contestId
int64 0
1.01k
| index
stringclasses 57
values | name
stringlengths 2
58
| type
stringclasses 2
values | rating
int64 0
3.5k
| tags
sequencelengths 0
11
| title
stringclasses 522
values | time-limit
stringclasses 8
values | memory-limit
stringclasses 8
values | problem-description
stringlengths 0
7.15k
| input-specification
stringlengths 0
2.05k
| output-specification
stringlengths 0
1.5k
| demo-input
sequencelengths 0
7
| demo-output
sequencelengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
425k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 14
values | testset
stringclasses 12
values | passedTestCount
int64 0
1k
| timeConsumedMillis
int64 0
15k
| memoryConsumedBytes
int64 0
805M
| code
stringlengths 3
65.5k
| prompt
stringlengths 262
8.2k
| response
stringlengths 17
65.5k
| score
float64 -1
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions. | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,671,122,308 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 60 | 0 | import math
x=list(map(int,input().split()))
print(math.ceil(math.prod(x)/2)) | Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none | ```python
import math
x=list(map(int,input().split()))
print(math.ceil(math.prod(x)/2))
``` | 0 |
296 | A | Yaroslav and Permutations | PROGRAMMING | 1,100 | [
"greedy",
"math"
] | null | null | Yaroslav has an array that consists of *n* integers. In one second Yaroslav can swap two neighboring array elements. Now Yaroslav is wondering if he can obtain an array where any two neighboring elements would be distinct in a finite time.
Help Yaroslav. | The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000) — the array elements. | In the single line print "YES" (without the quotes) if Yaroslav can obtain the array he needs, and "NO" (without the quotes) otherwise. | [
"1\n1\n",
"3\n1 1 2\n",
"4\n7 7 7 7\n"
] | [
"YES\n",
"YES\n",
"NO\n"
] | In the first sample the initial array fits well.
In the second sample Yaroslav can get array: 1, 2, 1. He can swap the last and the second last elements to obtain it.
In the third sample Yarosav can't get the array he needs. | 500 | [
{
"input": "1\n1",
"output": "YES"
},
{
"input": "3\n1 1 2",
"output": "YES"
},
{
"input": "4\n7 7 7 7",
"output": "NO"
},
{
"input": "4\n479 170 465 146",
"output": "YES"
},
{
"input": "5\n996 437 605 996 293",
"output": "YES"
},
{
"input": "6\n727 539 896 668 36 896",
"output": "YES"
},
{
"input": "7\n674 712 674 674 674 674 674",
"output": "NO"
},
{
"input": "8\n742 742 742 742 742 289 742 742",
"output": "NO"
},
{
"input": "9\n730 351 806 806 806 630 85 757 967",
"output": "YES"
},
{
"input": "10\n324 539 83 440 834 640 440 440 440 440",
"output": "YES"
},
{
"input": "7\n925 830 925 98 987 162 356",
"output": "YES"
},
{
"input": "68\n575 32 53 351 151 942 725 967 431 108 192 8 338 458 288 754 384 946 910 210 759 222 589 423 947 507 31 414 169 901 592 763 656 411 360 625 538 549 484 596 42 603 351 292 837 375 21 597 22 349 200 669 485 282 735 54 1000 419 939 901 789 128 468 729 894 649 484 808",
"output": "YES"
},
{
"input": "22\n618 814 515 310 617 936 452 601 250 520 557 799 304 225 9 845 610 990 703 196 486 94",
"output": "YES"
},
{
"input": "44\n459 581 449 449 449 449 449 449 449 623 449 449 449 449 449 449 449 449 889 449 203 273 329 449 449 449 449 449 449 845 882 323 22 449 449 893 449 449 449 449 449 870 449 402",
"output": "NO"
},
{
"input": "90\n424 3 586 183 286 89 427 618 758 833 933 170 155 722 190 977 330 369 693 426 556 435 550 442 513 146 61 719 754 140 424 280 997 688 530 550 438 867 950 194 196 298 417 287 106 489 283 456 735 115 702 317 672 787 264 314 356 186 54 913 809 833 946 314 757 322 559 647 983 482 145 197 223 130 162 536 451 174 467 45 660 293 440 254 25 155 511 746 650 187",
"output": "YES"
},
{
"input": "14\n959 203 478 315 788 788 373 834 488 519 774 764 193 103",
"output": "YES"
},
{
"input": "81\n544 528 528 528 528 4 506 528 32 528 528 528 528 528 528 528 528 975 528 528 528 528 528 528 528 528 528 528 528 528 528 20 528 528 528 528 528 528 528 528 852 528 528 120 528 528 61 11 528 528 528 228 528 165 883 528 488 475 628 528 528 528 528 528 528 597 528 528 528 528 528 528 528 528 528 528 528 412 528 521 925",
"output": "NO"
},
{
"input": "89\n354 356 352 355 355 355 352 354 354 352 355 356 355 352 354 356 354 355 355 354 353 352 352 355 355 356 352 352 353 356 352 353 354 352 355 352 353 353 353 354 353 354 354 353 356 353 353 354 354 354 354 353 352 353 355 356 356 352 356 354 353 352 355 354 356 356 356 354 354 356 354 355 354 355 353 352 354 355 352 355 355 354 356 353 353 352 356 352 353",
"output": "YES"
},
{
"input": "71\n284 284 285 285 285 284 285 284 284 285 284 285 284 284 285 284 285 285 285 285 284 284 285 285 284 284 284 285 284 285 284 285 285 284 284 284 285 284 284 285 285 285 284 284 285 284 285 285 284 285 285 284 285 284 284 284 285 285 284 285 284 285 285 285 285 284 284 285 285 284 285",
"output": "NO"
},
{
"input": "28\n602 216 214 825 814 760 814 28 76 814 814 288 814 814 222 707 11 490 814 543 914 705 814 751 976 814 814 99",
"output": "YES"
},
{
"input": "48\n546 547 914 263 986 945 914 914 509 871 324 914 153 571 914 914 914 528 970 566 544 914 914 914 410 914 914 589 609 222 914 889 691 844 621 68 914 36 914 39 630 749 914 258 945 914 727 26",
"output": "YES"
},
{
"input": "56\n516 76 516 197 516 427 174 516 706 813 94 37 516 815 516 516 937 483 16 516 842 516 638 691 516 635 516 516 453 263 516 516 635 257 125 214 29 81 516 51 362 516 677 516 903 516 949 654 221 924 516 879 516 516 972 516",
"output": "YES"
},
{
"input": "46\n314 723 314 314 314 235 314 314 314 314 270 314 59 972 314 216 816 40 314 314 314 314 314 314 314 381 314 314 314 314 314 314 314 789 314 957 114 942 314 314 29 314 314 72 314 314",
"output": "NO"
},
{
"input": "72\n169 169 169 599 694 81 250 529 865 406 817 169 667 169 965 169 169 663 65 169 903 169 942 763 169 807 169 603 169 169 13 169 169 810 169 291 169 169 169 169 169 169 169 713 169 440 169 169 169 169 169 480 169 169 867 169 169 169 169 169 169 169 169 393 169 169 459 169 99 169 601 800",
"output": "NO"
},
{
"input": "100\n317 316 317 316 317 316 317 316 317 316 316 317 317 316 317 316 316 316 317 316 317 317 316 317 316 316 316 316 316 316 317 316 317 317 317 317 317 317 316 316 316 317 316 317 316 317 316 317 317 316 317 316 317 317 316 317 316 317 316 317 316 316 316 317 317 317 317 317 316 317 317 316 316 316 316 317 317 316 317 316 316 316 316 316 316 317 316 316 317 317 317 317 317 317 317 317 317 316 316 317",
"output": "NO"
},
{
"input": "100\n510 510 510 162 969 32 510 511 510 510 911 183 496 875 903 461 510 510 123 578 510 510 510 510 510 755 510 673 510 510 763 510 510 909 510 435 487 959 807 510 368 788 557 448 284 332 510 949 510 510 777 112 857 926 487 510 510 510 678 510 510 197 829 427 698 704 409 509 510 238 314 851 510 651 510 455 682 510 714 635 973 510 443 878 510 510 510 591 510 24 596 510 43 183 510 510 671 652 214 784",
"output": "YES"
},
{
"input": "100\n476 477 474 476 476 475 473 476 474 475 473 477 476 476 474 476 474 475 476 477 473 473 473 474 474 476 473 473 476 476 475 476 473 474 473 473 477 475 475 475 476 475 477 477 477 476 475 475 475 473 476 477 475 476 477 473 474 477 473 475 476 476 474 477 476 474 473 477 473 475 477 473 476 474 477 473 475 477 473 476 476 475 476 475 474 473 477 473 475 473 477 473 473 474 475 473 477 476 477 474",
"output": "YES"
},
{
"input": "100\n498 498 498 498 498 499 498 499 499 499 498 498 498 498 499 498 499 499 498 499 498 498 498 499 499 499 498 498 499 499 498 498 498 499 498 499 498 498 498 499 498 499 498 498 498 498 499 498 498 499 498 498 499 498 499 499 498 499 499 499 498 498 498 498 499 498 499 498 499 499 499 499 498 498 499 499 498 499 499 498 498 499 499 498 498 499 499 499 498 498 499 498 498 498 499 499 499 498 498 499",
"output": "NO"
},
{
"input": "100\n858 53 816 816 816 816 816 816 816 181 816 816 816 816 579 879 816 948 171 816 816 150 866 816 816 816 897 816 816 816 816 816 816 706 816 539 816 816 816 816 816 816 423 487 816 615 254 816 816 816 816 83 816 816 816 816 816 816 816 816 816 816 816 136 775 999 816 816 816 644 816 816 816 816 927 816 802 816 856 816 816 816 816 816 816 816 816 816 816 700 816 816 816 816 982 477 816 891 806 816",
"output": "NO"
},
{
"input": "100\n167 169 169 167 169 169 167 167 167 167 168 166 170 170 169 170 170 170 169 168 166 167 170 169 167 169 168 169 166 170 166 167 170 166 166 167 169 166 166 169 166 167 168 168 170 167 168 166 168 170 167 168 167 169 169 166 168 167 170 168 167 169 168 169 166 168 168 169 169 166 170 168 167 169 170 168 167 169 168 167 168 168 166 169 170 170 166 166 167 170 167 168 167 167 169 169 166 166 169 167",
"output": "YES"
},
{
"input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000",
"output": "NO"
},
{
"input": "99\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000",
"output": "NO"
},
{
"input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "YES"
},
{
"input": "99\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "YES"
},
{
"input": "2\n1 1",
"output": "NO"
},
{
"input": "1\n1000",
"output": "YES"
},
{
"input": "12\n2 2 4 4 4 4 6 6 6 6 6 6",
"output": "YES"
}
] | 1,591,117,706 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 17 | 310 | 0 | #A. Yaroslav and Permutations
n = int(input())
a = list(map(int,input().split()))
if n==1:
print('YES')
else:
if len(set(a))>=n//2:
print('YES')
else:
print('NO') | Title: Yaroslav and Permutations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Yaroslav has an array that consists of *n* integers. In one second Yaroslav can swap two neighboring array elements. Now Yaroslav is wondering if he can obtain an array where any two neighboring elements would be distinct in a finite time.
Help Yaroslav.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000) — the array elements.
Output Specification:
In the single line print "YES" (without the quotes) if Yaroslav can obtain the array he needs, and "NO" (without the quotes) otherwise.
Demo Input:
['1\n1\n', '3\n1 1 2\n', '4\n7 7 7 7\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n']
Note:
In the first sample the initial array fits well.
In the second sample Yaroslav can get array: 1, 2, 1. He can swap the last and the second last elements to obtain it.
In the third sample Yarosav can't get the array he needs. | ```python
#A. Yaroslav and Permutations
n = int(input())
a = list(map(int,input().split()))
if n==1:
print('YES')
else:
if len(set(a))>=n//2:
print('YES')
else:
print('NO')
``` | 0 |
|
479 | A | Expression | PROGRAMMING | 1,000 | [
"brute force",
"math"
] | null | null | Petya studies in a school and he adores Maths. His class has been studying arithmetic expressions. On the last class the teacher wrote three positive integers *a*, *b*, *c* on the blackboard. The task was to insert signs of operations '+' and '*', and probably brackets between the numbers so that the value of the resulting expression is as large as possible. Let's consider an example: assume that the teacher wrote numbers 1, 2 and 3 on the blackboard. Here are some ways of placing signs and brackets:
- 1+2*3=7 - 1*(2+3)=5 - 1*2*3=6 - (1+2)*3=9
Note that you can insert operation signs only between *a* and *b*, and between *b* and *c*, that is, you cannot swap integers. For instance, in the given sample you cannot get expression (1+3)*2.
It's easy to see that the maximum value that you can obtain is 9.
Your task is: given *a*, *b* and *c* print the maximum value that you can get. | The input contains three integers *a*, *b* and *c*, each on a single line (1<=≤<=*a*,<=*b*,<=*c*<=≤<=10). | Print the maximum value of the expression that you can obtain. | [
"1\n2\n3\n",
"2\n10\n3\n"
] | [
"9\n",
"60\n"
] | none | 500 | [
{
"input": "1\n2\n3",
"output": "9"
},
{
"input": "2\n10\n3",
"output": "60"
},
{
"input": "1\n1\n1",
"output": "3"
},
{
"input": "1\n2\n1",
"output": "4"
},
{
"input": "10\n10\n10",
"output": "1000"
},
{
"input": "5\n1\n3",
"output": "20"
},
{
"input": "3\n1\n5",
"output": "20"
},
{
"input": "6\n7\n1",
"output": "48"
},
{
"input": "1\n8\n3",
"output": "27"
},
{
"input": "9\n7\n2",
"output": "126"
},
{
"input": "1\n1\n10",
"output": "20"
},
{
"input": "9\n1\n1",
"output": "18"
},
{
"input": "10\n5\n6",
"output": "300"
},
{
"input": "8\n9\n7",
"output": "504"
},
{
"input": "4\n2\n10",
"output": "80"
},
{
"input": "2\n8\n3",
"output": "48"
},
{
"input": "3\n5\n7",
"output": "105"
},
{
"input": "1\n10\n1",
"output": "12"
},
{
"input": "2\n2\n2",
"output": "8"
},
{
"input": "5\n6\n1",
"output": "35"
},
{
"input": "10\n1\n1",
"output": "20"
},
{
"input": "1\n6\n1",
"output": "8"
},
{
"input": "1\n9\n1",
"output": "11"
},
{
"input": "2\n1\n2",
"output": "6"
},
{
"input": "2\n6\n1",
"output": "14"
},
{
"input": "9\n2\n1",
"output": "27"
},
{
"input": "1\n9\n2",
"output": "20"
},
{
"input": "1\n3\n1",
"output": "5"
},
{
"input": "2\n1\n1",
"output": "4"
}
] | 1,691,431,636 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 46 | 0 | a = int(input())
b = int(input())
c = int(input())
l = []
r1 = a*b*c
l.append(r1)
r2 = a+b*c
l.append(r2)
r3 = a*b+c
l.append(r3)
r4 = (a+b)*c
l.append(r4)
r5 = a*(b+c)
l.append(r5)
print(max(l)) | Title: Expression
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya studies in a school and he adores Maths. His class has been studying arithmetic expressions. On the last class the teacher wrote three positive integers *a*, *b*, *c* on the blackboard. The task was to insert signs of operations '+' and '*', and probably brackets between the numbers so that the value of the resulting expression is as large as possible. Let's consider an example: assume that the teacher wrote numbers 1, 2 and 3 on the blackboard. Here are some ways of placing signs and brackets:
- 1+2*3=7 - 1*(2+3)=5 - 1*2*3=6 - (1+2)*3=9
Note that you can insert operation signs only between *a* and *b*, and between *b* and *c*, that is, you cannot swap integers. For instance, in the given sample you cannot get expression (1+3)*2.
It's easy to see that the maximum value that you can obtain is 9.
Your task is: given *a*, *b* and *c* print the maximum value that you can get.
Input Specification:
The input contains three integers *a*, *b* and *c*, each on a single line (1<=≤<=*a*,<=*b*,<=*c*<=≤<=10).
Output Specification:
Print the maximum value of the expression that you can obtain.
Demo Input:
['1\n2\n3\n', '2\n10\n3\n']
Demo Output:
['9\n', '60\n']
Note:
none | ```python
a = int(input())
b = int(input())
c = int(input())
l = []
r1 = a*b*c
l.append(r1)
r2 = a+b*c
l.append(r2)
r3 = a*b+c
l.append(r3)
r4 = (a+b)*c
l.append(r4)
r5 = a*(b+c)
l.append(r5)
print(max(l))
``` | 0 |
|
340 | A | The Wall | PROGRAMMING | 1,200 | [
"math"
] | null | null | Iahub and his friend Floyd have started painting a wall. Iahub is painting the wall red and Floyd is painting it pink. You can consider the wall being made of a very large number of bricks, numbered 1, 2, 3 and so on.
Iahub has the following scheme of painting: he skips *x*<=-<=1 consecutive bricks, then he paints the *x*-th one. That is, he'll paint bricks *x*, 2·*x*, 3·*x* and so on red. Similarly, Floyd skips *y*<=-<=1 consecutive bricks, then he paints the *y*-th one. Hence he'll paint bricks *y*, 2·*y*, 3·*y* and so on pink.
