D4BF).NFKC.list ~~ (0x006A,), '1D4BF -> 006A'; ok Uni.new(0x1D4C0).NFKC.list ~~ (0x006B,), '1D4C0 -> 006B'; ok Uni.new(0x1D4C1).NFKC.list ~~ (0x006C,), '1D4C1 -> 006C'; ok Uni.new(0x1D4C2).NFKC.list ~~ (0x006D,), '1D4C2 -> 006D'; ok Uni.new(0x1D4C3).NFKC.list ~~ (0x006E,), '1D4C3 -> 006E'; ok Uni.new(0x1D4C5).NFKC.list ~~ (0x0070,), '1D4C5 -> 0070'; ok Uni.new(0x1D4C6).NFKC.list ~~ (0x0071,), '1D4C6 -> 0071'; ok Uni.new(0x1D4C7).NFKC.list ~~ (0x0072,), '1D4C7 -> 0072'; ok Uni.new(0x1D4C8).NFKC.list ~~ (0x0073,), '1D4C8 -> 0073'; ok Uni.new(0x1D4C9).NFKC.list ~~ (0x0074,), '1D4C9 -> 0074'; ok Uni.new(0x1D4CA).NFKC.list ~~ (0x0075,), '1D4CA -> 0075'; ok Uni.new(0x1D4CB).NFKC.list ~~ (0x0076,), '1D4CB -> 0076'; ok Uni.new(0x1D4CC).NFKC.list ~~ (0x0077,), '1D4CC -> 0077'; ok Uni.new(0x1D4CD).NFKC.list ~~ (0x0078,), '1D4CD -> 0078'; ok Uni.new(0x1D4CE).NFKC.list ~~ (0x0079,), '1D4CE -> 0079'; ok Uni.new(0x1D4CF).NFKC.list ~~ (0x007A,), '1D4CF -> 007A'; ok Uni.new(0x1D4D0).NFKC.list ~~ (0x0041,), '1D4D0 -> 0041'; ok Uni.new(0x1D4D1).NFKC.list ~~ (0x0042,), '1D4D1 -> 0042'; ok Uni.new(0x1D4D2).NFKC.list ~~ (0x0043,), '1D4D2 -> 0043'; ok Uni.new(0x1D4D3).NFKC.list ~~ (0x0044,), '1D4D3 -> 0044'; ok Uni.new(0x1D4D4).NFKC.list ~~ (0x0045,), '1D4D4 -> 0045'; ok Uni.new(0x1D4D5).NFKC.list ~~ (0x0046,), '1D4D5 -> 0046'; ok Uni.new(0x1D4D6).NFKC.list ~~ (0x0047,), '1D4D6 -> 0047'; ok Uni.new(0x1D4D7).NFKC.list ~~ (0x0048,), '1D4D7 -> 0048'; ok Uni.new(0x1D4D8).NFKC.list ~~ (0x0049,), '1D4D8 -> 0049'; ok Uni.new(0x1D4D9).NFKC.list ~~ (0x004A,), '1D4D9 -> 004A'; ok Uni.new(0x1D4DA).NFKC.list ~~ (0x004B,), '1D4DA -> 004B'; ok Uni.new(0x1D4DB).NFKC.list ~~ (0x004C,), '1D4DB -> 004C'; ok Uni.new(0x1D4DC).NFKC.list ~~ (0x004D,), '1D4DC -> 004D'; ok Uni.new(0x1D4DD).NFKC.list ~~ (0x004E,), '1D4DD -> 004E'; ok Uni.new(0x1D4DE).NFKC.list ~~ (0x004F,), '1D4DE -> 004F'; ok Uni.new(0x1D4DF).NFKC.list ~~ (0x0050,), '1D4DF -> 0050'; ok Uni.new(0x1D4E0).NFKC.list ~~ (0x0051,), '1D4E0 -> 0051'; ok Uni.new(0x1D4E1).NFKC.list ~~ (0x0052,), '1D4E1 -> 0052'; ok Uni.new(0x1D4E2).NFKC.list ~~ (0x0053,), '1D4E2 -> 0053'; ok Uni.new(0x1D4E3).NFKC.list ~~ (0x0054,), '1D4E3 -> 0054'; ok Uni.new(0x1D4E4).NFKC.list ~~ (0x0055,), '1D4E4 -> 0055'; ok Uni.new(0x1D4E5).NFKC.list ~~ (0x0056,), '1D4E5 -> 0056'; ok Uni.new(0x1D4E6).NFKC.list ~~ (0x0057,), '1D4E6 -> 0057'; ok Uni.new(0x1D4E7).NFKC.list ~~ (0x0058,), '1D4E7 -> 0058'; ok Uni.new(0x1D4E8).NFKC.list ~~ (0x0059,), '1D4E8 -> 0059'; ok Uni.new(0x1D4E9).NFKC.list ~~ (0x005A,), '1D4E9 -> 005A'; ok Uni.new(0x1D4EA).NFKC.list ~~ (0x0061,), '1D4EA -> 0061'; ok Uni.new(0x1D4EB).NFKC.list ~~ (0x0062,), '1D4EB -> 0062'; ok Uni.new(0x1D4EC).NFKC.list ~~ (0x0063,), '1D4EC -> 0063'; ok Uni.new(0x1D4ED).NFKC.list ~~ (0x0064,), '1D4ED -> 0064'; ok Uni.new(0x1D4EE).NFKC.list ~~ (0x0065,), '1D4EE -> 0065'; ok Uni.new(0x1D4EF).NFKC.list ~~ (0x0066,), '1D4EF -> 0066'; ok Uni.new(0x1D4F0).NFKC.list ~~ (0x0067,), '1D4F0 -> 0067'; ok Uni.new(0x1D4F1).NFKC.list ~~ (0x0068,), '1D4F1 -> 0068'; ok Uni.new(0x1D4F2).NFKC.list ~~ (0x0069,), '1D4F2 -> 0069'; ok Uni.new(0x1D4F3).NFKC.list ~~ (0x006A,), '1D4F3 -> 006A'; ok Uni.new(0x1D4F4).NFKC.list ~~ (0x006B,), '1D4F4 -> 006B'; ok Uni.new(0x1D4F5).NFKC.list ~~ (0x006C,), '1D4F5 -> 006C'; ok Uni.new(0x1D4F6).NFKC.list ~~ (0x006D,), '1D4F6 -> 006D'; ok Uni.new(0x1D4F7).NFKC.list ~~ (0x006E,), '1D4F7 -> 006E'; ok Uni.new(0x1D4F8).NFKC.list ~~ (0x006F,), '1D4F8 -> 006F'; ok Uni.new(0x1D4F9).NFKC.list ~~ (0x0070,), '1D4F9 -> 0070'; ok Uni.new(0x1D4FA).NFKC.list ~~ (0x0071,), '1D4FA -> 0071'; ok Uni.new(0x1D4FB).NFKC.list ~~ (0x0072,), '1D4FB -> 0072'; ok Uni.new(0x1D4FC).NFKC.list ~~ (0x0073,), '1D4FC -> 0073'; ok Uni.new(0x1D4FD).NFKC.list ~~ (0x0074,), '1D4FD -> 0074'; ok Uni.new(0x1D4FE).NFKC.list ~~ (0x0075,), '1D4FE -> 0075'; ok Uni.new(0x1D4FF).NFKC.list ~~ (0x0076,), '1D4FF -> 0076'; ok Uni.new(0x1D500).NFKC.list ~~ (0x0077,), '1D500 -> 0077'; ok Uni.new(0x1D501).NFKC.list ~~ (0x0078,), '1D501 -> 0078'; ok Uni.new(0x1D502).NFKC.list ~~ (0x0079,), '1D502 -> 0079'; ok Uni.new(0x1D503).NFKC.list ~~ (0x007A,), '1D503 -> 007A'; ok Uni.new(0x1D504).NFKC.list ~~ (0x0041,), '1D504 -> 0041'; ok Uni.new(0x1D505).NFKC.list ~~ (0x0042,), '1D505 -> 0042'; ok Uni.new(0x1D507).NFKC.list ~~ (0x0044,), '1D507 -> 0044'; ok Uni.new(0x1D508).NFKC.list ~~ (0x0045,), '1D508 -> 0045'; ok Uni.new(0x1D509).NFKC.list ~~ (0x0046,), '1D509 -> 0046'; ok Uni.new(0x1D50A).NFKC.list ~~ (0x0047,), '1D50A -> 0047'; ok Uni.new(0x1D50D).NFKC.list ~~ (0x004A,), '1D50D -> 004A'; ok Uni.new(0x1D50E).NFKC.list ~~ (0x004B,), '1D50E -> 004B'; ok Uni.new(0x1D50F).NFKC.list ~~ (0x004C,), '1D50F -> 004C'; ok Uni.new(0x1D510).NFKC.list ~~ (0x004D,), '1D510 -> 004D'; ok Uni.new(0x1D511).NFKC.list ~~ (0x004E,), '1D511 -> 004E'; ok Uni.new(0x1D512).NFKC.list ~~ (0x004F,), '1D512 -> 004F'; ok Uni.new(0x1D513).NFKC.list ~~ (0x0050,), '1D513 -> 0050'; ok Uni.new(0x1D514).NFKC.list ~~ (0x0051,), '1D514 -> 0051'; ok Uni.new(0x1D516).NFKC.list ~~ (0x0053,), '1D516 -> 0053'; ok Uni.new(0x1D517).NFKC.list ~~ (0x0054,), '1D517 -> 0054'; ok Uni.new(0x1D518).NFKC.list ~~ (0x0055,), '1D518 -> 0055'; ok Uni.new(0x1D519).NFKC.list ~~ (0x0056,), '1D519 -> 0056'; ok Uni.new(0x1D51A).NFKC.list ~~ (0x0057,), '1D51A -> 0057'; ok Uni.new(0x1D51B).NFKC.list ~~ (0x0058,), '1D51B -> 0058'; ok Uni.new(0x1D51C).NFKC.list ~~ (0x0059,), '1D51C -> 0059'; ok Uni.new(0x1D51E).NFKC.list ~~ (0x0061,), '1D51E -> 0061'; ok Uni.new(0x1D51F).NFKC.list ~~ (0x0062,), '1D51F -> 0062'; ok Uni.new(0x1D520).NFKC.list ~~ (0x0063,), '1D520 -> 0063'; ok Uni.new(0x1D521).NFKC.list ~~ (0x0064,), '1D521 -> 0064'; ok Uni.new(0x1D522).NFKC.list ~~ (0x0065,), '1D522 -> 0065'; ok Uni.new(0x1D523).NFKC.list ~~ (0x0066,), '1D523 -> 0066'; ok Uni.new(0x1D524).NFKC.list ~~ (0x0067,), '1D524 -> 0067'; ok Uni.new(0x1D525).NFKC.list ~~ (0x0068,), '1D525 -> 0068'; ok Uni.new(0x1D526).NFKC.list ~~ (0x0069,), '1D526 -> 0069'; ok Uni.new(0x1D527).NFKC.list ~~ (0x006A,), '1D527 -> 006A'; ok Uni.new(0x1D528).NFKC.list ~~ (0x006B,), '1D528 -> 006B'; ok Uni.new(0x1D529).NFKC.list ~~ (0x006C,), '1D529 -> 006C'; ok Uni.new(0x1D52A).NFKC.list ~~ (0x006D,), '1D52A -> 006D'; ok Uni.new(0x1D52B).NFKC.list ~~ (0x006E,), '1D52B -> 006E'; ok Uni.new(0x1D52C).NFKC.list ~~ (0x006F,), '1D52C -> 006F'; ok Uni.new(0x1D52D).NFKC.list ~~ (0x0070,), '1D52D -> 0070'; ok Uni.new(0x1D52E).NFKC.list ~~ (0x0071,), '1D52E -> 0071'; ok Uni.new(0x1D52F).NFKC.list ~~ (0x0072,), '1D52F -> 0072'; ok Uni.new(0x1D530).NFKC.list ~~ (0x0073,), '1D530 -> 0073'; ok Uni.new(0x1D531).NFKC.list ~~ (0x0074,), '1D531 -> 0074'; ok Uni.new(0x1D532).NFKC.list ~~ (0x0075,), '1D532 -> 0075'; ok Uni.new(0x1D533).NFKC.list ~~ (0x0076,), '1D533 -> 0076'; ok Uni.new(0x1D534).NFKC.list ~~ (0x0077,), '1D534 -> 0077'; ok Uni.new(0x1D535).NFKC.list ~~ (0x0078,), '1D535 -> 0078'; ok Uni.new(0x1D536).NFKC.list ~~ (0x0079,), '1D536 -> 0079'; ok Uni.new(0x1D537).NFKC.list ~~ (0x007A,), '1D537 -> 007A'; ok Uni.new(0x1D538).NFKC.list ~~ (0x0041,), '1D538 -> 0041'; ok Uni.new(0x1D539).NFKC.list ~~ (0x0042,), '1D539 -> 0042'; ok Uni.new(0x1D53B).NFKC.list ~~ (0x0044,), '1D53B -> 0044'; ok Uni.new(0x1D53C).NFKC.list ~~ (0x0045,), '1D53C -> 0045'; ok Uni.new(0x1D53D).NFKC.list ~~ (0x0046,), '1D53D -> 0046'; ok Uni.new(0x1D53E).NFKC.list ~~ (0x0047,), '1D53E -> 0047'; ok Uni.new(0x1D540).NFKC.list ~~ (0x0049,), '1D540 -> 0049'; ok Uni.new(0x1D541).NFKC.list ~~ (0x004A,), '1D541 -> 004A'; ok Uni.new(0x1D542).NFKC.list ~~ (0x004B,), '1D542 -> 004B'; ok Uni.new(0x1D543).NFKC.list ~~ (0x004C,), '1D543 -> 004C'; ok Uni.new(0x1D544).NFKC.list ~~ (0x004D,), '1D544 -> 004D'; ok Uni.new(0x1D546).NFKC.list ~~ (0x004F,), '1D546 -> 004F'; ok Uni.new(0x1D54A).NFKC.list ~~ (0x0053,), '1D54A -> 0053'; ok Uni.new(0x1D54B).NFKC.list ~~ (0x0054,), '1D54B -> 0054'; ok Uni.new(0x1D54C).NFKC.list ~~ (0x0055,), '1D54C -> 0055'; ok Uni.new(0x1D54D).NFKC.list ~~ (0x0056,), '1D54D -> 0056'; ok Uni.new(0x1D54E).NFKC.list ~~ (0x0057,), '1D54E -> 0057'; ok Uni.new(0x1D54F).NFKC.list ~~ (0x0058,), '1D54F -> 0058'; ok Uni.new(0x1D550).NFKC.list ~~ (0x0059,), '1D550 -> 0059'; ok Uni.new(0x1D552).NFKC.list ~~ (0x0061,), '1D552 -> 0061'; ok Uni.new(0x1D553).NFKC.list ~~ (0x0062,), '1D553 -> 0062'; ok Uni.new(0x1D554).NFKC.list ~~ (0x0063,), '1D554 -> 0063'; ok Uni.new(0x1D555).NFKC.list ~~ (0x0064,), '1D555 -> 0064'; ok Uni.new(0x1D556).NFKC.list ~~ (0x0065,), '1D556 -> 0065'; ok Uni.new(0x1D557).NFKC.list ~~ (0x0066,), '1D557 -> 0066'; ok Uni.new(0x1D558).NFKC.list ~~ (0x0067,), '1D558 -> 0067'; ok Uni.new(0x1D559).NFKC.list ~~ (0x0068,), '1D559 -> 0068'; ok Uni.new(0x1D55A).NFKC.list ~~ (0x0069,), '1D55A -> 0069'; ok Uni.new(0x1D55B).NFKC.list ~~ (0x006A,), '1D55B -> 006A'; ok Uni.new(0x1D55C).NFKC.list ~~ (0x006B,), '1D55C -> 006B'; ok Uni.new(0x1D55D).NFKC.list ~~ (0x006C,), '1D55D -> 006C'; ok Uni.new(0x1D55E).NFKC.list ~~ (0x006D,), '1D55E -> 006D'; ok Uni.new(0x1D55F).NFKC.list ~~ (0x006E,), '1D55F -> 006E'; ok Uni.new(0x1D560).NFKC.list ~~ (0x006F,), '1D560 -> 006F'; ok Uni.new(0x1D561).NFKC.list ~~ (0x0070,), '1D561 -> 0070'; ok Uni.new(0x1D562).NFKC.list ~~ (0x0071,), '1D562 -> 0071'; ok Uni.new(0x1D563).NFKC.list ~~ (0x0072,), '1D563 -> 0072'; ok Uni.new(0x1D564).NFKC.list ~~ (0x0073,), '1D564 -> 0073'; ok Uni.new(0x1D565).NFKC.list ~~ (0x0074,), '1D565 -> 0074'; ok Uni.new(0x1D566).NFKC.list ~~ (0x0075,), '1D566 -> 0075'; ok Uni.new(0x1D567).NFKC.list ~~ (0x0076,), '1D567 -> 0076'; ok Uni.new(0x1D568).NFKC.list ~~ (0x0077,), '1D568 -> 0077'; ok Uni.new(0x1D569).NFKC.list ~~ (0x0078,), '1D569 -> 0078'; ok Uni.new(0x1D56A).NFKC.list ~~ (0x0079,), '1D56A -> 0079'; ok Uni.new(0x1D56B).NFKC.list ~~ (0x007A,), '1D56B -> 007A'; ok Uni.new(0x1D56C).NFKC.list ~~ (0x0041,), '1D56C -> 0041'; ok Uni.new(0x1D56D).NFKC.list ~~ (0x0042,), '1D56D -> 0042'; ok Uni.new(0x1D56E).NFKC.list ~~ (0x0043,), '1D56E -> 0043'; ok Uni.new(0x1D56F).NFKC.list ~~ (0x0044,), '1D56F -> 0044'; ok Uni.new(0x1D570).NFKC.list ~~ (0x0045,), '1D570 -> 0045'; ok Uni.new(0x1D571).NFKC.list ~~ (0x0046,), '1D571 -> 0046'; ok Uni.new(0x1D572).NFKC.list ~~ (0x0047,), '1D572 -> 0047'; ok Uni.new(0x1D573).NFKC.list ~~ (0x0048,), '1D573 -> 0048'; ok Uni.new(0x1D574).NFKC.list ~~ (0x0049,), '1D574 -> 0049'; ok Uni.new(0x1D575).NFKC.list ~~ (0x004A,), '1D575 -> 004A'; ok Uni.new(0x1D576).NFKC.list ~~ (0x004B,), '1D576 -> 004B'; ok Uni.new(0x1D577).NFKC.list ~~ (0x004C,), '1D577 -> 004C'; ok Uni.new(0x1D578).NFKC.list ~~ (0x004D,), '1D578 -> 004D'; ok Uni.new(0x1D579).NFKC.list ~~ (0x004E,), '1D579 -> 004E'; ok Uni.new(0x1D57A).NFKC.list ~~ (0x004F,), '1D57A -> 004F'; ok Uni.new(0x1D57B).NFKC.list ~~ (0x0050,), '1D57B -> 0050'; ok Uni.new(0x1D57C).NFKC.list ~~ (0x0051,), '1D57C -> 0051'; ok Uni.new(0x1D57D).NFKC.list ~~ (0x0052,), '1D57D -> 0052'; ok Uni.new(0x1D57E).NFKC.list ~~ (0x0053,), '1D57E -> 0053'; ok Uni.new(0x1D57F).NFKC.list ~~ (0x0054,), '1D57F -> 0054'; ok Uni.new(0x1D580).NFKC.list ~~ (0x0055,), '1D580 -> 0055'; ok Uni.new(0x1D581).NFKC.list ~~ (0x0056,), '1D581 -> 0056'; ok Uni.new(0x1D582).NFKC.list ~~ (0x0057,), '1D582 -> 0057'; ok Uni.new(0x1D583).NFKC.list ~~ (0x0058,), '1D583 -> 0058'; ok Uni.new(0x1D584).NFKC.list ~~ (0x0059,), '1D584 -> 0059'; ok Uni.new(0x1D585).NFKC.list ~~ (0x005A,), '1D585 -> 005A'; ok Uni.new(0x1D586).NFKC.list ~~ (0x0061,), '1D586 -> 0061'; ok Uni.new(0x1D587).NFKC.list ~~ (0x0062,), '1D587 -> 0062'; ok Uni.new(0x1D588).NFKC.list ~~ (0x0063,), '1D588 -> 0063'; ok Uni.new(0x1D589).NFKC.list ~~ (0x0064,), '1D589 -> 0064'; ok Uni.new(0x1D58A).NFKC.list ~~ (0x0065,), '1D58A -> 0065'; ok Uni.new(0x1D58B).NFKC.list ~~ (0x0066,), '1D58B -> 0066'; ok Uni.new(0x1D58C).NFKC.list ~~ (0x0067,), '1D58C -> 0067'; ok Uni.new(0x1D58D).NFKC.list ~~ (0x0068,), '1D58D -> 0068'; ok Uni.new(0x1D58E).NFKC.list ~~ (0x0069,), '1D58E -> 0069'; ok Uni.new(0x1D58F).NFKC.list ~~ (0x006A,), '1D58F -> 006A'; ok Uni.new(0x1D590).NFKC.list ~~ (0x006B,), '1D590 -> 006B'; ok Uni.new(0x1D591).NFKC.list ~~ (0x006C,), '1D591 -> 006C'; ok Uni.new(0x1D592).NFKC.list ~~ (0x006D,), '1D592 -> 006D'; ok Uni.new(0x1D593).NFKC.list ~~ (0x006E,), '1D593 -> 006E'; ok Uni.new(0x1D594).NFKC.list ~~ (0x006F,), '1D594 -> 006F'; ok Uni.new(0x1D595).NFKC.list ~~ (0x0070,), '1D595 -> 0070'; ok Uni.new(0x1D596).NFKC.list ~~ (0x0071,), '1D596 -> 0071'; ok Uni.new(0x1D597).NFKC.list ~~ (0x0072,), '1D597 -> 0072'; ok Uni.new(0x1D598).NFKC.list ~~ (0x0073,), '1D598 -> 0073'; ok Uni.new(0x1D599).NFKC.list ~~ (0x0074,), '1D599 -> 0074'; ok Uni.new(0x1D59A).NFKC.list ~~ (0x0075,), '1D59A -> 0075'; ok Uni.new(0x1D59B).NFKC.list ~~ (0x0076,), '1D59B -> 0076'; ok Uni.new(0x1D59C).NFKC.list ~~ (0x0077,), '1D59C -> 0077'; ok Uni.new(0x1D59D).NFKC.list ~~ (0x0078,), '1D59D -> 0078'; ok Uni.new(0x1D59E).NFKC.list ~~ (0x0079,), '1D59E -> 0079'; ok Uni.new(0x1D59F).NFKC.list ~~ (0x007A,), '1D59F -> 007A'; ok Uni.new(0x1D5A0).NFKC.list ~~ (0x0041,), '1D5A0 -> 0041'; ok Uni.new(0x1D5A1).NFKC.list ~~ (0x0042,), '1D5A1 -> 0042'; ok Uni.new(0x1D5A2).NFKC.list ~~ (0x0043,), '1D5A2 -> 0043'; ok Uni.new(0x1D5A3).NFKC.list ~~ (0x0044,), '1D5A3 -> 0044'; ok Uni.new(0x1D5A4).NFKC.list ~~ (0x0045,), '1D5A4 -> 0045'; ok Uni.new(0x1D5A5).NFKC.list ~~ (0x0046,), '1D5A5 -> 0046'; ok Uni.new(0x1D5A6).NFKC.list ~~ (0x0047,), '1D5A6 -> 0047'; ok Uni.new(0x1D5A7).NFKC.list ~~ (0x0048,), '1D5A7 -> 0048'; ok Uni.new(0x1D5A8).NFKC.list ~~ (0x0049,), '1D5A8 -> 0049'; ok Uni.new(0x1D5A9).NFKC.list ~~ (0x004A,), '1D5A9 -> 004A'; ok Uni.new(0x1D5AA).NFKC.list ~~ (0x004B,), '1D5AA -> 004B'; ok Uni.new(0x1D5AB).NFKC.list ~~ (0x004C,), '1D5AB -> 004C'; ok Uni.new(0x1D5AC).NFKC.list ~~ (0x004D,), '1D5AC -> 004D'; ok Uni.new(0x1D5AD).NFKC.list ~~ (0x004E,), '1D5AD -> 004E'; ok Uni.new(0x1D5AE).NFKC.list ~~ (0x004F,), '1D5AE -> 004F'; ok Uni.new(0x1D5AF).NFKC.list ~~ (0x0050,), '1D5AF -> 0050'; ok Uni.new(0x1D5B0).NFKC.list ~~ (0x0051,), '1D5B0 -> 0051'; ok Uni.new(0x1D5B1).NFKC.list ~~ (0x0052,), '1D5B1 -> 0052'; ok Uni.new(0x1D5B2).NFKC.list ~~ (0x0053,), '1D5B2 -> 0053'; ok Uni.new(0x1D5B3).NFKC.list ~~ (0x0054,), '1D5B3 -> 0054'; ok Uni.new(0x1D5B4).NFKC.list ~~ (0x0055,), '1D5B4 -> 0055'; ok Uni.new(0x1D5B5).NFKC.list ~~ (0x0056,), '1D5B5 -> 0056'; ok Uni.new(0x1D5B6).NFKC.list ~~ (0x0057,), '1D5B6 -> 0057'; ok Uni.new(0x1D5B7).NFKC.list ~~ (0x0058,), '1D5B7 -> 0058'; ok Uni.new(0x1D5B8).NFKC.list ~~ (0x0059,), '1D5B8 -> 0059'; ok Uni.new(0x1D5B9).NFKC.list ~~ (0x005A,), '1D5B9 -> 005A'; ok Uni.new(0x1D5BA).NFKC.list ~~ (0x0061,), '1D5BA -> 0061'; ok Uni.new(0x1D5BB).NFKC.list ~~ (0x0062,), '1D5BB -> 0062'; ok Uni.new(0x1D5BC).NFKC.list ~~ (0x0063,), '1D5BC -> 0063'; ok Uni.new(0x1D5BD).NFKC.list ~~ (0x0064,), '1D5BD -> 0064'; ok Uni.new(0x1D5BE).NFKC.list ~~ (0x0065,), '1D5BE -> 0065'; ok Uni.new(0x1D5BF).NFKC.list ~~ (0x0066,), '1D5BF -> 0066'; ok Uni.new(0x1D5C0).NFKC.list ~~ (0x0067,), '1D5C0 -> 0067'; ok Uni.new(0x1D5C1).NFKC.list ~~ (0x0068,), '1D5C1 -> 0068'; ok Uni.new(0x1D5C2).NFKC.list ~~ (0x0069,), '1D5C2 -> 0069'; ok Uni.new(0x1D5C3).NFKC.list ~~ (0x006A,), '1D5C3 -> 006A'; ok Uni.new(0x1D5C4).NFKC.list ~~ (0x006B,), '1D5C4 -> 006B'; ok Uni.new(0x1D5C5).NFKC.list ~~ (0x006C,), '1D5C5 -> 006C'; ok Uni.new(0x1D5C6).NFKC.list ~~ (0x006D,), '1D5C6 -> 006D'; ok Uni.new(0x1D5C7).NFKC.list ~~ (0x006E,), '1D5C7 -> 006E'; ok Uni.new(0x1D5C8).NFKC.list ~~ (0x006F,), '1D5C8 -> 006F'; ok Uni.new(0x1D5C9).NFKC.list ~~ (0x0070,), '1D5C9 -> 0070'; ok Uni.new(0x1D5CA).NFKC.list ~~ (0x0071,), '1D5CA -> 0071'; ok Uni.new(0x1D5CB).NFKC.list ~~ (0x0072,), '1D5CB -> 0072'; ok Uni.new(0x1D5CC).NFKC.list ~~ (0x0073,), '1D5CC -> 0073'; ok Uni.new(0x1D5CD).NFKC.list ~~ (0x0074,), '1D5CD -> 0074'; ok Uni.new(0x1D5CE).NFKC.list ~~ (0x0075,), '1D5CE -> 0075'; ok Uni.new(0x1D5CF).NFKC.list ~~ (0x0076,), '1D5CF -> 0076'; ok Uni.new(0x1D5D0).NFKC.list ~~ (0x0077,), '1D5D0 -> 0077'; ok Uni.new(0x1D5D1).NFKC.list ~~ (0x0078,), '1D5D1 -> 0078'; ok Uni.new(0x1D5D2).NFKC.list ~~ (0x0079,), '1D5D2 -> 0079'; ok Uni.new(0x1D5D3).NFKC.list ~~ (0x007A,), '1D5D3 -> 007A'; ok Uni.new(0x1D5D4).NFKC.list ~~ (0x0041,), '1D5D4 -> 0041'; ok Uni.new(0x1D5D5).NFKC.list ~~ (0x0042,), '1D5D5 -> 0042'; ok Uni.new(0x1D5D6).NFKC.list ~~ (0x0043,), '1D5D6 -> 0043'; ok Uni.new(0x1D5D7).NFKC.list ~~ (0x0044,), '1D5D7 -> 0044'; ok Uni.new(0x1D5D8).NFKC.list ~~ (0x0045,), '1D5D8 -> 0045'; ok Uni.new(0x1D5D9).NFKC.list ~~ (0x0046,), '1D5D9 -> 0046'; ok Uni.new(0x1D5DA).NFKC.list ~~ (0x0047,), '1D5DA -> 0047'; ok Uni.new(0x1D5DB).NFKC.list ~~ (0x0048,), '1D5DB -> 0048'; ok Uni.new(0x1D5DC).NFKC.list ~~ (0x0049,), '1D5DC -> 0049'; ok Uni.new(0x1D5DD).NFKC.list ~~ (0x004A,), '1D5DD -> 004A'; ok Uni.new(0x1D5DE).NFKC.list ~~ (0x004B,), '1D5DE -> 004B'; ok Uni.new(0x1D5DF).NFKC.list ~~ (0x004C,), '1D5DF -> 004C'; ok Uni.new(0x1D5E0).NFKC.list ~~ (0x004D,), '1D5E0 -> 004D'; ok Uni.new(0x1D5E1).NFKC.list ~~ (0x004E,), '1D5E1 -> 004E'; ok Uni.new(0x1D5E2).NFKC.list ~~ (0x004F,), '1D5E2 -> 004F'; ok Uni.new(0x1D5E3).NFKC.list ~~ (0x0050,), '1D5E3 -> 0050'; ok Uni.new(0x1D5E4).NFKC.list ~~ (0x0051,), '1D5E4 -> 0051'; ok Uni.new(0x1D5E5).NFKC.list ~~ (0x0052,), '1D5E5 -> 0052'; ok Uni.new(0x1D5E6).NFKC.list ~~ (0x0053,), '1D5E6 -> 0053'; ok Uni.new(0x1D5E7).NFKC.list ~~ (0x0054,), '1D5E7 -> 0054'; ok Uni.new(0x1D5E8).NFKC.list ~~ (0x0055,), '1D5E8 -> 0055'; ok Uni.new(0x1D5E9).NFKC.list ~~ (0x0056,), '1D5E9 -> 0056'; ok Uni.new(0x1D5EA).NFKC.list ~~ (0x0057,), '1D5EA -> 0057'; ok Uni.new(0x1D5EB).NFKC.list ~~ (0x0058,), '1D5EB -> 0058'; ok Uni.new(0x1D5EC).NFKC.list ~~ (0x0059,), '1D5EC -> 0059'; ok Uni.new(0x1D5ED).NFKC.list ~~ (0x005A,), '1D5ED -> 005A'; ok Uni.new(0x1D5EE).NFKC.list ~~ (0x0061,), '1D5EE -> 0061'; ok Uni.new(0x1D5EF).NFKC.list ~~ (0x0062,), '1D5EF -> 0062'; ok Uni.new(0x1D5F0).NFKC.list ~~ (0x0063,), '1D5F0 -> 0063'; ok Uni.new(0x1D5F1).NFKC.list ~~ (0x0064,), '1D5F1 -> 0064'; ok Uni.new(0x1D5F2).NFKC.list ~~ (0x0065,), '1D5F2 -> 0065'; ok Uni.new(0x1D5F3).NFKC.list ~~ (0x0066,), '1D5F3 -> 0066'; ok Uni.new(0x1D5F4).NFKC.list ~~ (0x0067,), '1D5F4 -> 0067'; ok Uni.new(0x1D5F5).NFKC.list ~~ (0x0068,), '1D5F5 -> 0068'; ok Uni.new(0x1D5F6).NFKC.list ~~ (0x0069,), '1D5F6 -> 0069'; ok Uni.new(0x1D5F7).NFKC.list ~~ (0x006A,), '1D5F7 -> 006A'; ok Uni.new(0x1D5F8).NFKC.list ~~ (0x006B,), '1D5F8 -> 006B'; ok Uni.new(0x1D5F9).NFKC.list ~~ (0x006C,), '1D5F9 -> 006C'; ok Uni.new(0x1D5FA).NFKC.list ~~ (0x006D,), '1D5FA -> 006D'; ok Uni.new(0x1D5FB).NFKC.list ~~ (0x006E,), '1D5FB -> 006E'; ok Uni.new(0x1D5FC).NFKC.list ~~ (0x006F,), '1D5FC -> 006F'; ok Uni.new(0x1D5FD).NFKC.list ~~ (0x0070,), '1D5FD -> 0070'; ok Uni.new(0x1D5FE).NFKC.list ~~ (0x0071,), '1D5FE -> 0071'; ok Uni.new(0x1D5FF).NFKC.list ~~ (0x0072,), '1D5FF -> 0072'; ok Uni.new(0x1D600).NFKC.list ~~ (0x0073,), '1D600 -> 0073'; ok Uni.new(0x1D601).NFKC.list ~~ (0x0074,), '1D601 -> 0074'; ok Uni.new(0x1D602).NFKC.list ~~ (0x0075,), '1D602 -> 0075'; ok Uni.new(0x1D603).NFKC.list ~~ (0x0076,), '1D603 -> 0076'; ok Uni.new(0x1D604).NFKC.list ~~ (0x0077,), '1D604 -> 0077'; ok Uni.new(0x1D605).NFKC.list ~~ (0x0078,), '1D605 -> 0078'; ok Uni.new(0x1D606).NFKC.list ~~ (0x0079,), '1D606 -> 0079'; ok Uni.new(0x1D607).NFKC.list ~~ (0x007A,), '1D607 -> 007A'; ok Uni.new(0x1D608).NFKC.list ~~ (0x0041,), '1D608 -> 0041'; ok Uni.new(0x1D609).NFKC.list ~~ (0x0042,), '1D609 -> 0042'; ok Uni.new(0x1D60A).NFKC.list ~~ (0x0043,), '1D60A -> 0043'; ok Uni.new(0x1D60B).NFKC.list ~~ (0x0044,), '1D60B -> 0044'; ok Uni.new(0x1D60C).NFKC.list ~~ (0x0045,), '1D60C -> 0045'; ok Uni.new(0x1D60D).NFKC.list ~~ (0x0046,), '1D60D -> 0046'; ok Uni.new(0x1D60E).NFKC.list ~~ (0x0047,), '1D60E -> 0047'; ok Uni.new(0x1D60F).NFKC.list ~~ (0x0048,), '1D60F -> 0048'; ok Uni.new(0x1D610).NFKC.list ~~ (0x0049,), '1D610 -> 0049'; ok Uni.new(0x1D611).NFKC.list ~~ (0x004A,), '1D611 -> 004A'; ok Uni.new(0x1D612).NFKC.list ~~ (0x004B,), '1D612 -> 004B'; ok Uni.new(0x1D613).NFKC.list ~~ (0x004C,), '1D613 -> 004C'; ok Uni.new(0x1D614).NFKC.list ~~ (0x004D,), '1D614 -> 004D'; ok Uni.new(0x1D615).NFKC.list ~~ (0x004E,), '1D615 -> 004E'; ok Uni.new(0x1D616).NFKC.list ~~ (0x004F,), '1D616 -> 004F'; ok Uni.new(0x1D617).NFKC.list ~~ (0x0050,), '1D617 -> 0050'; ok Uni.new(0x1D618).NFKC.list ~~ (0x0051,), '1D618 -> 0051'; ok Uni.new(0x1D619).NFKC.list ~~ (0x0052,), '1D619 -> 0052'; ok Uni.new(0x1D61A).NFKC.list ~~ (0x0053,), '1D61A -> 0053'; ok Uni.new(0x1D61B).NFKC.list ~~ (0x0054,), '1D61B -> 0054'; ok Uni.new(0x1D61C).NFKC.list ~~ (0x0055,), '1D61C -> 0055'; ok Uni.new(0x1D61D).NFKC.list ~~ (0x0056,), '1D61D -> 0056'; ok Uni.new(0x1D61E).NFKC.list ~~ (0x0057,), '1D61E -> 0057'; ok Uni.new(0x1D61F).NFKC.list ~~ (0x0058,), '1D61F -> 0058'; ok Uni.new(0x1D620).NFKC.list ~~ (0x0059,), '1D620 -> 0059'; ok Uni.new(0x1D621).NFKC.list ~~ (0x005A,), '1D621 -> 005A'; ok Uni.new(0x1D622).NFKC.list ~~ (0x0061,), '1D622 -> 0061'; ok Uni.new(0x1D623).NFKC.list ~~ (0x0062,), '1D623 -> 0062'; ok Uni.new(0x1D624).NFKC.list ~~ (0x0063,), '1D624 -> 0063'; ok Uni.new(0x1D625).NFKC.list ~~ (0x0064,), '1D625 -> 0064'; ok Uni.new(0x1D626).NFKC.list ~~ (0x0065,), '1D626 -> 0065'; ok Uni.new(0x1D627).NFKC.list ~~ (0x0066,), '1D627 -> 0066'; ok Uni.new(0x1D628).NFKC.list ~~ (0x0067,), '1D628 -> 0067'; ok Uni.new(0x1D629).NFKC.list ~~ (0x0068,), '1D629 -> 0068'; ok Uni.new(0x1D62A).NFKC.list ~~ (0x0069,), '1D62A -> 0069'; ok Uni.new(0x1D62B).NFKC.list ~~ (0x006A,), '1D62B -> 006A'; ok Uni.new(0x1D62C).NFKC.list ~~ (0x006B,), '1D62C -> 006B'; ok Uni.new(0x1D62D).NFKC.list ~~ (0x006C,), '1D62D -> 006C'; ok Uni.new(0x1D62E).NFKC.list ~~ (0x006D,), '1D62E -> 006D'; ok Uni.new(0x1D62F).NFKC.list ~~ (0x006E,), '1D62F -> 006E'; ok Uni.new(0x1D630).NFKC.list ~~ (0x006F,), '1D630 -> 006F'; ok Uni.new(0x1D631).NFKC.list ~~ (0x0070,), '1D631 -> 0070'; ok Uni.new(0x1D632).NFKC.list ~~ (0x0071,), '1D632 -> 0071'; ok Uni.new(0x1D633).NFKC.list ~~ (0x0072,), '1D633 -> 0072'; ok Uni.new(0x1D634).NFKC.list ~~ (0x0073,), '1D634 -> 0073'; ok Uni.new(0x1D635).NFKC.list ~~ (0x0074,), '1D635 -> 0074'; ok Uni.new(0x1D636).NFKC.list ~~ (0x0075,), '1D636 -> 0075'; ok Uni.new(0x1D637).NFKC.list ~~ (0x0076,), '1D637 -> 0076'; ok Uni.new(0x1D638).NFKC.list ~~ (0x0077,), '1D638 -> 0077'; ok Uni.new(0x1D639).NFKC.list ~~ (0x0078,), '1D639 -> 0078'; ok Uni.new(0x1D63A).NFKC.list ~~ (0x0079,), '1D63A -> 0079'; ok Uni.new(0x1D63B).NFKC.list ~~ (0x007A,), '1D63B -> 007A'; ok Uni.new(0x1D63C).NFKC.list ~~ (0x0041,), '1D63C -> 0041'; ok Uni.new(0x1D63D).NFKC.list ~~ (0x0042,), '1D63D -> 0042'; ok Uni.new(0x1D63E).NFKC.list ~~ (0x0043,), '1D63E -> 0043'; ok Uni.new(0x1D63F).NFKC.list ~~ (0x0044,), '1D63F -> 0044'; ok Uni.new(0x1D640).NFKC.list ~~ (0x0045,), '1D640 -> 0045'; ok Uni.new(0x1D641).NFKC.list ~~ (0x0046,), '1D641 -> 0046'; ok Uni.new(0x1D642).NFKC.list ~~ (0x0047,), '1D642 -> 0047'; ok Uni.new(0x1D643).NFKC.list ~~ (0x0048,), '1D643 -> 0048'; ok Uni.new(0x1D644).NFKC.list ~~ (0x0049,), '1D644 -> 0049'; ok Uni.new(0x1D645).NFKC.list ~~ (0x004A,), '1D645 -> 004A'; ok Uni.new(0x1D646).NFKC.list ~~ (0x004B,), '1D646 -> 004B'; ok Uni.new(0x1D647).NFKC.list ~~ (0x004C,), '1D647 -> 004C'; ok Uni.new(0x1D648).NFKC.list ~~ (0x004D,), '1D648 -> 004D'; ok Uni.new(0x1D649).NFKC.list ~~ (0x004E,), '1D649 -> 004E'; ok Uni.new(0x1D64A).NFKC.list ~~ (0x004F,), '1D64A -> 004F'; ok Uni.new(0x1D64B).NFKC.list ~~ (0x0050,), '1D64B -> 0050'; ok Uni.new(0x1D64C).NFKC.list ~~ (0x0051,), '1D64C -> 0051'; ok Uni.new(0x1D64D).NFKC.list ~~ (0x0052,), '1D64D -> 0052'; ok Uni.new(0x1D64E).NFKC.list ~~ (0x0053,), '1D64E -> 0053'; ok Uni.new(0x1D64F).NFKC.list ~~ (0x0054,), '1D64F -> 0054'; ok Uni.new(0x1D650).NFKC.list ~~ (0x0055,), '1D650 -> 0055'; ok Uni.new(0x1D651).NFKC.list ~~ (0x0056,), '1D651 -> 0056'; ok Uni.new(0x1D652).NFKC.list ~~ (0x0057,), '1D652 -> 0057'; ok Uni.new(0x1D653).NFKC.list ~~ (0x0058,), '1D653 -> 0058'; ok Uni.new(0x1D654).NFKC.list ~~ (0x0059,), '1D654 -> 0059'; ok Uni.new(0x1D655).NFKC.list ~~ (0x005A,), '1D655 -> 005A'; ok Uni.new(0x1D656).NFKC.list ~~ (0x0061,), '1D656 -> 0061'; ok Uni.new(0x1D657).NFKC.list ~~ (0x0062,), '1D657 -> 0062'; ok Uni.new(0x1D658).NFKC.list ~~ (0x0063,), '1D658 -> 0063'; ok Uni.new(0x1D659).NFKC.list ~~ (0x0064,), '1D659 -> 0064'; ok Uni.new(0x1D65A).NFKC.list ~~ (0x0065,), '1D65A -> 0065'; ok Uni.new(0x1D65B).NFKC.list ~~ (0x0066,), '1D65B -> 0066'; ok Uni.new(0x1D65C).NFKC.list ~~ (0x0067,), '1D65C -> 0067'; ok Uni.new(0x1D65D).NFKC.list ~~ (0x0068,), '1D65D -> 0068'; ok Uni.new(0x1D65E).NFKC.list ~~ (0x0069,), '1D65E -> 0069'; ok Uni.new(0x1D65F).NFKC.list ~~ (0x006A,), '1D65F -> 006A'; ok Uni.new(0x1D660).NFKC.list ~~ (0x006B,), '1D660 -> 006B'; ok Uni.new(0x1D661).NFKC.list ~~ (0x006C,), '1D661 -> 006C'; ok Uni.new(0x1D662).NFKC.list ~~ (0x006D,), '1D662 -> 006D'; ok Uni.new(0x1D663).NFKC.list ~~ (0x006E,), '1D663 -> 006E'; ok Uni.new(0x1D664).NFKC.list ~~ (0x006F,), '1D664 -> 006F'; ok Uni.new(0x1D665).NFKC.list ~~ (0x0070,), '1D665 -> 0070'; ok Uni.new(0x1D666).NFKC.list ~~ (0x0071,), '1D666 -> 0071'; ok Uni.new(0x1D667).NFKC.list ~~ (0x0072,), '1D667 -> 0072'; ok Uni.new(0x1D668).NFKC.list ~~ (0x0073,), '1D668 -> 0073'; ok Uni.new(0x1D669).NFKC.list ~~ (0x0074,), '1D669 -> 0074'; ok Uni.new(0x1D66A).NFKC.list ~~ (0x0075,), '1D66A -> 0075'; ok Uni.new(0x1D66B).NFKC.list ~~ (0x0076,), '1D66B -> 0076'; ok Uni.new(0x1D66C).NFKC.list ~~ (0x0077,), '1D66C -> 0077'; ok Uni.new(0x1D66D).NFKC.list ~~ (0x0078,), '1D66D -> 0078'; ok Uni.new(0x1D66E).NFKC.list ~~ (0x0079,), '1D66E -> 0079'; ok Uni.new(0x1D66F).NFKC.list ~~ (0x007A,), '1D66F -> 007A'; ok Uni.new(0x1D670).NFKC.list ~~ (0x0041,), '1D670 -> 0041'; ok Uni.new(0x1D671).NFKC.list ~~ (0x0042,), '1D671 -> 0042'; ok Uni.new(0x1D672).NFKC.list ~~ (0x0043,), '1D672 -> 0043'; ok Uni.new(0x1D673).NFKC.list ~~ (0x0044,), '1D673 -> 0044'; ok Uni.new(0x1D674).NFKC.list ~~ (0x0045,), '1D674 -> 0045'; ok Uni.new(0x1D675).NFKC.list ~~ (0x0046,), '1D675 -> 0046'; ok Uni.new(0x1D676).NFKC.list ~~ (0x0047,), '1D676 -> 0047'; ok Uni.new(0x1D677).NFKC.list ~~ (0x0048,), '1D677 -> 0048'; ok Uni.new(0x1D678).NFKC.list ~~ (0x0049,), '1D678 -> 0049'; ok Uni.new(0x1D679).NFKC.list ~~ (0x004A,), '1D679 -> 004A'; ok Uni.new(0x1D67A).NFKC.list ~~ (0x004B,), '1D67A -> 004B'; ok Uni.new(0x1D67B).NFKC.list ~~ (0x004C,), '1D67B -> 004C'; ok Uni.new(0x1D67C).NFKC.list ~~ (0x004D,), '1D67C -> 004D'; ok Uni.new(0x1D67D).NFKC.list ~~ (0x004E,), '1D67D -> 004E'; ok Uni.new(0x1D67E).NFKC.list ~~ (0x004F,), '1D67E -> 004F'; ok Uni.new(0x1D67F).NFKC.list ~~ (0x0050,), '1D67F -> 0050'; ok Uni.new(0x1D680).NFKC.list ~~ (0x0051,), '1D680 -> 0051'; ok Uni.new(0x1D681).NFKC.list ~~ (0x0052,), '1D681 -> 0052'; ok Uni.new(0x1D682).NFKC.list ~~ (0x0053,), '1D682 -> 0053'; ok Uni.new(0x1D683).NFKC.list ~~ (0x0054,), '1D683 -> 0054'; ok Uni.new(0x1D684).NFKC.list ~~ (0x0055,), '1D684 -> 0055'; ok Uni.new(0x1D685).NFKC.list ~~ (0x0056,), '1D685 -> 0056'; ok Uni.new(0x1D686).NFKC.list ~~ (0x0057,), '1D686 -> 0057'; ok Uni.new(0x1D687).NFKC.list ~~ (0x0058,), '1D687 -> 0058'; ok Uni.new(0x1D688).NFKC.list ~~ (0x0059,), '1D688 -> 0059'; ok Uni.new(0x1D689).NFKC.list ~~ (0x005A,), '1D689 -> 005A'; ok Uni.new(0x1D68A).NFKC.list ~~ (0x0061,), '1D68A -> 0061'; ok Uni.new(0x1D68B).NFKC.list ~~ (0x0062,), '1D68B -> 0062'; ok Uni.new(0x1D68C).NFKC.list ~~ (0x0063,), '1D68C -> 0063'; ok Uni.new(0x1D68D).NFKC.list ~~ (0x0064,), '1D68D -> 0064'; ok Uni.new(0x1D68E).NFKC.list ~~ (0x0065,), '1D68E -> 0065'; ok Uni.new(0x1D68F).NFKC.list ~~ (0x0066,), '1D68F -> 0066'; ok Uni.new(0x1D690).NFKC.list ~~ (0x0067,), '1D690 -> 0067'; ok Uni.new(0x1D691).NFKC.list ~~ (0x0068,), '1D691 -> 0068'; ok Uni.new(0x1D692).NFKC.list ~~ (0x0069,), '1D692 -> 0069'; ok Uni.new(0x1D693).NFKC.list ~~ (0x006A,), '1D693 -> 006A'; ok Uni.new(0x1D694).NFKC.list ~~ (0x006B,), '1D694 -> 006B'; ok Uni.new(0x1D695).NFKC.list ~~ (0x006C,), '1D695 -> 006C'; ok Uni.new(0x1D696).NFKC.list ~~ (0x006D,), '1D696 -> 006D'; ok Uni.new(0x1D697).NFKC.list ~~ (0x006E,), '1D697 -> 006E'; ok Uni.new(0x1D698).NFKC.list ~~ (0x006F,), '1D698 -> 006F'; ok Uni.new(0x1D699).NFKC.list ~~ (0x0070,), '1D699 -> 0070'; ok Uni.new(0x1D69A).NFKC.list ~~ (0x0071,), '1D69A -> 0071'; ok Uni.new(0x1D69B).NFKC.list ~~ (0x0072,), '1D69B -> 0072'; ok Uni.new(0x1D69C).NFKC.list ~~ (0x0073,), '1D69C -> 0073'; ok Uni.new(0x1D69D).NFKC.list ~~ (0x0074,), '1D69D -> 0074'; ok Uni.new(0x1D69E).NFKC.list ~~ (0x0075,), '1D69E -> 0075'; ok Uni.new(0x1D69F).NFKC.list ~~ (0x0076,), '1D69F -> 0076'; ok Uni.new(0x1D6A0).NFKC.list ~~ (0x0077,), '1D6A0 -> 0077'; ok Uni.new(0x1D6A1).NFKC.list ~~ (0x0078,), '1D6A1 -> 0078'; ok Uni.new(0x1D6A2).NFKC.list ~~ (0x0079,), '1D6A2 -> 0079'; ok Uni.new(0x1D6A3).NFKC.list ~~ (0x007A,), '1D6A3 -> 007A'; ok Uni.new(0x1D6A4).NFKC.list ~~ (0x0131,), '1D6A4 -> 0131'; ok Uni.new(0x1D6A5).NFKC.list ~~ (0x0237,), '1D6A5 -> 0237'; ok Uni.new(0x1D6A8).NFKC.list ~~ (0x0391,), '1D6A8 -> 0391'; ok Uni.new(0x1D6A9).NFKC.list ~~ (0x0392,), '1D6A9 -> 0392'; ok Uni.new(0x1D6AA).NFKC.list ~~ (0x0393,), '1D6AA -> 0393'; ok Uni.new(0x1D6AB).NFKC.list ~~ (0x0394,), '1D6AB -> 0394'; ok Uni.new(0x1D6AC).NFKC.list ~~ (0x0395,), '1D6AC -> 0395'; ok Uni.new(0x1D6AD).NFKC.list ~~ (0x0396,), '1D6AD -> 0396'; ok Uni.new(0x1D6AE).NFKC.list ~~ (0x0397,), '1D6AE -> 0397'; ok Uni.new(0x1D6AF).NFKC.list ~~ (0x0398,), '1D6AF -> 0398'; ok Uni.new(0x1D6B0).NFKC.list ~~ (0x0399,), '1D6B0 -> 0399'; ok Uni.new(0x1D6B1).NFKC.list ~~ (0x039A,), '1D6B1 -> 039A'; ok Uni.new(0x1D6B2).NFKC.list ~~ (0x039B,), '1D6B2 -> 039B'; ok Uni.new(0x1D6B3).NFKC.list ~~ (0x039C,), '1D6B3 -> 039C'; ok Uni.new(0x1D6B4).NFKC.list ~~ (0x039D,), '1D6B4 -> 039D'; ok Uni.new(0x1D6B5).NFKC.list ~~ (0x039E,), '1D6B5 -> 039E'; ok Uni.new(0x1D6B6).NFKC.list ~~ (0x039F,), '1D6B6 -> 039F'; ok Uni.new(0x1D6B7).NFKC.list ~~ (0x03A0,), '1D6B7 -> 03A0'; ok Uni.new(0x1D6B8).NFKC.list ~~ (0x03A1,), '1D6B8 -> 03A1'; ok Uni.new(0x1D6B9).NFKC.list ~~ (0x0398,), '1D6B9 -> 0398'; ok Uni.new(0x1D6BA).NFKC.list ~~ (0x03A3,), '1D6BA -> 03A3'; ok Uni.new(0x1D6BB).NFKC.list ~~ (0x03A4,), '1D6BB -> 03A4'; ok Uni.new(0x1D6BC).NFKC.list ~~ (0x03A5,), '1D6BC -> 03A5'; ok Uni.new(0x1D6BD).NFKC.list ~~ (0x03A6,), '1D6BD -> 03A6'; ok Uni.new(0x1D6BE).NFKC.list ~~ (0x03A7,), '1D6BE -> 03A7'; ok Uni.new(0x1D6BF).NFKC.list ~~ (0x03A8,), '1D6BF -> 03A8'; ok Uni.new(0x1D6C0).NFKC.list ~~ (0x03A9,), '1D6C0 -> 03A9'; ok Uni.new(0x1D6C1).NFKC.list ~~ (0x2207,), '1D6C1 -> 2207'; ok Uni.new(0x1D6C2).NFKC.list ~~ (0x03B1,), '1D6C2 -> 03B1'; ok Uni.new(0x1D6C3).NFKC.list ~~ (0x03B2,), '1D6C3 -> 03B2'; ok Uni.new(0x1D6C4).NFKC.list ~~ (0x03B3,), '1D6C4 -> 03B3'; ok Uni.new(0x1D6C5).NFKC.list ~~ (0x03B4,), '1D6C5 -> 03B4'; ok Uni.new(0x1D6C6).NFKC.list ~~ (0x03B5,), '1D6C6 -> 03B5'; ok Uni.new(0x1D6C7).NFKC.list ~~ (0x03B6,), '1D6C7 -> 03B6'; ok Uni.new(0x1D6C8).NFKC.list ~~ (0x03B7,), '1D6C8 -> 03B7'; ok Uni.new(0x1D6C9).NFKC.list ~~ (0x03B8,), '1D6C9 -> 03B8'; ok Uni.new(0x1D6CA).NFKC.list ~~ (0x03B9,), '1D6CA -> 03B9'; ok Uni.new(0x1D6CB).NFKC.list ~~ (0x03BA,), '1D6CB -> 03BA'; ok Uni.new(0x1D6CC).NFKC.list ~~ (0x03BB,), '1D6CC -> 03BB'; ok Uni.new(0x1D6CD).NFKC.list ~~ (0x03BC,), '1D6CD -> 03BC'; ok Uni.new(0x1D6CE).NFKC.list ~~ (0x03BD,), '1D6CE -> 03BD'; ok Uni.new(0x1D6CF).NFKC.list ~~ (0x03BE,), '1D6CF -> 03BE'; ok Uni.new(0x1D6D0).NFKC.list ~~ (0x03BF,), '1D6D0 -> 03BF'; ok Uni.new(0x1D6D1).NFKC.list ~~ (0x03C0,), '1D6D1 -> 03C0'; ok Uni.new(0x1D6D2).NFKC.list ~~ (0x03C1,), '1D6D2 -> 03C1'; ok Uni.new(0x1D6D3).NFKC.list ~~ (0x03C2,), '1D6D3 -> 03C2'; ok Uni.new(0x1D6D4).NFKC.list ~~ (0x03C3,), '1D6D4 -> 03C3'; ok Uni.new(0x1D6D5).NFKC.list ~~ (0x03C4,), '1D6D5 -> 03C4'; ok Uni.new(0x1D6D6).NFKC.list ~~ (0x03C5,), '1D6D6 -> 03C5'; ok Uni.new(0x1D6D7).NFKC.list ~~ (0x03C6,), '1D6D7 -> 03C6'; ok Uni.new(0x1D6D8).NFKC.list ~~ (0x03C7,), '1D6D8 -> 03C7'; ok Uni.new(0x1D6D9).NFKC.list ~~ (0x03C8,), '1D6D9 -> 03C8'; ok Uni.new(0x1D6DA).NFKC.list ~~ (0x03C9,), '1D6DA -> 03C9'; ok Uni.new(0x1D6DB).NFKC.list ~~ (0x2202,), '1D6DB -> 2202'; ok Uni.new(0x1D6DC).NFKC.list ~~ (0x03B5,), '1D6DC -> 03B5'; ok Uni.new(0x1D6DD).NFKC.list ~~ (0x03B8,), '1D6DD -> 03B8'; ok Uni.new(0x1D6DE).NFKC.list ~~ (0x03BA,), '1D6DE -> 03BA'; ok Uni.new(0x1D6DF).NFKC.list ~~ (0x03C6,), '1D6DF -> 03C6'; ok Uni.new(0x1D6E0).NFKC.list ~~ (0x03C1,), '1D6E0 -> 03C1'; ok Uni.new(0x1D6E1).NFKC.list ~~ (0x03C0,), '1D6E1 -> 03C0'; ok Uni.new(0x1D6E2).NFKC.list ~~ (0x0391,), '1D6E2 -> 0391'; ok Uni.new(0x1D6E3).NFKC.list ~~ (0x0392,), '1D6E3 -> 0392'; ok Uni.new(0x1D6E4).NFKC.list ~~ (0x0393,), '1D6E4 -> 0393'; ok Uni.new(0x1D6E5).NFKC.list ~~ (0x0394,), '1D6E5 -> 0394'; ok Uni.new(0x1D6E6).NFKC.list ~~ (0x0395,), '1D6E6 -> 0395'; ok Uni.new(0x1D6E7).NFKC.list ~~ (0x0396,), '1D6E7 -> 0396'; ok Uni.new(0x1D6E8).NFKC.list ~~ (0x0397,), '1D6E8 -> 0397'; ok Uni.new(0x1D6E9).NFKC.list ~~ (0x0398,), '1D6E9 -> 0398'; ok Uni.new(0x1D6EA).NFKC.list ~~ (0x0399,), '1D6EA -> 0399'; ok Uni.new(0x1D6EB).NFKC.list ~~ (0x039A,), '1D6EB -> 039A'; ok Uni.new(0x1D6EC).NFKC.list ~~ (0x039B,), '1D6EC -> 039B'; ok Uni.new(0x1D6ED).NFKC.list ~~ (0x039C,), '1D6ED -> 039C'; ok Uni.new(0x1D6EE).NFKC.list ~~ (0x039D,), '1D6EE -> 039D'; ok Uni.new(0x1D6EF).NFKC.list ~~ (0x039E,), '1D6EF -> 039E'; ok Uni.new(0x1D6F0).NFKC.list ~~ (0x039F,), '1D6F0 -> 039F'; ok Uni.new(0x1D6F1).NFKC.list ~~ (0x03A0,), '1D6F1 -> 03A0'; ok Uni.new(0x1D6F2).NFKC.list ~~ (0x03A1,), '1D6F2 -> 03A1'; ok Uni.new(0x1D6F3).NFKC.list ~~ (0x0398,), '1D6F3 -> 0398'; ok Uni.new(0x1D6F4).NFKC.list ~~ (0x03A3,), '1D6F4 -> 03A3'; ok Uni.new(0x1D6F5).NFKC.list ~~ (0x03A4,), '1D6F5 -> 03A4'; ok Uni.new(0x1D6F6).NFKC.list ~~ (0x03A5,), '1D6F6 -> 03A5'; ok Uni.new(0x1D6F7).NFKC.list ~~ (0x03A6,), '1D6F7 -> 03A6'; ok Uni.new(0x1D6F8).NFKC.list ~~ (0x03A7,), '1D6F8 -> 03A7'; ok Uni.new(0x1D6F9).NFKC.list ~~ (0x03A8,), '1D6F9 -> 03A8'; ok Uni.new(0x1D6FA).NFKC.list ~~ (0x03A9,), '1D6FA -> 03A9'; ok Uni.new(0x1D6FB).NFKC.list ~~ (0x2207,), '1D6FB -> 2207'; ok Uni.new(0x1D6FC).NFKC.list ~~ (0x03B1,), '1D6FC -> 03B1'; ok Uni.new(0x1D6FD).NFKC.list ~~ (0x03B2,), '1D6FD -> 03B2'; ok Uni.new(0x1D6FE).NFKC.list ~~ (0x03B3,), '1D6FE -> 03B3'; ok Uni.new(0x1D6FF).NFKC.list ~~ (0x03B4,), '1D6FF -> 03B4'; ok Uni.new(0x1D700).NFKC.list ~~ (0x03B5,), '1D700 -> 03B5'; ok Uni.new(0x1D701).NFKC.list ~~ (0x03B6,), '1D701 -> 03B6'; ok Uni.new(0x1D702).NFKC.list ~~ (0x03B7,), '1D702 -> 03B7'; ok Uni.new(0x1D703).NFKC.list ~~ (0x03B8,), '1D703 -> 03B8'; ok Uni.new(0x1D704).NFKC.list ~~ (0x03B9,), '1D704 -> 03B9'; ok Uni.new(0x1D705).NFKC.list ~~ (0x03BA,), '1D705 -> 03BA'; ok Uni.new(0x1D706).NFKC.list ~~ (0x03BB,), '1D706 -> 03BB'; ok Uni.new(0x1D707).NFKC.list ~~ (0x03BC,), '1D707 -> 03BC'; ok Uni.new(0x1D708).NFKC.list ~~ (0x03BD,), '1D708 -> 03BD'; ok Uni.new(0x1D709).NFKC.list ~~ (0x03BE,), '1D709 -> 03BE'; ok Uni.new(0x1D70A).NFKC.list ~~ (0x03BF,), '1D70A -> 03BF'; ok Uni.new(0x1D70B).NFKC.list ~~ (0x03C0,), '1D70B -> 03C0'; ok Uni.new(0x1D70C).NFKC.list ~~ (0x03C1,), '1D70C -> 03C1'; ok Uni.new(0x1D70D).NFKC.list ~~ (0x03C2,), '1D70D -> 03C2'; ok Uni.new(0x1D70E).NFKC.list ~~ (0x03C3,), '1D70E -> 03C3'; ok Uni.new(0x1D70F).NFKC.list ~~ (0x03C4,), '1D70F -> 03C4'; ok Uni.new(0x1D710).NFKC.list ~~ (0x03C5,), '1D710 -> 03C5'; ok Uni.new(0x1D711).NFKC.list ~~ (0x03C6,), '1D711 -> 03C6'; ok Uni.new(0x1D712).NFKC.list ~~ (0x03C7,), '1D712 -> 03C7'; ok Uni.new(0x1D713).NFKC.list ~~ (0x03C8,), '1D713 -> 03C8'; ok Uni.new(0x1D714).NFKC.list ~~ (0x03C9,), '1D714 -> 03C9'; ok Uni.new(0x1D715).NFKC.list ~~ (0x2202,), '1D715 -> 2202'; ok Uni.new(0x1D716).NFKC.list ~~ (0x03B5,), '1D716 -> 03B5'; ok Uni.new(0x1D717).NFKC.list ~~ (0x03B8,), '1D717 -> 03B8'; ok Uni.new(0x1D718).NFKC.list ~~ (0x03BA,), '1D718 -> 03BA'; ok Uni.new(0x1D719).NFKC.list ~~ (0x03C6,), '1D719 -> 03C6'; ok Uni.new(0x1D71A).NFKC.list ~~ (0x03C1,), '1D71A -> 03C1'; ok Uni.new(0x1D71B).NFKC.list ~~ (0x03C0,), '1D71B -> 03C0'; ok Uni.new(0x1D71C).NFKC.list ~~ (0x0391,), '1D71C -> 0391'; ok Uni.new(0x1D71D).NFKC.list ~~ (0x0392,), '1D71D -> 0392'; ok Uni.new(0x1D71E).NFKC.list ~~ (0x0393,), '1D71E -> 0393'; ok Uni.new(0x1D71F).NFKC.list ~~ (0x0394,), '1D71F -> 0394'; ok Uni.new(0x1D720).NFKC.list ~~ (0x0395,), '1D720 -> 0395'; ok Uni.new(0x1D721).NFKC.list ~~ (0x0396,), '1D721 -> 0396'; ok Uni.new(0x1D722).NFKC.list ~~ (0x0397,), '1D722 -> 0397'; ok Uni.new(0x1D723).NFKC.list ~~ (0x0398,), '1D723 -> 0398'; ok Uni.new(0x1D724).NFKC.list ~~ (0x0399,), '1D724 -> 0399'; ok Uni.new(0x1D725).NFKC.list ~~ (0x039A,), '1D725 -> 039A'; ok Uni.new(0x1D726).NFKC.list ~~ (0x039B,), '1D726 -> 039B'; ok Uni.new(0x1D727).NFKC.list ~~ (0x039C,), '1D727 -> 039C'; ok Uni.new(0x1D728).NFKC.list ~~ (0x039D,), '1D728 -> 039D'; ok Uni.new(0x1D729).NFKC.list ~~ (0x039E,), '1D729 -> 039E'; ok Uni.new(0x1D72A).NFKC.list ~~ (0x039F,), '1D72A -> 039F'; ok Uni.new(0x1D72B).NFKC.list ~~ (0x03A0,), '1D72B -> 03A0'; ok Uni.new(0x1D72C).NFKC.list ~~ (0x03A1,), '1D72C -> 03A1'; ok Uni.new(0x1D72D).NFKC.list ~~ (0x0398,), '1D72D -> 0398'; ok Uni.new(0x1D72E).NFKC.list ~~ (0x03A3,), '1D72E -> 03A3'; ok Uni.new(0x1D72F).NFKC.list ~~ (0x03A4,), '1D72F -> 03A4'; ok Uni.new(0x1D730).NFKC.list ~~ (0x03A5,), '1D730 -> 03A5'; ok Uni.new(0x1D731).NFKC.list ~~ (0x03A6,), '1D731 -> 03A6'; ok Uni.new(0x1D732).NFKC.list ~~ (0x03A7,), '1D732 -> 03A7'; ok Uni.new(0x1D733).NFKC.list ~~ (0x03A8,), '1D733 -> 03A8'; ok Uni.new(0x1D734).NFKC.list ~~ (0x03A9,), '1D734 -> 03A9'; ok Uni.new(0x1D735).NFKC.list ~~ (0x2207,), '1D735 -> 2207'; ok Uni.new(0x1D736).NFKC.list ~~ (0x03B1,), '1D736 -> 03B1'; ok Uni.new(0x1D737).NFKC.list ~~ (0x03B2,), '1D737 -> 03B2'; ok Uni.new(0x1D738).NFKC.list ~~ (0x03B3,), '1D738 -> 03B3'; ok Uni.new(0x1D739).NFKC.list ~~ (0x03B4,), '1D739 -> 03B4'; ok Uni.new(0x1D73A).NFKC.list ~~ (0x03B5,), '1D73A -> 03B5'; ok Uni.new(0x1D73B).NFKC.list ~~ (0x03B6,), '1D73B -> 03B6'; ok Uni.new(0x1D73C).NFKC.list ~~ (0x03B7,), '1D73C -> 03B7'; ok Uni.new(0x1D73D).NFKC.list ~~ (0x03B8,), '1D73D -> 03B8'; ok Uni.new(0x1D73E).NFKC.list ~~ (0x03B9,), '1D73E -> 03B9'; ok Uni.new(0x1D73F).NFKC.list ~~ (0x03BA,), '1D73F -> 03BA'; ok Uni.new(0x1D740).NFKC.list ~~ (0x03BB,), '1D740 -> 03BB'; ok Uni.new(0x1D741).NFKC.list ~~ (0x03BC,), '1D741 -> 03BC'; ok Uni.new(0x1D742).NFKC.list ~~ (0x03BD,), '1D742 -> 03BD'; ok Uni.new(0x1D743).NFKC.list ~~ (0x03BE,), '1D743 -> 03BE'; ok Uni.new(0x1D744).NFKC.list ~~ (0x03BF,), '1D744 -> 03BF'; ok Uni.new(0x1D745).NFKC.list ~~ (0x03C0,), '1D745 -> 03C0'; ok Uni.new(0x1D746).NFKC.list ~~ (0x03C1,), '1D746 -> 03C1'; ok Uni.new(0x1D747).NFKC.list ~~ (0x03C2,), '1D747 -> 03C2'; ok Uni.new(0x1D748).NFKC.list ~~ (0x03C3,), '1D748 -> 03C3'; ok Uni.new(0x1D749).NFKC.list ~~ (0x03C4,), '1D749 -> 03C4'; ok Uni.new(0x1D74A).NFKC.list ~~ (0x03C5,), '1D74A -> 03C5'; ok Uni.new(0x1D74B).NFKC.list ~~ (0x03C6,), '1D74B -> 03C6'; ok Uni.new(0x1D74C).NFKC.list ~~ (0x03C7,), '1D74C -> 03C7'; ok Uni.new(0x1D74D).NFKC.list ~~ (0x03C8,), '1D74D -> 03C8'; ok Uni.new(0x1D74E).NFKC.list ~~ (0x03C9,), '1D74E -> 03C9'; ok Uni.new(0x1D74F).NFKC.list ~~ (0x2202,), '1D74F -> 2202'; ok Uni.new(0x1D750).NFKC.list ~~ (0x03B5,), '1D750 -> 03B5'; ok Uni.new(0x1D751).NFKC.list ~~ (0x03B8,), '1D751 -> 03B8'; ok Uni.new(0x1D752).NFKC.list ~~ (0x03BA,), '1D752 -> 03BA'; ok Uni.new(0x1D753).NFKC.list ~~ (0x03C6,), '1D753 -> 03C6'; ok Uni.new(0x1D754).NFKC.list ~~ (0x03C1,), '1D754 -> 03C1'; ok Uni.new(0x1D755).NFKC.list ~~ (0x03C0,), '1D755 -> 03C0'; ok Uni.new(0x1D756).NFKC.list ~~ (0x0391,), '1D756 -> 0391'; ok Uni.new(0x1D757).NFKC.list ~~ (0x0392,), '1D757 -> 0392'; ok Uni.new(0x1D758).NFKC.list ~~ (0x0393,), '1D758 -> 0393'; ok Uni.new(0x1D759).NFKC.list ~~ (0x0394,), '1D759 -> 0394'; ok Uni.new(0x1D75A).NFKC.list ~~ (0x0395,), '1D75A -> 0395'; ok Uni.new(0x1D75B).NFKC.list ~~ (0x0396,), '1D75B -> 0396'; ok Uni.new(0x1D75C).NFKC.list ~~ (0x0397,), '1D75C -> 0397'; ok Uni.new(0x1D75D).NFKC.list ~~ (0x0398,), '1D75D -> 0398'; ok Uni.new(0x1D75E).NFKC.list ~~ (0x0399,), '1D75E -> 0399'; ok Uni.new(0x1D75F).NFKC.list ~~ (0x039A,), '1D75F -> 039A'; ok Uni.new(0x1D760).NFKC.list ~~ (0x039B,), '1D760 -> 039B'; ok Uni.new(0x1D761).NFKC.list ~~ (0x039C,), '1D761 -> 039C'; ok Uni.new(0x1D762).NFKC.list ~~ (0x039D,), '1D762 -> 039D'; ok Uni.new(0x1D763).NFKC.list ~~ (0x039E,), '1D763 -> 039E'; ok Uni.new(0x1D764).NFKC.list ~~ (0x039F,), '1D764 -> 039F'; ok Uni.new(0x1D765).NFKC.list ~~ (0x03A0,), '1D765 -> 03A0'; ok Uni.new(0x1D766).NFKC.list ~~ (0x03A1,), '1D766 -> 03A1'; ok Uni.new(0x1D767).NFKC.list ~~ (0x0398,), '1D767 -> 0398'; ok Uni.new(0x1D768).NFKC.list ~~ (0x03A3,), '1D768 -> 03A3'; ok Uni.new(0x1D769).NFKC.list ~~ (0x03A4,), '1D769 -> 03A4'; ok Uni.new(0x1D76A).NFKC.list ~~ (0x03A5,), '1D76A -> 03A5'; ok Uni.new(0x1D76B).NFKC.list ~~ (0x03A6,), '1D76B -> 03A6'; ok Uni.new(0x1D76C).NFKC.list ~~ (0x03A7,), '1D76C -> 03A7'; ok Uni.new(0x1D76D).NFKC.list ~~ (0x03A8,), '1D76D -> 03A8'; ok Uni.new(0x1D76E).NFKC.list ~~ (0x03A9,), '1D76E -> 03A9'; ok Uni.new(0x1D76F).NFKC.list ~~ (0x2207,), '1D76F -> 2207'; ok Uni.new(0x1D770).NFKC.list ~~ (0x03B1,), '1D770 -> 03B1'; ok Uni.new(0x1D771).NFKC.list ~~ (0x03B2,), '1D771 -> 03B2'; ok Uni.new(0x1D772).NFKC.list ~~ (0x03B3,), '1D772 -> 03B3'; ok Uni.new(0x1D773).NFKC.list ~~ (0x03B4,), '1D773 -> 03B4'; ok Uni.new(0x1D774).NFKC.list ~~ (0x03B5,), '1D774 -> 03B5'; ok Uni.new(0x1D775).NFKC.list ~~ (0x03B6,), '1D775 -> 03B6'; ok Uni.new(0x1D776).NFKC.list ~~ (0x03B7,), '1D776 -> 03B7'; ok Uni.new(0x1D777).NFKC.list ~~ (0x03B8,), '1D777 -> 03B8'; ok Uni.new(0x1D778).NFKC.list ~~ (0x03B9,), '1D778 -> 03B9'; ok Uni.new(0x1D779).NFKC.list ~~ (0x03BA,), '1D779 -> 03BA'; ok Uni.new(0x1D77A).NFKC.list ~~ (0x03BB,), '1D77A -> 03BB'; ok Uni.new(0x1D77B).NFKC.list ~~ (0x03BC,), '1D77B -> 03BC'; ok Uni.new(0x1D77C).NFKC.list ~~ (0x03BD,), '1D77C -> 03BD'; ok Uni.new(0x1D77D).NFKC.list ~~ (0x03BE,), '1D77D -> 03BE'; ok Uni.new(0x1D77E).NFKC.list ~~ (0x03BF,), '1D77E -> 03BF'; ok Uni.new(0x1D77F).NFKC.list ~~ (0x03C0,), '1D77F -> 03C0'; ok Uni.new(0x1D780).NFKC.list ~~ (0x03C1,), '1D780 -> 03C1'; ok Uni.new(0x1D781).NFKC.list ~~ (0x03C2,), '1D781 -> 03C2'; ok Uni.new(0x1D782).NFKC.list ~~ (0x03C3,), '1D782 -> 03C3'; ok Uni.new(0x1D783).NFKC.list ~~ (0x03C4,), '1D783 -> 03C4'; ok Uni.new(0x1D784).NFKC.list ~~ (0x03C5,), '1D784 -> 03C5'; ok Uni.new(0x1D785).NFKC.list ~~ (0x03C6,), '1D785 -> 03C6'; ok Uni.new(0x1D786).NFKC.list ~~ (0x03C7,), '1D786 -> 03C7'; ok Uni.new(0x1D787).NFKC.list ~~ (0x03C8,), '1D787 -> 03C8'; ok Uni.new(0x1D788).NFKC.list ~~ (0x03C9,), '1D788 -> 03C9'; ok Uni.new(0x1D789).NFKC.list ~~ (0x2202,), '1D789 -> 2202'; ok Uni.new(0x1D78A).NFKC.list ~~ (0x03B5,), '1D78A -> 03B5'; ok Uni.new(0x1D78B).NFKC.list ~~ (0x03B8,), '1D78B -> 03B8'; ok Uni.new(0x1D78C).NFKC.list ~~ (0x03BA,), '1D78C -> 03BA'; ok Uni.new(0x1D78D).NFKC.list ~~ (0x03C6,), '1D78D -> 03C6'; ok Uni.new(0x1D78E).NFKC.list ~~ (0x03C1,), '1D78E -> 03C1'; ok Uni.new(0x1D78F).NFKC.list ~~ (0x03C0,), '1D78F -> 03C0'; ok Uni.new(0x1D790).NFKC.list ~~ (0x0391,), '1D790 -> 0391'; ok Uni.new(0x1D791).NFKC.list ~~ (0x0392,), '1D791 -> 0392'; ok Uni.new(0x1D792).NFKC.list ~~ (0x0393,), '1D792 -> 0393'; ok Uni.new(0x1D793).NFKC.list ~~ (0x0394,), '1D793 -> 0394'; ok Uni.new(0x1D794).NFKC.list ~~ (0x0395,), '1D794 -> 0395'; ok Uni.new(0x1D795).NFKC.list ~~ (0x0396,), '1D795 -> 0396'; ok Uni.new(0x1D796).NFKC.list ~~ (0x0397,), '1D796 -> 0397'; ok Uni.new(0x1D797).NFKC.list ~~ (0x0398,), '1D797 -> 0398'; ok Uni.new(0x1D798).NFKC.list ~~ (0x0399,), '1D798 -> 0399';
64.548259
279
0.628016
ed90a0230357688ac734b8d2be08c178959a900c
14,463
pl
Perl
src/backend/catalog/genbki.pl
chet0xhenry/postgresql
6ffdf1265e74405c84b89ae8f239b01c8de47b89
[ "PostgreSQL" ]
1
2021-02-24T13:01:00.000Z
2021-02-24T13:01:00.000Z
src/backend/catalog/genbki.pl
chet0xhenry/postgresql
6ffdf1265e74405c84b89ae8f239b01c8de47b89
[ "PostgreSQL" ]
null
null
null
src/backend/catalog/genbki.pl
chet0xhenry/postgresql
6ffdf1265e74405c84b89ae8f239b01c8de47b89
[ "PostgreSQL" ]
null
null
null
#!/usr/bin/perl -w #---------------------------------------------------------------------- # # genbki.pl # Perl script that generates postgres.bki, postgres.description, # postgres.shdescription, and schemapg.h from specially formatted # header files. The .bki files are used to initialize the postgres # template database. # # Portions Copyright (c) 1996-2018, PostgreSQL Global Development Group # Portions Copyright (c) 1994, Regents of the University of California # # src/backend/catalog/genbki.pl # #---------------------------------------------------------------------- use Catalog; use strict; use warnings; my @input_files; my @include_path; my $output_path = ''; my $major_version; # Process command line switches. while (@ARGV) { my $arg = shift @ARGV; if ($arg !~ /^-/) { push @input_files, $arg; } elsif ($arg =~ /^-o/) { $output_path = length($arg) > 2 ? substr($arg, 2) : shift @ARGV; } elsif ($arg =~ /^-I/) { push @include_path, length($arg) > 2 ? substr($arg, 2) : shift @ARGV; } elsif ($arg =~ /^--set-version=(.*)$/) { $major_version = $1; die "Invalid version string.\n" if !($major_version =~ /^\d+$/); } else { usage(); } } # Sanity check arguments. die "No input files.\n" if !@input_files; die "No include path; you must specify -I at least once.\n" if !@include_path; die "--set-version must be specified.\n" if !defined $major_version; # Make sure output_path ends in a slash. if ($output_path ne '' && substr($output_path, -1) ne '/') { $output_path .= '/'; } # Open temp files my $tmpext = ".tmp$$"; my $bkifile = $output_path . 'postgres.bki'; open my $bki, '>', $bkifile . $tmpext or die "can't open $bkifile$tmpext: $!"; my $schemafile = $output_path . 'schemapg.h'; open my $schemapg, '>', $schemafile . $tmpext or die "can't open $schemafile$tmpext: $!"; my $descrfile = $output_path . 'postgres.description'; open my $descr, '>', $descrfile . $tmpext or die "can't open $descrfile$tmpext: $!"; my $shdescrfile = $output_path . 'postgres.shdescription'; open my $shdescr, '>', $shdescrfile . $tmpext or die "can't open $shdescrfile$tmpext: $!"; # Fetch some special data that we will substitute into the output file. # CAUTION: be wary about what symbols you substitute into the .bki file here! # It's okay to substitute things that are expected to be really constant # within a given Postgres release, such as fixed OIDs. Do not substitute # anything that could depend on platform or configuration. (The right place # to handle those sorts of things is in initdb.c's bootstrap_template1().) # NB: make sure that the files used here are known to be part of the .bki # file's dependencies by src/backend/catalog/Makefile. my $BOOTSTRAP_SUPERUSERID = Catalog::FindDefinedSymbol('pg_authid.h', \@include_path, 'BOOTSTRAP_SUPERUSERID'); my $PG_CATALOG_NAMESPACE = Catalog::FindDefinedSymbol('pg_namespace.h', \@include_path, 'PG_CATALOG_NAMESPACE'); # Read all the input header files into internal data structures my $catalogs = Catalog::Catalogs(@input_files); # Generate postgres.bki, postgres.description, and postgres.shdescription # version marker for .bki file print $bki "# PostgreSQL $major_version\n"; # vars to hold data needed for schemapg.h my %schemapg_entries; my @tables_needing_macros; my %regprocoids; my %types; # produce output, one catalog at a time foreach my $catname (@{ $catalogs->{names} }) { # .bki CREATE command for this catalog my $catalog = $catalogs->{$catname}; print $bki "create $catname $catalog->{relation_oid}" . $catalog->{shared_relation} . $catalog->{bootstrap} . $catalog->{without_oids} . $catalog->{rowtype_oid} . "\n"; my @attnames; my $first = 1; print $bki " (\n"; my $schema = $catalog->{columns}; foreach my $column (@$schema) { my $attname = $column->{name}; my $atttype = $column->{type}; push @attnames, $attname; if (!$first) { print $bki " ,\n"; } $first = 0; print $bki " $attname = $atttype"; if (defined $column->{forcenotnull}) { print $bki " FORCE NOT NULL"; } elsif (defined $column->{forcenull}) { print $bki " FORCE NULL"; } } print $bki "\n )\n"; # Open it, unless bootstrap case (create bootstrap does this # automatically) if (!$catalog->{bootstrap}) { print $bki "open $catname\n"; } if (defined $catalog->{data}) { # Ordinary catalog with DATA line(s) foreach my $row (@{ $catalog->{data} }) { # Split line into tokens without interpreting their meaning. my %bki_values; @bki_values{@attnames} = Catalog::SplitDataLine($row->{bki_values}); # Perform required substitutions on fields foreach my $column (@$schema) { my $attname = $column->{name}; my $atttype = $column->{type}; # Substitute constant values we acquired above. # (It's intentional that this can apply to parts of a field). $bki_values{$attname} =~ s/\bPGUID\b/$BOOTSTRAP_SUPERUSERID/g; $bki_values{$attname} =~ s/\bPGNSP\b/$PG_CATALOG_NAMESPACE/g; # Replace regproc columns' values with OIDs. # If we don't have a unique value to substitute, # just do nothing (regprocin will complain). if ($atttype eq 'regproc') { my $procoid = $regprocoids{ $bki_values{$attname} }; $bki_values{$attname} = $procoid if defined($procoid) && $procoid ne 'MULTIPLE'; } } # Save pg_proc oids for use in later regproc substitutions. # This relies on the order we process the files in! if ($catname eq 'pg_proc') { if (defined($regprocoids{ $bki_values{proname} })) { $regprocoids{ $bki_values{proname} } = 'MULTIPLE'; } else { $regprocoids{ $bki_values{proname} } = $row->{oid}; } } # Save pg_type info for pg_attribute processing below if ($catname eq 'pg_type') { my %type = %bki_values; $type{oid} = $row->{oid}; $types{ $type{typname} } = \%type; } # Write to postgres.bki my $oid = $row->{oid} ? "OID = $row->{oid} " : ''; printf $bki "insert %s( %s )\n", $oid, join(' ', @bki_values{@attnames}); # Write comments to postgres.description and # postgres.shdescription if (defined $row->{descr}) { printf $descr "%s\t%s\t0\t%s\n", $row->{oid}, $catname, $row->{descr}; } if (defined $row->{shdescr}) { printf $shdescr "%s\t%s\t%s\n", $row->{oid}, $catname, $row->{shdescr}; } } } if ($catname eq 'pg_attribute') { # For pg_attribute.h, we generate DATA entries ourselves. # NB: pg_type.h must come before pg_attribute.h in the input list # of catalog names, since we use info from pg_type.h here. foreach my $table_name (@{ $catalogs->{names} }) { my $table = $catalogs->{$table_name}; # Currently, all bootstrapped relations also need schemapg.h # entries, so skip if the relation isn't to be in schemapg.h. next if !