After painting the wall all day, the boys observed that some bricks are painted both red and pink. Iahub has a lucky number *a* and Floyd has a lucky number *b*. Boys wonder how many bricks numbered no less than *a* and no greater than *b* are painted both red and pink. This is exactly your task: compute and print the answer to the question. | The input will have a single line containing four integers in this order: *x*, *y*, *a*, *b*. (1<=≤<=*x*,<=*y*<=≤<=1000, 1<=≤<=*a*,<=*b*<=≤<=2·109, *a*<=≤<=*b*). | Output a single integer — the number of bricks numbered no less than *a* and no greater than *b* that are painted both red and pink. | [
"2 3 6 18\n"
] | [
"3"
] | Let's look at the bricks from *a* to *b* (*a* = 6, *b* = 18). The bricks colored in red are numbered 6, 8, 10, 12, 14, 16, 18. The bricks colored in pink are numbered 6, 9, 12, 15, 18. The bricks colored in both red and pink are numbered with 6, 12 and 18. | 500 | [
{
"input": "2 3 6 18",
"output": "3"
},
{
"input": "4 6 20 201",
"output": "15"
},
{
"input": "15 27 100 10000",
"output": "74"
},
{
"input": "105 60 3456 78910",
"output": "179"
},
{
"input": "1 1 1000 100000",
"output": "99001"
},
{
"input": "3 2 5 5",
"output": "0"
},
{
"input": "555 777 1 1000000",
"output": "257"
},
{
"input": "1000 1000 1 32323",
"output": "32"
},
{
"input": "45 125 93451125 100000000",
"output": "5821"
},
{
"input": "101 171 1 1000000000",
"output": "57900"
},
{
"input": "165 255 69696 1000000000",
"output": "356482"
},
{
"input": "555 777 666013 1000000000",
"output": "257229"
},
{
"input": "23 46 123321 900000000",
"output": "19562537"
},
{
"input": "321 123 15 1000000",
"output": "75"
},
{
"input": "819 1000 9532 152901000",
"output": "186"
},
{
"input": "819 1000 10000 1000000",
"output": "1"
},
{
"input": "1 1 1 1",
"output": "1"
},
{
"input": "1 2 2 1000003",
"output": "500001"
},
{
"input": "1 1 1 1000000000",
"output": "1000000000"
},
{
"input": "10 15 69 195610342",
"output": "6520342"
},
{
"input": "2 1 1 1000000000",
"output": "500000000"
},
{
"input": "1000 1000 1 20",
"output": "0"
},
{
"input": "1 1 1 2000000000",
"output": "2000000000"
},
{
"input": "1 2 1 2000000000",
"output": "1000000000"
},
{
"input": "2 1 1 2000000000",
"output": "1000000000"
},
{
"input": "2 3 1 1000000000",
"output": "166666666"
},
{
"input": "2 3 1 2000000000",
"output": "333333333"
},
{
"input": "3 7 1 1000000000",
"output": "47619047"
},
{
"input": "1 1 1000000000 2000000000",
"output": "1000000001"
},
{
"input": "2 2 1 2000000000",
"output": "1000000000"
},
{
"input": "1 1 2 2000000000",
"output": "1999999999"
},
{
"input": "3 2 1 2000000000",
"output": "333333333"
},
{
"input": "1 1 2000000000 2000000000",
"output": "1"
},
{
"input": "2 3 7 7",
"output": "0"
},
{
"input": "3 3 3 7",
"output": "2"
}
] | 1,378,911,480 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 92 | 0 | x,y,a,b=map(int,input().split())
def gcd(x,y):
if (x%y==0):
return y
else:
return(gcd(y,x%y))
n=gcd(x,y)
t=x*y/n
s=0
u=((a/t)+1)*t
if(u<b):s=int((b-u)/t)+1
if a%t==0:s+=1
print(s)
| Title: The Wall
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Iahub and his friend Floyd have started painting a wall. Iahub is painting the wall red and Floyd is painting it pink. You can consider the wall being made of a very large number of bricks, numbered 1, 2, 3 and so on.
Iahub has the following scheme of painting: he skips *x*<=-<=1 consecutive bricks, then he paints the *x*-th one. That is, he'll paint bricks *x*, 2·*x*, 3·*x* and so on red. Similarly, Floyd skips *y*<=-<=1 consecutive bricks, then he paints the *y*-th one. Hence he'll paint bricks *y*, 2·*y*, 3·*y* and so on pink.
After painting the wall all day, the boys observed that some bricks are painted both red and pink. Iahub has a lucky number *a* and Floyd has a lucky number *b*. Boys wonder how many bricks numbered no less than *a* and no greater than *b* are painted both red and pink. This is exactly your task: compute and print the answer to the question.
Input Specification:
The input will have a single line containing four integers in this order: *x*, *y*, *a*, *b*. (1<=≤<=*x*,<=*y*<=≤<=1000, 1<=≤<=*a*,<=*b*<=≤<=2·109, *a*<=≤<=*b*).
Output Specification:
Output a single integer — the number of bricks numbered no less than *a* and no greater than *b* that are painted both red and pink.
Demo Input:
['2 3 6 18\n']
Demo Output:
['3']
Note:
Let's look at the bricks from *a* to *b* (*a* = 6, *b* = 18). The bricks colored in red are numbered 6, 8, 10, 12, 14, 16, 18. The bricks colored in pink are numbered 6, 9, 12, 15, 18. The bricks colored in both red and pink are numbered with 6, 12 and 18. | ```python
x,y,a,b=map(int,input().split())
def gcd(x,y):
if (x%y==0):
return y
else:
return(gcd(y,x%y))
n=gcd(x,y)
t=x*y/n
s=0
u=((a/t)+1)*t
if(u<b):s=int((b-u)/t)+1
if a%t==0:s+=1
print(s)
``` | 0 |
|
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square. | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,659,432,646 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 31 | 0 | import math as m
a,b,c=map(int,input().split())
n=m.ceil(a/c)+(m.ceil(a/c))*m.ceil(abs(a-c)/c)
print(n)
| Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none | ```python
import math as m
a,b,c=map(int,input().split())
n=m.ceil(a/c)+(m.ceil(a/c))*m.ceil(abs(a-c)/c)
print(n)
``` | 0 |
61 | A | Ultra-Fast Mathematician | PROGRAMMING | 800 | [
"implementation"
] | A. Ultra-Fast Mathematician | 2 | 256 | Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate. | There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. | Write one line — the corresponding answer. Do not omit the leading 0s. | [
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] | [
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] | none | 500 | [
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "10\n01",
"output": "11"
},
{
"input": "00111111\n11011101",
"output": "11100010"
},
{
"input": "011001100\n101001010",
"output": "110000110"
},
{
"input": "1100100001\n0110101100",
"output": "1010001101"
},
{
"input": "00011101010\n10010100101",
"output": "10001001111"
},
{
"input": "100000101101\n111010100011",
"output": "011010001110"
},
{
"input": "1000001111010\n1101100110001",
"output": "0101101001011"
},
{
"input": "01011111010111\n10001110111010",
"output": "11010001101101"
},
{
"input": "110010000111100\n001100101011010",
"output": "111110101100110"
},
{
"input": "0010010111110000\n0000000011010110",
"output": "0010010100100110"
},
{
"input": "00111110111110000\n01111100001100000",
"output": "01000010110010000"
},
{
"input": "101010101111010001\n001001111101111101",
"output": "100011010010101100"
},
{
"input": "0110010101111100000\n0011000101000000110",
"output": "0101010000111100110"
},
{
"input": "11110100011101010111\n00001000011011000000",
"output": "11111100000110010111"
},
{
"input": "101010101111101101001\n111010010010000011111",
"output": "010000111101101110110"
},
{
"input": "0000111111100011000010\n1110110110110000001010",
"output": "1110001001010011001000"
},
{
"input": "10010010101000110111000\n00101110100110111000111",
"output": "10111100001110001111111"
},
{
"input": "010010010010111100000111\n100100111111100011001110",
"output": "110110101101011111001001"
},
{
"input": "0101110100100111011010010\n0101100011010111001010001",
"output": "0000010111110000010000011"
},
{
"input": "10010010100011110111111011\n10000110101100000001000100",
"output": "00010100001111110110111111"
},
{
"input": "000001111000000100001000000\n011100111101111001110110001",
"output": "011101000101111101111110001"
},
{
"input": "0011110010001001011001011100\n0000101101000011101011001010",
"output": "0011011111001010110010010110"
},
{
"input": "11111000000000010011001101111\n11101110011001010100010000000",
"output": "00010110011001000111011101111"
},
{
"input": "011001110000110100001100101100\n001010000011110000001000101001",
"output": "010011110011000100000100000101"
},
{
"input": "1011111010001100011010110101111\n1011001110010000000101100010101",
"output": "0000110100011100011111010111010"
},
{
"input": "10111000100001000001010110000001\n10111000001100101011011001011000",
"output": "00000000101101101010001111011001"
},
{
"input": "000001010000100001000000011011100\n111111111001010100100001100000111",
"output": "111110101001110101100001111011011"
},
{
"input": "1101000000000010011011101100000110\n1110000001100010011010000011011110",
"output": "0011000001100000000001101111011000"
},
{
"input": "01011011000010100001100100011110001\n01011010111000001010010100001110000",
"output": "00000001111010101011110000010000001"
},
{
"input": "000011111000011001000110111100000100\n011011000110000111101011100111000111",
"output": "011000111110011110101101011011000011"
},
{
"input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000",
"output": "1011001001111001001011101010101000010"
},
{
"input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011",
"output": "10001110000010101110000111000011111110"
},
{
"input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100",
"output": "000100001011110000011101110111010001110"
},
{
"input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001",
"output": "1101110101010110000011000000101011110011"
},
{
"input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100",
"output": "11001011110010010000010111001100001001110"
},
{
"input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110",
"output": "001100101000011111111101111011101010111001"
},
{
"input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001",
"output": "0111010010100110110101100010000100010100000"
},
{
"input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100",
"output": "11111110000000100101000100110111001100011001"
},
{
"input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011",
"output": "101011011100100010100011011001101010100100010"
},
{
"input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001",
"output": "1101001100111011010111110110101111001011110111"
},
{
"input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001",
"output": "10010101000101000000011010011110011110011110001"
},
{
"input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100",
"output": "011011011100000000010101110010000000101000111101"
},
{
"input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100",
"output": "0101010111101001011011110110011101010101010100011"
},
{
"input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011",
"output": "11001011010010111000010110011101100100001110111111"
},
{
"input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011",
"output": "111011101010011100001111101001101011110010010110001"
},
{
"input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001",
"output": "0100111110110011111110010010010000110111100101101101"
},
{
"input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100",
"output": "01011001110111010111001100010011010100010000111011000"
},
{
"input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111",
"output": "100011101001001000011011011001111000100000010100100100"
},
{
"input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110",
"output": "1100110010000101101010111111101001001001110101110010110"
},
{
"input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110",
"output": "01000111100111001011110010100011111111110010101100001101"
},
{
"input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010",
"output": "110001010001000011000101110101000100001011111001011001001"
},
{
"input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111",
"output": "1110100010111000101001001011101110011111100111000011011011"
},
{
"input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110",
"output": "01110110101110100100110011010000001000101100101111000111011"
},
{
"input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011",
"output": "111100101000000011101011011001110010101111000110010010000000"
},
{
"input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111",
"output": "0100100010111110010011101010000011111110001110010110010111001"
},
{
"input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111",
"output": "00110100000011001101101100100010110010001100000001100110011101"
},
{
"input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011",
"output": "000000011000111011110011101000010000010100101000000011010110010"
},
{
"input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010",
"output": "0010100110110100111100100100101101010100100111011010001001010101"
},
{
"input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111",
"output": "11010110111100101111101001100001110100010110010110110111100110100"
},
{
"input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111",
"output": "111111010011011100101110100110111111111001111110011010111111110000"
},
{
"input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110",
"output": "1010101010100010001001001001100000111000010010010100010011000100000"
},
{
"input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000",
"output": "00011111011111001000011100010011100011010100101011011000001001111110"
},
{
"input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111",
"output": "001111000011001110100111010101111111011100110011001010010010000111011"
},
{
"input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101",
"output": "0110001100110100010000110111000010011010011000011001010011010100010100"
},
{
"input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010",
"output": "00010000000110110101000011001000000100100110111010011111101010001010000"
},
{
"input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001",
"output": "000100100000000110011100100001010110101001100101110010010011111001110111"
},
{
"input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000",
"output": "1000111100010011010110011101000000101010101100011111100001101111001010010"
},
{
"input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011",
"output": "01000010011110111001011011110000001011000111101101101010010110001010100100"
},
{
"input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101",
"output": "101101110110110010011100001011111100100001110000101100110000100011011100110"
},
{
"input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001",
"output": "1110111111110010111000001100101010101011010100101010100101100011001001111111"
},
{
"input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111",
"output": "10111011000111000101110100101000100111011011100011110110000101010001111010111"
},
{
"input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110",
"output": "110100100110000101010010011010011001100110000111010000010100001011110111111101"
},
{
"input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111",
"output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111"
},
{
"input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001",
"output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001"
},
{
"input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110",
"output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011"
},
{
"input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111",
"output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101"
},
{
"input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010",
"output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101"
},
{
"input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000",
"output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001"
},
{
"input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011",
"output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110"
},
{
"input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011",
"output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011"
},
{
"input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011",
"output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011"
},
{
"input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010",
"output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011"
},
{
"input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001",
"output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110"
},
{
"input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111",
"output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010"
},
{
"input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011",
"output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011"
},
{
"input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100",
"output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000"
},
{
"input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001",
"output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101"
},
{
"input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110",
"output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101"
},
{
"input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011",
"output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110"
},
{
"input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111",
"output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110"
},
{
"input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000",
"output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001"
},
{
"input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010",
"output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101"
},
{
"input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101",
"output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011"
},
{
"input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011",
"output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010",
"output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "0\n1",
"output": "1"
}
] | 1,638,549,833 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 30 | 0 | n,p = input()
s = ''
for i in range(100):
if p[i] != n[i]:
s+=1
else:
s+=0
print(s) | Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line — the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none | ```python
n,p = input()
s = ''
for i in range(100):
if p[i] != n[i]:
s+=1
else:
s+=0
print(s)
``` | -1 |
454 | B | Little Pony and Sort by Shift | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence? | The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105). | If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it. | [
"2\n2 1\n",
"3\n1 3 2\n",
"2\n1 2\n"
] | [
"1\n",
"-1\n",
"0\n"
] | none | 1,000 | [
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "3\n1 3 2",
"output": "-1"
},
{
"input": "2\n1 2",
"output": "0"
},
{
"input": "6\n3 4 5 6 3 2",
"output": "-1"
},
{
"input": "3\n1 2 1",
"output": "1"
},
{
"input": "5\n1 1 2 1 1",
"output": "2"
},
{
"input": "4\n5 4 5 4",
"output": "-1"
},
{
"input": "7\n3 4 5 5 5 1 2",
"output": "2"
},
{
"input": "5\n2 2 1 2 2",
"output": "3"
},
{
"input": "5\n5 4 1 2 3",
"output": "-1"
},
{
"input": "4\n6 1 2 7",
"output": "-1"
},
{
"input": "5\n4 5 6 2 3",
"output": "2"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "4\n1 2 2 1",
"output": "1"
},
{
"input": "9\n4 5 6 7 1 2 3 4 10",
"output": "-1"
},
{
"input": "7\n2 3 4 1 2 3 4",
"output": "-1"
},
{
"input": "6\n1 2 1 2 1 2",
"output": "-1"
},
{
"input": "3\n3 2 1",
"output": "-1"
},
{
"input": "4\n1 4 4 1",
"output": "1"
},
{
"input": "5\n1 2 1 1 1",
"output": "3"
},
{
"input": "5\n4 6 7 3 5",
"output": "-1"
},
{
"input": "4\n2 3 1 4",
"output": "-1"
},
{
"input": "5\n5 4 3 2 1",
"output": "-1"
},
{
"input": "4\n2 4 1 4",
"output": "-1"
},
{
"input": "6\n4 5 6 1 2 7",
"output": "-1"
},
{
"input": "6\n1 2 3 1 1 1",
"output": "3"
},
{
"input": "5\n1 3 3 3 1",
"output": "1"
},
{
"input": "6\n5 6 7 5 5 5",
"output": "3"
},
{
"input": "5\n3 4 2 1 2",
"output": "-1"
},
{
"input": "3\n3 4 2",
"output": "1"
},
{
"input": "6\n1 1 2 2 1 1",
"output": "2"
},
{
"input": "4\n2 3 4 2",
"output": "1"
},
{
"input": "5\n3 5 7 7 3",
"output": "1"
},
{
"input": "4\n1 1 4 1",
"output": "1"
},
{
"input": "7\n1 5 6 1 1 1 1",
"output": "4"
},
{
"input": "5\n7 8 6 7 8",
"output": "-1"
},
{
"input": "4\n2 4 1 3",
"output": "-1"
}
] | 1,665,489,825 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 56 | 93 | 13,516,800 | n = int(input())
arr = list(map(int, input().split()))
ind = -2
for i in range(n):
if arr[(i+1)%n]>=arr[i%n]:
continue
else:
if ind == -2:
ind = i
else:
ind = -4
break
if ind == -4:
print(-1)
elif ind == -2:
print(0)
else:
print(n-ind-1) | Title: Little Pony and Sort by Shift
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence?
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105).
Output Specification:
If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it.
Demo Input:
['2\n2 1\n', '3\n1 3 2\n', '2\n1 2\n']
Demo Output:
['1\n', '-1\n', '0\n']
Note:
none | ```python
n = int(input())
arr = list(map(int, input().split()))
ind = -2
for i in range(n):
if arr[(i+1)%n]>=arr[i%n]:
continue
else:
if ind == -2:
ind = i
else:
ind = -4
break
if ind == -4:
print(-1)
elif ind == -2:
print(0)
else:
print(n-ind-1)
``` | 3 |
|
702 | A | Maximum Increase | PROGRAMMING | 800 | [
"dp",
"greedy",
"implementation"
] | null | null | You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous. | The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print the maximum length of an increasing subarray of the given array. | [
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] | [
"3\n",
"1\n",
"3\n"
] | none | 0 | [
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 799843967 446173607 796619138 402690754",
"output": "3"
},
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "5\n1 2 3 3 4",
"output": "3"
},
{
"input": "4\n1 2 2 3",
"output": "2"
},
{
"input": "3\n2 1 1",
"output": "1"
},
{
"input": "3\n1 2 1",
"output": "2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 1 2",
"output": "2"
},
{
"input": "11\n1 2 3 1 2 3 2 1 2 3 4",
"output": "4"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "9\n1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "3\n3 2 1",
"output": "1"
},
{
"input": "7\n1 2 3 4 5 6 7",
"output": "7"
},
{
"input": "1\n1234394",
"output": "1"
}
] | 1,678,782,796 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | n = int(input())
array = list(map(int,input().split()))
subarray = [array[-1]]
for i in range(n-2, -1, -1):
num = array[i]
if num < subarray[-1]:
subarray.append(num)
if (len(subarray) > 1 and subarray[-2] > num > subarray[-1]) \
or (len(subarray) == 1 and num > subarray[-1]):
subarray[-1] = num
print(len(subarray))
| Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
Input Specification:
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print the maximum length of an increasing subarray of the given array.