$table->{schema_macro}; $schemapg_entries{$table_name} = []; push @tables_needing_macros, $table_name; # Generate entries for user attributes. my $attnum = 0; my $priornotnull = 1; foreach my $attr (@{ $table->{columns} }) { $attnum++; my %row; $row{attnum} = $attnum; $row{attrelid} = $table->{relation_oid}; morph_row_for_pgattr(\%row, $schema, $attr, $priornotnull); $priornotnull &= ($row{attnotnull} eq 't'); # If it's bootstrapped, put an entry in postgres.bki. print_bki_insert(\%row, @attnames) if $table->{bootstrap}; # Store schemapg entries for later. morph_row_for_schemapg(\%row, $schema); push @{ $schemapg_entries{$table_name} }, sprintf "{ %s }", join(', ', grep { defined $_ } @row{@attnames}); } # Generate entries for system attributes. # We only need postgres.bki entries, not schemapg.h entries. if ($table->{bootstrap}) { $attnum = 0; my @SYS_ATTRS = ( { name => 'ctid', type => 'tid' }, { name => 'oid', type => 'oid' }, { name => 'xmin', type => 'xid' }, { name => 'cmin', type => 'cid' }, { name => 'xmax', type => 'xid' }, { name => 'cmax', type => 'cid' }, { name => 'tableoid', type => 'oid' }); foreach my $attr (@SYS_ATTRS) { $attnum--; my %row; $row{attnum} = $attnum; $row{attrelid} = $table->{relation_oid}; $row{attstattarget} = '0'; # Omit the oid column if the catalog doesn't have them next if $table->{without_oids} && $attr->{name} eq 'oid'; morph_row_for_pgattr(\%row, $schema, $attr, 1); print_bki_insert(\%row, @attnames); } } } } print $bki "close $catname\n"; } # Any information needed for the BKI that is not contained in a pg_*.h header # (i.e., not contained in a header with a CATALOG() statement) comes here # Write out declare toast/index statements foreach my $declaration (@{ $catalogs->{toasting}->{data} }) { print $bki $declaration; } foreach my $declaration (@{ $catalogs->{indexing}->{data} }) { print $bki $declaration; } # Now generate schemapg.h # Opening boilerplate for schemapg.h print $schemapg <<EOM; /*------------------------------------------------------------------------- * * schemapg.h * Schema_pg_xxx macros for use by relcache.c * * Portions Copyright (c) 1996-2018, PostgreSQL Global Development Group * Portions Copyright (c) 1994, Regents of the University of California * * NOTES * ****************************** * *** DO NOT EDIT THIS FILE! *** * ****************************** * * It has been GENERATED by src/backend/catalog/genbki.pl * *------------------------------------------------------------------------- */ #ifndef SCHEMAPG_H #define SCHEMAPG_H EOM # Emit schemapg declarations foreach my $table_name (@tables_needing_macros) { print $schemapg "\n#define Schema_$table_name \\\n"; print $schemapg join ", \\\n", @{ $schemapg_entries{$table_name} }; print $schemapg "\n"; } # Closing boilerplate for schemapg.h print $schemapg "\n#endif /* SCHEMAPG_H */\n"; # We're done emitting data close $bki; close $schemapg; close $descr; close $shdescr; # Finally, rename the completed files into place. Catalog::RenameTempFile($bkifile, $tmpext); Catalog::RenameTempFile($schemafile, $tmpext); Catalog::RenameTempFile($descrfile, $tmpext); Catalog::RenameTempFile($shdescrfile, $tmpext); exit 0; #################### Subroutines ######################## # Given $pgattr_schema (the pg_attribute schema for a catalog sufficient for # AddDefaultValues), $attr (the description of a catalog row), and # $priornotnull (whether all prior attributes in this catalog are not null), # modify the $row hashref for print_bki_insert. This includes setting data # from the corresponding pg_type element and filling in any default values. # Any value not handled here must be supplied by caller. sub morph_row_for_pgattr { my ($row, $pgattr_schema, $attr, $priornotnull) = @_; my $attname = $attr->{name}; my $atttype = $attr->{type}; $row->{attname} = $attname; # Adjust type name for arrays: foo[] becomes _foo, so we can look it up in # pg_type $atttype = '_' . $1 if $atttype =~ /(.+)\[\]$/; # Copy the type data from pg_type, and add some type-dependent items my $type = $types{$atttype}; $row->{atttypid} = $type->{oid}; $row->{attlen} = $type->{typlen}; $row->{attbyval} = $type->{typbyval}; $row->{attstorage} = $type->{typstorage}; $row->{attalign} = $type->{typalign}; # set attndims if it's an array type $row->{attndims} = $type->{typcategory} eq 'A' ? '1' : '0'; $row->{attcollation} = $type->{typcollation}; if (defined $attr->{forcenotnull}) { $row->{attnotnull} = 't'; } elsif (defined $attr->{forcenull}) { $row->{attnotnull} = 'f'; } elsif ($priornotnull) { # attnotnull will automatically be set if the type is # fixed-width and prior columns are all NOT NULL --- # compare DefineAttr in bootstrap.c. oidvector and # int2vector are also treated as not-nullable. $row->{attnotnull} = $type->{typname} eq 'oidvector' ? 't' : $type->{typname} eq 'int2vector' ? 't' : $type->{typlen} eq 'NAMEDATALEN' ? 't' : $type->{typlen} > 0 ? 't' : 'f'; } else { $row->{attnotnull} = 'f'; } my $error = Catalog::AddDefaultValues($row, $pgattr_schema); if ($error) { die "Failed to form full tuple for pg_attribute: ", $error; } } # Write a pg_attribute entry to postgres.bki sub print_bki_insert { my $row = shift; my @attnames = @_; my $oid = $row->{oid} ? "OID = $row->{oid} " : ''; my $bki_values = join ' ', @{$row}{@attnames}; printf $bki "insert %s( %s )\n", $oid, $bki_values; } # Given a row reference, modify it so that it becomes a valid entry for # a catalog schema declaration in schemapg.h. # # The field values of a Schema_pg_xxx declaration are similar, but not # quite identical, to the corresponding values in postgres.bki. sub morph_row_for_schemapg { my $row = shift; my $pgattr_schema = shift; foreach my $column (@$pgattr_schema) { my $attname = $column->{name}; my $atttype = $column->{type}; # Some data types have special formatting rules. if ($atttype eq 'name') { # add {" ... "} quoting $row->{$attname} = sprintf(qq'{"%s"}', $row->{$attname}); } elsif ($atttype eq 'char') { # Replace empty string by zero char constant; add single quotes $row->{$attname} = '\0' if $row->{$attname} eq q|""|; $row->{$attname} = sprintf("'%s'", $row->{$attname}); } # Expand booleans from 'f'/'t' to 'false'/'true'. # Some values might be other macros (eg FLOAT4PASSBYVAL), # don't change. elsif ($atttype eq 'bool') { $row->{$attname} = 'true' if $row->{$attname} eq 't'; $row->{$attname} = 'false' if $row->{$attname} eq 'f'; } # We don't emit initializers for the variable length fields at all. # Only the fixed-size portions of the descriptors are ever used. delete $row->{$attname} if $column->{is_varlen}; } } sub usage { die <<EOM; Usage: genbki.pl [options] header... Options: -I path to include files -o output path --set-version PostgreSQL version number for initdb cross-check genbki.pl generates BKI files from specially formatted header files. These BKI files are used to initialize the postgres template database. Report bugs to <pgsql-bugs\@postgresql.org>. EOM }
28.192982
78
0.621863
73e2a4d2e0c8b03496d703a358a36384318e66c3
9,195
pm
Perl
lib/Mojo/IOLoop/Client.pm
jamadam/mojo
e3217946f67e2a71541d119e3492a5107e07cdd3
[ "Artistic-2.0" ]
null
null
null
lib/Mojo/IOLoop/Client.pm
jamadam/mojo
e3217946f67e2a71541d119e3492a5107e07cdd3
[ "Artistic-2.0" ]
3
2021-01-27T10:09:28.000Z
2021-05-11T21:20:12.000Z
lib/Mojo/IOLoop/Client.pm
jamadam/mojo
e3217946f67e2a71541d119e3492a5107e07cdd3
[ "Artistic-2.0" ]
2
2020-03-13T13:41:29.000Z
2021-09-29T00:19:26.000Z
package Mojo::IOLoop::Client; use Mojo::Base 'Mojo::EventEmitter'; use Errno 'EINPROGRESS'; use IO::Socket::IP; use IO::Socket::UNIX; use Mojo::IOLoop; use Mojo::IOLoop::TLS; use Scalar::Util 'weaken'; use Socket qw(IPPROTO_TCP SOCK_STREAM TCP_NODELAY); # Non-blocking name resolution requires Net::DNS::Native use constant NNR => $ENV{MOJO_NO_NNR} ? 0 : eval { require Net::DNS::Native; Net::DNS::Native->VERSION('0.15'); 1 }; my $NDN; # SOCKS support requires IO::Socket::Socks use constant SOCKS => $ENV{MOJO_NO_SOCKS} ? 0 : eval { require IO::Socket::Socks; IO::Socket::Socks->VERSION('0.64'); 1 }; use constant READ => SOCKS ? IO::Socket::Socks::SOCKS_WANT_READ() : 0; use constant WRITE => SOCKS ? IO::Socket::Socks::SOCKS_WANT_WRITE() : 0; has reactor => sub { Mojo::IOLoop->singleton->reactor }, weak => 1; sub DESTROY { shift->_cleanup } sub can_nnr {NNR} sub can_socks {SOCKS} sub connect { my ($self, $args) = (shift, ref $_[0] ? $_[0] : {@_}); # Timeout weaken $self; my $reactor = $self->reactor; $self->{timer} = $reactor->timer($args->{timeout} || 10, sub { $self->emit(error => 'Connect timeout') }); # Blocking name resolution $_ && s/[[\]]//g for @$args{qw(address socks_address)}; my $address = $args->{socks_address} || ($args->{address} ||= '127.0.0.1'); return $reactor->next_tick(sub { $self && $self->_connect($args) }) if !NNR || $args->{handle} || $args->{path}; # Non-blocking name resolution $NDN //= Net::DNS::Native->new(pool => 5, extra_thread => 1); my $handle = $self->{dns} = $NDN->getaddrinfo($address, _port($args), {protocol => IPPROTO_TCP, socktype => SOCK_STREAM}); $reactor->io( $handle => sub { my $reactor = shift; $reactor->remove($self->{dns}); my ($err, @res) = $NDN->get_result(delete $self->{dns}); return $self->emit(error => "Can't resolve: $err") if $err; $args->{addr_info} = \@res; $self->_connect($args); } )->watch($handle, 1, 0); } sub _cleanup { my $self = shift; $NDN->timedout($self->{dns}) if $NDN && $self->{dns}; return $self unless my $reactor = $self->reactor; $self->{$_} && $reactor->remove(delete $self->{$_}) for qw(dns timer handle); return $self; } sub _connect { my ($self, $args) = @_; my $path = $args->{path}; my $handle = $self->{handle} = $args->{handle}; unless ($handle) { my $class = $path ? 'IO::Socket::UNIX' : 'IO::Socket::IP'; my %options = (Blocking => 0); # UNIX domain socket if ($path) { $options{Peer} = $path } # IP socket else { if (my $info = $args->{addr_info}) { $options{PeerAddrInfo} = $info } else { $options{PeerAddr} = $args->{socks_address} || $args->{address}; $options{PeerPort} = _port($args); } $options{LocalAddr} = $args->{local_address} if $args->{local_address}; } return $self->emit(error => "Can't connect: $@") unless $self->{handle} = $handle = $class->new(%options); } $handle->blocking(0); $path ? $self->_try_socks($args) : $self->_wait('_ready', $handle, $args); } sub _port { $_[0]{socks_port} || $_[0]{port} || ($_[0]{tls} ? 443 : 80) } sub _ready { my ($self, $args) = @_; # Socket changes in between attempts and needs to be re-added for epoll/kqueue my $handle = $self->{handle}; unless ($handle->connect) { return $self->emit(error => $!) unless $! == EINPROGRESS; $self->reactor->remove($handle); return $self->_wait('_ready', $handle, $args); } return $self->emit(error => $! || 'Not connected') unless $handle->connected; # Disable Nagle's algorithm setsockopt $handle, IPPROTO_TCP, TCP_NODELAY, 1; $self->_try_socks($args); } sub _socks { my ($self, $args) = @_; # Connected my $handle = $self->{handle}; return $self->_try_tls($args) if $handle->ready; # Switch between reading and writing my $err = $IO::Socket::Socks::SOCKS_ERROR; if ($err == READ) { $self->reactor->watch($handle, 1, 0) } elsif ($err == WRITE) { $self->reactor->watch($handle, 1, 1) } else { $self->emit(error => $err) } } sub _try_socks { my ($self, $args) = @_; my $handle = $self->{handle}; return $self->_try_tls($args) unless $args->{socks_address}; return $self->emit( error => 'IO::Socket::Socks 0.64+ required for SOCKS support') unless SOCKS; my %options = (ConnectAddr => $args->{address}, ConnectPort => $args->{port}); @options{qw(AuthType Username Password)} = ('userpass', @$args{qw(socks_user socks_pass)}) if $args->{socks_user}; my $reactor = $self->reactor; $reactor->remove($handle); return $self->emit(error => 'SOCKS upgrade failed') unless IO::Socket::Socks->start_SOCKS($handle, %options); $self->_wait('_socks', $handle, $args); } sub _try_tls { my ($self, $args) = @_; my $handle = $self->{handle}; return $self->_cleanup->emit(connect => $handle) unless $args->{tls}; my $reactor = $self->reactor; $reactor->remove($handle); # Start TLS handshake weaken $self; my $tls = Mojo::IOLoop::TLS->new($handle)->reactor($self->reactor); $tls->on(upgrade => sub { $self->_cleanup->emit(connect => pop) }); $tls->on(error => sub { $self->emit(error => pop) }); $tls->negotiate(%$args); } sub _wait { my ($self, $next, $handle, $args) = @_; weaken $self; $self->reactor->io($handle => sub { $self->$next($args) }) ->watch($handle, 0, 1); } 1; =encoding utf8 =head1 NAME Mojo::IOLoop::Client - Non-blocking TCP/IP and UNIX domain socket client =head1 SYNOPSIS use Mojo::IOLoop::Client; # Create socket connection my $client = Mojo::IOLoop::Client->new; $client->on(connect => sub { my ($client, $handle) = @_; ... }); $client->on(error => sub { my ($client, $err) = @_; ... }); $client->connect(address => 'example.com', port => 80); # Start reactor if necessary $client->reactor->start unless $client->reactor->is_running; =head1 DESCRIPTION L<Mojo::IOLoop::Client> opens TCP/IP and UNIX domain socket connections for L<Mojo::IOLoop>. =head1 EVENTS L<Mojo::IOLoop::Client> inherits all events from L<Mojo::EventEmitter> and can emit the following new ones. =head2 connect $client->on(connect => sub { my ($client, $handle) = @_; ... }); Emitted once the connection is established. =head2 error $client->on(error => sub { my ($client, $err) = @_; ... }); Emitted if an error occurs on the connection, fatal if unhandled. =head1 ATTRIBUTES L<Mojo::IOLoop::Client> implements the following attributes. =head2 reactor my $reactor = $client->reactor; $client = $client->reactor(Mojo::Reactor::Poll->new); Low-level event reactor, defaults to the C<reactor> attribute value of the global L<Mojo::IOLoop> singleton. Note that this attribute is weakened. =head1 METHODS L<Mojo::IOLoop::Client> inherits all methods from L<Mojo::EventEmitter> and implements the following new ones. =head2 can_nnr my $bool = Mojo::IOLoop::Client->can_nnr; True if L<Net::DNS::Native> 0.15+ is installed and non-blocking name resolution support enabled. =head2 can_socks my $bool = Mojo::IOLoop::Client->can_socks; True if L<IO::Socket::SOCKS> 0.64+ is installed and SOCKS5 support enabled. =head2 connect $client->connect(address => '127.0.0.1', port => 3000); $client->connect({address => '127.0.0.1', port => 3000}); Open a socket connection to a remote host. Note that non-blocking name resolution depends on L<Net::DNS::Native> (0.15+), SOCKS5 support on L<IO::Socket::Socks> (0.64), and TLS support on L<IO::Socket::SSL> (2.009+). These options are currently available: =over 2 =item address address => 'mojolicious.org' Address or host name of the peer to connect to, defaults to C<127.0.0.1>. =item handle handle => $handle Use an already prepared L<IO::Socket::IP> object. =item local_address local_address => '127.0.0.1' Local address to bind to. =item path path => '/tmp/myapp.sock' Path of UNIX domain socket to connect to. =item port port => 80 Port to connect to, defaults to C<80> or C<443> with C<tls> option. =item socks_address socks_address => '127.0.0.1' Address or host name of SOCKS5 proxy server to use for connection. =item socks_pass socks_pass => 'secr3t' Password to use for SOCKS5 authentication. =item socks_port socks_port => 9050 Port of SOCKS5 proxy server to use for connection. =item socks_user socks_user => 'sri' Username to use for SOCKS5 authentication. =item timeout timeout => 15 Maximum amount of time in seconds establishing connection may take before getting canceled, defaults to C<10>. =item tls tls => 1 Enable TLS. =item tls_ca tls_ca => '/etc/tls/ca.crt' Path to TLS certificate authority file. =item tls_cert tls_cert => '/etc/tls/client.crt' Path to the TLS certificate file. =item tls_key tls_key => '/etc/tls/client.key' Path to the TLS key file. =item tls_protocols tls_protocols => ['foo', 'bar'] ALPN protocols to negotiate. =item tls_verify tls_verify => 0x00 TLS verification mode. =back =head1 SEE ALSO L<Mojolicious>, L<Mojolicious::Guides>, L<https://mojolicious.org>. =cut
23.883117
80
0.639587
ed0dd772d501251a70ff24f1f1454c14f0e5a8b2
1,231
pm
Perl
lib/OpusVL/FB11/Form/Admin/Users/Edit.pm
OpusVL/OpusVL-FB11
eecdace4e58ffd4421743b69e3fcfd7b879ad344
[ "Artistic-1.0" ]
2
2019-06-11T18:56:30.000Z
2019-08-22T13:44:16.000Z
lib/OpusVL/FB11/Form/Admin/Users/Edit.pm
OpusVL/OpusVL-FB11
eecdace4e58ffd4421743b69e3fcfd7b879ad344
[ "Artistic-1.0" ]
45
2017-11-27T09:34:17.000Z
2020-09-26T09:56:29.000Z
lib/OpusVL/FB11/Form/Admin/Users/Edit.pm
OpusVL/OpusVL-FB11
eecdace4e58ffd4421743b69e3fcfd7b879ad344
[ "Artistic-1.0" ]
1
2019-03-28T13:50:46.000Z
2019-03-28T13:50:46.000Z
package OpusVL::FB11::Form::Admin::Users::Edit; our $VERSION = '2'; use OpusVL::FB11::Plugin::FormHandler; with 'HTML::FormHandler::TraitFor::Model::DBIC'; has_field 'username' => ( type => 'Text', label => 'Username', required => 1, # Stops chrome trying to populate it like a login form element_attr => { autocomplete => 'new-username', } ); has_field 'name' => ( type => 'Text', label => 'Name', required => 1, ); has_field 'email' => ( type => 'Email', label => 'Email', required => 1, ); has_field 'tel' => ( type => 'Text', label => 'Telephone', ); has_field 'status' => ( type => 'Select', widget => 'RadioGroup', options => [ { value => 'enabled', label => 'Enabled', attributes => { checked => 'checked' } }, { value => 'disabled', label => 'Disabled' }, ], ); has_field 'submit-it' => ( type => 'Submit', widget => "ButtonTag", widget_wrapper => "None", value => '<i class="fa fa-check"></i> Submit', element_attr => { value => 'submitok', class => ['btn', 'btn-primary'] } ); no HTML::FormHandler::Moose; 1; __END__
22.381818
91
0.515028
ed234dd610081e2e46643f7ee39a004b8ef9a319
1,304
pl
Perl
pop/plog/lib/on_interrupt.pl
nickpapadonis/poplog-x64
c4af8c97e68823fe162fbedde0bc0af183c3a1ca
[ "MIT" ]
null
null
null
pop/plog/lib/on_interrupt.pl
nickpapadonis/poplog-x64
c4af8c97e68823fe162fbedde0bc0af183c3a1ca
[ "MIT" ]
null
null
null
pop/plog/lib/on_interrupt.pl
nickpapadonis/poplog-x64
c4af8c97e68823fe162fbedde0bc0af183c3a1ca
[ "MIT" ]
null
null
null
/* --- Copyright University of Sussex 1991. All rights reserved. ---------- > File: C.all/plog/lib/on_interrupt.pl > Purpose: Handling keyboard interrupts > Author: Simon Nichols, Jun 19 1991 > Documentation: HELP * ON_INTERRUPT */ :- system_predicate on_interrupt/2. :- module prolog. :- prolog_language(pop11). compile_mode:pop11 +strict; 12 -> item_chartype(`\\`, readitem); ;;; alphabeticiser define on_interrupt\/2(OldAction, NewAction); lvars OldAction, NewAction, old_action; define lconstant invoke(/* Goal */) with_nargs 1; prolog_sysinvoke(prolog_instance(/* Goal */)) -> ; enddefine; if prolog_interrupt == identfn then "abort"; elseif pdpart(prolog_interrupt) == invoke then prolog_instance(frozval(1, prolog_interrupt)); else prolog_interrupt; endif -> old_action; returnunless(prolog_unify(OldAction, old_action)); prolog_deref(NewAction) -> NewAction; if isprologvar(NewAction) then prolog_assign(NewAction, old_action); elseif NewAction == "abort" then identfn -> prolog_interrupt; elseif isprocedure(NewAction) then NewAction -> prolog_interrupt; else invoke(% prolog_generalise(NewAction) %) -> prolog_interrupt; endif; chain(prolog_apply_continuation) enddefine; :- prolog_language(prolog). :- endmodule prolog.
25.076923
75
0.726994
73de6f7f0fce3d63c796c0d510ae8e623fb9a186
1,974
pm
Perl
src/soft/miARma-Seq.1.7.5/lib/Perl/DateTime/TimeZone/America/Bogota.pm
eandresleon/miRNA-mRNA_Integration
b478a6ae73e235f9826cbf5343d2865bfcb067fa
[ "Apache-2.0" ]
8
2018-08-13T18:50:15.000Z
2021-11-02T05:09:44.000Z
src/soft/miARma-Seq.1.7.5/lib/Perl/DateTime/TimeZone/America/Bogota.pm
eandresleon/miRNA-mRNA_Integration
b478a6ae73e235f9826cbf5343d2865bfcb067fa
[ "Apache-2.0" ]
null
null
null
src/soft/miARma-Seq.1.7.5/lib/Perl/DateTime/TimeZone/America/Bogota.pm
eandresleon/miRNA-mRNA_Integration
b478a6ae73e235f9826cbf5343d2865bfcb067fa
[ "Apache-2.0" ]
4
2018-10-26T04:31:32.000Z
2020-06-20T07:01:33.000Z
# This file is auto-generated by the Perl DateTime Suite time zone # code generator (0.07) This code generator comes with the # DateTime::TimeZone module distribution in the tools/ directory # # Generated from /tmp/8FT049ktOU/southamerica. Olson data version 2015d # # Do not edit this file directly. # package DateTime::TimeZone::America::Bogota; $DateTime::TimeZone::America::Bogota::VERSION = '1.90'; use strict; use Class::Singleton 1.03; use DateTime::TimeZone; use DateTime::TimeZone::OlsonDB; @DateTime::TimeZone::America::Bogota::ISA = ( 'Class::Singleton', 'DateTime::TimeZone' ); my $spans = [ [ DateTime::TimeZone::NEG_INFINITY, # utc_start 59428011376, # utc_end 1884-03-13 04:56:16 (Thu) DateTime::TimeZone::NEG_INFINITY, # local_start 59427993600, # local_end 1884-03-13 00:00:00 (Thu) -17776, 0, 'LMT', ], [ 59428011376, # utc_start 1884-03-13 04:56:16 (Thu) 60396641776, # utc_end 1914-11-23 04:56:16 (Mon) 59427993600, # local_start 1884-03-13 00:00:00 (Thu) 60396624000, # local_end 1914-11-23 00:00:00 (Mon) -17776, 0, 'BMT', ], [ 60396641776, # utc_start 1914-11-23 04:56:16 (Mon) 62840552400, # utc_end 1992-05-03 05:00:00 (Sun) 60396623776, # local_start 1914-11-22 23:56:16 (Sun) 62840534400, # local_end 1992-05-03 00:00:00 (Sun) -18000, 0, 'COT', ], [ 62840552400, # utc_start 1992-05-03 05:00:00 (Sun) 62869579200, # utc_end 1993-04-04 04:00:00 (Sun) 62840538000, # local_start 1992-05-03 01:00:00 (Sun) 62869564800, # local_end 1993-04-04 00:00:00 (Sun) -14400, 1, 'COST', ], [ 62869579200, # utc_start 1993-04-04 04:00:00 (Sun) DateTime::TimeZone::INFINITY, # utc_end 62869561200, # local_start 1993-04-03 23:00:00 (Sat) DateTime::TimeZone::INFINITY, # local_end -18000, 0, 'COT', ], ]; sub olson_version {'2015d'} sub has_dst_changes {1} sub _max_year {2025} sub _new_instance { return shift->_init( @_, spans => $spans ); } 1;
23.783133
89
0.674265
ed07434b717846404a613cc45eebeff0870cbc94
787
pm
Perl
lib/Moose/Meta/Method/Accessor/Native/Hash/delete.pm
RsrchBoy/moose
6bdea4fe2cf00478e26c3949994825ed66964da0
[ "Artistic-1.0" ]
null
null
null
lib/Moose/Meta/Method/Accessor/Native/Hash/delete.pm
RsrchBoy/moose
6bdea4fe2cf00478e26c3949994825ed66964da0
[ "Artistic-1.0" ]
null
null
null
lib/Moose/Meta/Method/Accessor/Native/Hash/delete.pm
RsrchBoy/moose
6bdea4fe2cf00478e26c3949994825ed66964da0
[ "Artistic-1.0" ]
null
null
null
package Moose::Meta::Method::Accessor::Native::Hash::delete; our $VERSION = '2.2007'; use strict; use warnings; use Moose::Role; with 'Moose::Meta::Method::Accessor::Native::Hash::Writer'; sub _adds_members { 0 } sub _potential_value { my $self = shift; my ($slot_access) = @_; return '(do { ' . 'my %potential = %{ (' . $slot_access . ') }; ' . '@return = delete @potential{@_}; ' . '\%potential; ' . '})'; } sub _inline_optimized_set_new_value { my $self = shift; my ($inv, $new, $slot_access) = @_; return '@return = delete @{ (' . $slot_access . ') }{@_};'; } sub _return_value { my $self = shift; my ($slot_access) = @_; return 'wantarray ? @return : $return[-1]'; } no Moose::Role; 1;
19.195122
63
0.551461
ed70fadd9cdd47982d32397b5689b911996261bc
9,003
pl
Perl
v2.1/developer/dist_3.0.70/mcon/pl/wanted.pl
oldbitpusher/npasswd
c0d535196d0d26bde72f44e4883a5be0a841c6b7
[ "BSD-4-Clause-UC" ]
null
null
null
v2.1/developer/dist_3.0.70/mcon/pl/wanted.pl
oldbitpusher/npasswd
c0d535196d0d26bde72f44e4883a5be0a841c6b7
[ "BSD-4-Clause-UC" ]
null
null
null
v2.1/developer/dist_3.0.70/mcon/pl/wanted.pl
oldbitpusher/npasswd
c0d535196d0d26bde72f44e4883a5be0a841c6b7
[ "BSD-4-Clause-UC" ]
null
null
null
;# $Id: wanted.pl,v 3.0.1.2 1995/01/11 15:42:37 ram Exp $ ;# ;# Copyright (c) 1991-1993, Raphael Manfredi ;# ;# You may redistribute only under the terms of the Artistic Licence, ;# as specified in the README file that comes with the distribution. ;# You may reuse parts of this distribution only within the terms of ;# that same Artistic Licence; a copy of which may be found at the root ;# of the source tree for dist 3.0. ;# ;# $Log: wanted.pl,v $ ;# Revision 3.0.1.2 1995/01/11 15:42:37 ram ;# patch45: added % in front of hash table names for perl5's each() (ADO) ;# patch45: tell users about possible extra file-extension lookups ;# ;# Revision 3.0.1.1 1993/10/16 13:56:05 ram ;# patch12: modified to handle ?M: lines ;# patch12: added warning when magic symbols used without proper config ;# ;# Revision 3.0 1993/08/18 12:10:29 ram ;# Baseline for dist 3.0 netwide release. ;# ;# ;# These two arrays record the file names of the files which may (or may not) ;# contain shell or C symbols known by metaconfig. ;# @SHlist records the .SH files ;# @clist records the C-like files (i.e. .[chyl]) ;# ;# These files are scanned in turn to see how many symbols known by metaconfig ;# they have. Those symbols are gathered in a Wanted file. As C symbols are ;# not true targets for the forthcoming Makefile, a ">" sign is prepended. ;# Finally, the obsolete symbols are preceded by a "!". ;# ;# When obsolete symbols are found, they are dumped in file 'Obsolete'. Two ;# files are created anyway in the .MT directory. Obsol_h.U and Obsol_sh.U which ;# respectively list the obsoleted symbols (C and shell ones). ;# Obsol_h.U records obsolete C symbols ;# Obsol_sh.U records obsolete shell symbols ;# ;# The manifake() routine has to be provided externally. ;# # Build a wanted file from the files held in @SHlist and @clist arrays sub build_wanted { # If wanted file is already there, parse it to map obsolete if -o option # was used. Otherwise, build a new one. if (-f 'Wanted') { &map_obsolete if $opt_o; # Build Obsol*.U files &dump_obsolete; # Dump obsolete symbols if any return; } &parse_files; } sub parse_files { print "Building a Wanted file...\n" unless $opt_s; open(WANTED,"| sort | uniq >Wanted") || die "Can't create Wanted.\n"; unless (-f $NEWMANI) { &manifake; die "No $NEWMANI--can't build a Wanted file.\n" unless -f $NEWMANI; } local($search); # Where to-be-evaled script is held local($_) = ' ' x 50000 if $opt_m; # Pre-extend pattern search space local(%visited); # Records visited files local(%lastfound); # Where last occurence of key was # Now we are a little clever, and build a loop to eval so that we don't # have to recompile our patterns on every file. We also use "study" since # we are searching the same string for many different things. Hauls! if (@clist) { local($others) = $cext ? " $cext" : ''; print " Scanning .[chyl]$others files for symbols...\n" unless $opt_s; $search = ' ' x (40 * (@cmaster + @ocmaster)); # Pre-extend $search = "while (<>) {study;\n"; # Init loop over ARGV foreach $key (keys(%cmaster)) { $search .= "&cmaster('$key') if /\\b$key\\b/;\n"; } foreach $key (grep(!/^\$/, keys %Obsolete)) { $search .= "&ofound('$key') if /\\b$key\\b/;\n"; } $search .= "}\n"; # terminate loop print $search if $opt_d; @ARGV = @clist; # Swallow each file as a whole, if memory is available undef $/ if $opt_m; eval $search; eval ''; $/ = "\n"; while (($key,$value) = each(%cmaster)) { print WANTED $cwanted{$key}, "\n", ">$key", "\n" if $value; } } # If they don't use magic but use magically guarded symbols without # their corresponding C symbol dependency, warn them, since they might # not know about that portability issue. if (@clist && !$opt_M) { local($nused); # list of non-used symbols local($warning) = 0; # true when one warning issued foreach $cmag (keys %mwanted) { # loop over all used magic symbols next unless $cmaster{$cmag}; $nused = ''; foreach $cdep (split(' ', $mwanted{$cmag})) { $nused .= " $cdep" unless $cmaster{$cdep}; } $nused =~ s/^ //; $nused = "one of " . $nused if $nused =~ s/ /, /g; if ($nused ne '') { print " Warning: $cmag is used without $nused.\n"; $warning++; } } if ($warning) { local($those) = $warning == 1 ? 'that' : 'those'; local($s) = $warning == 1 ? '' : 's'; print "Note: $those previous warning$s may be suppressed by -M.\n"; } } # Cannot remove $cmaster as it is used later on when building Configure undef @clist; undef %cwanted; undef %mwanted; %visited = (); %lastfound = (); if (@SHlist) { local($others) = $shext ? " $shext" : ''; print " Scanning .SH$others files for symbols...\n" unless $opt_s; $search = ' ' x (40 * (@shmaster + @oshmaster)); # Pre-extend $search = "while (<>) {study;\n"; # All the keys already have a leading '$' foreach $key (keys(%shmaster)) { $search .= "&shmaster('$key') if /\\$key\\b/;\n"; } foreach $key (grep (/^\$/, keys %Obsolete)) { $search .= "&ofound('$key') if /\\$key\\b/;\n"; } $search .= "}\n"; print $search if $opt_d; @ARGV = @SHlist; # Swallow each file as a whole, if memory is available undef $/ if $opt_m; eval $search; eval ''; $/ = "\n"; while (($key,$value) = each(%shmaster)) { if ($value) { $key =~ s/^\$//; print WANTED $key, "\n"; } } } # Obsolete symbols, if any, are written in the Wanted file preceded by a # '!' character. In case -w is used, we'll thus be able to correctly build # the Obsol_h.U and Obsol_sh.U files. &add_obsolete; # Add obsolete symbols in Wanted file close WANTED; # If obsolete symbols where found, write an Obsolete file which lists where # each of them appear and the new symbol to be used. Also write Obsol_h.U # and Obsol_sh.U in .MT for later perusal. &dump_obsolete; # Dump obsolete symbols if any die "No desirable symbols found--aborting.\n" unless -s 'Wanted'; # Clean-up memory by freeing useless data structures undef @SHlist; undef %shmaster; } # This routine records matches of C master keys sub cmaster { local($key) = @_; $cmaster{$key}++; # This symbol is wanted return unless $opt_t || $opt_M; # Return if neither -t nor -M if ($opt_t && $lastfound{$key} ne $ARGV # Never mentionned for this file ? ) { $visited{$ARGV}++ || print $ARGV,":\n"; print "\t$key\n"; $lastfound{$key} = $ARGV; } if ($opt_M && defined($mwanted{$key}) # Found a ?M: symbol ) { foreach $csym (split(' ', $mwanted{$key})) { $cmaster{$csym}++; # Activate C symbol dependencies } } } # This routine records matches of obsolete keys (C or shell) sub ofound { local($key) = @_; local($_) = $Obsolete{$key}; # Value of new symbol $ofound{"$ARGV $key $_"}++; # Record obsolete match $cmaster{$_}++ unless /^\$/; # A C hit $shmaster{$_}++ if /^\$/; # Or a shell one return unless $opt_t; # Continue if trace option on if ($lastfound{$key} ne $ARGV) { # Never mentionned for this file ? $visited{$ARGV}++ || print $ARGV,":\n"; print "\t$key (obsolete, use $_)\n"; $lastfound{$key} = $ARGV; } } # This routine records matches of shell master keys sub shmaster { local($key) = @_; $shmaster{$key}++; # This symbol is wanted return unless $opt_t; # Continue if trace option on if ($lastfound{$key} ne $ARGV) { # Never mentionned for this file ? $visited{$ARGV}++ || print $ARGV,":\n"; print "\t$key\n"; $lastfound{$key} = $ARGV; } } # Write obsolete symbols into the Wanted file for later perusal by -w. sub add_obsolete { local($file); # File where obsolete symbol was found local($old); # Name of this old symbol local($new); # Value of the new symbol to be used foreach $key (sort keys %ofound) { ($file, $old, $new) = ($key =~ /^(\S+)\s+(\S+)\s+(\S+)/); if ($new =~ s/^\$//) { # We found an obsolete shell symbol print WANTED "!$old\n"; } else { # We found an obsolete C symbol print WANTED "!>$old\n"; } } } # Map obsolete symbols from Wanted file into %Obsolete and call dump_obsolete # to actually build the Obsol_sh.U and Obsol_h.U files. Those will be needed # during the Configure building phase to actually do the remaping. # The obsolete symbols found are entered in the %ofound array, tagged as from # file 'XXX', which is specially recognized by dump_obsolete. sub map_obsolete { open(WANTED, 'Wanted') || die "Can't open Wanted file.\n"; local($new); # New symbol to be used instead of obsolete one while (<WANTED>) { chop; next unless s/^!//; # Skip non-obsolete symbols if (s/^>//) { # C symbol $new = $Obsolete{$_}; # Fetch new symbol $ofound{"XXX $_ $new"}++; # Record obsolete match (XXX = no file) } else { # Shell symbol $new = $Obsolete{"\$$_"}; # Fetch new symbol $ofound{"XXX \$$_ $new"}++; # Record obsolete match (XXX = no file) } } close WANTED; }
34.102273
80
0.635233
ed9441fd1901b43a7077a66e70a41651dbe5af40
9,302
pm
Perl
Net-SSLeay-1.85/inc/Module/Install/PRIVATE/Net/SSLeay.pm
jmaslak/dotfiles
c3cf4697cdfc9f42b2173a4d6121caed0a776b09
[ "Apache-2.0", "MIT" ]
4
2019-08-24T19:16:54.000Z
2020-09-09T22:45:45.000Z
Net-SSLeay-1.85/inc/Module/Install/PRIVATE/Net/SSLeay.pm
jmaslak/dotfiles
c3cf4697cdfc9f42b2173a4d6121caed0a776b09
[ "Apache-2.0", "MIT" ]
1
2017-12-05T18:32:58.000Z
2018-07-12T15:24:56.000Z
Net-SSLeay-1.85/inc/Module/Install/PRIVATE/Net/SSLeay.pm
jmaslak/dotfiles
c3cf4697cdfc9f42b2173a4d6121caed0a776b09
[ "Apache-2.0", "MIT" ]
null
null
null
#line 1 package Module::Install::PRIVATE::Net::SSLeay; use strict; use Module::Install::Base; use File::Basename (); use File::Spec; use Config; use Symbol qw(gensym); use vars qw{$VERSION @ISA}; BEGIN { $VERSION = 0.01; @ISA = qw{Module::Install::Base}; } # Define this to one if you want to link the openssl libraries statically into # the Net-SSLeay loadable object on Windows my $win_link_statically = 0; sub ssleay { my ($self) = @_; $self->requires_external_cc; my $prefix = $self->find_openssl_prefix; my $exec = $self->find_openssl_exec($prefix); unless (-x $exec) { print <<EOM; *** Could not find OpenSSL If it's already installed, please set the OPENSSL_PREFIX environment variable accordingly. If it isn't installed yet, get the latest version from http://www.openssl.org/. EOM exit 0; # according http://wiki.cpantesters.org/wiki/CPANAuthorNotes this is best-practice when "missing library" } $self->check_openssl_version($prefix, $exec); my $opts = $self->ssleay_get_build_opts($prefix, $exec); $self->makemaker_args( CCCDLFLAGS => $opts->{cccdlflags}, OPTIMIZE => $opts->{optimize}, INC => join(' ', map {"-I$_"} @{$opts->{inc_paths}}), LIBS => join(' ', (map {"-L$_"} @{$opts->{lib_paths}}), (map {"-l$_"} @{$opts->{lib_links}})), ); if ( $self->prompt( "Do you want to run external tests?\n". "These tests *will* *fail* if you do not have network connectivity.", 'n', ) =~ /^y/i ) { $self->tests('t/*/*.t t/*/*/*.t'); } else { $self->tests('t/local/*.t t/handle/local/*.t'); } } sub ssleay_get_build_opts { my ($self, $prefix, $exec) = @_; my $opts = { lib_links => [], cccdlflags => '', }; for ("$prefix/include", "$prefix/inc32", '/usr/kerberos/include') { push @{$opts->{inc_paths}}, $_ if -f "$_/openssl/ssl.h"; } for ($prefix, "$prefix/lib64", "$prefix/lib", "$prefix/out32dll") { push @{$opts->{lib_paths}}, $_ if -d $_; } my $rsaref = $self->ssleay_is_rsaref; print <<EOM; *** Be sure to use the same compiler and options to compile your OpenSSL, perl, and Net::SSLeay. Mixing and matching compilers is not supported. EOM if ($^O eq 'MSWin32') { print "*** RSAREF build on Windows not supported out of box" if $rsaref; if ($win_link_statically) { # Link to static libs push @{ $opts->{lib_paths} }, "$prefix/lib/VC/static" if -d "$prefix/lib/VC/static"; } else { push @{ $opts->{lib_paths} }, "$prefix/lib/VC" if -d "$prefix/lib/VC"; } my $found = 0; my @pairs = (); # Library names depend on the compiler @pairs = (['eay32','ssl32'],['crypto.dll','ssl.dll'],['crypto','ssl']) if $Config{cc} =~ /gcc/; @pairs = (['libeay32','ssleay32'],['libeay32MD','ssleay32MD'],['libeay32MT','ssleay32MT']) if $Config{cc} =~ /cl/; for my $dir (@{$opts->{lib_paths}}) { for my $p (@pairs) { $found = 1 if ($Config{cc} =~ /gcc/ && -f "$dir/lib$p->[0].a" && -f "$dir/lib$p->[1].a"); $found = 1 if ($Config{cc} =~ /cl/ && -f "$dir/$p->[0].lib" && -f "$dir/p->[1].lib"); if ($found) { $opts->{lib_links} = [$p->[0], $p->[1], 'crypt32']; # Some systems need this system lib crypt32 too $opts->{lib_paths} = [$dir]; last; } } } if (!$found) { #fallback to the old behaviour push @{ $opts->{lib_links} }, qw( libeay32MD ssleay32MD libeay32 ssleay32 libssl32 crypt32); } } elsif ($^O eq 'VMS') { if (-r 'sslroot:[000000]openssl.cnf') { # openssl.org source install @{ $opts->{lib_paths} } = 'SSLLIB'; @{ $opts->{lib_links} } = qw( ssl_libssl32.olb ssl_libcrypto32.olb ); } elsif (-r 'ssl$root:[000000]openssl.cnf') { # HP install @{ $opts->{lib_paths} } = 'SYS$SHARE'; @{ $opts->{lib_links} } = qw( SSL$LIBSSL_SHR32 SSL$LIBCRYPTO_SHR32 ); } @{ $opts->{lib_links} } = map { $_ =~ s/32\b//g } @{ $opts->{lib_links} } if $Config{use64bitall}; } else { push @{ $opts->{lib_links} }, ($rsaref ? qw( ssl crypto RSAglue rsaref ) : qw( ssl crypto ) ); if (($Config{cc} =~ /aCC/i) && $^O eq 'hpux') { print "*** Enabling HPUX aCC options (+e)\n"; $opts->{optimize} = '+e -O2 -g'; } if ( (($Config{ccname} || $Config{cc}) eq 'gcc') && ($Config{cccdlflags} =~ /-fpic/) ) { print "*** Enabling gcc -fPIC optimization\n"; $opts->{cccdlflags} .= '-fPIC'; } } # From HMBRAND to handle multple version of OPENSSL installed if (my $lp = join " " => map { "-L$_" } @{$opts->{lib_paths} || []}) { my $mma = $self->makemaker_args; ($mma->{uc $_} = $Config{$_}) =~ s/-L/$lp -L/ for qw( lddlflags ldflags ); } return $opts; } sub ssleay_is_rsaref { my ($self) = @_; return $ENV{OPENSSL_RSAREF}; } my $other_try = 0; my @nopath; sub check_no_path { # On OS/2 it would be typically on default paths my $p; if (not($other_try++) and $] >= 5.008001) { use ExtUtils::MM; my $mm = MM->new(); my ($list) = $mm->ext("-lssl"); return unless $list =~ /-lssl\b/; for $p (split /\Q$Config{path_sep}/, $ENV{PATH}) { @nopath = ("$p/openssl$Config{_exe}", # exe name '.') # dummy lib path if -x "$p/openssl$Config{_exe}" } } @nopath; } sub find_openssl_prefix { my ($self, $dir) = @_; if (defined $ENV{OPENSSL_PREFIX}) { return $ENV{OPENSSL_PREFIX}; } my @guesses = ( '/home/linuxbrew/.linuxbrew/opt/openssl/bin/openssl' => '/home/linuxbrew/.linuxbrew/opt/openssl', # LinuxBrew openssl '/usr/local/opt/openssl/bin/openssl' => '/usr/local/opt/openssl', # OSX homebrew openssl '/usr/local/bin/openssl' => '/usr/local', # OSX homebrew openssl '/opt/local/bin/openssl' => '/opt/local', # Macports openssl '/usr/bin/openssl' => '/usr', '/usr/sbin/openssl' => '/usr', '/opt/ssl/bin/openssl' => '/opt/ssl', '/opt/ssl/sbin/openssl' => '/opt/ssl', '/usr/local/ssl/bin/openssl' => '/usr/local/ssl', '/usr/local/openssl/bin/openssl' => '/usr/local/openssl', '/apps/openssl/std/bin/openssl' => '/apps/openssl/std', '/usr/sfw/bin/openssl' => '/usr/sfw', # Open Solaris 'C:\OpenSSL\bin\openssl.exe' => 'C:\OpenSSL', 'C:\OpenSSL-Win32\bin\openssl.exe' => 'C:\OpenSSL-Win32', $Config{prefix} . '\bin\openssl.exe' => $Config{prefix}, # strawberry perl $Config{prefix} . '\..\c\bin\openssl.exe' => $Config{prefix} . '\..\c', # strawberry perl '/sslexe/openssl.exe' => '/sslroot', # VMS, openssl.org '/ssl$exe/openssl.exe' => '/ssl$root', # VMS, HP install ); while (my $k = shift @guesses and my $v = shift @guesses) { if ( -x $k ) { return $v; } } (undef, $dir) = $self->check_no_path and return $dir; return; } sub find_openssl_exec { my ($self, $prefix) = @_; my $exe_path; for my $subdir (qw( bin sbin out32dll ia64_exe alpha_exe )) { my $path = File::Spec->catfile($prefix, $subdir, "openssl$Config{_exe}"); if ( -x $path ) { return $path; } } ($prefix) = $self->check_no_path and return $prefix; return; } sub check_openssl_version { my ($self, $prefix, $exec) = @_; my ($major, $minor, $letter); { my $pipe = gensym(); open($pipe, qq{"$exec" version |}) or die "Could not execute $exec"; my $output = <$pipe>; chomp $output; close $pipe; if ( ($major, $minor, $letter) = $output =~ /^OpenSSL\s+(\d+\.\d+)\.(\d+)([a-z]?)/ ) { print "*** Found OpenSSL-${major}.${minor}${letter} installed in $prefix\n"; } elsif ( ($major, $minor) = $output =~ /^LibreSSL\s+(\d+\.\d+)\.(\d+)/ ) { print "*** Found LibreSSL-${major}.${minor} installed in $prefix\n"; } else { die <<EOM *** OpenSSL version test failed (`$output' has been returned) Either you have bogus OpenSSL or a new version has changed the version number format. Please inform the authors! EOM } } if ($major < 0.9 || ($major == 0.9 && $minor < 3)) { print <<EOM; *** That's too old! Please upgrade OpenSSL to the latest version (http://www.openssl.org/) EOM exit 0; # according http://wiki.cpantesters.org/wiki/CPANAuthorNotes this is best-practice when "missing library" } if ($major == 1.1 && $minor > 0) { print <<EOM; *** That's newer than what this module was tested with You should consider checking if there is a newer release of this module available. Everything will probably work OK, though. EOM } } sub fixpath { my ($self, $text) = @_; my $sep = File::Spec->catdir(''); $text =~ s{\b/}{$sep}g; return $text; } 1;
33.103203
122
0.536551
73febd4dae74fa0324a61cc752116600e448d247
20,623
pm
Perl
lib/Lemplate/Directive.pm
openresty/lemplate
5335fcf49138a53aa73c65a9158a021e3029e1d3
[ "Condor-1.1", "Naumen", "Xnet", "Net-SNMP", "X11", "MS-PL" ]
93
2016-01-09T06:49:41.000Z
2021-06-14T13:54:47.000Z
lib/Lemplate/Directive.pm
openresty/lemplate
5335fcf49138a53aa73c65a9158a021e3029e1d3
[ "Condor-1.1", "Naumen", "Xnet", "Net-SNMP", "X11", "MS-PL" ]
9
2017-04-06T21:30:25.000Z
2017-11-29T07:13:49.000Z
lib/Lemplate/Directive.pm
openresty/lemplate
5335fcf49138a53aa73c65a9158a021e3029e1d3
[ "Condor-1.1", "Naumen", "Xnet", "Net-SNMP", "X11", "MS-PL" ]
18
2016-01-18T02:51:06.000Z
2019-11-05T09:19:27.000Z
package Lemplate::Directive; use strict; use warnings; our $VERSION = '0.15'; our $OUTPUT = 'i = i + 1 output[i] ='; our $WHILE_MAX = 1000; # parser state variable # only true when inside JAVASCRIPT blocks our $INJAVASCRIPT = 0; sub new { my $class = shift; return bless {}, $class } sub template { my ($class, $block) = @_; return "function() return '' end" unless $block =~ /\S/; return <<"..."; function (context) if not context then return error("Lemplate function called without context\\n") end local stash = context.stash local output = {} local i = 0 $block return output end ... } # Try to do 1 .. 10 expansions sub _attempt_range_expand_val ($) { my $val = shift; return $val unless my ( $from, $to ) = $val =~ m/\s*\[\s*(\S+)\s*\.\.\s*(\S+)\s*\]/; die "Range expansion is current supported for positive/negative integer values only (e.g. [ 1 .. 10 ])\nCannot expand: $val" unless $from =~ m/^-?\d+$/ && $to =~ m/^-?\d+$/; return join '', '[', join( ',', $from .. $to ), ']'; } #------------------------------------------------------------------------ # textblock($text) #------------------------------------------------------------------------ sub textblock { my ($class, $text) = @_; return $text if $INJAVASCRIPT; return "$OUTPUT " . $class->text($text); } #------------------------------------------------------------------------ # text($text) #------------------------------------------------------------------------ sub text { my ($class, $text) = @_; for ($text) { s/([\'\\])/\\$1/g; s/\n/\\n/g; s/\r/\\r/g; } return "'" . $text . "'"; } #------------------------------------------------------------------------ # ident(\@ident) foo.bar(baz) #------------------------------------------------------------------------ sub ident { my ($class, $ident) = @_; return "''" unless @$ident; my $ns; # does the first element of the identifier have a NAMESPACE # handler defined? if (ref $class && @$ident > 2 && ($ns = $class->{ NAMESPACE })) { my $key = $ident->[0]; $key =~ s/^'(.+)'$/$1/s; if ($ns = $ns->{ $key }) { return $ns->ident($ident); } } if (scalar @$ident <= 2 && ! $ident->[1]) { $ident = $ident->[0]; } else { $ident = '{' . join(', ', @$ident) . '}'; } return "stash_get(stash, $ident)"; } #------------------------------------------------------------------------ # assign(\@ident, $value, $default) foo = bar #------------------------------------------------------------------------ sub assign { my ($class, $var, $val, $default) = @_; if (ref $var) { if (scalar @$var == 2 && ! $var->[1]) { $var = $var->[0]; } else { $var = '{' . join(', ', @$var) . '}'; } } $val = _attempt_range_expand_val $val; $val .= ', 1' if $default; return "stash_set(stash, $var, $val)"; } #------------------------------------------------------------------------ # args(\@args) foo, bar, baz = qux #------------------------------------------------------------------------ sub args { my ($class, $args) = @_; my $hash = shift @$args; push(@$args, '{ ' . join(', ', @$hash) . ' }') if @$hash; return '{}' unless @$args; return '{ ' . join(', ', @$args) . ' }'; } #------------------------------------------------------------------------ # filenames(\@names) #------------------------------------------------------------------------ sub filenames { my ($class, $names) = @_; if (@$names > 1) { $names = '[ ' . join(', ', @$names) . ' ]'; } else { $names = shift @$names; } return $names; } #------------------------------------------------------------------------ # get($expr) [% foo %] #------------------------------------------------------------------------ sub get { my ($class, $expr) = @_; return "$OUTPUT $expr"; } sub block { my ($class, $block) = @_; return join "\n", map { s/^#(?=line \d+)/-- /gm; $_; } @{ $block || [] }; } #------------------------------------------------------------------------ # call($expr) [% CALL bar %] #------------------------------------------------------------------------ sub call { my ($class, $expr) = @_; $expr .= ';'; return $expr; } #------------------------------------------------------------------------ # set(\@setlist) [% foo = bar, baz = qux %] #------------------------------------------------------------------------ sub set { my ($class, $setlist) = @_; my $output; while (my ($var, $val) = splice(@$setlist, 0, 2)) { $output .= $class->assign($var, $val) . ";\n"; } chomp $output; return $output; } #------------------------------------------------------------------------ # default(\@setlist) [% DEFAULT foo = bar, baz = qux %] #------------------------------------------------------------------------ sub default { my ($class, $setlist) = @_; my $output; while (my ($var, $val) = splice(@$setlist, 0, 2)) { $output .= &assign($class, $var, $val, 1) . ";\n"; } chomp $output; return $output; } #------------------------------------------------------------------------ # include(\@nameargs) [% INCLUDE template foo = bar %] # # => [ [ $file, ... ], \@args ] #------------------------------------------------------------------------ sub include { my ($class, $nameargs) = @_; my ($file, $args) = @$nameargs; my $hash = shift @$args; $file = $class->filenames($file); (my $raw_file = $file) =~ s/^'|'$//g; $Lemplate::ExtraTemplates{$raw_file} = 1; my $file2 = "'$Lemplate::TemplateName/$raw_file'"; my $str_args = (@$hash ? ', { ' . join(', ', @$hash) . ' }' : ''); return "$OUTPUT context.include(context, template_map['$Lemplate::TemplateName/$raw_file'] and $file2 or $file$str_args)"; } #------------------------------------------------------------------------ # process(\@nameargs) [% PROCESS template foo = bar %] # # => [ [ $file, ... ], \@args ] #------------------------------------------------------------------------ sub process { my ($class, $nameargs) = @_; my ($file, $args) = @$nameargs; my $hash = shift @$args; $file = $class->filenames($file); (my $raw_file = $file) =~ s/^'|'$//g; $Lemplate::ExtraTemplates{$raw_file} = 1; $file .