Demo Input:
['5\n1 7 2 11 15\n', '6\n100 100 100 100 100 100\n', '3\n1 2 3\n']
Demo Output:
['3\n', '1\n', '3\n']
Note:
none | ```python
n = int(input())
array = list(map(int,input().split()))
subarray = [array[-1]]
for i in range(n-2, -1, -1):
num = array[i]
if num < subarray[-1]:
subarray.append(num)
if (len(subarray) > 1 and subarray[-2] > num > subarray[-1]) \
or (len(subarray) == 1 and num > subarray[-1]):
subarray[-1] = num
print(len(subarray))
``` | 0 |
|
27 | A | Next Test | PROGRAMMING | 1,200 | [
"implementation",
"sortings"
] | A. Next Test | 2 | 256 | «Polygon» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests. | The first line contains one integer *n* (1<=≤<=*n*<=≤<=3000) — the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=3000) — indexes of these tests. | Output the required default value for the next test index. | [
"3\n1 7 2\n"
] | [
"3\n"
] | none | 500 | [
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n2 1",
"output": "3"
},
{
"input": "3\n3 4 1",
"output": "2"
},
{
"input": "4\n6 4 3 5",
"output": "1"
},
{
"input": "5\n3 2 1 7 4",
"output": "5"
},
{
"input": "6\n4 1 2 5 3 7",
"output": "6"
},
{
"input": "7\n3 2 1 6 5 7 4",
"output": "8"
},
{
"input": "8\n2 8 3 7 6 9 1 5",
"output": "4"
},
{
"input": "9\n10 5 9 3 8 7 1 2 4",
"output": "6"
},
{
"input": "10\n7 2 3 8 9 6 5 4 1 10",
"output": "11"
},
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n1 2",
"output": "3"
},
{
"input": "3\n2 4 1",
"output": "3"
},
{
"input": "4\n4 2 3 1",
"output": "5"
},
{
"input": "5\n3 1 4 2 5",
"output": "6"
},
{
"input": "6\n1 3 6 7 2 4",
"output": "5"
},
{
"input": "7\n1 5 4 7 2 3 6",
"output": "8"
},
{
"input": "8\n12 1 6 5 2 8 3 4",
"output": "7"
},
{
"input": "9\n3 2 7 5 6 4 1 9 10",
"output": "8"
},
{
"input": "10\n1 7 13 6 5 10 3 8 2 4",
"output": "9"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n3",
"output": "1"
},
{
"input": "1\n3000",
"output": "1"
},
{
"input": "2\n2 3",
"output": "1"
},
{
"input": "2\n3000 1",
"output": "2"
}
] | 1,585,848,225 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 22 | 218 | 409,600 | n = int(input())
arr = [int(x) for x in str(input()).split()]
s = set(x for x in range(1,3000))
for el in arr:
s.discard(el)
print(min(s))
| Title: Next Test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
«Polygon» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests.
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=3000) — the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=3000) — indexes of these tests.
Output Specification:
Output the required default value for the next test index.
Demo Input:
['3\n1 7 2\n']
Demo Output:
['3\n']
Note:
none | ```python
n = int(input())
arr = [int(x) for x in str(input()).split()]
s = set(x for x in range(1,3000))
for el in arr:
s.discard(el)
print(min(s))
``` | -1 |
0 | none | none | none | 0 | [
"none"
] | null | null | Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days. | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out. | Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days. | [
"4\n1 3 2 0\n",
"7\n1 3 3 2 1 2 3\n",
"2\n2 2\n"
] | [
"2\n",
"0\n",
"1\n"
] | In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | 0 | [
{
"input": "4\n1 3 2 0",
"output": "2"
},
{
"input": "7\n1 3 3 2 1 2 3",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "10\n0 0 1 1 0 0 0 0 1 0",
"output": "8"
},
{
"input": "100\n3 2 3 3 3 2 3 1 3 2 2 3 2 3 3 3 3 3 3 1 2 2 3 1 3 3 2 2 2 3 1 0 3 3 3 2 3 3 1 1 3 1 3 3 3 1 3 1 3 0 1 3 2 3 2 1 1 3 2 3 3 3 2 3 1 3 3 3 3 2 2 2 1 3 1 3 3 3 3 1 3 2 3 3 0 3 3 3 3 3 1 0 2 1 3 3 0 2 3 3",
"output": "16"
},
{
"input": "10\n2 3 0 1 3 1 2 2 1 0",
"output": "3"
},
{
"input": "45\n3 3 2 3 2 3 3 3 0 3 3 3 3 3 3 3 1 3 2 3 2 3 2 2 2 3 2 3 3 3 3 3 1 2 3 3 2 2 2 3 3 3 3 1 3",
"output": "6"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "1\n2",
"output": "0"
},
{
"input": "1\n3",
"output": "0"
},
{
"input": "2\n1 1",
"output": "1"
},
{
"input": "2\n1 3",
"output": "0"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "2\n0 0",
"output": "2"
},
{
"input": "2\n3 3",
"output": "0"
},
{
"input": "3\n3 3 3",
"output": "0"
},
{
"input": "2\n3 2",
"output": "0"
},
{
"input": "2\n0 2",
"output": "1"
},
{
"input": "10\n2 2 3 3 3 3 2 1 3 2",
"output": "2"
},
{
"input": "15\n0 1 0 0 0 2 0 1 0 0 0 2 0 0 0",
"output": "11"
},
{
"input": "15\n1 3 2 2 2 3 3 3 3 2 3 2 2 1 1",
"output": "4"
},
{
"input": "15\n3 1 3 2 3 2 2 2 3 3 3 3 2 3 2",
"output": "3"
},
{
"input": "20\n0 2 0 1 0 0 0 1 2 0 1 1 1 0 1 1 0 1 1 0",
"output": "12"
},
{
"input": "20\n2 3 2 3 3 3 3 2 0 3 1 1 2 3 0 3 2 3 0 3",
"output": "5"
},
{
"input": "20\n3 3 3 3 2 3 3 2 1 3 3 2 2 2 3 2 2 2 2 2",
"output": "4"
},
{
"input": "25\n0 0 1 0 0 1 0 0 1 0 0 1 0 2 0 0 2 0 0 1 0 2 0 1 1",
"output": "16"
},
{
"input": "25\n1 3 3 2 2 3 3 3 3 3 1 2 2 3 2 0 2 1 0 1 3 2 2 3 3",
"output": "5"
},
{
"input": "25\n2 3 1 3 3 2 1 3 3 3 1 3 3 1 3 2 3 3 1 3 3 3 2 3 3",
"output": "3"
},
{
"input": "30\n0 0 1 0 1 0 1 1 0 0 0 0 0 0 1 0 0 1 1 0 0 2 0 0 1 1 2 0 0 0",
"output": "22"
},
{
"input": "30\n1 1 3 2 2 0 3 2 3 3 1 2 0 1 1 2 3 3 2 3 1 3 2 3 0 2 0 3 3 2",
"output": "9"
},
{
"input": "30\n1 2 3 2 2 3 3 3 3 3 3 3 3 3 3 1 2 2 3 2 3 3 3 2 1 3 3 3 1 3",
"output": "2"
},
{
"input": "35\n0 1 1 0 0 2 0 0 1 0 0 0 1 0 1 0 1 0 0 0 1 2 1 0 2 2 1 0 1 0 1 1 1 0 0",
"output": "21"
},
{
"input": "35\n2 2 0 3 2 2 0 3 3 1 1 3 3 1 2 2 0 2 2 2 2 3 1 0 2 1 3 2 2 3 2 3 3 1 2",
"output": "11"
},
{
"input": "35\n1 2 2 3 3 3 3 3 2 2 3 3 2 3 3 2 3 2 3 3 2 2 2 3 3 2 3 3 3 1 3 3 2 2 2",
"output": "7"
},
{
"input": "40\n2 0 1 1 0 0 0 0 2 0 1 1 1 0 0 1 0 0 0 0 0 2 0 0 0 2 1 1 1 3 0 0 0 0 0 0 0 1 1 0",
"output": "28"
},
{
"input": "40\n2 2 3 2 0 2 3 2 1 2 3 0 2 3 2 1 1 3 1 1 0 2 3 1 3 3 1 1 3 3 2 2 1 3 3 3 2 3 3 1",
"output": "10"
},
{
"input": "40\n1 3 2 3 3 2 3 3 2 2 3 1 2 1 2 2 3 1 2 2 1 2 2 2 1 2 2 3 2 3 2 3 2 3 3 3 1 3 2 3",
"output": "8"
},
{
"input": "45\n2 1 0 0 0 2 1 0 1 0 0 2 2 1 1 0 0 2 0 0 0 0 0 0 1 0 0 2 0 0 1 1 0 0 1 0 0 1 1 2 0 0 2 0 2",
"output": "29"
},
{
"input": "45\n3 3 2 3 3 3 2 2 3 2 3 1 3 2 3 2 2 1 1 3 2 3 2 1 3 1 2 3 2 2 0 3 3 2 3 2 3 2 3 2 0 3 1 1 3",
"output": "8"
},
{
"input": "50\n3 0 0 0 2 0 0 0 0 0 0 0 2 1 0 2 0 1 0 1 3 0 2 1 1 0 0 1 1 0 0 1 2 1 1 2 1 1 0 0 0 0 0 0 0 1 2 2 0 0",
"output": "32"
},
{
"input": "50\n3 3 3 3 1 0 3 3 0 2 3 1 1 1 3 2 3 3 3 3 3 1 0 1 2 2 3 3 2 3 0 0 0 2 1 0 1 2 2 2 2 0 2 2 2 1 2 3 3 2",
"output": "16"
},
{
"input": "50\n3 2 3 1 2 1 2 3 3 2 3 3 2 1 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 2 3 3 3 3 2 3 1 2 3 3 2 3 3 1 2 2 1 1 3 3",
"output": "7"
},
{
"input": "55\n0 0 1 1 0 1 0 0 1 0 1 0 0 0 2 0 0 1 0 0 0 1 0 0 0 0 3 1 0 0 0 1 0 0 0 0 2 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 2 0 0",
"output": "40"
},
{
"input": "55\n3 0 3 3 3 2 0 2 3 0 3 2 3 3 0 3 3 1 3 3 1 2 3 2 0 3 3 2 1 2 3 2 3 0 3 2 2 1 2 3 2 2 1 3 2 2 3 1 3 2 2 3 3 2 2",
"output": "13"
},
{
"input": "55\n3 3 1 3 2 3 2 3 2 2 3 3 3 3 3 1 1 3 3 2 3 2 3 2 0 1 3 3 3 3 2 3 2 3 1 1 2 2 2 3 3 3 3 3 2 2 2 3 2 3 3 3 3 1 3",
"output": "7"
},
{
"input": "60\n0 1 0 0 0 0 0 0 0 2 1 1 3 0 0 0 0 0 1 0 1 1 0 0 0 3 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 0",
"output": "44"
},
{
"input": "60\n3 2 1 3 2 2 3 3 3 1 1 3 2 2 3 3 1 3 2 2 3 3 2 2 2 2 0 2 2 3 2 3 0 3 3 3 2 3 3 0 1 3 2 1 3 1 1 2 1 3 1 1 2 2 1 3 3 3 2 2",
"output": "15"
},
{
"input": "60\n3 2 2 3 2 3 2 3 3 2 3 2 3 3 2 3 3 3 3 3 3 2 3 3 1 2 3 3 3 2 1 3 3 1 3 1 3 0 3 3 3 2 3 2 3 2 3 3 1 1 2 3 3 3 3 2 1 3 2 3",
"output": "8"
},
{
"input": "65\n1 0 2 1 1 0 1 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 1 2 0 2 1 0 2 1 0 1 0 1 1 0 1 1 1 2 1 0 1 0 0 0 0 1 2 2 1 0 0 1 2 1 2 0 2 0 0 0 1 1",
"output": "35"
},
{
"input": "65\n2 2 2 3 0 2 1 2 3 3 1 3 1 2 1 3 2 3 2 2 2 1 2 0 3 1 3 1 1 3 1 3 3 3 3 3 1 3 0 3 1 3 1 2 2 3 2 0 3 1 3 2 1 2 2 2 3 3 2 3 3 3 2 2 3",
"output": "13"
},
{
"input": "65\n3 2 3 3 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 3 3 2 2 2 3 3 2 3 3 2 3 3 3 3 2 3 3 3 2 2 3 3 3 3 3 3 2 2 3 3 2 3 3 1 3 3 3 3",
"output": "6"
},
{
"input": "70\n1 0 0 0 1 0 1 0 0 0 1 1 0 1 0 0 1 1 1 0 1 1 0 0 1 1 1 3 1 1 0 1 2 0 2 1 0 0 0 1 1 1 1 1 0 0 1 0 0 0 1 1 1 3 0 0 1 0 0 0 1 0 0 0 0 0 1 0 1 1",
"output": "43"
},
{
"input": "70\n2 3 3 3 1 3 3 1 2 1 1 2 2 3 0 2 3 3 1 3 3 2 2 3 3 3 2 2 2 2 1 3 3 0 2 1 1 3 2 3 3 2 2 3 1 3 1 2 3 2 3 3 2 2 2 3 1 1 2 1 3 3 2 2 3 3 3 1 1 1",
"output": "16"
},
{
"input": "70\n3 3 2 2 1 2 1 2 2 2 2 2 3 3 2 3 3 3 3 2 2 2 2 3 3 3 1 3 3 3 2 3 3 3 3 2 3 3 1 3 1 3 2 3 3 2 3 3 3 2 3 2 3 3 1 2 3 3 2 2 2 3 2 3 3 3 3 3 3 1",
"output": "10"
},
{
"input": "75\n1 0 0 1 1 0 0 1 0 1 2 0 0 2 1 1 0 0 0 0 0 0 2 1 1 0 0 0 0 1 0 1 0 1 1 1 0 1 0 0 1 0 0 0 0 0 0 1 1 0 0 1 2 1 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 1 1 0 1 0",
"output": "51"
},
{
"input": "75\n1 3 3 3 1 1 3 2 3 3 1 3 3 3 2 1 3 2 2 3 1 1 1 1 1 1 2 3 3 3 3 3 3 2 3 3 3 3 3 2 3 3 2 2 2 1 2 3 3 2 2 3 0 1 1 3 3 0 0 1 1 3 2 3 3 3 3 1 2 2 3 3 3 3 1",
"output": "16"
},
{
"input": "75\n3 3 3 3 2 2 3 2 2 3 2 2 1 2 3 3 2 2 3 3 1 2 2 2 1 3 3 3 1 2 2 3 3 3 2 3 2 2 2 3 3 1 3 2 2 3 3 3 0 3 2 1 3 3 2 3 3 3 3 1 2 3 3 3 2 2 3 3 3 3 2 2 3 3 1",
"output": "11"
},
{
"input": "80\n0 0 0 0 2 0 1 1 1 1 1 0 0 0 0 2 0 0 1 0 0 0 0 1 1 0 2 2 1 1 0 1 0 1 0 1 1 1 0 1 2 1 1 0 0 0 1 1 0 1 1 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 2 2 0 1 1 0 0 0 0 0 0 0 0 1",
"output": "56"
},
{
"input": "80\n2 2 3 3 2 1 0 1 0 3 2 2 3 2 1 3 1 3 3 2 3 3 3 2 3 3 3 2 1 3 3 1 3 3 3 3 3 3 2 2 2 1 3 2 1 3 2 1 1 0 1 1 2 1 3 0 1 2 3 2 2 3 2 3 1 3 3 2 1 1 0 3 3 3 3 1 2 1 2 0",
"output": "17"
},
{
"input": "80\n2 3 3 2 2 2 3 3 2 3 3 3 3 3 2 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 1 3 2 3 3 0 3 1 2 3 3 1 2 3 2 3 3 2 3 3 3 3 3 2 2 3 0 3 3 3 3 3 2 2 3 2 3 3 3 3 3 2 3 2 3 3 3 3 2 3",
"output": "9"
},
{
"input": "85\n0 1 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 1 0 0 2 0 1 1 0 0 0 0 2 2 0 0 0 1 0 0 0 1 2 0 1 0 0 0 2 1 1 2 0 3 1 0 2 2 1 0 0 1 1 0 0 0 0 1 0 2 1 1 2 1 0 0 1 2 1 2 0 0 1 0 1 0",
"output": "54"
},
{
"input": "85\n2 3 1 3 2 3 1 3 3 2 1 2 1 2 2 3 2 2 3 2 0 3 3 2 1 2 2 2 3 3 2 3 3 3 2 1 1 3 1 3 2 2 2 3 3 2 3 2 3 1 1 3 2 3 1 3 3 2 3 3 2 2 3 0 1 1 2 2 2 2 1 2 3 1 3 3 1 3 2 2 3 2 3 3 3",
"output": "19"
},
{
"input": "85\n1 2 1 2 3 2 3 3 3 3 3 3 3 2 1 3 2 3 3 3 3 2 3 3 3 1 3 3 3 3 2 3 3 3 3 3 3 2 2 1 3 3 3 3 2 2 3 1 1 2 3 3 3 2 3 3 3 3 3 2 3 3 3 2 2 3 3 1 1 1 3 3 3 3 1 3 3 3 1 3 3 1 3 2 3",
"output": "9"
},
{
"input": "90\n2 0 1 0 0 0 0 0 0 1 1 2 0 0 0 0 0 0 0 2 2 0 2 0 0 2 1 0 2 0 1 0 1 0 0 1 2 2 0 0 1 0 0 1 0 1 0 2 0 1 1 1 0 1 1 0 1 0 2 0 1 0 1 0 0 0 1 0 0 1 2 0 0 0 1 0 0 2 2 0 0 0 0 0 1 3 1 1 0 1",
"output": "57"
},
{
"input": "90\n2 3 3 3 2 3 2 1 3 0 3 2 3 3 2 1 3 3 2 3 2 3 3 2 1 3 1 3 3 1 2 2 3 3 2 1 2 3 2 3 0 3 3 2 2 3 1 0 3 3 1 3 3 3 3 2 1 2 2 1 3 2 1 3 3 1 2 0 2 2 3 2 2 3 3 3 1 3 2 1 2 3 3 2 3 2 3 3 2 1",
"output": "17"
},
{
"input": "90\n2 3 2 3 2 2 3 3 2 3 2 1 2 3 3 3 2 3 2 3 3 2 3 3 3 1 3 3 1 3 2 3 2 2 1 3 3 3 3 3 3 3 3 3 3 2 3 2 3 2 1 3 3 3 3 2 2 3 3 3 3 3 3 3 3 3 3 3 3 2 2 3 3 3 3 1 3 2 3 3 3 2 2 3 2 3 2 1 3 2",
"output": "9"
},
{
"input": "95\n0 0 3 0 2 0 1 0 0 2 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 2 1 0 0 1 0 0 0 1 0 0 0 0 1 0 1 0 0 1 0 1 2 0 1 2 2 0 0 1 0 2 0 0 0 1 0 2 1 2 1 0 1 0 0 0 1 0 0 1 1 2 1 1 1 1 2 0 0 0 0 0 1 1 0 1",
"output": "61"
},
{
"input": "95\n2 3 3 2 1 1 3 3 3 2 3 3 3 2 3 2 3 3 3 2 3 2 2 3 3 2 1 2 3 3 3 1 3 0 3 3 1 3 3 1 0 1 3 3 3 0 2 1 3 3 3 3 0 1 3 2 3 3 2 1 3 1 2 1 1 2 3 0 3 3 2 1 3 2 1 3 3 3 2 2 3 2 3 3 3 2 1 3 3 3 2 3 3 1 2",
"output": "15"
},
{
"input": "95\n2 3 3 2 3 2 2 1 3 1 2 1 2 3 1 2 3 3 1 3 3 3 1 2 3 2 2 2 2 3 3 3 2 2 3 3 3 3 3 1 2 2 3 3 3 3 2 3 2 2 2 3 3 2 3 3 3 3 3 3 3 0 3 2 0 3 3 1 3 3 3 2 3 2 3 2 3 3 3 3 2 2 1 1 3 3 3 3 3 1 3 3 3 3 2",
"output": "14"
},
{
"input": "100\n1 0 2 0 0 0 0 2 0 0 0 1 0 1 0 0 1 0 1 2 0 1 1 0 0 1 0 1 1 0 0 0 2 0 1 0 0 2 0 0 0 0 0 1 1 1 0 0 1 0 2 0 0 0 0 1 0 1 0 1 0 1 0 1 2 2 0 0 2 0 1 0 1 0 1 0 0 0 1 0 0 2 1 1 1 0 0 1 0 0 0 2 0 0 2 1 1 0 0 2",
"output": "63"
},
{
"input": "100\n3 2 1 3 2 3 2 3 2 2 3 1 3 3 3 3 3 2 2 3 2 2 3 2 3 3 3 2 3 1 2 1 3 3 3 3 1 3 3 3 3 3 2 3 2 1 3 3 1 2 2 3 1 3 3 1 2 2 1 3 1 3 2 2 3 3 1 3 2 3 1 2 1 2 3 3 2 2 1 2 3 3 3 3 3 1 3 3 3 3 2 1 3 0 3 3 3 2 3 3",
"output": "15"
},
{
"input": "100\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "0"
},
{
"input": "100\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "0"
},
{
"input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
},
{
"input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "50"
},
{
"input": "99\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "49"
},
{
"input": "100\n2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1",
"output": "0"
},
{
"input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
"output": "100"
},
{
"input": "2\n0 3",
"output": "1"
},
{
"input": "2\n1 0",
"output": "1"
},
{
"input": "2\n1 2",
"output": "0"
},
{
"input": "2\n2 0",
"output": "1"
},
{
"input": "2\n2 1",
"output": "0"
},
{
"input": "2\n2 3",
"output": "0"
},
{
"input": "2\n3 0",
"output": "1"
},
{
"input": "2\n3 1",
"output": "0"
},
{
"input": "100\n3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0",
"output": "50"
}
] | 1,690,503,168 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 30 | 0 | print("_RANDOM_GUESS_1690503168.0330718")# 1690503168.0330935 | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out.