= @$hash ? ', { ' . join(', ', @$hash) . ' }' : ''; return "$OUTPUT context.process(context, $file)"; } #------------------------------------------------------------------------ # if($expr, $block, $else) [% IF foo < bar %] # ... # [% ELSE %] # ... # [% END %] #------------------------------------------------------------------------ sub if { my ($class, $expr, $block, $else) = @_; my @else = $else ? @$else : (); $else = pop @else; my $output = "if tt2_true($expr) then\n$block\n"; foreach my $elsif (@else) { ($expr, $block) = @$elsif; $output .= "elseif tt2_true($expr) then\n$block\n"; } if (defined $else) { $output .= "else\n$else\nend\n"; } else { $output .= "end\n"; } return $output; } #------------------------------------------------------------------------ # foreach($target, $list, $args, $block) [% FOREACH x = [ foo bar ] %] # ... # [% END %] #------------------------------------------------------------------------ sub foreach { my ($class, $target, $list, $args, $block) = @_; $args = shift @$args; $args = @$args ? ', { ' . join(', ', @$args) . ' }' : ''; my ($loop_save, $loop_set, $loop_restore, $setiter); if ($target) { $loop_save = 'local oldloop = ' . $class->ident(["'loop'"]); $loop_set = "stash['$target'] = value"; $loop_restore = "stash_set(stash, 'loop', oldloop)"; } else { die "XXX - Not supported yet"; $loop_save = 'stash = context.localise()'; $loop_set = "stash.get(['import', [value]]) if typeof(value) == 'object'"; $loop_restore = 'stash = context.delocalise()'; } $list = _attempt_range_expand_val $list; return <<EOF; -- FOREACH do local list = $list local iterator if list.list then iterator = list list = list.list end $loop_save local count if not iterator then count = table_maxn(list) iterator = { count = 1, max = count - 1, index = 0, size = count, first = true, last = false, prev = "" } else count = iterator.size end stash.loop = iterator for idx, value in ipairs(list) do if idx == count then iterator.last = true end iterator.index = idx - 1 iterator.count = idx iterator.next = list[idx + 1] $loop_set $block iterator.first = false iterator.prev = value end $loop_restore end EOF } #------------------------------------------------------------------------ # next() [% NEXT %] # # Next iteration of a FOREACH loop (experimental) #------------------------------------------------------------------------ sub next { return <<EOF; return error("NEXT not implemented yet") EOF } #------------------------------------------------------------------------ # wrapper(\@nameargs, $block) [% WRAPPER template foo = bar %] # # => [ [$file,...], \@args ] #------------------------------------------------------------------------ sub wrapper { my ($class, $nameargs, $block) = @_; my ($file, $args) = @$nameargs; my $hash = shift @$args; s/ => /: / for @$hash; return $class->multi_wrapper($file, $hash, $block) if @$file > 1; $file = shift @$file; push(@$hash, "'content': output"); $file .= @$hash ? ', { ' . join(', ', @$hash) . ' }' : ''; return <<EOF; // WRAPPER $OUTPUT (function() { var output = ''; $block; return context.include($file); })(); EOF } sub multi_wrapper { my ($class, $file, $hash, $block) = @_; push(@$hash, "'content': output"); $hash = @$hash ? ', { ' . join(', ', @$hash) . ' }' : ''; $file = join(', ', reverse @$file); # print STDERR "multi wrapper: $file\n"; return <<EOF; // WRAPPER $OUTPUT (function() { var output = ''; $block; var files = new Array($file); for (var i = 0; i < files.length; i++) { output = context.include(files[i]$hash); } return output; })(); EOF } #------------------------------------------------------------------------ # while($expr, $block) [% WHILE x < 10 %] # ... # [% END %] #------------------------------------------------------------------------ sub while { my ($class, $expr, $block) = @_; return <<EOF; -- WHILE do local failsafe = $WHILE_MAX; while $expr do failsafe = failsafe - 1 if failsafe <= 0 then break end $block end if not failsafe then return error("WHILE loop terminated (> $WHILE_MAX iterations)\\n") end end EOF } #------------------------------------------------------------------------ # javascript($script) [% JAVASCRIPT %] # ... # [% END %] #------------------------------------------------------------------------ sub javascript { my ( $class, $javascript ) = @_; return $javascript; } sub no_javascript { my ( $class ) = @_; die "EVAL_JAVASCRIPT has not been enabled, cannot process [% JAVASCRIPT %] blocks"; } #------------------------------------------------------------------------ # switch($expr, \@case) [% SWITCH %] # [% CASE foo %] # ... # [% END %] #------------------------------------------------------------------------ sub switch { my ($class, $expr, $case) = @_; my @case = @$case; my ($match, $block, $default); my $caseblock = ''; $default = pop @case; foreach $case (@case) { $match = $case->[0]; $block = $case->[1]; # $block = pad($block, 1) if $PRETTY; $caseblock .= <<EOF; case $match: $block break; EOF } if (defined $default) { $caseblock .= <<EOF; default: $default break; EOF } # $caseblock = pad($caseblock, 2) if $PRETTY; return <<EOF; switch($expr) { $caseblock } EOF } #------------------------------------------------------------------------ # throw(\@nameargs) [% THROW foo "bar error" %] # # => [ [$type], \@args ] #------------------------------------------------------------------------ sub throw { my ($class, $nameargs) = @_; my ($type, $args) = @$nameargs; my $hash = shift(@$args); my $info = shift(@$args); $type = shift @$type; return qq{return error({$type, $info})}; } #------------------------------------------------------------------------ # clear() [% CLEAR %] # # NOTE: this is redundant, being hard-coded (for now) into Parser.yp #------------------------------------------------------------------------ sub clear { return "output = {}"; } #------------------------------------------------------------------------ # break() [% BREAK %] # # NOTE: this is redundant, being hard-coded (for now) into Parser.yp #------------------------------------------------------------------------ sub break { return 'break'; } #------------------------------------------------------------------------ # return() [% RETURN %] #------------------------------------------------------------------------ sub return { return "return output" } #------------------------------------------------------------------------ # stop() [% STOP %] #------------------------------------------------------------------------ sub stop { return "return error('Lemplate.STOP\\n' .. concat(output))"; } #------------------------------------------------------------------------ # use(\@lnameargs) [% USE alias = plugin(args) %] # # => [ [$file, ...], \@args, $alias ] #------------------------------------------------------------------------ sub use { my ($class, $lnameargs) = @_; my ($file, $args, $alias) = @$lnameargs; $file = shift @$file; # same production rule as INCLUDE $alias ||= $file; $args = &args($class, $args); $file .= ", $args" if $args; return "-- USE\n" . "stash_set(stash, $alias, context.plugin(context, $file))"; } #------------------------------------------------------------------------ # raw(\@lnameargs) [% RAW alias = plugin(args) %] # # => [ [$file, ...], \@args, $alias ] #------------------------------------------------------------------------ sub raw { my ($class, $lnameargs) = @_; my ($file, $args, $alias) = @$lnameargs; $file = shift @$file; # same production rule as INCLUDE $alias ||= $file; $args = &args($class, $args); # $file .= ", $args" if $args; $file =~ s/'|"//g; return "// RAW\n" . "stash_set(stash, $alias, $file)"; } #------------------------------------------------------------------------ # stubs() [% STOP %] #------------------------------------------------------------------------ sub filter { my ($class, $lnameargs, $block) = @_; my ($name, $args, $alias) = @$lnameargs; $name = shift @$name; $args = &args($class, $args); $args = $args ? "$args, $alias" : ", null, $alias" if $alias; $name .= ", $args" if $args; return <<EOF; -- FILTER local value do local output = {} local i = 0 $block value = context.filter(output, $name) end $OUTPUT value EOF } sub quoted { my $class = shift; if ( @_ && ref($_[0]) ) { return join( " .. ", @{$_[0]} ); } return "return error('QUOTED called with unknown arguments in Lemplate')"; } #------------------------------------------------------------------------ # macro($name, $block, \@args) #------------------------------------------------------------------------ sub macro { my ($class, $ident, $block, $args) = @_; if ($args) { $args = join(';', map { "args['$_'] = fargs.shift()" } @$args); return <<EOF; //MACRO stash.set('$ident', function () { var output = ''; var args = {}; var fargs = Array.prototype.slice.call(arguments); $args; args.arguments = Array.prototype.slice.call(arguments); var params = fargs.shift() || {}; for (var key in params) { args[key] = params[key]; } context.stash.clone(args); try { $block } catch(e) { var error = context.set_error(e, output); throw(error); } context.stash.declone(); return output; }); EOF } else { return <<EOF; //MACRO stash.set('$ident', function () { var output = ''; var args = {}; var fargs = Array.prototype.slice.call(arguments); args.arguments = Array.prototype.slice.call(arguments); if (typeof arguments[0] == 'object') args = arguments[0]; context.stash.clone(args); try { $block } catch(e) { var error = context.set_error(e, output); throw(error); } context.stash.declone(); return output;}); EOF } } sub capture { my ($class, $name, $block) = @_; if (ref $name) { if (scalar @$name == 2 && ! $name->[1]) { $name = $name->[0]; } else { $name = '[' . join(', ', @$name) . ']'; } } return <<EOF; // CAPTURE (function() { var output = ''; $block stash.set($name, output); })(); EOF } BEGIN { return; # Comment out this line to get callback traces no strict 'refs'; my $pkg = __PACKAGE__ . '::'; my $stash = \ %$pkg; use strict 'refs'; for my $name (keys %$stash) { my $glob = $stash->{$name}; if (*$glob{CODE}) { my $code = *$glob{CODE}; no warnings 'redefine'; $stash->{$name} = sub { warn "Calling $name(@_)\n"; &$code(@_); }; } } } 1; __END__ =encoding UTF-8 =head1 NAME Lemplate::Directive - Lemplate Code Generating Backend =head1 SYNOPSIS use Lemplate::Directive; =head1 DESCRIPTION Lemplate::Directive is the analog to Template::Directive, which is the module that produces that actual code that templates turn into. The Lemplate version obviously produces Lua code rather than Perl. Other than that the two modules are almost exactly the same. =head1 BUGS Unfortunately, some of the code generation seems to happen before Lemplate::Directive gets control. So it currently has heuristical code to rejigger Perl code snippets into Lua. This processing needs to happen upstream once I get more clarity on how Template::Toolkit works. =head1 AUTHOR Ingy döt Net <ingy@cpan.org> =head1 COPYRIGHT Copyright (c) 2016. Yichun Zhang (agentzh). All rights reserved. Copyright (c) 2006-2014. Ingy döt Net. All rights reserved. This program is free software; you can redistribute it and/or modify it under the same terms as Perl itself. See L<http://www.perl.com/perl/misc/Artistic.html> =cut
26.372123
177
0.378849
ed54184c0e6b1ccca78778014bcc817759452adf
2,646
pm
Perl
perl/vendor/lib/CPANPLUS/Shell/Default/Plugins/Source.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
2
2021-11-19T22:37:28.000Z
2021-11-22T18:04:55.000Z
perl/vendor/lib/CPANPLUS/Shell/Default/Plugins/Source.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
6
2021-11-18T00:39:48.000Z
2021-11-20T00:31:40.000Z
perl/vendor/lib/CPANPLUS/Shell/Default/Plugins/Source.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
null
null
null
package CPANPLUS::Shell::Default::Plugins::Source; use strict; use CPANPLUS::Error qw[error msg]; use Locale::Maketext::Simple Class => 'CPANPLUS', Style => 'gettext'; use vars qw[$VERSION]; $VERSION = "0.9910"; =head1 NAME CPANPLUS::Shell::Default::Plugins::Source - read in CPANPLUS commands =head1 SYNOPSIS CPAN Terminal> /source /tmp/list_of_commands /tmp/more_commands =head1 DESCRIPTION This is a C<CPANPLUS::Shell::Default> plugin that works just like your unix shells source(1) command; it reads in a file that has commands in it to execute, and then executes them. A sample file might look like this: # first, update all the source files x --update_source # find all of my modules that are on the CPAN # test them, and store the error log a ^KANE$' t * p /home/kane/cpan-autotest/log # and inform us we're good to go ! print "Autotest complete, log stored; please enter your commands!" Note how empty lines, and lines starting with a '#' are being skipped in the execution. =cut sub plugins { return ( source => 'source' ) } sub source { my $class = shift; my $shell = shift; my $cb = shift; my $cmd = shift; my $input = shift || ''; my $opts = shift || {}; my $verbose = $cb->configure_object->get_conf('verbose'); for my $file ( split /\s+/, $input ) { my $fh = FileHandle->new("$file") or( error(loc("Could not open file '%1': %2", $file, $!)), next ); while( my $line = <$fh> ) { chomp $line; next if $line !~ /\S+/; # skip empty/whitespace only lines next if $line =~ /^#/; # skip comments msg(loc("Dispatching '%1'", $line), $verbose); return 1 if $shell->dispatch_on_input( input => $line ); } } } sub source_help { return loc(' /source FILE [FILE ..] '. '# read in commands from the specified file' ), } 1; =pod =head1 BUG REPORTS Please report bugs or other issues to E<lt>bug-cpanplus@rt.cpan.org<gt>. =head1 AUTHOR This module by Jos Boumans E<lt>kane@cpan.orgE<gt>. =head1 COPYRIGHT The CPAN++ interface (of which this module is a part of) is copyright (c) 2001 - 2007, Jos Boumans E<lt>kane@cpan.orgE<gt>. All rights reserved. This library is free software; you may redistribute and/or modify it under the same terms as Perl itself. =head1 SEE ALSO L<CPANPLUS::Shell::Default>, L<CPANPLUS::Shell>, L<cpanp> =cut # Local variables: # c-indentation-style: bsd # c-basic-offset: 4 # indent-tabs-mode: nil # End: # vim: expandtab shiftwidth=4:
23.837838
73
0.629252
ed820622759169d871b2e1a1436e09d44293dabe
2,706
pm
Perl
lib/Dancer2/Logger/Multiplex.pm
atancasis/Dancer2-Logger-Multiplex
917441732b78f4a288fca093c1df83acc91aac96
[ "Artistic-1.0" ]
null
null
null
lib/Dancer2/Logger/Multiplex.pm
atancasis/Dancer2-Logger-Multiplex
917441732b78f4a288fca093c1df83acc91aac96
[ "Artistic-1.0" ]
null
null
null
lib/Dancer2/Logger/Multiplex.pm
atancasis/Dancer2-Logger-Multiplex
917441732b78f4a288fca093c1df83acc91aac96
[ "Artistic-1.0" ]
null
null
null
package Dancer2::Logger::Multiplex; use strict; use 5.008_005; our $VERSION = '0.02'; use Moo; use Dancer2::Core::Types; with 'Dancer2::Core::Role::Logger'; has loggers => ( is => 'ro', isa => ArrayRef, ); has logging_engines => ( is => 'lazy', ); sub _build_logging_engines { my $self = shift; my ($app) = grep { $_->name eq $self->app_name } @{ $Dancer2::runner->apps }; my @logging_engines = map { $app->_factory->create( logger => $_, %{ $app->_get_config_for_engine( logger => $_, $app->config ) }, location => $app->config_location, environment => $app->environment, app_name => $app->name, postponed_hooks => $app->postponed_hooks ) } @{ $self->loggers }; return \@logging_engines; } sub log { my ($self, $level, $message) = @_; $_->log($level, $message) for @{ $self->logging_engines }; } 1; __END__ =encoding utf-8 =head1 NAME Dancer2::Logger::Multiplex - Log to multiple Dancer2::Logger engines =head1 VERSION version 0.02 =head1 SYNOPSIS use Dancer2::Logger::Multiplex; =head1 DESCRIPTION Implements a multiplexing logger engine to dispatch logs to multiple backend L<Dancer2::Core::Role::Logger> engines. =head1 METHODS =head2 log($level, $message) Writes the log message to multiple logger engines. =head1 CONFIGURATION The setting B<logger> should be set to C<Multiplex> in order to use this logging engine in a Dancer2 application. Below is a sample configuration: logger: "Multiplex" engines: logger: Multiplex: loggers: - Console - File - Fluent File: log_dir: "/var/log/myapp" file_name: "myapp.log" Fluent: tag_prefix: "myapp" host: "127.0.0.1" port: 24224 Allowed options are as follows: =over 4 =item loggers Specifies the list of L<Dancer2::Core::Role::Logger> backend engines to dispatch log messages to. Each logger engine will be initialized with their corresponding configurations. As such, in the example above, L<Dancer2::Logger::File> will be initialized with settings for I<log_dir> and I<file_name>, while L<Dancer2::Logger::Fluent> will be initialized with settings for I<tag_prefix>, I<host>, and I<port> as specified in the sample configuration. =back =head1 AUTHOR Arnold Tan Casis E<lt>atancasis@cpan.orgE<gt> =head1 COPYRIGHT Copyright 2017- Arnold Tan Casis =head1 LICENSE This library is free software; you can redistribute it and/or modify it under the same terms as Perl itself. =head1 SEE ALSO See L<Dancer2> for details about logging in route handlers. =cut
20.656489
81
0.656689
ed4b97dfafb9d54ace72eaa761998e4e01ee9cad
1,751
pl
Perl
probs/SYJ/SYJ211+1.008.pl
ptarau/TypesAndProofs
ca9e4347d3dabb3531d38bdef6aafaa41a30555d
[ "Apache-2.0" ]
25
2018-07-19T00:08:18.000Z
2022-02-08T23:07:12.000Z
probs/SYJ/SYJ211+1.008.pl
ptarau/TypesAndProofs
ca9e4347d3dabb3531d38bdef6aafaa41a30555d
[ "Apache-2.0" ]
null
null
null
probs/SYJ/SYJ211+1.008.pl
ptarau/TypesAndProofs
ca9e4347d3dabb3531d38bdef6aafaa41a30555d
[ "Apache-2.0" ]
4
2019-01-12T17:02:14.000Z
2021-11-23T08:16:09.000Z
%-------------------------------------------------------------------------- % File : SYJ211+1.008 : ILTP v1.1.2 % Domain : Intuitionistic Syntactic % Problem : Formulae of Korn & Kreitz % Version : Especial. % Problem formulation : Inuit. Invalid. Size 8 % English : (A & B(N) & C(N)) -> f with % A - (a(0) -> f), B(N) - (~~b(N) -> b(0) -> a(N)), % C(N) - (&&_{i-1..n} ((~~b(i-1) -> a(i)) -> a(i-1))), % Refs : [Dyc97] Roy Dyckhoff. Some benchmark formulas for % intuitionistic propositional logic. At % http://www.dcs.st-and.ac.uk/~rd/logic/marks.html % : [KK97] D. Korn & C. Kreitz, A constructively adequate % refutation system for intuitionistic logic, % position paper at Tableaux'97, available at % http://www.cs.uni-potsdam.de/ti/kreitz/PDF/ % Source : [Dyc97] % Names : kk_n8 : Dyckhoff's benchmark formulas (1997) % % Status (intuit.) : Non-Theorem % Rating (intuit.) : 0.25 v1.0.0 % % Comments : %-------------------------------------------------------------------------- fof(axiom1,axiom,( ( a0 -> f) )). fof(axiom2,axiom,( ( ( ~(~(b8)) -> b0) -> a8) )). fof(axiom3,axiom,( ( ( ~(~(b0)) -> a1) -> a0) )). fof(axiom4,axiom,( ( ( ~(~(b1)) -> a2) -> a1) )). fof(axiom5,axiom,( ( ( ~(~(b2)) -> a3) -> a2) )). fof(axiom6,axiom,( ( ( ~(~(b3)) -> a4) -> a3) )). fof(axiom7,axiom,( ( ( ~(~(b4)) -> a5) -> a4) )). fof(axiom8,axiom,( ( ( ~(~(b5)) -> a6) -> a5) )). fof(axiom9,axiom,( ( ( ~(~(b6)) -> a7) -> a6) )). fof(axiom10,axiom,( ( ( ~(~(b7)) -> a8) -> a7) )). fof(con,conjecture,( f )). %--------------------------------------------------------------------------
28.241935
75
0.4249
ed680a4295222fbbf817166fde770d81a46816d3
35,230
pm
Perl
lib/DateTime/TimeZone/America/Sao_Paulo.pm
Helmholtz-HIPS/prosnap
5286cda39276d5eda85d2ddb23b8ab83c5d4960c
[ "MIT" ]
1
2021-11-26T17:29:56.000Z
2021-11-26T17:29:56.000Z
lib/DateTime/TimeZone/America/Sao_Paulo.pm
Helmholtz-HIPS/prosnap
5286cda39276d5eda85d2ddb23b8ab83c5d4960c
[ "MIT" ]
1
2020-03-19T21:12:23.000Z
2020-03-19T21:12:23.000Z
lib/DateTime/TimeZone/America/Sao_Paulo.pm
Helmholtz-HIPS/prosnap
5286cda39276d5eda85d2ddb23b8ab83c5d4960c
[ "MIT" ]
null
null
null
# This file is auto-generated by the Perl DateTime Suite time zone # code generator (0.07) This code generator comes with the # DateTime::TimeZone module distribution in the tools/ directory # # Generated from /tmp/8FT049ktOU/southamerica. Olson data version 2015d # # Do not edit this file directly. # package DateTime::TimeZone::America::Sao_Paulo; $DateTime::TimeZone::America::Sao_Paulo::VERSION = '1.88'; use strict; use Class::Singleton 1.03; use DateTime::TimeZone; use DateTime::TimeZone::OlsonDB; @DateTime::TimeZone::America::Sao_Paulo::ISA = ( 'Class::Singleton', 'DateTime::TimeZone' ); my $spans = [ [ DateTime::TimeZone::NEG_INFINITY, # utc_start 60368468788, # utc_end 1914-01-01 03:06:28 (Thu) DateTime::TimeZone::NEG_INFINITY, # local_start 60368457600, # local_end 1914-01-01 00:00:00 (Thu) -11188, 0, 'LMT', ], [ 60368468788, # utc_start 1914-01-01 03:06:28 (Thu) 60928725600, # utc_end 1931-10-03 14:00:00 (Sat) 60368457988, # local_start 1914-01-01 00:06:28 (Thu) 60928714800, # local_end 1931-10-03 11:00:00 (Sat) -10800, 0, 'BRT', ], [ 60928725600, # utc_start 1931-10-03 14:00:00 (Sat) 60944320800, # utc_end 1932-04-01 02:00:00 (Fri) 60928718400, # local_start 1931-10-03 12:00:00 (Sat) 60944313600, # local_end 1932-04-01 00:00:00 (Fri) -7200, 1, 'BRST', ], [ 60944320800, # utc_start 1932-04-01 02:00:00 (Fri) 60960308400, # utc_end 1932-10-03 03:00:00 (Mon) 60944310000, # local_start 1932-03-31 23:00:00 (Thu) 60960297600, # local_end 1932-10-03 00:00:00 (Mon) -10800, 0, 'BRT', ], [ 60960308400, # utc_start 1932-10-03 03:00:00 (Mon) 60975856800, # utc_end 1933-04-01 02:00:00 (Sat) 60960301200, # local_start 1932-10-03 01:00:00 (Mon) 60975849600, # local_end 1933-04-01 00:00:00 (Sat) -7200, 1, 'BRST', ], [ 60975856800, # utc_start 1933-04-01 02:00:00 (Sat) 61501863600, # utc_end 1949-12-01 03:00:00 (Thu) 60975846000, # local_start 1933-03-31 23:00:00 (Fri) 61501852800, # local_end 1949-12-01 00:00:00 (Thu) -10800, 0, 'BRT', ], [ 61501863600, # utc_start 1949-12-01 03:00:00 (Thu) 61513614000, # utc_end 1950-04-16 03:00:00 (Sun) 61501856400, # local_start 1949-12-01 01:00:00 (Thu) 61513606800, # local_end 1950-04-16 01:00:00 (Sun) -7200, 1, 'BRST', ], [ 61513614000, # utc_start 1950-04-16 03:00:00 (Sun) 61533399600, # utc_end 1950-12-01 03:00:00 (Fri) 61513603200, # local_start 1950-04-16 00:00:00 (Sun) 61533388800, # local_end 1950-12-01 00:00:00 (Fri) -10800, 0, 'BRT', ], [ 61533399600, # utc_start 1950-12-01 03:00:00 (Fri) 61543850400, # utc_end 1951-04-01 02:00:00 (Sun) 61533392400, # local_start 1950-12-01 01:00:00 (Fri) 61543843200, # local_end 1951-04-01 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 61543850400, # utc_start 1951-04-01 02:00:00 (Sun) 61564935600, # utc_end 1951-12-01 03:00:00 (Sat) 61543839600, # local_start 1951-03-31 23:00:00 (Sat) 61564924800, # local_end 1951-12-01 00:00:00 (Sat) -10800, 0, 'BRT', ], [ 61564935600, # utc_start 1951-12-01 03:00:00 (Sat) 61575472800, # utc_end 1952-04-01 02:00:00 (Tue) 61564928400, # local_start 1951-12-01 01:00:00 (Sat) 61575465600, # local_end 1952-04-01 00:00:00 (Tue) -7200, 1, 'BRST', ], [ 61575472800, # utc_start 1952-04-01 02:00:00 (Tue) 61596558000, # utc_end 1952-12-01 03:00:00 (Mon) 61575462000, # local_start 1952-03-31 23:00:00 (Mon) 61596547200, # local_end 1952-12-01 00:00:00 (Mon) -10800, 0, 'BRT', ], [ 61596558000, # utc_start 1952-12-01 03:00:00 (Mon) 61604330400, # utc_end 1953-03-01 02:00:00 (Sun) 61596550800, # local_start 1952-12-01 01:00:00 (Mon) 61604323200, # local_end 1953-03-01 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 61604330400, # utc_start 1953-03-01 02:00:00 (Sun) 61940257200, # utc_end 1963-10-23 03:00:00 (Wed) 61604319600, # local_start 1953-02-28 23:00:00 (Sat) 61940246400, # local_end 1963-10-23 00:00:00 (Wed) -10800, 0, 'BRT', ], [ 61940257200, # utc_start 1963-10-23 03:00:00 (Wed) 61946301600, # utc_end 1964-01-01 02:00:00 (Wed) 61940250000, # local_start 1963-10-23 01:00:00 (Wed) 61946294400, # local_end 1964-01-01 00:00:00 (Wed) -7200, 1, 'BRST', ], [ 61946301600, # utc_start 1964-01-01 02:00:00 (Wed) 61951485600, # utc_end 1964-03-01 02:00:00 (Sun) 61946294400, # local_start 1964-01-01 00:00:00 (Wed) 61951478400, # local_end 1964-03-01 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 61951485600, # utc_start 1964-03-01 02:00:00 (Sun) 61980519600, # utc_end 1965-01-31 03:00:00 (Sun) 61951474800, # local_start 1964-02-29 23:00:00 (Sat) 61980508800, # local_end 1965-01-31 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 61980519600, # utc_start 1965-01-31 03:00:00 (Sun) 61985613600, # utc_end 1965-03-31 02:00:00 (Wed) 61980512400, # local_start 1965-01-31 01:00:00 (Sun) 61985606400, # local_end 1965-03-31 00:00:00 (Wed) -7200, 1, 'BRST', ], [ 61985613600, # utc_start 1965-03-31 02:00:00 (Wed) 62006785200, # utc_end 1965-12-01 03:00:00 (Wed) 61985602800, # local_start 1965-03-30 23:00:00 (Tue) 62006774400, # local_end 1965-12-01 00:00:00 (Wed) -10800, 0, 'BRT', ], [ 62006785200, # utc_start 1965-12-01 03:00:00 (Wed) 62014557600, # utc_end 1966-03-01 02:00:00 (Tue) 62006778000, # local_start 1965-12-01 01:00:00 (Wed) 62014550400, # local_end 1966-03-01 00:00:00 (Tue) -7200, 1, 'BRST', ], [ 62014557600, # utc_start 1966-03-01 02:00:00 (Tue) 62035729200, # utc_end 1966-11-01 03:00:00 (Tue) 62014546800, # local_start 1966-02-28 23:00:00 (Mon) 62035718400, # local_end 1966-11-01 00:00:00 (Tue) -10800, 0, 'BRT', ], [ 62035729200, # utc_start 1966-11-01 03:00:00 (Tue) 62046093600, # utc_end 1967-03-01 02:00:00 (Wed) 62035722000, # local_start 1966-11-01 01:00:00 (Tue) 62046086400, # local_end 1967-03-01 00:00:00 (Wed) -7200, 1, 'BRST', ], [ 62046093600, # utc_start 1967-03-01 02:00:00 (Wed) 62067265200, # utc_end 1967-11-01 03:00:00 (Wed) 62046082800, # local_start 1967-02-28 23:00:00 (Tue) 62067254400, # local_end 1967-11-01 00:00:00 (Wed) -10800, 0, 'BRT', ], [ 62067265200, # utc_start 1967-11-01 03:00:00 (Wed) 62077716000, # utc_end 1968-03-01 02:00:00 (Fri) 62067258000, # local_start 1967-11-01 01:00:00 (Wed) 62077708800, # local_end 1968-03-01 00:00:00 (Fri) -7200, 1, 'BRST', ], [ 62077716000, # utc_start 1968-03-01 02:00:00 (Fri) 62635431600, # utc_end 1985-11-02 03:00:00 (Sat) 62077705200, # local_start 1968-02-29 23:00:00 (Thu) 62635420800, # local_end 1985-11-02 00:00:00 (Sat) -10800, 0, 'BRT', ], [ 62635431600, # utc_start 1985-11-02 03:00:00 (Sat) 62646919200, # utc_end 1986-03-15 02:00:00 (Sat) 62635424400, # local_start 1985-11-02 01:00:00 (Sat) 62646912000, # local_end 1986-03-15 00:00:00 (Sat) -7200, 1, 'BRST', ], [ 62646919200, # utc_start 1986-03-15 02:00:00 (Sat) 62666276400, # utc_end 1986-10-25 03:00:00 (Sat) 62646908400, # local_start 1986-03-14 23:00:00 (Fri) 62666265600, # local_end 1986-10-25 00:00:00 (Sat) -10800, 0, 'BRT', ], [ 62666276400, # utc_start 1986-10-25 03:00:00 (Sat) 62675949600, # utc_end 1987-02-14 02:00:00 (Sat) 62666269200, # local_start 1986-10-25 01:00:00 (Sat) 62675942400, # local_end 1987-02-14 00:00:00 (Sat) -7200, 1, 'BRST', ], [ 62675949600, # utc_start 1987-02-14 02:00:00 (Sat) 62697812400, # utc_end 1987-10-25 03:00:00 (Sun) 62675938800, # local_start 1987-02-13 23:00:00 (Fri) 62697801600, # local_end 1987-10-25 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62697812400, # utc_start 1987-10-25 03:00:00 (Sun) 62706880800, # utc_end 1988-02-07 02:00:00 (Sun) 62697805200, # local_start 1987-10-25 01:00:00 (Sun) 62706873600, # local_end 1988-02-07 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62706880800, # utc_start 1988-02-07 02:00:00 (Sun) 62728657200, # utc_end 1988-10-16 03:00:00 (Sun) 62706870000, # local_start 1988-02-06 23:00:00 (Sat) 62728646400, # local_end 1988-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62728657200, # utc_start 1988-10-16 03:00:00 (Sun) 62737725600, # utc_end 1989-01-29 02:00:00 (Sun) 62728650000, # local_start 1988-10-16 01:00:00 (Sun) 62737718400, # local_end 1989-01-29 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62737725600, # utc_start 1989-01-29 02:00:00 (Sun) 62760106800, # utc_end 1989-10-15 03:00:00 (Sun) 62737714800, # local_start 1989-01-28 23:00:00 (Sat) 62760096000, # local_end 1989-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62760106800, # utc_start 1989-10-15 03:00:00 (Sun) 62770384800, # utc_end 1990-02-11 02:00:00 (Sun) 62760099600, # local_start 1989-10-15 01:00:00 (Sun) 62770377600, # local_end 1990-02-11 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62770384800, # utc_start 1990-02-11 02:00:00 (Sun) 62792161200, # utc_end 1990-10-21 03:00:00 (Sun) 62770374000, # local_start 1990-02-10 23:00:00 (Sat) 62792150400, # local_end 1990-10-21 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62792161200, # utc_start 1990-10-21 03:00:00 (Sun) 62802439200, # utc_end 1991-02-17 02:00:00 (Sun) 62792154000, # local_start 1990-10-21 01:00:00 (Sun) 62802432000, # local_end 1991-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62802439200, # utc_start 1991-02-17 02:00:00 (Sun) 62823610800, # utc_end 1991-10-20 03:00:00 (Sun) 62802428400, # local_start 1991-02-16 23:00:00 (Sat) 62823600000, # local_end 1991-10-20 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62823610800, # utc_start 1991-10-20 03:00:00 (Sun) 62833284000, # utc_end 1992-02-09 02:00:00 (Sun) 62823603600, # local_start 1991-10-20 01:00:00 (Sun) 62833276800, # local_end 1992-02-09 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62833284000, # utc_start 1992-02-09 02:00:00 (Sun) 62855665200, # utc_end 1992-10-25 03:00:00 (Sun) 62833273200, # local_start 1992-02-08 23:00:00 (Sat) 62855654400, # local_end 1992-10-25 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62855665200, # utc_start 1992-10-25 03:00:00 (Sun) 62864128800, # utc_end 1993-01-31 02:00:00 (Sun) 62855658000, # local_start 1992-10-25 01:00:00 (Sun) 62864121600, # local_end 1993-01-31 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62864128800, # utc_start 1993-01-31 02:00:00 (Sun) 62886510000, # utc_end 1993-10-17 03:00:00 (Sun) 62864118000, # local_start 1993-01-30 23:00:00 (Sat) 62886499200, # local_end 1993-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62886510000, # utc_start 1993-10-17 03:00:00 (Sun) 62897392800, # utc_end 1994-02-20 02:00:00 (Sun) 62886502800, # local_start 1993-10-17 01:00:00 (Sun) 62897385600, # local_end 1994-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62897392800, # utc_start 1994-02-20 02:00:00 (Sun) 62917959600, # utc_end 1994-10-16 03:00:00 (Sun) 62897382000, # local_start 1994-02-19 23:00:00 (Sat) 62917948800, # local_end 1994-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62917959600, # utc_start 1994-10-16 03:00:00 (Sun) 62928842400, # utc_end 1995-02-19 02:00:00 (Sun) 62917952400, # local_start 1994-10-16 01:00:00 (Sun) 62928835200, # local_end 1995-02-19 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62928842400, # utc_start 1995-02-19 02:00:00 (Sun) 62949409200, # utc_end 1995-10-15 03:00:00 (Sun) 62928831600, # local_start 1995-02-18 23:00:00 (Sat) 62949398400, # local_end 1995-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62949409200, # utc_start 1995-10-15 03:00:00 (Sun) 62959687200, # utc_end 1996-02-11 02:00:00 (Sun) 62949402000, # local_start 1995-10-15 01:00:00 (Sun) 62959680000, # local_end 1996-02-11 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62959687200, # utc_start 1996-02-11 02:00:00 (Sun) 62980254000, # utc_end 1996-10-06 03:00:00 (Sun) 62959676400, # local_start 1996-02-10 23:00:00 (Sat) 62980243200, # local_end 1996-10-06 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 62980254000, # utc_start 1996-10-06 03:00:00 (Sun) 62991741600, # utc_end 1997-02-16 02:00:00 (Sun) 62980246800, # local_start 1996-10-06 01:00:00 (Sun) 62991734400, # local_end 1997-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 62991741600, # utc_start 1997-02-16 02:00:00 (Sun) 63011790000, # utc_end 1997-10-06 03:00:00 (Mon) 62991730800, # local_start 1997-02-15 23:00:00 (Sat) 63011779200, # local_end 1997-10-06 00:00:00 (Mon) -10800, 0, 'BRT', ], [ 63011790000, # utc_start 1997-10-06 03:00:00 (Mon) 63024400800, # utc_end 1998-03-01 02:00:00 (Sun) 63011782800, # local_start 1997-10-06 01:00:00 (Mon) 63024393600, # local_end 1998-03-01 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63024400800, # utc_start 1998-03-01 02:00:00 (Sun) 63043758000, # utc_end 1998-10-11 03:00:00 (Sun) 63024390000, # local_start 1998-02-28 23:00:00 (Sat) 63043747200, # local_end 1998-10-11 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63043758000, # utc_start 1998-10-11 03:00:00 (Sun) 63055245600, # utc_end 1999-02-21 02:00:00 (Sun) 63043750800, # local_start 1998-10-11 01:00:00 (Sun) 63055238400, # local_end 1999-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63055245600, # utc_start 1999-02-21 02:00:00 (Sun) 63074602800, # utc_end 1999-10-03 03:00:00 (Sun) 63055234800, # local_start 1999-02-20 23:00:00 (Sat) 63074592000, # local_end 1999-10-03 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63074602800, # utc_start 1999-10-03 03:00:00 (Sun) 63087300000, # utc_end 2000-02-27 02:00:00 (Sun) 63074595600, # local_start 1999-10-03 01:00:00 (Sun) 63087292800, # local_end 2000-02-27 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63087300000, # utc_start 2000-02-27 02:00:00 (Sun) 63106657200, # utc_end 2000-10-08 03:00:00 (Sun) 63087289200, # local_start 2000-02-26 23:00:00 (Sat) 63106646400, # local_end 2000-10-08 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63106657200, # utc_start 2000-10-08 03:00:00 (Sun) 63118144800, # utc_end 2001-02-18 02:00:00 (Sun) 63106650000, # local_start 2000-10-08 01:00:00 (Sun) 63118137600, # local_end 2001-02-18 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63118144800, # utc_start 2001-02-18 02:00:00 (Sun) 63138711600, # utc_end 2001-10-14 03:00:00 (Sun) 63118134000, # local_start 2001-02-17 23:00:00 (Sat) 63138700800, # local_end 2001-10-14 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63138711600, # utc_start 2001-10-14 03:00:00 (Sun) 63149594400, # utc_end 2002-02-17 02:00:00 (Sun) 63138704400, # local_start 2001-10-14 01:00:00 (Sun) 63149587200, # local_end 2002-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63149594400, # utc_start 2002-02-17 02:00:00 (Sun) 63171975600, # utc_end 2002-11-03 03:00:00 (Sun) 63149583600, # local_start 2002-02-16 23:00:00 (Sat) 63171964800, # local_end 2002-11-03 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63171975600, # utc_start 2002-11-03 03:00:00 (Sun) 63181044000, # utc_end 2003-02-16 02:00:00 (Sun) 63171968400, # local_start 2002-11-03 01:00:00 (Sun) 63181036800, # local_end 2003-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63181044000, # utc_start 2003-02-16 02:00:00 (Sun) 63202215600, # utc_end 2003-10-19 03:00:00 (Sun) 63181033200, # local_start 2003-02-15 23:00:00 (Sat) 63202204800, # local_end 2003-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63202215600, # utc_start 2003-10-19 03:00:00 (Sun) 63212493600, # utc_end 2004-02-15 02:00:00 (Sun) 63202208400, # local_start 2003-10-19 01:00:00 (Sun) 63212486400, # local_end 2004-02-15 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63212493600, # utc_start 2004-02-15 02:00:00 (Sun) 63235047600, # utc_end 2004-11-02 03:00:00 (Tue) 63212482800, # local_start 2004-02-14 23:00:00 (Sat) 63235036800, # local_end 2004-11-02 00:00:00 (Tue) -10800, 0, 'BRT', ], [ 63235047600, # utc_start 2004-11-02 03:00:00 (Tue) 63244548000, # utc_end 2005-02-20 02:00:00 (Sun) 63235040400, # local_start 2004-11-02 01:00:00 (Tue) 63244540800, # local_end 2005-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63244548000, # utc_start 2005-02-20 02:00:00 (Sun) 63265114800, # utc_end 2005-10-16 03:00:00 (Sun) 63244537200, # local_start 2005-02-19 23:00:00 (Sat) 63265104000, # local_end 2005-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63265114800, # utc_start 2005-10-16 03:00:00 (Sun) 63275997600, # utc_end 2006-02-19 02:00:00 (Sun) 63265107600, # local_start 2005-10-16 01:00:00 (Sun) 63275990400, # local_end 2006-02-19 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63275997600, # utc_start 2006-02-19 02:00:00 (Sun) 63298378800, # utc_end 2006-11-05 03:00:00 (Sun) 63275986800, # local_start 2006-02-18 23:00:00 (Sat) 63298368000, # local_end 2006-11-05 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63298378800, # utc_start 2006-11-05 03:00:00 (Sun) 63308052000, # utc_end 2007-02-25 02:00:00 (Sun) 63298371600, # local_start 2006-11-05 01:00:00 (Sun) 63308044800, # local_end 2007-02-25 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63308052000, # utc_start 2007-02-25 02:00:00 (Sun) 63328014000, # utc_end 2007-10-14 03:00:00 (Sun) 63308041200, # local_start 2007-02-24 23:00:00 (Sat) 63328003200, # local_end 2007-10-14 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63328014000, # utc_start 2007-10-14 03:00:00 (Sun) 63338896800, # utc_end 2008-02-17 02:00:00 (Sun) 63328006800, # local_start 2007-10-14 01:00:00 (Sun) 63338889600, # local_end 2008-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63338896800, # utc_start 2008-02-17 02:00:00 (Sun) 63360068400, # utc_end 2008-10-19 03:00:00 (Sun) 63338886000, # local_start 2008-02-16 23:00:00 (Sat) 63360057600, # local_end 2008-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63360068400, # utc_start 2008-10-19 03:00:00 (Sun) 63370346400, # utc_end 2009-02-15 02:00:00 (Sun) 63360061200, # local_start 2008-10-19 01:00:00 (Sun) 63370339200, # local_end 2009-02-15 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63370346400, # utc_start 2009-02-15 02:00:00 (Sun) 63391518000, # utc_end 2009-10-18 03:00:00 (Sun) 63370335600, # local_start 2009-02-14 23:00:00 (Sat) 63391507200, # local_end 2009-10-18 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63391518000, # utc_start 2009-10-18 03:00:00 (Sun) 63402400800, # utc_end 2010-02-21 02:00:00 (Sun) 63391510800, # local_start 2009-10-18 01:00:00 (Sun) 63402393600, # local_end 2010-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63402400800, # utc_start 2010-02-21 02:00:00 (Sun) 63422967600, # utc_end 2010-10-17 03:00:00 (Sun) 63402390000, # local_start 2010-02-20 23:00:00 (Sat) 63422956800, # local_end 2010-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63422967600, # utc_start 2010-10-17 03:00:00 (Sun) 63433850400, # utc_end 2011-02-20 02:00:00 (Sun) 63422960400, # local_start 2010-10-17 01:00:00 (Sun) 63433843200, # local_end 2011-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63433850400, # utc_start 2011-02-20 02:00:00 (Sun) 63454417200, # utc_end 2011-10-16 03:00:00 (Sun) 63433839600, # local_start 2011-02-19 23:00:00 (Sat) 63454406400, # local_end 2011-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63454417200, # utc_start 2011-10-16 03:00:00 (Sun) 63465904800, # utc_end 2012-02-26 02:00:00 (Sun) 63454410000, # local_start 2011-10-16 01:00:00 (Sun) 63465897600, # local_end 2012-02-26 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63465904800, # utc_start 2012-02-26 02:00:00 (Sun) 63486471600, # utc_end 2012-10-21 03:00:00 (Sun) 63465894000, # local_start 2012-02-25 23:00:00 (Sat) 63486460800, # local_end 2012-10-21 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63486471600, # utc_start 2012-10-21 03:00:00 (Sun) 63496749600, # utc_end 2013-02-17 02:00:00 (Sun) 63486464400, # local_start 2012-10-21 01:00:00 (Sun) 63496742400, # local_end 2013-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63496749600, # utc_start 2013-02-17 02:00:00 (Sun) 63517921200, # utc_end 2013-10-20 03:00:00 (Sun) 63496738800, # local_start 2013-02-16 23:00:00 (Sat) 63517910400, # local_end 2013-10-20 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63517921200, # utc_start 2013-10-20 03:00:00 (Sun) 63528199200, # utc_end 2014-02-16 02:00:00 (Sun) 63517914000, # local_start 2013-10-20 01:00:00 (Sun) 63528192000, # local_end 2014-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63528199200, # utc_start 2014-02-16 02:00:00 (Sun) 63549370800, # utc_end 2014-10-19 03:00:00 (Sun) 63528188400, # local_start 2014-02-15 23:00:00 (Sat) 63549360000, # local_end 2014-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63549370800, # utc_start 2014-10-19 03:00:00 (Sun) 63560253600, # utc_end 2015-02-22 02:00:00 (Sun) 63549363600, # local_start 2014-10-19 01:00:00 (Sun) 63560246400, # local_end 2015-02-22 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63560253600, # utc_start 2015-02-22 02:00:00 (Sun) 63580820400, # utc_end 2015-10-18 03:00:00 (Sun) 63560242800, # local_start 2015-02-21 23:00:00 (Sat) 63580809600, # local_end 2015-10-18 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63580820400, # utc_start 2015-10-18 03:00:00 (Sun) 63591703200, # utc_end 2016-02-21 02:00:00 (Sun) 63580813200, # local_start 2015-10-18 01:00:00 (Sun) 63591696000, # local_end 2016-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63591703200, # utc_start 2016-02-21 02:00:00 (Sun) 63612270000, # utc_end 2016-10-16 03:00:00 (Sun) 63591692400, # local_start 2016-02-20 23:00:00 (Sat) 63612259200, # local_end 2016-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63612270000, # utc_start 2016-10-16 03:00:00 (Sun) 63623152800, # utc_end 2017-02-19 02:00:00 (Sun) 63612262800, # local_start 2016-10-16 01:00:00 (Sun) 63623145600, # local_end 2017-02-19 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63623152800, # utc_start 2017-02-19 02:00:00 (Sun) 63643719600, # utc_end 2017-10-15 03:00:00 (Sun) 63623142000, # local_start 2017-02-18 23:00:00 (Sat) 63643708800, # local_end 2017-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63643719600, # utc_start 2017-10-15 03:00:00 (Sun) 63654602400, # utc_end 2018-02-18 02:00:00 (Sun) 63643712400, # local_start 2017-10-15 01:00:00 (Sun) 63654595200, # local_end 2018-02-18 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63654602400, # utc_start 2018-02-18 02:00:00 (Sun) 63675774000, # utc_end 2018-10-21 03:00:00 (Sun) 63654591600, # local_start 2018-02-17 23:00:00 (Sat) 63675763200, # local_end 2018-10-21 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63675774000, # utc_start 2018-10-21 03:00:00 (Sun) 63686052000, # utc_end 2019-02-17 02:00:00 (Sun) 63675766800, # local_start 2018-10-21 01:00:00 (Sun) 63686044800, # local_end 2019-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63686052000, # utc_start 2019-02-17 02:00:00 (Sun) 63707223600, # utc_end 2019-10-20 03:00:00 (Sun) 63686041200, # local_start 2019-02-16 23:00:00 (Sat) 63707212800, # local_end 2019-10-20 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63707223600, # utc_start 2019-10-20 03:00:00 (Sun) 63717501600, # utc_end 2020-02-16 02:00:00 (Sun) 63707216400, # local_start 2019-10-20 01:00:00 (Sun) 63717494400, # local_end 2020-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63717501600, # utc_start 2020-02-16 02:00:00 (Sun) 63738673200, # utc_end 2020-10-18 03:00:00 (Sun) 63717490800, # local_start 2020-02-15 23:00:00 (Sat) 63738662400, # local_end 2020-10-18 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63738673200, # utc_start 2020-10-18 03:00:00 (Sun) 63749556000, # utc_end 2021-02-21 02:00:00 (Sun) 63738666000, # local_start 2020-10-18 01:00:00 (Sun) 63749548800, # local_end 2021-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63749556000, # utc_start 2021-02-21 02:00:00 (Sun) 63770122800, # utc_end 2021-10-17 03:00:00 (Sun) 63749545200, # local_start 2021-02-20 23:00:00 (Sat) 63770112000, # local_end 2021-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63770122800, # utc_start 2021-10-17 03:00:00 (Sun) 63781005600, # utc_end 2022-02-20 02:00:00 (Sun) 63770115600, # local_start 2021-10-17 01:00:00 (Sun) 63780998400, # local_end 2022-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63781005600, # utc_start 2022-02-20 02:00:00 (Sun) 63801572400, # utc_end 2022-10-16 03:00:00 (Sun) 63780994800, # local_start 2022-02-19 23:00:00 (Sat) 63801561600, # local_end 2022-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63801572400, # utc_start 2022-10-16 03:00:00 (Sun) 63813060000, # utc_end 2023-02-26 02:00:00 (Sun) 63801565200, # local_start 2022-10-16 01:00:00 (Sun) 63813052800, # local_end 2023-02-26 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63813060000, # utc_start 2023-02-26 02:00:00 (Sun) 63833022000, # utc_end 2023-10-15 03:00:00 (Sun) 63813049200, # local_start 2023-02-25 23:00:00 (Sat) 63833011200, # local_end 2023-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63833022000, # utc_start 2023-10-15 03:00:00 (Sun) 63843904800, # utc_end 2024-02-18 02:00:00 (Sun) 63833014800, # local_start 2023-10-15 01:00:00 (Sun) 63843897600, # local_end 2024-02-18 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63843904800, # utc_start 2024-02-18 02:00:00 (Sun) 63865076400, # utc_end 2024-10-20 03:00:00 (Sun) 63843894000, # local_start 2024-02-17 23:00:00 (Sat) 63865065600, # local_end 2024-10-20 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63865076400, # utc_start 2024-10-20 03:00:00 (Sun) 63875354400, # utc_end 2025-02-16 02:00:00 (Sun) 63865069200, # local_start 2024-10-20 01:00:00 (Sun) 63875347200, # local_end 2025-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63875354400, # utc_start 2025-02-16 02:00:00 (Sun) 63896526000, # utc_end 2025-10-19 03:00:00 (Sun) 63875343600, # local_start 2025-02-15 23:00:00 (Sat) 63896515200, # local_end 2025-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63896526000, # utc_start 2025-10-19 03:00:00 (Sun) 63907408800, # utc_end 2026-02-22 02:00:00 (Sun) 63896518800, # local_start 2025-10-19 01:00:00 (Sun) 63907401600, # local_end 2026-02-22 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63907408800, # utc_start 2026-02-22 02:00:00 (Sun) 63927975600, # utc_end 2026-10-18 03:00:00 (Sun) 63907398000, # local_start 2026-02-21 23:00:00 (Sat) 63927964800, # local_end 2026-10-18 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63927975600, # utc_start 2026-10-18 03:00:00 (Sun) 63938858400, # utc_end 2027-02-21 02:00:00 (Sun) 63927968400, # local_start 2026-10-18 01:00:00 (Sun) 63938851200, # local_end 2027-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63938858400, # utc_start 2027-02-21 02:00:00 (Sun) 63959425200, # utc_end 2027-10-17 03:00:00 (Sun) 63938847600, # local_start 2027-02-20 23:00:00 (Sat) 63959414400, # local_end 2027-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63959425200, # utc_start 2027-10-17 03:00:00 (Sun) 63970308000, # utc_end 2028-02-20 02:00:00 (Sun) 63959418000, # local_start 2027-10-17 01:00:00 (Sun) 63970300800, # local_end 2028-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 63970308000, # utc_start 2028-02-20 02:00:00 (Sun) 63990874800, # utc_end 2028-10-15 03:00:00 (Sun) 63970297200, # local_start 2028-02-19 23:00:00 (Sat) 63990864000, # local_end 2028-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 63990874800, # utc_start 2028-10-15 03:00:00 (Sun) 64001757600, # utc_end 2029-02-18 02:00:00 (Sun) 63990867600, # local_start 2028-10-15 01:00:00 (Sun) 64001750400, # local_end 2029-02-18 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64001757600, # utc_start 2029-02-18 02:00:00 (Sun) 64022929200, # utc_end 2029-10-21 03:00:00 (Sun) 64001746800, # local_start 2029-02-17 23:00:00 (Sat) 64022918400, # local_end 2029-10-21 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64022929200, # utc_start 2029-10-21 03:00:00 (Sun) 64033207200, # utc_end 2030-02-17 02:00:00 (Sun) 64022922000, # local_start 2029-10-21 01:00:00 (Sun) 64033200000, # local_end 2030-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64033207200, # utc_start 2030-02-17 02:00:00 (Sun) 64054378800, # utc_end 2030-10-20 03:00:00 (Sun) 64033196400, # local_start 2030-02-16 23:00:00 (Sat) 64054368000, # local_end 2030-10-20 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64054378800, # utc_start 2030-10-20 03:00:00 (Sun) 64064656800, # utc_end 2031-02-16 02:00:00 (Sun) 64054371600, # local_start 2030-10-20 01:00:00 (Sun) 64064649600, # local_end 2031-02-16 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64064656800, # utc_start 2031-02-16 02:00:00 (Sun) 64085828400, # utc_end 2031-10-19 03:00:00 (Sun) 64064646000, # local_start 2031-02-15 23:00:00 (Sat) 64085817600, # local_end 2031-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64085828400, # utc_start 2031-10-19 03:00:00 (Sun) 64096106400, # utc_end 2032-02-15 02:00:00 (Sun) 64085821200, # local_start 2031-10-19 01:00:00 (Sun) 64096099200, # local_end 2032-02-15 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64096106400, # utc_start 2032-02-15 02:00:00 (Sun) 64117278000, # utc_end 2032-10-17 03:00:00 (Sun) 64096095600, # local_start 2032-02-14 23:00:00 (Sat) 64117267200, # local_end 2032-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64117278000, # utc_start 2032-10-17 03:00:00 (Sun) 64128160800, # utc_end 2033-02-20 02:00:00 (Sun) 64117270800, # local_start 2032-10-17 01:00:00 (Sun) 64128153600, # local_end 2033-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64128160800, # utc_start 2033-02-20 02:00:00 (Sun) 64148727600, # utc_end 2033-10-16 03:00:00 (Sun) 64128150000, # local_start 2033-02-19 23:00:00 (Sat) 64148716800, # local_end 2033-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64148727600, # utc_start 2033-10-16 03:00:00 (Sun) 64160215200, # utc_end 2034-02-26 02:00:00 (Sun) 64148720400, # local_start 2033-10-16 01:00:00 (Sun) 64160208000, # local_end 2034-02-26 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64160215200, # utc_start 2034-02-26 02:00:00 (Sun) 64180177200, # utc_end 2034-10-15 03:00:00 (Sun) 64160204400, # local_start 2034-02-25 23:00:00 (Sat) 64180166400, # local_end 2034-10-15 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64180177200, # utc_start 2034-10-15 03:00:00 (Sun) 64191060000, # utc_end 2035-02-18 02:00:00 (Sun) 64180170000, # local_start 2034-10-15 01:00:00 (Sun) 64191052800, # local_end 2035-02-18 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64191060000, # utc_start 2035-02-18 02:00:00 (Sun) 64212231600, # utc_end 2035-10-21 03:00:00 (Sun) 64191049200, # local_start 2035-02-17 23:00:00 (Sat) 64212220800, # local_end 2035-10-21 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64212231600, # utc_start 2035-10-21 03:00:00 (Sun) 64222509600, # utc_end 2036-02-17 02:00:00 (Sun) 64212224400, # local_start 2035-10-21 01:00:00 (Sun) 64222502400, # local_end 2036-02-17 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64222509600, # utc_start 2036-02-17 02:00:00 (Sun) 64243681200, # utc_end 2036-10-19 03:00:00 (Sun) 64222498800, # local_start 2036-02-16 23:00:00 (Sat) 64243670400, # local_end 2036-10-19 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64243681200, # utc_start 2036-10-19 03:00:00 (Sun) 64254564000, # utc_end 2037-02-22 02:00:00 (Sun) 64243674000, # local_start 2036-10-19 01:00:00 (Sun) 64254556800, # local_end 2037-02-22 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64254564000, # utc_start 2037-02-22 02:00:00 (Sun) 64275130800, # utc_end 2037-10-18 03:00:00 (Sun) 64254553200, # local_start 2037-02-21 23:00:00 (Sat) 64275120000, # local_end 2037-10-18 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64275130800, # utc_start 2037-10-18 03:00:00 (Sun) 64286013600, # utc_end 2038-02-21 02:00:00 (Sun) 64275123600, # local_start 2037-10-18 01:00:00 (Sun) 64286006400, # local_end 2038-02-21 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64286013600, # utc_start 2038-02-21 02:00:00 (Sun) 64306580400, # utc_end 2038-10-17 03:00:00 (Sun) 64286002800, # local_start 2038-02-20 23:00:00 (Sat) 64306569600, # local_end 2038-10-17 00:00:00 (Sun) -10800, 0, 'BRT', ], [ 64306580400, # utc_start 2038-10-17 03:00:00 (Sun) 64317463200, # utc_end 2039-02-20 02:00:00 (Sun) 64306573200, # local_start 2038-10-17 01:00:00 (Sun) 64317456000, # local_end 2039-02-20 00:00:00 (Sun) -7200, 1, 'BRST', ], [ 64317463200, # utc_start 2039-02-20 02:00:00 (Sun) 64338030000, # utc_end 2039-10-16 03:00:00 (Sun) 64317452400, # local_start 2039-02-19 23:00:00 (Sat) 64338019200, # local_end 2039-10-16 00:00:00 (Sun) -10800, 0, 'BRT', ], ]; sub olson_version {'2015d'} sub has_dst_changes {67} sub _max_year {2038} sub _new_instance { return shift->_init( @_, spans => $spans ); } sub _last_offset { -10800 } my $last_observance = bless( { 'format' => 'BR%sT', 'gmtoff' => '-3:00', 'local_start_datetime' => bless( { 'formatter' => undef, 'local_rd_days' => 716971, 'local_rd_secs' => 0, 'offset_modifier' => 0, 'rd_nanosecs' => 0, 'tz' => bless( { 'name' => 'floating', 'offset' => 0 }, 'DateTime::TimeZone::Floating' ), 'utc_rd_days' => 716971, 'utc_rd_secs' => 0, 'utc_year' => 1965 }, 'DateTime' ), 'offset_from_std' => 0, 'offset_from_utc' => -10800, 'until' => [], 'utc_start_datetime' => bless( { 'formatter' => undef, 'local_rd_days' => 716971, 'local_rd_secs' => 7200, 'offset_modifier' => 0, 'rd_nanosecs' => 0, 'tz' => bless( { 'name' => 'floating', 'offset' => 0 }, 'DateTime::TimeZone::Floating' ), 'utc_rd_days' => 716971, 'utc_rd_secs' => 7200, 'utc_year' => 1965 }, 'DateTime' ) }, 'DateTime::TimeZone::OlsonDB::Observance' ) ; sub _last_observance { $last_observance } my $rules = [ bless( { 'at' => '0:00', 'from' => '2038', 'in' => 'Feb', 'letter' => '', 'name' => 'Brazil', 'offset_from_std' => 0, 'on' => 'Sun>=15', 'save' => '0', 'to' => 'max', 'type' => undef }, 'DateTime::TimeZone::OlsonDB::Rule' ), bless( { 'at' => '0:00', 'from' => '2008', 'in' => 'Oct', 'letter' => 'S', 'name' => 'Brazil', 'offset_from_std' => 3600, 'on' => 'Sun>=15', 'save' => '1:00', 'to' => 'max', 'type' => undef }, 'DateTime::TimeZone::OlsonDB::Rule' ) ] ; sub _rules { $rules } 1;
27.037606
92
0.631791
ed463f21e419032db541ad24333ff52c531390a3
2,687
pl
Perl
ext/candc/src/data/italian/prolog/printTUT.pl
TeamSPoon/logicmoo_nlu
5c3e5013a3048da7d68a8a43476ad84d3ea4bb47
[ "MIT" ]
6
2020-01-27T12:08:02.000Z
2020-02-28T19:30:28.000Z
pack/logicmoo_nlu/prolog/candc/src/data/italian/prolog/printTUT.pl
logicmoo/old_logicmoo_workspace
44025b6e389e2f2f7d86b46c1301cab0604bba26
[ "MIT" ]
1
2020-02-02T13:12:34.000Z
2020-02-02T13:12:34.000Z
pack/logicmoo_nlu/prolog/candc/src/data/italian/prolog/printTUT.pl
logicmoo/old_logicmoo_workspace
44025b6e389e2f2f7d86b46c1301cab0604bba26
[ "MIT" ]
null
null
null
:- module(printTUT,[printTUT/2,lenTUT/2]). /* -------------------------------------------------------------------------- Tab Length -------------------------------------------------------------------------- */ tablength(4). /* -------------------------------------------------------------------------- Print Tree -------------------------------------------------------------------------- */ printTUT(X,Stream):- printTUT(X,0,Stream), nl(Stream). printTUT(X,_Tab,Stream):- atom(X), !, tab(Stream,1), write(Stream,X). printTUT(_Type:X,_Tab,Stream):- atom(X), !, tab(Stream,1), write(Stream,X). printTUT(Type:tree(A),Tab,Stream):- !, nl(Stream), tab(Stream,Tab), write(Stream,Type), write(Stream,'('),write(Stream,A), write(Stream,')'). printTUT(Type:tree(A,B),Tab,Stream):- !, nl(Stream), tab(Stream,Tab), write(Stream,Type),write(Stream,'('),write(Stream,A), tablength(Length), NewTab is Tab + Length, printTUTs([B],NewTab,Stream), write(Stream,')'). printTUT(Type:Tree,Tab,Stream):- Tree =.. [tree,A|Rest], !, nl(Stream), tab(Stream,Tab),write(Stream,Type),write(Stream,'('),write(Stream,A), tablength(Length), NewTab is Tab + Length, printTUTs(Rest,NewTab,Stream), write(Stream,')'). printTUT(Type:Tree,Tab,Stream):- !, nl(Stream), tab(Stream,Tab), write(Stream,Type:Tree). /* -------------------------------------------------------------------------- Print Branches -------------------------------------------------------------------------- */ printTUTs([],_,_):- !. printTUTs([X|L],Tab,Stream):- printTUT(X,Tab,Stream), !, printTUTs(L,Tab,Stream). /* -------------------------------------------------------------------------- Length Tree -------------------------------------------------------------------------- */ lenTUT(X,N):- lenTUT(X,0,N). lenTUT(X,N1,N2):- atom(X), !, token(X,N1,N2). lenTUT(_:X,N,N):- atom(X), !. lenTUT(_:tree(_),N,N):- !. lenTUT(_:tree(_,B),N1,N2):- !, lenTUTs([B],N1,N2). lenTUT(_:Tree,N1,N2):- Tree =.. [tree,_|Rest], !, lenTUTs(Rest,N1,N2). lenTUT(_,N,N). /* -------------------------------------------------------------------------- Length of Branches -------------------------------------------------------------------------- */ lenTUTs([],N,N):- !. lenTUTs([X|L],N1,N3):- lenTUT(X,N1,N2), !, lenTUTs(L,N2,N3). /* -------------------------------------------------------------------------- Deciding whether it is a token -------------------------------------------------------------------------- */ token(Atom,N1,N2):- atom(Atom), atom_chars(Atom,Lex), append(Chars,['/'|_],Lex), \+ member('.',Chars), !, N2 is N1 + 1. token(_,N,N).