Output Specification:
Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days.
Demo Input:
['4\n1 3 2 0\n', '7\n1 3 3 2 1 2 3\n', '2\n2 2\n']
Demo Output:
['2\n', '0\n', '1\n']
Note:
In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | ```python
print("_RANDOM_GUESS_1690503168.0330718")# 1690503168.0330935
``` | 0 |
|
959 | A | Mahmoud and Ehab and the even-odd game | PROGRAMMING | 800 | [
"games",
"math"
] | null | null | Mahmoud and Ehab play a game called the even-odd game. Ehab chooses his favorite integer *n* and then they take turns, starting from Mahmoud. In each player's turn, he has to choose an integer *a* and subtract it from *n* such that:
- 1<=≤<=*a*<=≤<=*n*. - If it's Mahmoud's turn, *a* has to be even, but if it's Ehab's turn, *a* has to be odd.
If the current player can't choose any number satisfying the conditions, he loses. Can you determine the winner if they both play optimally? | The only line contains an integer *n* (1<=≤<=*n*<=≤<=109), the number at the beginning of the game. | Output "Mahmoud" (without quotes) if Mahmoud wins and "Ehab" (without quotes) otherwise. | [
"1\n",
"2\n"
] | [
"Ehab",
"Mahmoud"
] | In the first sample, Mahmoud can't choose any integer *a* initially because there is no positive even integer less than or equal to 1 so Ehab wins.
In the second sample, Mahmoud has to choose *a* = 2 and subtract it from *n*. It's Ehab's turn and *n* = 0. There is no positive odd integer less than or equal to 0 so Mahmoud wins. | 500 | [
{
"input": "1",
"output": "Ehab"
},
{
"input": "2",
"output": "Mahmoud"
},
{
"input": "10000",
"output": "Mahmoud"
},
{
"input": "33333",
"output": "Ehab"
},
{
"input": "5",
"output": "Ehab"
},
{
"input": "1000000000",
"output": "Mahmoud"
},
{
"input": "999999999",
"output": "Ehab"
},
{
"input": "123123123",
"output": "Ehab"
},
{
"input": "22222221",
"output": "Ehab"
},
{
"input": "22222220",
"output": "Mahmoud"
},
{
"input": "3",
"output": "Ehab"
},
{
"input": "4",
"output": "Mahmoud"
},
{
"input": "6",
"output": "Mahmoud"
},
{
"input": "7",
"output": "Ehab"
},
{
"input": "8",
"output": "Mahmoud"
},
{
"input": "9",
"output": "Ehab"
},
{
"input": "10",
"output": "Mahmoud"
},
{
"input": "536870912",
"output": "Mahmoud"
},
{
"input": "536870913",
"output": "Ehab"
},
{
"input": "536870911",
"output": "Ehab"
}
] | 1,669,555,724 | 2,147,483,647 | PyPy 3-64 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | #include <bits/stdc++.h>
#define ll long long
using namespace std;
int main()
{
ll n;
cin>>n;
if (n % 2 == 0){
cout<<"Mahmoud";
}
else{
cout<<"Ehab";
}
return 0;
} | Title: Mahmoud and Ehab and the even-odd game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mahmoud and Ehab play a game called the even-odd game. Ehab chooses his favorite integer *n* and then they take turns, starting from Mahmoud. In each player's turn, he has to choose an integer *a* and subtract it from *n* such that:
- 1<=≤<=*a*<=≤<=*n*. - If it's Mahmoud's turn, *a* has to be even, but if it's Ehab's turn, *a* has to be odd.
If the current player can't choose any number satisfying the conditions, he loses. Can you determine the winner if they both play optimally?
Input Specification:
The only line contains an integer *n* (1<=≤<=*n*<=≤<=109), the number at the beginning of the game.
Output Specification:
Output "Mahmoud" (without quotes) if Mahmoud wins and "Ehab" (without quotes) otherwise.
Demo Input:
['1\n', '2\n']
Demo Output:
['Ehab', 'Mahmoud']
Note:
In the first sample, Mahmoud can't choose any integer *a* initially because there is no positive even integer less than or equal to 1 so Ehab wins.
In the second sample, Mahmoud has to choose *a* = 2 and subtract it from *n*. It's Ehab's turn and *n* = 0. There is no positive odd integer less than or equal to 0 so Mahmoud wins. | ```python
#include <bits/stdc++.h>
#define ll long long
using namespace std;
int main()
{
ll n;
cin>>n;
if (n % 2 == 0){
cout<<"Mahmoud";
}
else{
cout<<"Ehab";
}
return 0;
}
``` | -1 |
|
252 | A | Little Xor | PROGRAMMING | 1,100 | [
"brute force",
"implementation"
] | null | null | Little Petya likes arrays that consist of non-negative integers a lot. Recently his mom has presented him one such array consisting of *n* elements. Petya immediately decided to find there a segment of consecutive elements, such that the *xor* of all numbers from this segment was maximal possible. Help him with that.
The *xor* operation is the bitwise exclusive "OR", that is denoted as "xor" in Pascal and "^" in C/C++/Java. | The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains the space-separated integers from the array. All numbers are non-negative integers strictly less than 230. | Print a single integer — the required maximal *xor* of a segment of consecutive elements. | [
"5\n1 2 1 1 2\n",
"3\n1 2 7\n",
"4\n4 2 4 8\n"
] | [
"3\n",
"7\n",
"14\n"
] | In the first sample one of the optimal segments is the segment that consists of the first and the second array elements, if we consider the array elements indexed starting from one.
The second sample contains only one optimal segment, which contains exactly one array element (element with index three). | 500 | [
{
"input": "5\n1 2 1 1 2",
"output": "3"
},
{
"input": "3\n1 2 7",
"output": "7"
},
{
"input": "4\n4 2 4 8",
"output": "14"
},
{
"input": "5\n1 1 1 1 1",
"output": "1"
},
{
"input": "16\n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15",
"output": "15"
},
{
"input": "20\n1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10",
"output": "15"
},
{
"input": "100\n28 20 67 103 72 81 82 83 7 109 122 30 50 118 83 89 108 82 92 17 97 3 62 12 9 100 14 11 99 106 10 8 60 101 88 119 104 62 76 6 5 57 32 94 60 50 58 97 1 97 107 108 80 24 45 20 112 1 98 106 49 98 25 57 47 90 74 68 14 35 22 10 61 80 10 4 53 13 90 99 57 100 40 84 22 116 60 61 98 57 74 127 61 73 49 51 20 19 56 111",
"output": "127"
},
{
"input": "99\n87 67 4 84 13 20 35 7 11 86 25 1 58 1 74 64 74 86 98 74 72 46 63 78 84 13 60 38 30 45 45 60 9 44 36 70 33 22 82 15 71 7 43 47 23 2 20 49 42 43 54 27 51 51 53 23 27 37 17 66 90 89 61 0 18 20 49 30 84 20 13 32 64 69 56 68 59 10 91 96 43 64 19 10 2 57 62 23 100 39 32 19 95 55 77 19 24 4 77",
"output": "127"
},
{
"input": "1\n100",
"output": "100"
},
{
"input": "2\n1 1",
"output": "1"
},
{
"input": "2\n4 10",
"output": "14"
},
{
"input": "99\n3511 2076 9314 3598 7737 271 4110 4454 5830 8661 8584 8227 2236 2626 1025 3806 3162 2837 6071 9627 1836 7729 6629 4054 9377 3261 1325 8859 3610 7616 5052 9736 1249 6224 7031 6074 4196 8075 4005 5419 5664 8214 4391 731 8714 8622 6122 6976 4057 1770 8025 3778 2792 994 5204 1826 6083 5438 8409 8029 1962 3133 9836 8884 1234 1776 824 1630 6523 2869 9950 8609 5397 1472 7120 5012 6490 5958 8030 7741 5077 2771 7925 9784 9456 8596 6288 8939 4779 4415 3743 5188 5574 9686 1483 4245 4769 4917 1887",
"output": "16383"
},
{
"input": "27\n78 918 443 3900 591 12 4 10 1 24 70 88 429 2 3257 65 275 2 258 62 587 625 25 26 853 728 765",
"output": "4027"
},
{
"input": "2\n3 1",
"output": "3"
},
{
"input": "2\n3 2",
"output": "3"
},
{
"input": "3\n7 3 1",
"output": "7"
},
{
"input": "3\n1 7 2",
"output": "7"
},
{
"input": "2\n7 1",
"output": "7"
},
{
"input": "4\n1 2 7 1",
"output": "7"
},
{
"input": "3\n10 5 1",
"output": "15"
}
] | 1,670,316,185 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 7 | 92 | 0 | import sys
def func_1(num, pos):
pos[0] = int(input())
num = list(map(int, input().split()))
def func_3(num):
max_xor = num[0]
xor = num[0]
l = 0
for r in range(1,len(num)):
xor = xor ^ num[r]
while (xor < num[r]):
xor ^= num[l]
l +=1
if xor > max_xor:
max_xor = xor
return max_xor
pos = int(input())
num = list(map(int, input().split()))
print(func_3(num)) | Title: Little Xor
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Petya likes arrays that consist of non-negative integers a lot. Recently his mom has presented him one such array consisting of *n* elements. Petya immediately decided to find there a segment of consecutive elements, such that the *xor* of all numbers from this segment was maximal possible. Help him with that.
The *xor* operation is the bitwise exclusive "OR", that is denoted as "xor" in Pascal and "^" in C/C++/Java.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array. The second line contains the space-separated integers from the array. All numbers are non-negative integers strictly less than 230.
Output Specification:
Print a single integer — the required maximal *xor* of a segment of consecutive elements.
Demo Input:
['5\n1 2 1 1 2\n', '3\n1 2 7\n', '4\n4 2 4 8\n']
Demo Output:
['3\n', '7\n', '14\n']
Note:
In the first sample one of the optimal segments is the segment that consists of the first and the second array elements, if we consider the array elements indexed starting from one.
The second sample contains only one optimal segment, which contains exactly one array element (element with index three). | ```python
import sys
def func_1(num, pos):
pos[0] = int(input())
num = list(map(int, input().split()))
def func_3(num):
max_xor = num[0]
xor = num[0]
l = 0
for r in range(1,len(num)):
xor = xor ^ num[r]
while (xor < num[r]):
xor ^= num[l]
l +=1
if xor > max_xor:
max_xor = xor
return max_xor
pos = int(input())
num = list(map(int, input().split()))
print(func_3(num))
``` | 0 |
|
817 | C | Really Big Numbers | PROGRAMMING | 1,600 | [
"binary search",
"brute force",
"dp",
"math"
] | null | null | Ivan likes to learn different things about numbers, but he is especially interested in really big numbers. Ivan thinks that a positive integer number *x* is really big if the difference between *x* and the sum of its digits (in decimal representation) is not less than *s*. To prove that these numbers may have different special properties, he wants to know how rare (or not rare) they are — in fact, he needs to calculate the quantity of really big numbers that are not greater than *n*.
Ivan tried to do the calculations himself, but soon realized that it's too difficult for him. So he asked you to help him in calculations. | The first (and the only) line contains two integers *n* and *s* (1<=≤<=*n*,<=*s*<=≤<=1018). | Print one integer — the quantity of really big numbers that are not greater than *n*. | [
"12 1\n",
"25 20\n",
"10 9\n"
] | [
"3\n",
"0\n",
"1\n"
] | In the first example numbers 10, 11 and 12 are really big.
In the second example there are no really big numbers that are not greater than 25 (in fact, the first really big number is 30: 30 - 3 ≥ 20).
In the third example 10 is the only really big number (10 - 1 ≥ 9). | 0 | [
{
"input": "12 1",
"output": "3"
},
{
"input": "25 20",
"output": "0"
},
{
"input": "10 9",
"output": "1"
},
{
"input": "300 1000",
"output": "0"
},
{
"input": "500 1000",
"output": "0"
},
{
"input": "1000 2000",
"output": "0"
},
{
"input": "10000 1000",
"output": "8991"
},
{
"input": "1000000000000000000 1000000000000000000",
"output": "0"
},
{
"input": "1000000000000000000 100000000000000000",
"output": "899999999999999991"
},
{
"input": "1000000000000000000 10000000000000000",
"output": "989999999999999991"
},
{
"input": "1000000000000000000 1000000000000000",
"output": "998999999999999991"
},
{
"input": "1000000000000000000 100000000000000",
"output": "999899999999999991"
},
{
"input": "1000000000000000000 200000000000000000",
"output": "799999999999999991"
},
{
"input": "10 5",
"output": "1"
},
{
"input": "20 5",
"output": "11"
},
{
"input": "20 9",
"output": "11"
},
{
"input": "100 9",
"output": "91"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "130 118",
"output": "1"
},
{
"input": "190 181",
"output": "0"
},
{
"input": "1999 1971",
"output": "10"
},
{
"input": "100 99",
"output": "1"
},
{
"input": "6909094398 719694282",
"output": "6189400069"
},
{
"input": "260 258",
"output": "0"
},
{
"input": "35 19",
"output": "6"
},
{
"input": "100 87",
"output": "1"
},
{
"input": "91 89",
"output": "0"
},
{
"input": "109 89",
"output": "10"
},
{
"input": "109 91",
"output": "10"
},
{
"input": "20331 11580",
"output": "8732"
},
{
"input": "405487470 255750281",
"output": "149737161"
},
{
"input": "17382 12863",
"output": "4493"
},
{
"input": "19725 14457",
"output": "5246"
},
{
"input": "24848 15384",
"output": "9449"
},
{
"input": "25727 15982",
"output": "9728"
},
{
"input": "109 90",
"output": "10"
},
{
"input": "1000000000000000000 999999999999999999",
"output": "1"
},
{
"input": "1000000000000000000 999999999999999998",
"output": "1"
},
{
"input": "1009 980",
"output": "10"
},
{
"input": "999999999999999999 999999999999999838",
"output": "0"
},
{
"input": "1000000000000000000 99999999999999800",
"output": "900000000000000061"
},
{
"input": "8785369357 3377262261",
"output": "5408107058"
},
{
"input": "110 109",
"output": "0"
},
{
"input": "999 777",
"output": "200"
},
{
"input": "327170000015578 77230000029054",
"output": "249939999986479"
},
{
"input": "12515000022229 1791000022317",
"output": "10723999999880"
},
{
"input": "9999999999999 9999999999882",
"output": "10"
},
{
"input": "213 196",
"output": "14"
},
{
"input": "92 82",
"output": "0"
},
{
"input": "148 136",
"output": "0"
},
{
"input": "8 9",
"output": "0"
},
{
"input": "309 299",
"output": "0"
},
{
"input": "9999 9963",
"output": "10"
},
{
"input": "82 81",
"output": "0"
},
{
"input": "9999999 9999936",
"output": "10"
},
{
"input": "171 155",
"output": "2"
},
{
"input": "999 972",
"output": "10"
},
{
"input": "999999999999 999999999891",
"output": "10"
},
{
"input": "9 9",
"output": "0"
},
{
"input": "6900 6885",
"output": "1"
},
{
"input": "96 57",
"output": "27"
},
{
"input": "5 4",
"output": "0"
},
{
"input": "17386 5814",
"output": "11557"
},
{
"input": "493679757404593 316259583979965",
"output": "177420173424564"
},
{
"input": "18474 9478",
"output": "8975"
},
{
"input": "270091571496186 250931112649966",
"output": "19160458846177"
},
{
"input": "565751690089037 381448507916936",
"output": "184303182172038"
},
{
"input": "19 10",
"output": "0"
}
] | 1,585,131,898 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 20 | 140 | 0 | n, s = map(int, input().strip().split())
num = ''
div = 9
if s//10 != 0:
div= int('9'*(len(str(s))-1))
while s:
num += str(s//div)
s = s%div
div //= 10
if div == 0:
div = 1
else:
num = str(s)
mini = int(num)
if mini%10 != 0:
mini += 10
mini -= mini%10
print(max(0, n-mini+1))
# while s:
# num += str(s%div)
# s = s//div
# div = div*10+9
# num = num[::-1]
# print(max(0, n-mini+1))
| Title: Really Big Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Ivan likes to learn different things about numbers, but he is especially interested in really big numbers. Ivan thinks that a positive integer number *x* is really big if the difference between *x* and the sum of its digits (in decimal representation) is not less than *s*. To prove that these numbers may have different special properties, he wants to know how rare (or not rare) they are — in fact, he needs to calculate the quantity of really big numbers that are not greater than *n*.
Ivan tried to do the calculations himself, but soon realized that it's too difficult for him. So he asked you to help him in calculations.
Input Specification:
The first (and the only) line contains two integers *n* and *s* (1<=≤<=*n*,<=*s*<=≤<=1018).
Output Specification:
Print one integer — the quantity of really big numbers that are not greater than *n*.
Demo Input:
['12 1\n', '25 20\n', '10 9\n']
Demo Output:
['3\n', '0\n', '1\n']
Note:
In the first example numbers 10, 11 and 12 are really big.
In the second example there are no really big numbers that are not greater than 25 (in fact, the first really big number is 30: 30 - 3 ≥ 20).
In the third example 10 is the only really big number (10 - 1 ≥ 9). | ```python
n, s = map(int, input().strip().split())
num = ''
div = 9
if s//10 != 0:
div= int('9'*(len(str(s))-1))
while s:
num += str(s//div)
s = s%div
div //= 10
if div == 0:
div = 1
else:
num = str(s)
mini = int(num)
if mini%10 != 0:
mini += 10
mini -= mini%10
print(max(0, n-mini+1))
# while s:
# num += str(s%div)
# s = s//div
# div = div*10+9
# num = num[::-1]
# print(max(0, n-mini+1))
``` | 0 |
|
841 | B | Godsend | PROGRAMMING | 1,100 | [
"games",
"math"
] | null | null | Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero length with an odd sum of numbers and remove it from the array, after that the remaining parts are glued together into one array and the game continues. The second player can choose a subsegment of non-zero length with an even sum and remove it. Loses the one who can not make a move. Who will win if both play optimally? | First line of input data contains single integer *n* (1<=≤<=*n*<=≤<=106) — length of the array.
Next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109). | Output answer in single line. "First", if first player wins, and "Second" otherwise (without quotes). | [
"4\n1 3 2 3\n",
"2\n2 2\n"
] | [
"First\n",
"Second\n"
] | In first sample first player remove whole array in one move and win.
In second sample first player can't make a move and lose. | 1,000 | [
{
"input": "4\n1 3 2 3",
"output": "First"
},
{
"input": "2\n2 2",
"output": "Second"
},
{
"input": "4\n2 4 6 8",
"output": "Second"
},
{
"input": "5\n1 1 1 1 1",
"output": "First"
},
{
"input": "4\n720074544 345031254 849487632 80870826",
"output": "Second"
},
{
"input": "1\n0",
"output": "Second"
},
{
"input": "1\n999999999",
"output": "First"
},
{
"input": "2\n1 999999999",
"output": "First"
},
{
"input": "4\n3 3 4 4",
"output": "First"
},
{
"input": "2\n1 2",
"output": "First"
},
{
"input": "8\n2 2 2 1 1 2 2 2",
"output": "First"
},
{
"input": "5\n3 3 2 2 2",
"output": "First"
},
{
"input": "4\n0 1 1 0",
"output": "First"
},
{
"input": "3\n1 2 2",
"output": "First"
},
{
"input": "6\n2 2 1 1 4 2",
"output": "First"
},
{
"input": "8\n2 2 2 3 3 2 2 2",
"output": "First"
},
{
"input": "4\n2 3 3 4",
"output": "First"
},
{
"input": "10\n2 2 2 2 3 1 2 2 2 2",
"output": "First"
},
{
"input": "6\n2 2 1 1 2 2",
"output": "First"
},
{
"input": "3\n1 1 2",
"output": "First"
},
{
"input": "6\n2 4 3 3 4 6",
"output": "First"
},
{
"input": "6\n4 4 3 3 4 4",
"output": "First"
},
{
"input": "4\n1 1 2 2",
"output": "First"
},
{
"input": "4\n1 3 5 7",
"output": "First"
},
{
"input": "4\n2 1 1 2",
"output": "First"
},
{
"input": "4\n1 3 3 2",
"output": "First"
},
{
"input": "5\n3 2 2 2 2",
"output": "First"
},
{
"input": "3\n2 1 1",
"output": "First"
},
{
"input": "4\n1000000000 1000000000 1000000000 99999999",
"output": "First"
},
{
"input": "4\n2 2 1 1",
"output": "First"
},
{
"input": "5\n2 3 2 3 2",
"output": "First"
},
{
"input": "1\n1",
"output": "First"
},
{
"input": "4\n1000000000 1000000000 1000000000 1",
"output": "First"
},
{
"input": "5\n2 2 2 1 1",
"output": "First"
},
{
"input": "6\n2 1 1 1 1 2",
"output": "First"
},
{
"input": "6\n1 2 2 2 2 1",
"output": "First"
},
{
"input": "11\n2 2 2 2 2 1 2 2 2 2 2",
"output": "First"
},
{
"input": "5\n1 3 2 2 2",
"output": "First"
},
{
"input": "3\n2 3 2",
"output": "First"
},
{
"input": "2\n1 1",
"output": "First"
},
{
"input": "5\n4 4 4 3 3",
"output": "First"
},
{
"input": "5\n3 3 4 4 4",
"output": "First"
},
{
"input": "1\n2",
"output": "Second"
}
] | 1,682,775,665 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 88 | 327 | 92,569,600 | n=int(input())
print("First" if 1 in [int(e)%2 for e in input().split()] else "Second") | Title: Godsend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero length with an odd sum of numbers and remove it from the array, after that the remaining parts are glued together into one array and the game continues. The second player can choose a subsegment of non-zero length with an even sum and remove it. Loses the one who can not make a move. Who will win if both play optimally?
Input Specification:
First line of input data contains single integer *n* (1<=≤<=*n*<=≤<=106) — length of the array.
Next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109).
Output Specification:
Output answer in single line. "First", if first player wins, and "Second" otherwise (without quotes).
Demo Input:
['4\n1 3 2 3\n', '2\n2 2\n']
Demo Output:
['First\n', 'Second\n']
Note:
In first sample first player remove whole array in one move and win.
In second sample first player can't make a move and lose. | ```python
n=int(input())
print("First" if 1 in [int(e)%2 for e in input().split()] else "Second")
``` | 3 |
|
268 | A | Games | PROGRAMMING | 800 | [
"brute force"
] | null | null | Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question. | The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively. | In a single line print the number of games where the host team is going to play in the guest uniform. | [
"3\n1 2\n2 4\n3 4\n",
"4\n100 42\n42 100\n5 42\n100 5\n",
"2\n1 2\n1 2\n"
] | [
"1\n",
"5\n",
"0\n"
] | In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first). | 500 | [
{
"input": "3\n1 2\n2 4\n3 4",
"output": "1"
},
{
"input": "4\n100 42\n42 100\n5 42\n100 5",
"output": "5"
},
{
"input": "2\n1 2\n1 2",
"output": "0"
},
{
"input": "7\n4 7\n52 55\n16 4\n55 4\n20 99\n3 4\n7 52",
"output": "6"
},
{
"input": "10\n68 42\n1 35\n25 70\n59 79\n65 63\n46 6\n28 82\n92 62\n43 96\n37 28",
"output": "1"
},
{
"input": "30\n10 39\n89 1\n78 58\n75 99\n36 13\n77 50\n6 97\n79 28\n27 52\n56 5\n93 96\n40 21\n33 74\n26 37\n53 59\n98 56\n61 65\n42 57\n9 7\n25 63\n74 34\n96 84\n95 47\n12 23\n34 21\n71 6\n27 13\n15 47\n64 14\n12 77",
"output": "6"
},
{
"input": "30\n46 100\n87 53\n34 84\n44 66\n23 20\n50 34\n90 66\n17 39\n13 22\n94 33\n92 46\n63 78\n26 48\n44 61\n3 19\n41 84\n62 31\n65 89\n23 28\n58 57\n19 85\n26 60\n75 66\n69 67\n76 15\n64 15\n36 72\n90 89\n42 69\n45 35",
"output": "4"
},
{
"input": "2\n46 6\n6 46",
"output": "2"
},
{
"input": "29\n8 18\n33 75\n69 22\n97 95\n1 97\n78 10\n88 18\n13 3\n19 64\n98 12\n79 92\n41 72\n69 15\n98 31\n57 74\n15 56\n36 37\n15 66\n63 100\n16 42\n47 56\n6 4\n73 15\n30 24\n27 71\n12 19\n88 69\n85 6\n50 11",
"output": "10"
},
{
"input": "23\n43 78\n31 28\n58 80\n66 63\n20 4\n51 95\n40 20\n50 14\n5 34\n36 39\n77 42\n64 97\n62 89\n16 56\n8 34\n58 16\n37 35\n37 66\n8 54\n50 36\n24 8\n68 48\n85 33",
"output": "6"
},
{
"input": "13\n76 58\n32 85\n99 79\n23 58\n96 59\n72 35\n53 43\n96 55\n41 78\n75 10\n28 11\n72 7\n52 73",
"output": "0"
},
{
"input": "18\n6 90\n70 79\n26 52\n67 81\n29 95\n41 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 2",
"output": "1"
},
{
"input": "18\n6 90\n100 79\n26 100\n67 100\n29 100\n100 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 100",
"output": "8"
},
{
"input": "30\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "450"
},
{
"input": "30\n100 99\n58 59\n56 57\n54 55\n52 53\n50 51\n48 49\n46 47\n44 45\n42 43\n40 41\n38 39\n36 37\n34 35\n32 33\n30 31\n28 29\n26 27\n24 25\n22 23\n20 21\n18 19\n16 17\n14 15\n12 13\n10 11\n8 9\n6 7\n4 5\n2 3",
"output": "0"
},
{
"input": "15\n9 3\n2 6\n7 6\n5 10\n9 5\n8 1\n10 5\n2 8\n4 5\n9 8\n5 3\n3 8\n9 8\n4 10\n8 5",
"output": "20"
},
{
"input": "15\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n1 2",
"output": "108"
},
{
"input": "25\n2 1\n1 2\n1 2\n1 2\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n1 2\n2 1\n2 1\n2 1\n2 1\n1 2",
"output": "312"
},
{
"input": "25\n91 57\n2 73\n54 57\n2 57\n23 57\n2 6\n57 54\n57 23\n91 54\n91 23\n57 23\n91 57\n54 2\n6 91\n57 54\n2 57\n57 91\n73 91\n57 23\n91 57\n2 73\n91 2\n23 6\n2 73\n23 6",
"output": "96"
},
{
"input": "28\n31 66\n31 91\n91 31\n97 66\n31 66\n31 66\n66 91\n91 31\n97 31\n91 97\n97 31\n66 31\n66 97\n91 31\n31 66\n31 66\n66 31\n31 97\n66 97\n97 31\n31 91\n66 91\n91 66\n31 66\n91 66\n66 31\n66 31\n91 97",
"output": "210"
},
{
"input": "29\n78 27\n50 68\n24 26\n68 43\n38 78\n26 38\n78 28\n28 26\n27 24\n23 38\n24 26\n24 43\n61 50\n38 78\n27 23\n61 26\n27 28\n43 23\n28 78\n43 27\n43 78\n27 61\n28 38\n61 78\n50 26\n43 27\n26 78\n28 50\n43 78",
"output": "73"
},
{
"input": "29\n80 27\n69 80\n27 80\n69 80\n80 27\n80 27\n80 27\n80 69\n27 69\n80 69\n80 27\n27 69\n69 27\n80 69\n27 69\n69 80\n27 69\n80 69\n80 27\n69 27\n27 69\n27 80\n80 27\n69 80\n27 69\n80 69\n69 80\n69 80\n27 80",
"output": "277"
},
{
"input": "30\n19 71\n7 89\n89 71\n21 7\n19 21\n7 89\n19 71\n89 8\n89 21\n19 8\n21 7\n8 89\n19 89\n7 21\n19 8\n19 7\n7 19\n8 21\n71 21\n71 89\n7 19\n7 19\n21 7\n21 19\n21 19\n71 8\n21 8\n71 19\n19 71\n8 21",
"output": "154"
},
{
"input": "30\n44 17\n44 17\n44 17\n17 44\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n44 17\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n17 44\n44 17\n44 17\n44 17\n17 44\n17 44\n44 17\n17 44\n44 17\n44 17\n44 17",
"output": "418"
},
{
"input": "22\n78 92\n15 92\n92 78\n78 80\n92 16\n24 80\n92 16\n16 92\n78 16\n24 78\n80 78\n92 80\n16 80\n80 78\n15 78\n92 16\n24 15\n24 80\n80 16\n16 80\n92 80\n24 80",
"output": "74"
},
{
"input": "24\n9 83\n90 31\n83 3\n83 3\n21 31\n83 3\n32 31\n12 21\n31 21\n90 32\n32 21\n12 9\n12 31\n9 83\n83 12\n32 3\n32 83\n90 31\n9 32\n31 21\n83 90\n32 21\n21 3\n32 9",
"output": "59"
},
{
"input": "30\n67 21\n85 39\n85 87\n21 39\n66 85\n10 95\n10 21\n87 85\n82 21\n67 21\n95 10\n21 39\n82 21\n21 66\n66 39\n95 30\n67 85\n66 82\n85 82\n21 66\n10 39\n67 10\n21 85\n10 82\n85 95\n10 85\n21 39\n85 39\n39 10\n95 67",
"output": "100"
},
{
"input": "4\n8 7\n8 7\n7 8\n7 8",
"output": "8"
},
{
"input": "6\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1",
"output": "10"
},
{
"input": "12\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "72"
},
{
"input": "4\n1 2\n1 2\n2 1\n2 1",
"output": "8"
}
] | 1,680,001,614 | 2,147,483,647 | Python 3 | OK | TESTS | 31 | 92 | 0 | a=int(input())
g1=[]
g2=[]
c=0
for i in range(a):
h1,h2=list(map(int,input().split()))
g1.append(h1)
g2.append(h2)
for i in g1:
if i in g2:
m=g2.count(i)
c+=m
print(c)
| Title: Games
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question.
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively.
Output Specification:
In a single line print the number of games where the host team is going to play in the guest uniform.
Demo Input:
['3\n1 2\n2 4\n3 4\n', '4\n100 42\n42 100\n5 42\n100 5\n', '2\n1 2\n1 2\n']
Demo Output:
['1\n', '5\n', '0\n']
Note:
In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first). | ```python
a=int(input())
g1=[]
g2=[]
c=0
for i in range(a):
h1,h2=list(map(int,input().split()))
g1.append(h1)
g2.append(h2)
for i in g1:
if i in g2:
m=g2.count(i)
c+=m
print(c)
``` | 3 |
|
567 | A | Lineland Mail | PROGRAMMING | 900 | [
"greedy",
"implementation"
] | null | null | All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city | The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order. | Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city. | [
"4\n-5 -2 2 7\n",
"2\n-1 1\n"
] | [
"3 12\n3 9\n4 7\n5 12\n",
"2 2\n2 2\n"
] | none | 500 | [
{
"input": "4\n-5 -2 2 7",
"output": "3 12\n3 9\n4 7\n5 12"
},
{
"input": "2\n-1 1",
"output": "2 2\n2 2"
},
{
"input": "3\n-1 0 1",
"output": "1 2\n1 1\n1 2"
},
{
"input": "4\n-1 0 1 3",
"output": "1 4\n1 3\n1 2\n2 4"
},
{
"input": "3\n-1000000000 0 1000000000",
"output": "1000000000 2000000000\n1000000000 1000000000\n1000000000 2000000000"
},
{
"input": "2\n-1000000000 1000000000",
"output": "2000000000 2000000000\n2000000000 2000000000"
},
{
"input": "10\n1 10 12 15 59 68 130 912 1239 9123",
"output": "9 9122\n2 9113\n2 9111\n3 9108\n9 9064\n9 9055\n62 8993\n327 8211\n327 7884\n7884 9122"
},
{
"input": "5\n-2 -1 0 1 2",
"output": "1 4\n1 3\n1 2\n1 3\n1 4"
},
{
"input": "5\n-2 -1 0 1 3",
"output": "1 5\n1 4\n1 3\n1 3\n2 5"
},
{
"input": "3\n-10000 1 10000",
"output": "10001 20000\n9999 10001\n9999 20000"
},
{
"input": "5\n-1000000000 -999999999 -999999998 -999999997 -999999996",
"output": "1 4\n1 3\n1 2\n1 3\n1 4"
},
{
"input": "10\n-857422304 -529223472 82412729 145077145 188538640 265299215 527377039 588634631 592896147 702473706",
"output": "328198832 1559896010\n328198832 1231697178\n62664416 939835033\n43461495 1002499449\n43461495 1045960944\n76760575 1122721519\n61257592 1384799343\n4261516 1446056935\n4261516 1450318451\n109577559 1559896010"
},
{
"input": "10\n-876779400 -829849659 -781819137 -570920213 18428128 25280705 121178189 219147240 528386329 923854124",
"output": "46929741 1800633524\n46929741 1753703783\n48030522 1705673261\n210898924 1494774337\n6852577 905425996\n6852577 902060105\n95897484 997957589\n97969051 1095926640\n309239089 1405165729\n395467795 1800633524"
},
{
"input": "30\n-15 1 21 25 30 40 59 60 77 81 97 100 103 123 139 141 157 158 173 183 200 215 226 231 244 256 267 279 289 292",
"output": "16 307\n16 291\n4 271\n4 267\n5 262\n10 252\n1 233\n1 232\n4 215\n4 211\n3 195\n3 192\n3 189\n16 169\n2 154\n2 156\n1 172\n1 173\n10 188\n10 198\n15 215\n11 230\n5 241\n5 246\n12 259\n11 271\n11 282\n10 294\n3 304\n3 307"
},
{
"input": "10\n-1000000000 -999999999 -999999997 -999999996 -999999995 -999999994 -999999992 -999999990 -999999988 -999999986",
"output": "1 14\n1 13\n1 11\n1 10\n1 9\n1 8\n2 8\n2 10\n2 12\n2 14"
},
{
"input": "50\n-50000 -49459 -48875 -48456 -48411 -48096 -47901 -47500 -47150 -46808 -46687 -46679 -46337 -45747 -45604 -45194 -44752 -44242 -44231 -44122 -43636 -43274 -42916 -42881 -42386 -42095 -41830 -41618 -41145 -40897 -40534 -40007 -39761 -39389 -39104 -38909 -38630 -38561 -38364 -38255 -38214 -38084 -37959 -37607 -37202 -36890 -36681 -36136 -36123 -35886",
"output": "541 14114\n541 13573\n419 12989\n45 12570\n45 12525\n195 12210\n195 12015\n350 11614\n342 11264\n121 10922\n8 10801\n8 10793\n342 10451\n143 9861\n143 9718\n410 9308\n442 8866\n11 8356\n11 8345\n109 8236\n362 7750\n358 7388\n35 7084\n35 7119\n291 7614\n265 7905\n212 8170\n212 8382\n248 8855\n248 9103\n363 9466\n246 9993\n246 10239\n285 10611\n195 10896\n195 11091\n69 11370\n69 11439\n109 11636\n41 11745\n41 11786\n125 11916\n125 12041\n352 12393\n312 12798\n209 13110\n209 13319\n13 13864\n13 13877\n237 141..."