28.892473
81
0.400447
ed963a29dc947907dec5048d020d048bb4a87562
1,288
pm
Perl
lib/Google/Ads/GoogleAds/V3/Resources/MutateJob.pm
PierrickVoulet/google-ads-perl
bc9fa2de22aa3e11b99dc22251d90a1723dd8cc4
[ "Apache-2.0" ]
null
null
null
lib/Google/Ads/GoogleAds/V3/Resources/MutateJob.pm
PierrickVoulet/google-ads-perl
bc9fa2de22aa3e11b99dc22251d90a1723dd8cc4
[ "Apache-2.0" ]
null
null
null
lib/Google/Ads/GoogleAds/V3/Resources/MutateJob.pm
PierrickVoulet/google-ads-perl
bc9fa2de22aa3e11b99dc22251d90a1723dd8cc4
[ "Apache-2.0" ]
null
null
null
# Copyright 2020, Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. package Google::Ads::GoogleAds::V3::Resources::MutateJob; use strict; use warnings; use base qw(Google::Ads::GoogleAds::BaseEntity); use Google::Ads::GoogleAds::Utils::GoogleAdsHelper; sub new { my ($class, $args) = @_; my $self = { id => $args->{id}, longRunningOperation => $args->{longRunningOperation}, metadata => $args->{metadata}, nextAddSequenceToken => $args->{nextAddSequenceToken}, resourceName => $args->{resourceName}, status => $args->{status}}; # Delete the unassigned fields in this object for a more concise JSON payload remove_unassigned_fields($self, $args); bless $self, $class; return $self; } 1;
31.414634
79
0.687112
ed2d6ab74e4eed70262d028c1a74ae01ac1c362a
91
pl
Perl
Chapter11/4.pl
PacktPublishing/Perl-6-Deep-Dive
b47fadd6bd65efd38ed4860109edc5018ce98924
[ "MIT" ]
9
2017-12-28T13:41:36.000Z
2021-12-20T03:31:06.000Z
Chapter11/6.pl
PacktPublishing/Perl-6-Deep-Dive
b47fadd6bd65efd38ed4860109edc5018ce98924
[ "MIT" ]
1
2020-01-29T07:23:03.000Z
2020-12-01T07:38:06.000Z
Chapter11/6.pl
PacktPublishing/Perl-6-Deep-Dive
b47fadd6bd65efd38ed4860109edc5018ce98924
[ "MIT" ]
2
2017-12-13T10:11:15.000Z
2019-05-24T00:38:23.000Z
my $phone = '+31 645-23-10'; my $re = rx/\+? (\d | \s | \-)+/; say 'OK' if $phone ~~ $re;
18.2
33
0.417582
73dff3b16f59235b977817ce17e00a1bfcd3f43e
3,013
pl
Perl
Task/Sieve-of-Eratosthenes/Perl/sieve-of-eratosthenes-10.pl
mullikine/RosettaCodeData
4f0027c6ce83daa36118ee8b67915a13cd23ab67
[ "Info-ZIP" ]
1
2018-11-09T22:08:38.000Z
2018-11-09T22:08:38.000Z
Task/Sieve-of-Eratosthenes/Perl/sieve-of-eratosthenes-10.pl
mullikine/RosettaCodeData
4f0027c6ce83daa36118ee8b67915a13cd23ab67
[ "Info-ZIP" ]
null
null
null
Task/Sieve-of-Eratosthenes/Perl/sieve-of-eratosthenes-10.pl
mullikine/RosettaCodeData
4f0027c6ce83daa36118ee8b67915a13cd23ab67
[ "Info-ZIP" ]
1
2018-11-09T22:08:40.000Z
2018-11-09T22:08:40.000Z
use strict; use warnings; package Tie::SieveOfEratosthenes; sub TIEARRAY { my $class = shift; bless \$class, $class; } # If set to true, produces copious output. Observing this output # is an excellent way to gain insight into how the algorithm works. use constant DEBUG => 0; # If set to true, causes the code to skip over even numbers, # improving runtime. It does not alter the output content, only the speed. use constant WHEEL2 => 0; BEGIN { # This is loosely based on the Python implementation of this task, # specifically the "Infinite generator with a faster algorithm" my @primes = (2, 3); my $ps = WHEEL2 ? 1 : 0; my $p = $primes[$ps]; my $q = $p*$p; my $incr = WHEEL2 ? 2 : 1; my $candidate = $primes[-1] + $incr; my %sieve; print "Initial: p = $p, q = $q, candidate = $candidate\n" if DEBUG; sub FETCH { my $n = pop; return if $n < 0; return $primes[$n] if $n <= $#primes; OUTER: while( 1 ) { # each key in %sieve is a composite number between # p and p-squared. Each value in %sieve is $incr x the prime # which acted as a 'seed' for that key. We use the value # to step through multiples of the seed-prime, until we find # an empty slot in %sieve. while( my $s = delete $sieve{$candidate} ) { print "$candidate a multiple of ".($s/$incr).";\t\t" if DEBUG; my $composite = $candidate + $s; $composite += $s while exists $sieve{$composite}; print "The next stored multiple of ".($s/$incr)." is $composite\n" if DEBUG; $sieve{$composite} = $s; $candidate += $incr; } print "Candidate $candidate is not in sieve\n" if DEBUG; while( $candidate < $q ) { print "$candidate is prime\n" if DEBUG; push @primes, $candidate; $candidate += $incr; next OUTER if exists $sieve{$candidate}; } die "Candidate = $candidate, p = $p, q = $q" if $candidate > $q; print "Candidate $candidate is equal to $p squared;\t" if DEBUG; # Thus, it is now time to add p to the sieve, my $step = $incr * $p; my $composite = $q + $step; $composite += $step while exists $sieve{$composite}; print "The next multiple of $p is $composite\n" if DEBUG; $sieve{$composite} = $step; # and fetch out a new value for p from our primes array. $p = $primes[++$ps]; $q = $p * $p; # And since $candidate was equal to some prime squared, # it's obviously composite, and we need to increment it. $candidate += $incr; print "p is $p, q is $q, candidate is $candidate\n" if DEBUG; } continue { return $primes[$n] if $n <= $#primes; } } } if( !caller ) { tie my (@prime_list), 'Tie::SieveOfEratosthenes'; my $limit = $ARGV[0] || 100; my $line = ""; for( my $count = 0; $prime_list[$count] < $limit; ++$count ) { $line .= $prime_list[$count]. ", "; next if length($line) <= 70; if( $line =~ tr/,// > 1 ) { $line =~ s/^(.*,) (.*, )/$2/; print $1, "\n"; } else { print $line, "\n"; $line = ""; } } $line =~ s/, \z//; print $line, "\n" if $line; } 1;
28.158879
80
0.60604
ed887a5ca6c30fa84e4f47452980d6246291124a
11,265
pm
Perl
perl/vendor/lib/DBIx/Class.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
2
2021-07-24T12:46:49.000Z
2021-08-02T08:37:53.000Z
perl/vendor/lib/DBIx/Class.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
6
2021-11-18T00:39:48.000Z
2021-11-20T00:31:40.000Z
perl/vendor/lib/DBIx/Class.pm
ifleeyo180/VspriteMoodleWebsite
38baa924829c83808d2c87d44740ff365927a646
[ "Apache-2.0" ]
null
null
null
package DBIx::Class; use strict; use warnings; our $VERSION; # Always remember to do all digits for the version even if they're 0 # i.e. first release of 0.XX *must* be 0.XX000. This avoids fBSD ports # brain damage and presumably various other packaging systems too # $VERSION declaration must stay up here, ahead of any other package # declarations, as to not confuse various modules attempting to determine # this ones version, whether that be s.c.o. or Module::Metadata, etc $VERSION = '0.082842'; { package DBIx::Class::_ENV_; require constant; constant->import( DEVREL => ( ($DBIx::Class::VERSION =~ /_/) ? 1 : 0 ) ); } $VERSION = eval $VERSION if $VERSION =~ /_/; # numify for warning-free dev releases use DBIx::Class::_Util; use mro 'c3'; use DBIx::Class::Optional::Dependencies; use base qw/DBIx::Class::Componentised DBIx::Class::AccessorGroup/; use DBIx::Class::StartupCheck; use DBIx::Class::Exception; __PACKAGE__->mk_group_accessors(inherited => '_skip_namespace_frames'); __PACKAGE__->_skip_namespace_frames('^DBIx::Class|^SQL::Abstract|^Try::Tiny|^Class::Accessor::Grouped|^Context::Preserve'); # FIXME - this is not really necessary, and is in # fact going to slow things down a bit # However it is the right thing to do in order to get # various install bases to highlight their brokenness # Remove at some unknown point in the future sub DESTROY { &DBIx::Class::_Util::detected_reinvoked_destructor } sub mk_classdata { shift->mk_classaccessor(@_); } sub mk_classaccessor { my $self = shift; $self->mk_group_accessors('inherited', $_[0]); $self->set_inherited(@_) if @_ > 1; } sub component_base_class { 'DBIx::Class' } sub MODIFY_CODE_ATTRIBUTES { my ($class,$code,@attrs) = @_; $class->mk_classdata('__attr_cache' => {}) unless $class->can('__attr_cache'); $class->__attr_cache->{$code} = [@attrs]; return (); } sub _attr_cache { my $self = shift; my $cache = $self->can('__attr_cache') ? $self->__attr_cache : {}; return { %$cache, %{ $self->maybe::next::method || {} }, }; } # *DO NOT* change this URL nor the identically named =head1 below # it is linked throughout the ecosystem sub DBIx::Class::_ENV_::HELP_URL () { 'http://p3rl.org/DBIx::Class#GETTING_HELP/SUPPORT' } 1; __END__ # This is the only file where an explicit =encoding is needed, # as the distbuild-time injected author list is utf8 encoded # Without this pod2text output is less than ideal # # A bit regarding selection/compatiblity: # Before 5.8.7 UTF-8 was == utf8, both behaving like the (lax) utf8 we know today # Then https://www.nntp.perl.org/group/perl.unicode/2004/12/msg2705.html happened # Encode way way before 5.8.0 supported UTF-8: https://metacpan.org/source/DANKOGAI/Encode-1.00/lib/Encode/Supported.pod#L44 # so it is safe for the oldest toolchains. # Additionally we inject all the utf8 programattically and test its well-formedness # so all is well # =encoding UTF-8 =head1 NAME DBIx::Class - Extensible and flexible object <-> relational mapper. =head1 WHERE TO START READING See L<DBIx::Class::Manual::DocMap> for an overview of the exhaustive documentation. To get the most out of DBIx::Class with the least confusion it is strongly recommended to read (at the very least) the L<Manuals|DBIx::Class::Manual::DocMap/Manuals> in the order presented there. =cut =head1 GETTING HELP/SUPPORT Due to the sheer size of its problem domain, DBIx::Class is a relatively complex framework. After you start using DBIx::Class questions will inevitably arise. If you are stuck with a problem or have doubts about a particular approach do not hesitate to contact us via any of the following options (the list is sorted by "fastest response time"): =over =item * RT Bug Tracker: L<https://rt.cpan.org/Public/Dist/Display.html?Name=DBIx-Class> =item * Email: L<mailto:bug-DBIx-Class@rt.cpan.org> =item * Twitter: L<https://twitter.com/intent/tweet?text=%40ribasushi%20%23DBIC> =back =head1 SYNOPSIS For the very impatient: L<DBIx::Class::Manual::QuickStart> This code in the next step can be generated automatically from an existing database, see L<dbicdump> from the distribution C<DBIx-Class-Schema-Loader>. =head2 Schema classes preparation Create a schema class called F<MyApp/Schema.pm>: package MyApp::Schema; use base qw/DBIx::Class::Schema/; __PACKAGE__->load_namespaces(); 1; Create a result class to represent artists, who have many CDs, in F<MyApp/Schema/Result/Artist.pm>: See L<DBIx::Class::ResultSource> for docs on defining result classes. package MyApp::Schema::Result::Artist; use base qw/DBIx::Class::Core/; __PACKAGE__->table('artist'); __PACKAGE__->add_columns(qw/ artistid name /); __PACKAGE__->set_primary_key('artistid'); __PACKAGE__->has_many(cds => 'MyApp::Schema::Result::CD', 'artistid'); 1; A result class to represent a CD, which belongs to an artist, in F<MyApp/Schema/Result/CD.pm>: package MyApp::Schema::Result::CD; use base qw/DBIx::Class::Core/; __PACKAGE__->load_components(qw/InflateColumn::DateTime/); __PACKAGE__->table('cd'); __PACKAGE__->add_columns(qw/ cdid artistid title year /); __PACKAGE__->set_primary_key('cdid'); __PACKAGE__->belongs_to(artist => 'MyApp::Schema::Result::Artist', 'artistid'); 1; =head2 API usage Then you can use these classes in your application's code: # Connect to your database. use MyApp::Schema; my $schema = MyApp::Schema->connect($dbi_dsn, $user, $pass, \%dbi_params); # Query for all artists and put them in an array, # or retrieve them as a result set object. # $schema->resultset returns a DBIx::Class::ResultSet my @all_artists = $schema->resultset('Artist')->all; my $all_artists_rs = $schema->resultset('Artist'); # Output all artists names # $artist here is a DBIx::Class::Row, which has accessors # for all its columns. Rows are also subclasses of your Result class. foreach $artist (@all_artists) { print $artist->name, "\n"; } # Create a result set to search for artists. # This does not query the DB. my $johns_rs = $schema->resultset('Artist')->search( # Build your WHERE using an SQL::Abstract::Classic-compatible structure: { name => { like => 'John%' } } ); # Execute a joined query to get the cds. my @all_john_cds = $johns_rs->search_related('cds')->all; # Fetch the next available row. my $first_john = $johns_rs->next; # Specify ORDER BY on the query. my $first_john_cds_by_title_rs = $first_john->cds( undef, { order_by => 'title' } ); # Create a result set that will fetch the artist data # at the same time as it fetches CDs, using only one query. my $millennium_cds_rs = $schema->resultset('CD')->search( { year => 2000 }, { prefetch => 'artist' } ); my $cd = $millennium_cds_rs->next; # SELECT ... FROM cds JOIN artists ... my $cd_artist_name = $cd->artist->name; # Already has the data so no 2nd query # new() makes a Result object but doesn't insert it into the DB. # create() is the same as new() then insert(). my $new_cd = $schema->resultset('CD')->new({ title => 'Spoon' }); $new_cd->artist($cd->artist); $new_cd->insert; # Auto-increment primary key filled in after INSERT $new_cd->title('Fork'); $schema->txn_do(sub { $new_cd->update }); # Runs the update in a transaction # change the year of all the millennium CDs at once $millennium_cds_rs->update({ year => 2002 }); =head1 DESCRIPTION This is an SQL to OO mapper with an object API inspired by L<Class::DBI> (with a compatibility layer as a springboard for porting) and a resultset API that allows abstract encapsulation of database operations. It aims to make representing queries in your code as perl-ish as possible while still providing access to as many of the capabilities of the database as possible, including retrieving related records from multiple tables in a single query, C<JOIN>, C<LEFT JOIN>, C<COUNT>, C<DISTINCT>, C<GROUP BY>, C<ORDER BY> and C<HAVING> support. DBIx::Class can handle multi-column primary and foreign keys, complex queries and database-level paging, and does its best to only query the database in order to return something you've directly asked for. If a resultset is used as an iterator it only fetches rows off the statement handle as requested in order to minimise memory usage. It has auto-increment support for SQLite, MySQL, PostgreSQL, Oracle, SQL Server and DB2 and is known to be used in production on at least the first four, and is fork- and thread-safe out of the box (although L<your DBD may not be|DBI/Threads and Thread Safety>). This project is still under rapid development, so large new features may be marked B<experimental> - such APIs are still usable but may have edge bugs. Failing test cases are I<always> welcome and point releases are put out rapidly as bugs are found and fixed. We do our best to maintain full backwards compatibility for published APIs, since DBIx::Class is used in production in many organisations, and even backwards incompatible changes to non-published APIs will be fixed if they're reported and doing so doesn't cost the codebase anything. The test suite is quite substantial, and several developer releases are generally made to CPAN before the branch for the next release is merged back to trunk for a major release. =head1 HOW TO CONTRIBUTE Contributions are always welcome, in all usable forms (we especially welcome documentation improvements). The delivery methods include git- or unified-diff formatted patches, GitHub pull requests, or plain bug reports either via RT or the Mailing list. Do not hesitate to L<get in touch|/GETTING HELP/SUPPORT> with any further questions you may have. =for comment FIXME: Getty, frew and jnap need to get off their asses and finish the contrib section so we can link it here ;) This project is maintained in a git repository. The code and related tools are accessible at the following locations: =over =item * Current git repository: L<https://github.com/Perl5/DBIx-Class> =item * Travis-CI log: L<https://travis-ci.com/github/Perl5/DBIx-Class/branches> =back =head1 AUTHORS Even though a large portion of the source I<appears> to be written by just a handful of people, this library continues to remain a collaborative effort - perhaps one of the most successful such projects on L<CPAN|http://cpan.org>. It is important to remember that ideas do not always result in a direct code contribution, but deserve acknowledgement just the same. Time and time again the seemingly most insignificant questions and suggestions have been shown to catalyze monumental improvements in consistency, accuracy and performance. =for comment this line is replaced with the author list at dist-building time The canonical source of authors and their details is the F<AUTHORS> file at the root of this distribution (or repository). The canonical source of per-line authorship is the L<git repository|/HOW TO CONTRIBUTE> history itself. =head1 COPYRIGHT AND LICENSE Copyright (c) 2005 by mst, castaway, ribasushi, and other DBIx::Class L</AUTHORS> as listed above and in F<AUTHORS>. This library is free software and may be distributed under the same terms as perl5 itself. See F<LICENSE> for the complete licensing terms.
35.093458
124
0.740435
ed6d39727d89d056a3a3af96048246a3b800fb3a
3,236
pm
Perl
Plack/Middleware/Choke/Bytes.pm
hathitrust/plack-lib
a519ef9d455582fd785177bf1127f425e32b2ffd
[ "BSD-3-Clause" ]
null
null
null
Plack/Middleware/Choke/Bytes.pm
hathitrust/plack-lib
a519ef9d455582fd785177bf1127f425e32b2ffd
[ "BSD-3-Clause" ]
null
null
null
Plack/Middleware/Choke/Bytes.pm
hathitrust/plack-lib
a519ef9d455582fd785177bf1127f425e32b2ffd
[ "BSD-3-Clause" ]
null
null
null
package Plack::Middleware::Choke::Bytes; use base qw( Plack::Middleware::Choke ); use Date::Manip; use Data::Dumper; sub test { my ( $self ) = @_; my $delta = ( $self->now - $self->data->{'_ts'} ); my $allowed = 1; my $message; my $tx_credit = 0; my $reset = 0; my ( $max_debt, $max_debt_unit ) = @{ $self->max_debt }; $max_debt *= $self->multiplier; unless ( ref($self->data->{bytes}) ) { $self->data->{bytes} = { debt => 0, max_debt => join(" / ", @{ $self->max_debt} ) }; if ( ref($self->credit_rate) ) { $self->data->{bytes}->{credit_rate} = join(" / ", @{ $self->credit_rate }); if ( $self->rate_multiplier != 1 ) { $self->data->{bytes}->{credit_rate} .= qq{ * $self->rate_multiplier}; } } } if ( ref($self->credit_rate) ) { my ( $credit_rate, $unit ) = @{ $self->credit_rate }; $credit_rate *= $self->rate_multiplier; if ( $unit eq 'min' ) { $credit_rate = $credit_rate / 60.0; } elsif ( $unit eq 'hour' ) { $credit_rate = $credit_rate / 60.0 / 60.0; } $tx_credit = $credit_rate * $delta; if ( $self->data->{bytes}->{debt} > 0 ) { $self->data->{bytes}->{debt} -= $tx_credit; $self->data->{bytes}->{debt} = 0 if ( $self->data->{bytes}->{debt} < 0 ); } } if ( $self->data->{_until_ts} ) { if ( $self->now > $self->data->{_until_ts} ) { # throttling is OVER! $self->data->{bytes}->{debt} = 0; delete $self->data->{_until_ts}; } else { $allowed = 0; $message = qq{Request still throttled until : } . $self->data->{_until_ts}; } } elsif ( $self->data->{bytes}->{debt} > $max_debt ) { $allowed = 0; unless ( $max_debt_unit =~ m,^\+, ) { $max_debt_unit = qq{+ 1 $max_debt_unit}; } $self->data->{_until_ts} = UnixDate($max_debt_unit, "%s"); $message = qq{Request throttled until : } . $self->data->{_until_ts}; } $self->headers->{'X-Choke-Allowed'} = $allowed; $self->headers->{'X-Choke'} = 'bytes'; $self->headers->{'X-Choke-Now'} = UnixDate("epoch " . $self->now, "%Y-%m-%d %H:%M:%S"); $self->headers->{'X-Choke-Until'} = UnixDate("epoch " . $self->data->{_until_ts}, "%Y-%m-%d %H:%M:%S") if ( $self->data->{_until_ts} ); $self->headers->{'X-Choke-UntilEpoch'} = $self->data->{_until_ts} if ( $self->data->{_until_ts} ); $self->headers->{'X-Choke-Debt'} = $self->data->{bytes}->{debt}; $self->headers->{'X-Choke-Max'} = $max_debt; $self->headers->{'X-Choke-Credit'} = $tx_credit; $self->headers->{'X-Choke-Message'} = $message; $self->headers->{'X-Choke-Delta'} = $delta; $rate = qq{$max_debt bytes / $max_debt_unit}; $rate =~ s, \+([0-9]), $1,; $self->headers->{'X-Choke-Rate'} = $rate; return ( $allowed, $message ); } sub post_process { my ( $self, $chunk ) = @_; my $content_length = length($chunk); if ( $content_length ) { $self->data->{bytes}->{debt} += $content_length; $self->update_cache(); } return $chunk; } 1;
35.955556
139
0.504635
ed79eb40af54d0c5d4c2d264075ec00c77c18b8a
4,485
perl
Perl
Vagrantfile.perl
sergueik/puppetmaster_vagrant
4ce82f9618a040206a695038bfe8f8fc21cdfcb6
[ "MIT" ]
3
2016-02-04T22:24:59.000Z
2020-04-13T17:09:30.000Z
Vagrantfile.perl
sergueik/puppetmaster_vagrant
4ce82f9618a040206a695038bfe8f8fc21cdfcb6
[ "MIT" ]
6
2021-12-11T14:40:53.000Z
2022-01-04T16:54:19.000Z
Vagrantfile.perl
sergueik/puppetmaster_vagrant
4ce82f9618a040206a695038bfe8f8fc21cdfcb6
[ "MIT" ]
1
2016-07-19T13:36:24.000Z
2016-07-19T13:36:24.000Z
# -*- mode: ruby -*- # vi: set ft=ruby : # based on: # https://github.com/williambelle/perl-box # collapsed into single, fixed few Vagrant specific issues perl_version = ENV.fetch('PERL_VERSION', '5.28.0') # TODO: use to suppress brew # e.g. 5.28.0 box_name = ENV.fetch('BOX_NAME', 'puppetlabs/ubuntu-16.04-64-puppet') debug_perl = ENV.fetch('DEBUG_PERL', '') debug_perl = true if debug_perl =~ /^(?:true|yes|1)$/i # debug = ENV.fetch('DEBUG', false) debug = ENV.fetch('DEBUG', '') debug = true if debug =~ /^(?:true|yes|1)$/i perl_old = '5.8.9 5.10.1 5.12.5 5.14.4 5.16.3 5.18.4 ' perl_new = '5.20.3 5.22.4 5.24.4 5.26.2 5.28.0' VAGRANTFILE_API_VERSION = '2' basedir = (ENV.fetch('HOME','') || ENV.fetch('USERPROFILE', '')).gsub('\\', '/') box_memory = ENV.fetch('BOX_MEMORY', '1024').to_i Vagrant.configure(VAGRANTFILE_API_VERSION) do |config| config.vm.box = box_name # using localy cached vagrant box # invoke-webrequest -uri 'https://app.vagrantup.com/puppetlabs/boxes/ubuntu-16.04-64-puppet/versions/1.0.0/providers/virtualbox.box' -outfile "${env:USERPROFILE}\Downloads\ubuntu-16.04-64-puppet.box" config_vm_box_name = 'ubuntu-16.04-64-puppet.box' config.vm.box_url = "file://#{basedir}/Downloads/#{config_vm_box_name}" # based on https://groups.google.com/forum/#!topic/vagrant-up/k2aUobRmn1A # config.vm.provision 'file', source: './bootstrap', destination: '/tmp/bootstrap' # config.vm.provision 'shell', inline: '/tmp/bootstrap/bootstrap-script.sh' # only required for config.vm.boot_timeout = 600 config.vm.synced_folder './' , '/vagrant' shell_script = <<-EOF sudo apt-get -qy update sudo apt-get -qqy install vim jq build-essential curl zlib1g-dev libssl-dev libexpat1-dev sudo apt-get -qqy install perl-doc perltidy libperl-critic-perl libwww-perl sudo apt-get -qqy apache2 lynx sudo apt-get install libhtml-tokeparser-simple-perl libossp-uuid-perl libregexp-common-perl # https://tecadmin.net/enable-or-disable-cgi-in-apache24/ # https://httpd.apache.org/docs/2.4/howto/cgi.html # http://www.wellho.net/forum/Perl-Programming/Running-Perl-CGI-scripts-under-Apache-Tomcat.html sudo a2enmod cgi sudo systemctl restart httpd PERL_MODULES='JSON YAML Date::Manip Date::Parse CGI::FastTemplate Test::CheckManifest Carp Test::Pod::Coverage Test::CheckManifest Test::Pod::Coverage Test::Pod Test::Perl::Critic Data::Dumper CGI Time::HiRes Time::CTime Time::Local Time::ParseDate File::Basename List::MoreUtils Data::UUID HTML::TokeParser::Simple Regexp::Common Regexp::Assemble::Compressed XML::Parser XML::SAX::Expat XML::Simple HTML::TableExtract Log::Log4perl Getopt::Long HTML::TagParser Log::Log4perl' cpan install CPAN::Shell # https://www.perlmonks.org/?node_id=859409 for M in $PERL_MODULES; do perl -MCPAN -e "CPAN::Shell->notest('install', '$M')" # cpan install $M; done export PERLBREW_ROOT='/home/vagrant/perl5/perlbrew' PERLBREW_BIN="${PERLBREW_ROOT}/bin/perlbrew" PERL_OLD='5.8.9 5.10.1 5.12.5 5.14.4 5.16.3 5.18.4 ' PERL_NEW='5.20.3 5.22.4 5.24.4 5.26.2 5.28.0' # NOTE: cannot leave empty PERL_OLD='5.8.9' PERL_NEW='5.28.0' # Install Perlbrew. # NOTE: all temporary files being deleted. # NOTE: no way currently to override PERLBREW_ROOT # NOTE: installing as regular user curl -kL https://install.perlbrew.pl | bash # Add Perlbrew to PATH echo 'source ~/perl5/perlbrew/etc/bashrc' >> /home/vagrant/.bashrc # Install all Perl version $PERLBREW_BIN install-multiple --notest $PERL_OLD $PERL_NEW # Install cpanm $PERLBREW_BIN install-cpanm # NOTE: need to suppress cpanm testing during install: too time-consuming # Install Perl dev dependencies for both old and new Perl versions. TODO: do the same in the system Perl to made vailable to apache2 CGI-BIN for M in $PERL_MODULES; do $PERLBREW_BIN exec cpanm -n $M; done chown -R vagrant:vagrant ~vagrant/perl5 # Switch to latest new Perl version $PERLBREW_BIN switch perl-${PERL_NEW##* } # echo $PERL_NEW | rev| cut -f 1 -d' ' | rev EOF config.vm.provision 'shell', env: { 'PERL_OLD' => perl_old, 'PERL_NEW' => perl_new, }, inline: shell_script end
43.543689
484
0.661984