},
{
"input": "3\n-1000000000 999999999 1000000000",
"output": "1999999999 2000000000\n1 1999999999\n1 2000000000"
}
] | 1,675,361,722 | 2,147,483,647 | Python 3 | OK | TESTS | 54 | 592 | 8,089,600 | x=int(input())
l=list(map(int,input().split()))
menor=0
maior=0
for i in range(0,x):
if i==0:
maior=l[x-1]-l[i]
menor=l[1]-l[0]
elif i==x-1:
maior=l[i]-l[0]
menor=l[i]-l[i-1]
else:
maior=max((l[x-1]-l[i]),(l[i]-l[0]))
menor=min(l[i+1]-l[i],l[i]-l[i-1])
print(menor,'',maior)
| Title: Lineland Mail
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city
Input Specification:
The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order.
Output Specification:
Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city.
Demo Input:
['4\n-5 -2 2 7\n', '2\n-1 1\n']
Demo Output:
['3 12\n3 9\n4 7\n5 12\n', '2 2\n2 2\n']
Note:
none | ```python
x=int(input())
l=list(map(int,input().split()))
menor=0
maior=0
for i in range(0,x):
if i==0:
maior=l[x-1]-l[i]
menor=l[1]-l[0]
elif i==x-1:
maior=l[i]-l[0]
menor=l[i]-l[i-1]
else:
maior=max((l[x-1]-l[i]),(l[i]-l[0]))
menor=min(l[i+1]-l[i],l[i]-l[i-1])
print(menor,'',maior)
``` | 3 |
|
0 | none | none | none | 0 | [
"none"
] | null | null | Gerald got a very curious hexagon for his birthday. The boy found out that all the angles of the hexagon are equal to . Then he measured the length of its sides, and found that each of them is equal to an integer number of centimeters. There the properties of the hexagon ended and Gerald decided to draw on it.
He painted a few lines, parallel to the sides of the hexagon. The lines split the hexagon into regular triangles with sides of 1 centimeter. Now Gerald wonders how many triangles he has got. But there were so many of them that Gerald lost the track of his counting. Help the boy count the triangles. | The first and the single line of the input contains 6 space-separated integers *a*1,<=*a*2,<=*a*3,<=*a*4,<=*a*5 and *a*6 (1<=≤<=*a**i*<=≤<=1000) — the lengths of the sides of the hexagons in centimeters in the clockwise order. It is guaranteed that the hexagon with the indicated properties and the exactly such sides exists. | Print a single integer — the number of triangles with the sides of one 1 centimeter, into which the hexagon is split. | [
"1 1 1 1 1 1\n",
"1 2 1 2 1 2\n"
] | [
"6\n",
"13\n"
] | This is what Gerald's hexagon looks like in the first sample:
<img class="tex-graphics" src="https://espresso.codeforces.com/84d193e27b02c38eb1eadc536602a2ec0b9f9519.png" style="max-width: 100.0%;max-height: 100.0%;"/>
And that's what it looks like in the second sample:
<img class="tex-graphics" src="https://espresso.codeforces.com/e29076a96da8ca864654cc6195654d9bf07d31ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> | 0 | [
{
"input": "1 1 1 1 1 1",
"output": "6"
},
{
"input": "1 2 1 2 1 2",
"output": "13"
},
{
"input": "2 4 5 3 3 6",
"output": "83"
},
{
"input": "45 19 48 18 46 21",
"output": "6099"
},
{
"input": "66 6 65 6 66 5",
"output": "5832"
},
{
"input": "7 5 4 8 4 5",
"output": "175"
},
{
"input": "3 2 1 4 1 2",
"output": "25"
},
{
"input": "7 1 7 3 5 3",
"output": "102"
},
{
"input": "9 2 9 3 8 3",
"output": "174"
},
{
"input": "1 6 1 5 2 5",
"output": "58"
},
{
"input": "41 64 48 61 44 68",
"output": "17488"
},
{
"input": "1 59 2 59 1 60",
"output": "3838"
},
{
"input": "30 36 36 32 34 38",
"output": "7052"
},
{
"input": "50 40 46 38 52 34",
"output": "11176"
},
{
"input": "4 60 4 60 4 60",
"output": "4576"
},
{
"input": "718 466 729 470 714 481",
"output": "2102808"
},
{
"input": "131 425 143 461 95 473",
"output": "441966"
},
{
"input": "125 7 128 8 124 11",
"output": "20215"
},
{
"input": "677 303 685 288 692 296",
"output": "1365807"
},
{
"input": "1 577 7 576 2 582",
"output": "342171"
},
{
"input": "1000 1000 1000 1000 1000 1000",
"output": "6000000"
},
{
"input": "1 1 1000 1 1 1000",
"output": "4002"
},
{
"input": "1000 1000 1 1000 1000 1",
"output": "2004000"
},
{
"input": "1000 1 1000 999 2 999",
"output": "2003997"
},
{
"input": "1 1000 1 1 1000 1",
"output": "4002"
},
{
"input": "888 888 888 887 889 887",
"output": "4729487"
}
] | 1,437,833,506 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | def triang(n):
a = 0
i = 1
while i <= n:
a += (2 * i - 1)
i += 1
return a
a = input().split()
for i in range(len(a)):
a[i] = int(a[i])
c = a[0] + a[1] + a[5]
print(c)
print(triang(c) - triang(a[1]) - triang(a[3]) - triang(a[5])) | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Gerald got a very curious hexagon for his birthday. The boy found out that all the angles of the hexagon are equal to . Then he measured the length of its sides, and found that each of them is equal to an integer number of centimeters. There the properties of the hexagon ended and Gerald decided to draw on it.
He painted a few lines, parallel to the sides of the hexagon. The lines split the hexagon into regular triangles with sides of 1 centimeter. Now Gerald wonders how many triangles he has got. But there were so many of them that Gerald lost the track of his counting. Help the boy count the triangles.
Input Specification:
The first and the single line of the input contains 6 space-separated integers *a*1,<=*a*2,<=*a*3,<=*a*4,<=*a*5 and *a*6 (1<=≤<=*a**i*<=≤<=1000) — the lengths of the sides of the hexagons in centimeters in the clockwise order. It is guaranteed that the hexagon with the indicated properties and the exactly such sides exists.
Output Specification:
Print a single integer — the number of triangles with the sides of one 1 centimeter, into which the hexagon is split.
Demo Input:
['1 1 1 1 1 1\n', '1 2 1 2 1 2\n']
Demo Output:
['6\n', '13\n']
Note:
This is what Gerald's hexagon looks like in the first sample:
<img class="tex-graphics" src="https://espresso.codeforces.com/84d193e27b02c38eb1eadc536602a2ec0b9f9519.png" style="max-width: 100.0%;max-height: 100.0%;"/>
And that's what it looks like in the second sample:
<img class="tex-graphics" src="https://espresso.codeforces.com/e29076a96da8ca864654cc6195654d9bf07d31ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> | ```python
def triang(n):
a = 0
i = 1
while i <= n:
a += (2 * i - 1)
i += 1
return a
a = input().split()
for i in range(len(a)):
a[i] = int(a[i])
c = a[0] + a[1] + a[5]
print(c)
print(triang(c) - triang(a[1]) - triang(a[3]) - triang(a[5]))
``` | 0 |
|
855 | A | Tom Riddle's Diary | PROGRAMMING | 800 | [
"brute force",
"implementation",
"strings"
] | null | null | Harry Potter is on a mission to destroy You-Know-Who's Horcruxes. The first Horcrux that he encountered in the Chamber of Secrets is Tom Riddle's diary. The diary was with Ginny and it forced her to open the Chamber of Secrets. Harry wants to know the different people who had ever possessed the diary to make sure they are not under its influence.
He has names of *n* people who possessed the diary in order. You need to tell, for each person, if he/she possessed the diary at some point before or not.
Formally, for a name *s**i* in the *i*-th line, output "YES" (without quotes) if there exists an index *j* such that *s**i*<==<=*s**j* and *j*<=<<=*i*, otherwise, output "NO" (without quotes). | First line of input contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of names in the list.
Next *n* lines each contain a string *s**i*, consisting of lowercase English letters. The length of each string is between 1 and 100. | Output *n* lines each containing either "YES" or "NO" (without quotes), depending on whether this string was already present in the stream or not.
You can print each letter in any case (upper or lower). | [
"6\ntom\nlucius\nginny\nharry\nginny\nharry\n",
"3\na\na\na\n"
] | [
"NO\nNO\nNO\nNO\nYES\nYES\n",
"NO\nYES\nYES\n"
] | In test case 1, for *i* = 5 there exists *j* = 3 such that *s*<sub class="lower-index">*i*</sub> = *s*<sub class="lower-index">*j*</sub> and *j* < *i*, which means that answer for *i* = 5 is "YES". | 500 | [
{
"input": "6\ntom\nlucius\nginny\nharry\nginny\nharry",
"output": "NO\nNO\nNO\nNO\nYES\nYES"
},
{
"input": "3\na\na\na",
"output": "NO\nYES\nYES"
},
{
"input": "1\nzn",
"output": "NO"
},
{
"input": "9\nliyzmbjwnzryjokufuxcqtzwworjeoxkbaqrujrhdidqdvwdfzilwszgnzglnnbogaclckfnbqovtziuhwvyrqwmskx\nliyzmbjwnzryjokufuxcqtzwworjeoxkbaqrujrhdidqdvwdfzilwszgnzglnnbogaclckfnbqovtziuhwvyrqwmskx\nliyzmbjwnzryjokufuxcqtzwworjeoxkbaqrujrhdidqdvwdfzilwszgnzglnnbogaclckfnbqovtziuhwvyrqwmskx\nhrtm\nssjqvixduertmotgagizamvfucfwtxqnhuowbqbzctgznivehelpcyigwrbbdsxnewfqvcf\nhyrtxvozpbveexfkgalmguozzakitjiwsduqxonb\nwcyxteiwtcyuztaguilqpbiwcwjaiq\nwcyxteiwtcyuztaguilqpbiwcwjaiq\nbdbivqzvhggth",
"output": "NO\nYES\nYES\nNO\nNO\nNO\nNO\nYES\nNO"
},
{
"input": "10\nkkiubdktydpdcbbttwpfdplhhjhrpqmpg\nkkiubdktydpdcbbttwpfdplhhjhrpqmpg\nmvutw\nqooeqoxzxwetlpecqiwgdbogiqqulttysyohwhzxzphvsfmnplizxoebzcvvfyppqbhxjksuzepuezqqzxlfmdanoeaoqmor\nmvutw\nvchawxjoreboqzuklifv\nvchawxjoreboqzuklifv\nnivijte\nrflybruq\nvchawxjoreboqzuklifv",
"output": "NO\nYES\nNO\nNO\nYES\nNO\nYES\nNO\nNO\nYES"
},
{
"input": "1\nz",
"output": "NO"
},
{
"input": "9\nl\ny\nm\nj\nn\nr\nj\nk\nf",
"output": "NO\nNO\nNO\nNO\nNO\nNO\nYES\nNO\nNO"
},
{
"input": "14\nw\na\nh\np\nk\nw\ny\nv\ns\nf\nx\nd\nk\nr",
"output": "NO\nNO\nNO\nNO\nNO\nYES\nNO\nNO\nNO\nNO\nNO\nNO\nYES\nNO"
},
{
"input": "25\np\nk\nu\nl\nf\nt\nc\ns\nq\nd\nb\nq\no\ni\ni\nd\ni\nw\nn\ng\nw\nt\na\ne\ni",
"output": "NO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nYES\nNO\nNO\nYES\nYES\nYES\nNO\nNO\nNO\nYES\nYES\nNO\nNO\nYES"
},
{
"input": "20\nd\nh\ng\no\np\ne\nt\nj\nv\ni\nt\nh\ns\ni\nw\nf\nx\na\nl\ni",
"output": "NO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nNO\nYES\nYES\nNO\nYES\nNO\nNO\nNO\nNO\nNO\nYES"
},
{
"input": "3\nbbbbbbb\nbbbbbbbbb\nbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "NO\nNO\nNO"
},
{
"input": "2\nab\nba",
"output": "NO\nNO"
},
{
"input": "6\ntom\nlucius\nginnys\nharpy\nginny\nharry",
"output": "NO\nNO\nNO\nNO\nNO\nNO"
},
{
"input": "2\nabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcde\nabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcdeabcde",
"output": "NO\nYES"
},
{
"input": "42\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na\na",
"output": "NO\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES\nYES"
}
] | 1,619,391,092 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 30 | 0 | n = int(input())
j = []
for i in range(n):
s = input()
j.append(s)
if s in j:
print('YES')
else:
print('NO')
| Title: Tom Riddle's Diary
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Harry Potter is on a mission to destroy You-Know-Who's Horcruxes. The first Horcrux that he encountered in the Chamber of Secrets is Tom Riddle's diary. The diary was with Ginny and it forced her to open the Chamber of Secrets. Harry wants to know the different people who had ever possessed the diary to make sure they are not under its influence.
He has names of *n* people who possessed the diary in order. You need to tell, for each person, if he/she possessed the diary at some point before or not.
Formally, for a name *s**i* in the *i*-th line, output "YES" (without quotes) if there exists an index *j* such that *s**i*<==<=*s**j* and *j*<=<<=*i*, otherwise, output "NO" (without quotes).
Input Specification:
First line of input contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of names in the list.
Next *n* lines each contain a string *s**i*, consisting of lowercase English letters. The length of each string is between 1 and 100.
Output Specification:
Output *n* lines each containing either "YES" or "NO" (without quotes), depending on whether this string was already present in the stream or not.
You can print each letter in any case (upper or lower).
Demo Input:
['6\ntom\nlucius\nginny\nharry\nginny\nharry\n', '3\na\na\na\n']
Demo Output:
['NO\nNO\nNO\nNO\nYES\nYES\n', 'NO\nYES\nYES\n']
Note:
In test case 1, for *i* = 5 there exists *j* = 3 such that *s*<sub class="lower-index">*i*</sub> = *s*<sub class="lower-index">*j*</sub> and *j* < *i*, which means that answer for *i* = 5 is "YES". | ```python
n = int(input())
j = []
for i in range(n):
s = input()
j.append(s)
if s in j:
print('YES')
else:
print('NO')
``` | 0 |
|
268 | A | Games | PROGRAMMING | 800 | [
"brute force"
] | null | null | Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question. | The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively. | In a single line print the number of games where the host team is going to play in the guest uniform. | [
"3\n1 2\n2 4\n3 4\n",
"4\n100 42\n42 100\n5 42\n100 5\n",
"2\n1 2\n1 2\n"
] | [
"1\n",
"5\n",
"0\n"
] | In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first). | 500 | [
{
"input": "3\n1 2\n2 4\n3 4",
"output": "1"
},
{
"input": "4\n100 42\n42 100\n5 42\n100 5",
"output": "5"
},
{
"input": "2\n1 2\n1 2",
"output": "0"
},
{
"input": "7\n4 7\n52 55\n16 4\n55 4\n20 99\n3 4\n7 52",
"output": "6"
},
{
"input": "10\n68 42\n1 35\n25 70\n59 79\n65 63\n46 6\n28 82\n92 62\n43 96\n37 28",
"output": "1"
},
{
"input": "30\n10 39\n89 1\n78 58\n75 99\n36 13\n77 50\n6 97\n79 28\n27 52\n56 5\n93 96\n40 21\n33 74\n26 37\n53 59\n98 56\n61 65\n42 57\n9 7\n25 63\n74 34\n96 84\n95 47\n12 23\n34 21\n71 6\n27 13\n15 47\n64 14\n12 77",
"output": "6"
},
{
"input": "30\n46 100\n87 53\n34 84\n44 66\n23 20\n50 34\n90 66\n17 39\n13 22\n94 33\n92 46\n63 78\n26 48\n44 61\n3 19\n41 84\n62 31\n65 89\n23 28\n58 57\n19 85\n26 60\n75 66\n69 67\n76 15\n64 15\n36 72\n90 89\n42 69\n45 35",
"output": "4"
},
{
"input": "2\n46 6\n6 46",
"output": "2"
},
{
"input": "29\n8 18\n33 75\n69 22\n97 95\n1 97\n78 10\n88 18\n13 3\n19 64\n98 12\n79 92\n41 72\n69 15\n98 31\n57 74\n15 56\n36 37\n15 66\n63 100\n16 42\n47 56\n6 4\n73 15\n30 24\n27 71\n12 19\n88 69\n85 6\n50 11",
"output": "10"
},
{
"input": "23\n43 78\n31 28\n58 80\n66 63\n20 4\n51 95\n40 20\n50 14\n5 34\n36 39\n77 42\n64 97\n62 89\n16 56\n8 34\n58 16\n37 35\n37 66\n8 54\n50 36\n24 8\n68 48\n85 33",
"output": "6"
},
{
"input": "13\n76 58\n32 85\n99 79\n23 58\n96 59\n72 35\n53 43\n96 55\n41 78\n75 10\n28 11\n72 7\n52 73",
"output": "0"
},
{
"input": "18\n6 90\n70 79\n26 52\n67 81\n29 95\n41 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 2",
"output": "1"
},
{
"input": "18\n6 90\n100 79\n26 100\n67 100\n29 100\n100 32\n94 88\n18 58\n59 65\n51 56\n64 68\n34 2\n6 98\n95 82\n34 2\n40 98\n83 78\n29 100",
"output": "8"
},
{
"input": "30\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "450"
},
{
"input": "30\n100 99\n58 59\n56 57\n54 55\n52 53\n50 51\n48 49\n46 47\n44 45\n42 43\n40 41\n38 39\n36 37\n34 35\n32 33\n30 31\n28 29\n26 27\n24 25\n22 23\n20 21\n18 19\n16 17\n14 15\n12 13\n10 11\n8 9\n6 7\n4 5\n2 3",
"output": "0"
},
{
"input": "15\n9 3\n2 6\n7 6\n5 10\n9 5\n8 1\n10 5\n2 8\n4 5\n9 8\n5 3\n3 8\n9 8\n4 10\n8 5",
"output": "20"
},
{
"input": "15\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n2 1\n1 2",
"output": "108"
},
{
"input": "25\n2 1\n1 2\n1 2\n1 2\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n1 2\n2 1\n1 2\n2 1\n2 1\n2 1\n2 1\n1 2",
"output": "312"
},
{
"input": "25\n91 57\n2 73\n54 57\n2 57\n23 57\n2 6\n57 54\n57 23\n91 54\n91 23\n57 23\n91 57\n54 2\n6 91\n57 54\n2 57\n57 91\n73 91\n57 23\n91 57\n2 73\n91 2\n23 6\n2 73\n23 6",
"output": "96"
},
{
"input": "28\n31 66\n31 91\n91 31\n97 66\n31 66\n31 66\n66 91\n91 31\n97 31\n91 97\n97 31\n66 31\n66 97\n91 31\n31 66\n31 66\n66 31\n31 97\n66 97\n97 31\n31 91\n66 91\n91 66\n31 66\n91 66\n66 31\n66 31\n91 97",
"output": "210"
},
{
"input": "29\n78 27\n50 68\n24 26\n68 43\n38 78\n26 38\n78 28\n28 26\n27 24\n23 38\n24 26\n24 43\n61 50\n38 78\n27 23\n61 26\n27 28\n43 23\n28 78\n43 27\n43 78\n27 61\n28 38\n61 78\n50 26\n43 27\n26 78\n28 50\n43 78",
"output": "73"
},
{
"input": "29\n80 27\n69 80\n27 80\n69 80\n80 27\n80 27\n80 27\n80 69\n27 69\n80 69\n80 27\n27 69\n69 27\n80 69\n27 69\n69 80\n27 69\n80 69\n80 27\n69 27\n27 69\n27 80\n80 27\n69 80\n27 69\n80 69\n69 80\n69 80\n27 80",
"output": "277"
},
{
"input": "30\n19 71\n7 89\n89 71\n21 7\n19 21\n7 89\n19 71\n89 8\n89 21\n19 8\n21 7\n8 89\n19 89\n7 21\n19 8\n19 7\n7 19\n8 21\n71 21\n71 89\n7 19\n7 19\n21 7\n21 19\n21 19\n71 8\n21 8\n71 19\n19 71\n8 21",
"output": "154"
},
{
"input": "30\n44 17\n44 17\n44 17\n17 44\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n44 17\n44 17\n44 17\n17 44\n17 44\n17 44\n44 17\n44 17\n17 44\n44 17\n44 17\n44 17\n17 44\n17 44\n44 17\n17 44\n44 17\n44 17\n44 17",
"output": "418"
},
{
"input": "22\n78 92\n15 92\n92 78\n78 80\n92 16\n24 80\n92 16\n16 92\n78 16\n24 78\n80 78\n92 80\n16 80\n80 78\n15 78\n92 16\n24 15\n24 80\n80 16\n16 80\n92 80\n24 80",
"output": "74"
},
{
"input": "24\n9 83\n90 31\n83 3\n83 3\n21 31\n83 3\n32 31\n12 21\n31 21\n90 32\n32 21\n12 9\n12 31\n9 83\n83 12\n32 3\n32 83\n90 31\n9 32\n31 21\n83 90\n32 21\n21 3\n32 9",
"output": "59"
},
{
"input": "30\n67 21\n85 39\n85 87\n21 39\n66 85\n10 95\n10 21\n87 85\n82 21\n67 21\n95 10\n21 39\n82 21\n21 66\n66 39\n95 30\n67 85\n66 82\n85 82\n21 66\n10 39\n67 10\n21 85\n10 82\n85 95\n10 85\n21 39\n85 39\n39 10\n95 67",
"output": "100"
},
{
"input": "4\n8 7\n8 7\n7 8\n7 8",
"output": "8"
},
{
"input": "6\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1",
"output": "10"
},
{
"input": "12\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1",
"output": "72"
},
{
"input": "4\n1 2\n1 2\n2 1\n2 1",
"output": "8"
}
] | 1,680,413,522 | 2,147,483,647 | Python 3 | OK | TESTS | 31 | 92 | 0 | n = int(input())
home = {}
away = {}
ahome = []
aaway = []
for _ in range(n) :
d = input().split()
n = [int(i) for i in d]
home[n[0]] = 0
away[n[1]] = 0
ahome.append(n[0])
aaway.append(n[1])
r= 0
for i in range(len(ahome)):
home[ahome[i]]+=1
away[aaway[i]]+=1
for i in home.keys():
if i in away.keys():
r+= away[i]*home[i]
print(r) | Title: Games
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Manao works on a sports TV. He's spent much time watching the football games of some country. After a while he began to notice different patterns. For example, each team has two sets of uniforms: home uniform and guest uniform. When a team plays a game at home, the players put on the home uniform. When a team plays as a guest on somebody else's stadium, the players put on the guest uniform. The only exception to that rule is: when the home uniform color of the host team matches the guests' uniform, the host team puts on its guest uniform as well. For each team the color of the home and guest uniform is different.
There are *n* teams taking part in the national championship. The championship consists of *n*·(*n*<=-<=1) games: each team invites each other team to its stadium. At this point Manao wondered: how many times during the championship is a host team going to put on the guest uniform? Note that the order of the games does not affect this number.
You know the colors of the home and guest uniform for each team. For simplicity, the colors are numbered by integers in such a way that no two distinct colors have the same number. Help Manao find the answer to his question.
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=30). Each of the following *n* lines contains a pair of distinct space-separated integers *h**i*, *a**i* (1<=≤<=*h**i*,<=*a**i*<=≤<=100) — the colors of the *i*-th team's home and guest uniforms, respectively.
Output Specification:
In a single line print the number of games where the host team is going to play in the guest uniform.
Demo Input:
['3\n1 2\n2 4\n3 4\n', '4\n100 42\n42 100\n5 42\n100 5\n', '2\n1 2\n1 2\n']
Demo Output:
['1\n', '5\n', '0\n']
Note:
In the first test case the championship consists of 6 games. The only game with the event in question is the game between teams 2 and 1 on the stadium of team 2.
In the second test sample the host team will have to wear guest uniform in the games between teams: 1 and 2, 2 and 1, 2 and 3, 3 and 4, 4 and 2 (the host team is written first). | ```python
n = int(input())
home = {}
away = {}
ahome = []
aaway = []
for _ in range(n) :
d = input().split()
n = [int(i) for i in d]
home[n[0]] = 0
away[n[1]] = 0
ahome.append(n[0])
aaway.append(n[1])
r= 0
for i in range(len(ahome)):
home[ahome[i]]+=1
away[aaway[i]]+=1
for i in home.keys():
if i in away.keys():
r+= away[i]*home[i]
print(r)
``` | 3 |
|
322 | B | Ciel and Flowers | PROGRAMMING | 1,600 | [
"combinatorics",
"math"
] | null | null | Fox Ciel has some flowers: *r* red flowers, *g* green flowers and *b* blue flowers. She wants to use these flowers to make several bouquets. There are 4 types of bouquets:
- To make a "red bouquet", it needs 3 red flowers. - To make a "green bouquet", it needs 3 green flowers. - To make a "blue bouquet", it needs 3 blue flowers. - To make a "mixing bouquet", it needs 1 red, 1 green and 1 blue flower.
Help Fox Ciel to find the maximal number of bouquets she can make. | The first line contains three integers *r*, *g* and *b* (0<=≤<=*r*,<=*g*,<=*b*<=≤<=109) — the number of red, green and blue flowers. | Print the maximal number of bouquets Fox Ciel can make. | [
"3 6 9\n",
"4 4 4\n",
"0 0 0\n"
] | [
"6\n",
"4\n",
"0\n"
] | In test case 1, we can make 1 red bouquet, 2 green bouquets and 3 blue bouquets.
In test case 2, we can make 1 red, 1 green, 1 blue and 1 mixing bouquet. | 1,000 | [
{
"input": "3 6 9",
"output": "6"
},
{
"input": "4 4 4",
"output": "4"
},
{
"input": "0 0 0",
"output": "0"
},
{
"input": "0 3 6",
"output": "3"
},
{
"input": "7 8 9",
"output": "7"
},
{
"input": "8 8 9",
"output": "8"
},
{
"input": "15 3 999",
"output": "339"
},
{
"input": "32 62 92",
"output": "62"
},
{
"input": "123456789 123456789 123456789",
"output": "123456789"
},
{
"input": "3 5 5",
"output": "4"
},
{
"input": "666806767 385540591 357848286",
"output": "470065214"
},
{
"input": "80010646 727118126 817880463",
"output": "541669744"
},
{
"input": "829651016 732259171 572879931",
"output": "711596705"
},
{
"input": "242854896 442432924 180395753",
"output": "288561190"
},
{
"input": "139978911 5123031 935395222",
"output": "360165721"
},
{
"input": "553182792 10264076 395427398",
"output": "319624755"
},
{
"input": "597790453 720437830 855459575",
"output": "724562619"
},
{
"input": "494914467 356982656 757942689",
"output": "536613270"
},
{
"input": "908118348 67156409 217974865",
"output": "397749873"
},
{
"input": "952726009 629846517 972974334",
"output": "851848953"
},
{
"input": "775140200 616574841 630329230",
"output": "674014756"
},
{
"input": "524780569 326748594 90361407",
"output": "313963523"
},
{
"input": "937984449 184405994 992844522",
"output": "705078321"
},
{
"input": "835108464 525983528 452876698",
"output": "604656229"
},
{
"input": "879716125 531124573 207876166",
"output": "539572288"
},
{
"input": "292920005 241298326 667908343",
"output": "400708891"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1000000000"
},
{
"input": "1000000000 999999999 999999998",
"output": "999999998"
},
{
"input": "999999998 999999998 999999999",
"output": "999999998"
},
{
"input": "0 1 1",
"output": "0"
},
{
"input": "0 1000000000 0",
"output": "333333333"
},
{
"input": "0 1 0",
"output": "0"
},
{
"input": "1 0 0",
"output": "0"
},
{
"input": "0 2 2",
"output": "0"
},
{
"input": "3 3 5",
"output": "3"
},
{
"input": "2 2 0",
"output": "0"
},
{
"input": "0 5 5",
"output": "2"
},
{
"input": "2 0 11",
"output": "3"
},
{
"input": "9 9 7",
"output": "8"
},
{
"input": "65 30 74",
"output": "56"
}
] | 1,662,472,338 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 5 | 92 | 0 | r, b, g = list(map(int, input().split()))
total = 0
total += r//3
total += g//3
total += b//3
r %= 3
g %= 3
b %= 3
total += min(r, g, b)
print(total)
| Title: Ciel and Flowers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel has some flowers: *r* red flowers, *g* green flowers and *b* blue flowers. She wants to use these flowers to make several bouquets. There are 4 types of bouquets:
- To make a "red bouquet", it needs 3 red flowers. - To make a "green bouquet", it needs 3 green flowers. - To make a "blue bouquet", it needs 3 blue flowers. - To make a "mixing bouquet", it needs 1 red, 1 green and 1 blue flower.
Help Fox Ciel to find the maximal number of bouquets she can make.
Input Specification:
The first line contains three integers *r*, *g* and *b* (0<=≤<=*r*,<=*g*,<=*b*<=≤<=109) — the number of red, green and blue flowers.
Output Specification:
Print the maximal number of bouquets Fox Ciel can make.
Demo Input:
['3 6 9\n', '4 4 4\n', '0 0 0\n']
Demo Output:
['6\n', '4\n', '0\n']
Note:
In test case 1, we can make 1 red bouquet, 2 green bouquets and 3 blue bouquets.
In test case 2, we can make 1 red, 1 green, 1 blue and 1 mixing bouquet. | ```python
r, b, g = list(map(int, input().split()))
total = 0
total += r//3
total += g//3
total += b//3
r %= 3
g %= 3
b %= 3
total += min(r, g, b)
print(total)
``` | 0 |
|
0 | none | none | none | 0 | [
"none"
] | null | null | Vlad likes to eat in cafes very much. During his life, he has visited cafes *n* times. Unfortunately, Vlad started to feel that his last visits are not any different from each other. To fix that Vlad had a small research.
First of all, Vlad assigned individual indices to all cafes. Then, he wrote down indices of cafes he visited in a row, in order of visiting them. Now, Vlad wants to find such a cafe that his last visit to that cafe was before his last visits to every other cafe. In other words, he wants to find such a cafe that he hasn't been there for as long as possible. Help Vlad to find that cafe. | In first line there is one integer *n* (1<=≤<=*n*<=≤<=2·105) — number of cafes indices written by Vlad.
In second line, *n* numbers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=2·105) are written — indices of cafes in order of being visited by Vlad. Vlad could visit some cafes more than once. Note that in numeration, some indices could be omitted. | Print one integer — index of the cafe that Vlad hasn't visited for as long as possible. | [
"5\n1 3 2 1 2\n",
"6\n2 1 2 2 4 1\n"
] | [
"3\n",
"2\n"
] | In first test, there are three cafes, and the last visits to cafes with indices 1 and 2 were after the last visit to cafe with index 3; so this cafe is the answer.
In second test case, there are also three cafes, but with indices 1, 2 and 4. Cafes with indices 1 and 4 were visited after the last visit of cafe with index 2, so the answer is 2. Note that Vlad could omit some numbers while numerating the cafes. | 0 | [
{
"input": "5\n1 3 2 1 2",
"output": "3"
},
{
"input": "6\n2 1 2 2 4 1",
"output": "2"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "1\n200000",
"output": "200000"
},
{
"input": "2\n2018 2017",
"output": "2018"
},
{
"input": "5\n100 1000 1000 1000 1000",
"output": "100"
},
{
"input": "8\n200000 1 200000 1 200000 1 200000 2",
"output": "1"
},
{
"input": "5\n20000 1 2 3 4",
"output": "20000"
},
{
"input": "2\n200000 1",
"output": "200000"
},
{
"input": "3\n2 100 2",
"output": "100"
},
{
"input": "2\n10 1",
"output": "10"
},
{
"input": "11\n1 1 1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "3\n5 5 5",
"output": "5"
},
{
"input": "2\n5 1",
"output": "5"
}
] | 1,688,459,500 | 2,147,483,647 | PyPy 3-64 | RUNTIME_ERROR | TESTS | 4 | 170 | 26,931,200 | n = int(input())
a = [int(x) for x in input().split()]
b = list(set(a))
a = a[::-1]
for x in a:
if len(b) == 1:
print(b[0])
break
b.remove(x) | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vlad likes to eat in cafes very much. During his life, he has visited cafes *n* times. Unfortunately, Vlad started to feel that his last visits are not any different from each other. To fix that Vlad had a small research.
First of all, Vlad assigned individual indices to all cafes. Then, he wrote down indices of cafes he visited in a row, in order of visiting them. Now, Vlad wants to find such a cafe that his last visit to that cafe was before his last visits to every other cafe. In other words, he wants to find such a cafe that he hasn't been there for as long as possible. Help Vlad to find that cafe.
Input Specification:
In first line there is one integer *n* (1<=≤<=*n*<=≤<=2·105) — number of cafes indices written by Vlad.
In second line, *n* numbers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=2·105) are written — indices of cafes in order of being visited by Vlad. Vlad could visit some cafes more than once. Note that in numeration, some indices could be omitted.
Output Specification:
Print one integer — index of the cafe that Vlad hasn't visited for as long as possible.
Demo Input:
['5\n1 3 2 1 2\n', '6\n2 1 2 2 4 1\n']
Demo Output:
['3\n', '2\n']
Note:
In first test, there are three cafes, and the last visits to cafes with indices 1 and 2 were after the last visit to cafe with index 3; so this cafe is the answer.
In second test case, there are also three cafes, but with indices 1, 2 and 4. Cafes with indices 1 and 4 were visited after the last visit of cafe with index 2, so the answer is 2. Note that Vlad could omit some numbers while numerating the cafes. | ```python
n = int(input())
a = [int(x) for x in input().split()]
b = list(set(a))
a = a[::-1]
for x in a:
if len(b) == 1:
print(b[0])
break
b.remove(x)
``` | -1 |
|
358 | A | Dima and Continuous Line | PROGRAMMING | 1,400 | [
"brute force",
"implementation"
] | null | null | Dima and Seryozha live in an ordinary dormitory room for two. One day Dima had a date with his girl and he asked Seryozha to leave the room. As a compensation, Seryozha made Dima do his homework.
The teacher gave Seryozha the coordinates of *n* distinct points on the abscissa axis and asked to consecutively connect them by semi-circus in a certain order: first connect the first point with the second one, then connect the second point with the third one, then the third one with the fourth one and so on to the *n*-th point. Two points with coordinates (*x*1,<=0) and (*x*2,<=0) should be connected by a semi-circle that passes above the abscissa axis with the diameter that coincides with the segment between points. Seryozha needs to find out if the line on the picture intersects itself. For clarifications, see the picture Seryozha showed to Dima (the left picture has self-intersections, the right picture doesn't have any).
Seryozha is not a small boy, so the coordinates of the points can be rather large. Help Dima cope with the problem. | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=103). The second line contains *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=106<=≤<=*x**i*<=≤<=106) — the *i*-th point has coordinates (*x**i*,<=0). The points are not necessarily sorted by their *x* coordinate. | In the single line print "yes" (without the quotes), if the line has self-intersections. Otherwise, print "no" (without the quotes). | [
"4\n0 10 5 15\n",
"4\n0 15 5 10\n"
] | [
"yes\n",
"no\n"
] | The first test from the statement is on the picture to the left, the second test is on the picture to the right. | 500 | [
{
"input": "4\n0 10 5 15",
"output": "yes"
},
{
"input": "4\n0 15 5 10",
"output": "no"
},
{
"input": "5\n0 1000 2000 3000 1500",
"output": "yes"
},
{
"input": "5\n-724093 710736 -383722 -359011 439613",
"output": "no"
},
{
"input": "50\n384672 661179 -775591 -989608 611120 442691 601796 502406 384323 -315945 -934146 873993 -156910 -94123 -930137 208544 816236 466922 473696 463604 794454 -872433 -149791 -858684 -467655 -555239 623978 -217138 -408658 493342 -733576 -350871 711210 884148 -426172 519986 -356885 527171 661680 977247 141654 906254 -961045 -759474 -48634 891473 -606365 -513781 -966166 27696",
"output": "yes"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "no"
},
{
"input": "11\n1 11 10 2 3 9 8 4 5 7 6",
"output": "no"
},
{
"input": "10\n3 2 4 5 1 6 9 7 8 10",
"output": "yes"
},
{
"input": "11\n3 4 2 5 1 6 11 7 10 8 9",
"output": "no"
},
{
"input": "15\n0 -1 1 2 3 13 12 4 11 10 5 6 7 9 8",
"output": "no"
},
{
"input": "16\n6 7 8 9 5 10 11 12 13 14 15 4 16 2 1 3",
"output": "yes"
},
{
"input": "1\n0",
"output": "no"
},
{
"input": "4\n3 1 4 2",
"output": "yes"
},
{
"input": "5\n0 2 4 -2 5",
"output": "no"
},
{
"input": "5\n1 9 8 7 0",
"output": "yes"
},
{
"input": "3\n5 10 0",
"output": "no"
},
{
"input": "6\n1 3 -1 5 2 4",
"output": "yes"
},
{
"input": "4\n3 2 4 1",
"output": "no"
},
{
"input": "4\n10 5 15 0",
"output": "no"
},
{
"input": "2\n-5 -10",
"output": "no"
},
{
"input": "3\n1 0 3",
"output": "no"
},
{
"input": "4\n-2 -4 1 -3",
"output": "yes"
},
{
"input": "4\n3 6 0 2",
"output": "no"
},
{
"input": "4\n-9 10 -10 0",
"output": "yes"
},
{
"input": "4\n5 10 1 15",
"output": "no"
},
{
"input": "3\n1 0 2",
"output": "no"
},
{
"input": "4\n2 3 4 1",
"output": "no"
},
{
"input": "4\n7 5 9 12",
"output": "no"
}
] | 1,548,582,914 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 10 | 108 | 0 | n=int(input())
l=list(map(int,input().split()))
maxx=l[0]
minn=l[0]
for i in range(0,n-1):
if l[i+1]>l[i]:
if l[i]>minn and l[i]<maxx and l[i+1]>maxx:
print("yes")
exit()
elif l[i]<minn and l[i+1]>minn and l[i+1]<maxx :
print("yes")
exit()
else:
if l[i]>maxx:
maxx=l[i]
if l[i]<minn:
minn=l[i]
elif l[i+1]<l[i]:
if l[i+1]>minn and l[i+1]<maxx:
print("yes")
exit()
else:
if l[i]>maxx:
maxx=l[i]
if l[i]<minn:
minn=l[i]
print("no")
| Title: Dima and Continuous Line
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dima and Seryozha live in an ordinary dormitory room for two. One day Dima had a date with his girl and he asked Seryozha to leave the room. As a compensation, Seryozha made Dima do his homework.
The teacher gave Seryozha the coordinates of *n* distinct points on the abscissa axis and asked to consecutively connect them by semi-circus in a certain order: first connect the first point with the second one, then connect the second point with the third one, then the third one with the fourth one and so on to the *n*-th point. Two points with coordinates (*x*1,<=0) and (*x*2,<=0) should be connected by a semi-circle that passes above the abscissa axis with the diameter that coincides with the segment between points. Seryozha needs to find out if the line on the picture intersects itself. For clarifications, see the picture Seryozha showed to Dima (the left picture has self-intersections, the right picture doesn't have any).
Seryozha is not a small boy, so the coordinates of the points can be rather large. Help Dima cope with the problem.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=103). The second line contains *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=106<=≤<=*x**i*<=≤<=106) — the *i*-th point has coordinates (*x**i*,<=0). The points are not necessarily sorted by their *x* coordinate.
Output Specification:
In the single line print "yes" (without the quotes), if the line has self-intersections. Otherwise, print "no" (without the quotes).
Demo Input:
['4\n0 10 5 15\n', '4\n0 15 5 10\n']
Demo Output:
['yes\n', 'no\n']
Note:
The first test from the statement is on the picture to the left, the second test is on the picture to the right. | ```python
n=int(input())
l=list(map(int,input().split()))
maxx=l[0]
minn=l[0]
for i in range(0,n-1):
if l[i+1]>l[i]:
if l[i]>minn and l[i]<maxx and l[i+1]>maxx:
print("yes")
exit()
elif l[i]<minn and l[i+1]>minn and l[i+1]<maxx :
print("yes")
exit()
else:
if l[i]>maxx:
maxx=l[i]
if l[i]<minn:
minn=l[i]
elif l[i+1]<l[i]:
if l[i+1]>minn and l[i+1]<maxx:
print("yes")
exit()
else:
if l[i]>maxx:
maxx=l[i]
if l[i]<minn:
minn=l[i]
print("no")
``` | 0 |
|
235 | A | LCM Challenge | PROGRAMMING | 1,600 | [
"number theory"
] | null | null | Some days ago, I learned the concept of LCM (least common multiple). I've played with it for several times and I want to make a big number with it.
But I also don't want to use many numbers, so I'll choose three positive integers (they don't have to be distinct) which are not greater than *n*. Can you help me to find the maximum possible least common multiple of these three integers? | The first line contains an integer *n* (1<=≤<=*n*<=≤<=106) — the *n* mentioned in the statement. | Print a single integer — the maximum possible LCM of three not necessarily distinct positive integers that are not greater than *n*. | [
"9\n",
"7\n"
] | [
"504\n",
"210\n"
] | The least common multiple of some positive integers is the least positive integer which is multiple for each of them.
The result may become very large, 32-bit integer won't be enough. So using 64-bit integers is recommended.
For the last example, we can chose numbers 7, 6, 5 and the LCM of them is 7·6·5 = 210. It is the maximum value we can get. | 500 | [
{
"input": "9",
"output": "504"
},
{
"input": "7",
"output": "210"
},
{
"input": "1",
"output": "1"
},
{
"input": "5",
"output": "60"
},
{
"input": "6",
"output": "60"
},
{
"input": "33",
"output": "32736"
},
{
"input": "21",
"output": "7980"
},
{
"input": "2",
"output": "2"
},
{
"input": "41",
"output": "63960"
},
{
"input": "29",
"output": "21924"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "149",
"output": "3241644"
},
{
"input": "733",
"output": "392222436"
},
{
"input": "925",
"output": "788888100"
},
{
"input": "509",
"output": "131096004"
},
{
"input": "829",
"output": "567662724"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "925",
"output": "788888100"
},
{
"input": "213",
"output": "9527916"
},
{
"input": "53",
"output": "140556"
},
{
"input": "341",
"output": "39303660"
},
{
"input": "21",
"output": "7980"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "149",
"output": "3241644"
},
{
"input": "733",
"output": "392222436"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "53",
"output": "140556"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "829",
"output": "567662724"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "20",
"output": "6460"
},
{
"input": "604",
"output": "218891412"
},
{
"input": "796",
"output": "501826260"
},
{
"input": "732",
"output": "389016270"
},
{
"input": "412",
"output": "69256788"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "244",
"output": "14289372"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "796",
"output": "501826260"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "21",
"output": "7980"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "116",
"output": "1507420"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "732",
"output": "389016270"
},
{
"input": "20",
"output": "6460"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "148",
"output": "3154620"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "763116",
"output": "444394078546562430"
},
{
"input": "756604",
"output": "433115377058855412"
},
{
"input": "447244",
"output": "89460162932862372"
},
{
"input": "372636",
"output": "51742503205363470"
},
{
"input": "546924",
"output": "163597318076822526"
},
{
"input": "540412",
"output": "157823524476316788"
},
{
"input": "714700",
"output": "365063922340784100"
},
{
"input": "520731",
"output": "141201007712496270"
},
{
"input": "695019",
"output": "335728459024850814"
},
{
"input": "688507",
"output": "326379736779169710"
},
{
"input": "862795",
"output": "642275489615199390"
},
{
"input": "668827",
"output": "299184742915995150"
},
{
"input": "810411",
"output": "532248411551110590"
},
{
"input": "836603",
"output": "585540171302562606"
},
{
"input": "978187",
"output": "935975171582120670"
},
{
"input": "816923",
"output": "545182335484592526"
},
{
"input": "958507",
"output": "880611813728059710"
},
{
"input": "984699",
"output": "954792870629291694"
},
{
"input": "642635",
"output": "265393998349453470"
},
{
"input": "296604",
"output": "26092892528622606"
},
{
"input": "1000000",
"output": "999996000003000000"
},
{
"input": "8",
"output": "280"
},
{
"input": "3",
"output": "6"
},
{
"input": "4",
"output": "12"
},
{
"input": "30",
"output": "21924"
},
{
"input": "18",
"output": "4080"
},
{
"input": "12",
"output": "990"
}
] | 1,615,473,136 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 4 | 186 | 0 | n=int(input())
def gcd(a,b):
maxi=max(a,b)
mini=min(a,b)
if(mini==0):
return maxi
while(maxi%mini):
tmp=maxi
maxi=mini
mini=tmp%mini
return mini
tmp=n
gc=n
cnt=1
for i in range(n-1,0,-1):
tp=gcd(n,i)
if(cnt==3):
break
if(tp==1):
tmp*=i
cnt+=1
print(tmp) | Title: LCM Challenge
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Some days ago, I learned the concept of LCM (least common multiple). I've played with it for several times and I want to make a big number with it.
But I also don't want to use many numbers, so I'll choose three positive integers (they don't have to be distinct) which are not greater than *n*. Can you help me to find the maximum possible least common multiple of these three integers?
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=106) — the *n* mentioned in the statement.
Output Specification:
Print a single integer — the maximum possible LCM of three not necessarily distinct positive integers that are not greater than *n*.
Demo Input:
['9\n', '7\n']
Demo Output:
['504\n', '210\n']
Note:
The least common multiple of some positive integers is the least positive integer which is multiple for each of them.
The result may become very large, 32-bit integer won't be enough. So using 64-bit integers is recommended.
For the last example, we can chose numbers 7, 6, 5 and the LCM of them is 7·6·5 = 210. It is the maximum value we can get. | ```python
n=int(input())
def gcd(a,b):
maxi=max(a,b)
mini=min(a,b)
if(mini==0):
return maxi
while(maxi%mini):
tmp=maxi
maxi=mini
mini=tmp%mini
return mini
tmp=n
gc=n
cnt=1
for i in range(n-1,0,-1):
tp=gcd(n,i)
if(cnt==3):
break
if(tp==1):
tmp*=i
cnt+=1
print(tmp)
``` | 0 |
|
141 | A | Amusing Joke | PROGRAMMING | 800 | [
"implementation",
"sortings",
"strings"
] | null | null | So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door.
The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters.
Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning. | The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100. | Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes. | [
"SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n",
"PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n",
"BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left.
In the second sample letter "P" is missing from the pile and there's an extra letter "L".
In the third sample there's an extra letter "L". | 500 | [
{
"input": "SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS",
"output": "YES"
},
{
"input": "PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI",
"output": "NO"
},
{
"input": "BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER",
"output": "NO"
},
{
"input": "B\nA\nAB",
"output": "YES"
},
{
"input": "ONDOL\nJNPB\nONLNJBODP",
"output": "YES"
},
{
"input": "Y\nW\nYW",
"output": "YES"
},
{
"input": "OI\nM\nIMO",
"output": "YES"
},
{
"input": "VFQRWWWACX\nGHZJPOQUSXRAQDGOGMR\nOPAWDOUSGWWCGQXXQAZJRQRGHRMVF",
"output": "YES"
},
{
"input": "JUTCN\nPIGMZOPMEUFADQBW\nNWQGZMAIPUPOMCDUB",
"output": "NO"
},
{
"input": "Z\nO\nZOCNDOLTBZKQLTBOLDEGXRHZGTTPBJBLSJCVSVXISQZCSFDEBXRCSGBGTHWOVIXYHACAGBRYBKBJAEPIQZHVEGLYH",
"output": "NO"
},
{
"input": "IQ\nOQ\nQOQIGGKFNHJSGCGM",
"output": "NO"
},
{
"input": "ROUWANOPNIGTVMIITVMZ\nOQTUPZMTKUGY\nVTVNGZITGPUNPMQOOATUUIYIWMMKZOTR",
"output": "YES"
},
{
"input": "OVQELLOGFIOLEHXMEMBJDIGBPGEYFG\nJNKFPFFIJOFHRIFHXEWYZOPDJBZTJZKBWQTECNHRFSJPJOAPQT\nYAIPFFFEXJJNEJPLREIGODEGQZVMCOBDFKWTMWJSBEBTOFFQOHIQJLHFNXIGOHEZRZLFOKJBJPTPHPGY",
"output": "YES"
},
{
"input": "NBJGVNGUISUXQTBOBKYHQCOOVQWUXWPXBUDLXPKX\nNSFQDFUMQDQWQ\nWXKKVNTDQQFXCUQBIMQGQHSLVGWSBFYBUPOWPBDUUJUXQNOQDNXOX",
"output": "YES"
},
{
"input": "IJHHGKCXWDBRWJUPRDBZJLNTTNWKXLUGJSBWBOAUKWRAQWGFNL\nNJMWRMBCNPHXTDQQNZ\nWDNJRCLILNQRHWBANLTXWMJBPKUPGKJDJZAQWKTZFBRCTXHHBNXRGUQUNBNMWODGSJWW",
"output": "YES"
},
{
"input": "SRROWANGUGZHCIEFYMQVTWVOMDWPUZJFRDUMVFHYNHNTTGNXCJ\nDJYWGLBFCCECXFHOLORDGDCNRHPWXNHXFCXQCEZUHRRNAEKUIX\nWCUJDNYHNHYOPWMHLDCDYRWBVOGHFFUKOZTXJRXJHRGWICCMRNEVNEGQWTZPNFCSHDRFCFQDCXMHTLUGZAXOFNXNVGUEXIACRERU",
"output": "YES"
},
{
"input": "H\nJKFGHMIAHNDBMFXWYQLZRSVNOTEGCQSVUBYUOZBTNKTXPFQDCMKAGFITEUGOYDFIYQIORMFJEOJDNTFVIQEBICSNGKOSNLNXJWC\nBQSVDOGIHCHXSYNYTQFCHNJGYFIXTSOQINZOKSVQJMTKNTGFNXAVTUYEONMBQMGJLEWJOFGEARIOPKFUFCEMUBRBDNIIDFZDCLWK",
"output": "YES"
},
{
"input": "DSWNZRFVXQ\nPVULCZGOOU\nUOLVZXNUPOQRZGWFVDSCANQTCLEIE",
"output": "NO"
},
{
"input": "EUHTSCENIPXLTSBMLFHD\nIZAVSZPDLXOAGESUSE\nLXAELAZ",
"output": "NO"
},
{
"input": "WYSJFEREGELSKRQRXDXCGBODEFZVSI\nPEJKMGFLBFFDWRCRFSHVEFLEBTJCVCHRJTLDTISHPOGFWPLEWNYJLMXWIAOTYOXMV\nHXERTZWLEXTPIOTFRVMEJVYFFJLRPFMXDEBNSGCEOFFCWTKIDDGCFYSJKGLHBORWEPLDRXRSJYBGASSVCMHEEJFLVI",
"output": "NO"
},
{
"input": "EPBMDIUQAAUGLBIETKOKFLMTCVEPETWJRHHYKCKU\nHGMAETVPCFZYNNKDQXVXUALHYLOTCHM\nECGXACVKEYMCEDOTMKAUFHLHOMT",
"output": "NO"
},
{
"input": "NUBKQEJHALANSHEIFUZHYEZKKDRFHQKAJHLAOWTZIMOCWOVVDW\nEFVOBIGAUAUSQGVSNBKNOBDMINODMFSHDL\nKLAMKNTHBFFOHVKWICHBKNDDQNEISODUSDNLUSIOAVWY",
"output": "NO"
},
{
"input": "VXINHOMEQCATZUGAJEIUIZZLPYFGUTVLNBNWCUVMEENUXKBWBGZTMRJJVJDLVSLBABVCEUDDSQFHOYPYQTWVAGTWOLKYISAGHBMC\nZMRGXPZSHOGCSAECAPGVOIGCWEOWWOJXLGYRDMPXBLOKZVRACPYQLEQGFQCVYXAGBEBELUTDAYEAGPFKXRULZCKFHZCHVCWIRGPK\nRCVUXGQVNWFGRUDLLENNDQEJHYYVWMKTLOVIPELKPWCLSQPTAXAYEMGWCBXEVAIZGGDDRBRT",
"output": "NO"
},
{
"input": "PHBDHHWUUTZAHELGSGGOPOQXSXEZIXHZTOKYFBQLBDYWPVCNQSXHEAXRRPVHFJBVBYCJIFOTQTWSUOWXLKMVJJBNLGTVITWTCZZ\nFUPDLNVIHRWTEEEHOOEC\nLOUSUUSZCHJBPEWIILUOXEXRQNCJEGTOBRVZLTTZAHTKVEJSNGHFTAYGY",
"output": "NO"
},
{
"input": "GDSLNIIKTO\nJF\nPDQYFKDTNOLI",
"output": "NO"
},
{
"input": "AHOKHEKKPJLJIIWJRCGY\nORELJCSIX\nZVWPXVFWFSWOXXLIHJKPXIOKRELYE",
"output": "NO"
},
{
"input": "ZWCOJFORBPHXCOVJIDPKVECMHVHCOC\nTEV\nJVGTBFTLFVIEPCCHODOFOMCVZHWXVCPEH",
"output": "NO"
},
{
"input": "AGFIGYWJLVMYZGNQHEHWKJIAWBPUAQFERMCDROFN\nPMJNHMVNRGCYZAVRWNDSMLSZHFNYIUWFPUSKKIGU\nMCDVPPRXGUAYLSDRHRURZASXUWZSIIEZCPXUVEONKNGNWRYGOSFMCKESMVJZHWWUCHWDQMLASLNNMHAU",
"output": "NO"
},
{
"input": "XLOWVFCZSSXCSYQTIIDKHNTKNKEEDFMDZKXSPVLBIDIREDUAIN\nZKIWNDGBISDB\nSLPKLYFYSRNRMOSWYLJJDGFFENPOXYLPZFTQDANKBDNZDIIEWSUTTKYBKVICLG",
"output": "NO"
},
{
"input": "PMUKBTRKFIAYVGBKHZHUSJYSSEPEOEWPOSPJLWLOCTUYZODLTUAFCMVKGQKRRUSOMPAYOTBTFPXYAZXLOADDEJBDLYOTXJCJYTHA\nTWRRAJLCQJTKOKWCGUH\nEWDPNXVCXWCDQCOYKKSOYTFSZTOOPKPRDKFJDETKSRAJRVCPDOBWUGPYRJPUWJYWCBLKOOTUPBESTOFXZHTYLLMCAXDYAEBUTAHM",
"output": "NO"
},
{
"input": "QMIMGQRQDMJDPNFEFXSXQMCHEJKTWCTCVZPUAYICOIRYOWKUSIWXJLHDYWSBOITHTMINXFKBKAWZTXXBJIVYCRWKXNKIYKLDDXL\nV\nFWACCXBVDOJFIUAVYRALBYJKXXWIIFORRUHKHCXLDBZMXIYJWISFEAWTIQFIZSBXMKNOCQKVKRWDNDAMQSTKYLDNYVTUCGOJXJTW",
"output": "NO"
},
{
"input": "XJXPVOOQODELPPWUISSYVVXRJTYBPDHJNENQEVQNVFIXSESKXVYPVVHPMOSX\nLEXOPFPVPSZK\nZVXVPYEYOYXVOISVLXPOVHEQVXPNQJIOPFDTXEUNMPEPPHELNXKKWSVSOXSBPSJDPVJVSRFQ",
"output": "YES"
},
{
"input": "OSKFHGYNQLSRFSAHPXKGPXUHXTRBJNAQRBSSWJVEENLJCDDHFXVCUNPZAIVVO\nFNUOCXAGRRHNDJAHVVLGGEZQHWARYHENBKHP\nUOEFNWVXCUNERLKVTHAGPSHKHDYFPYWZHJKHQLSNFBJHVJANRXCNSDUGVDABGHVAOVHBJZXGRACHRXEGNRPQEAPORQSILNXFS",
"output": "YES"
},
{
"input": "VYXYVVACMLPDHONBUTQFZTRREERBLKUJYKAHZRCTRLRCLOZYWVPBRGDQPFPQIF\nFE\nRNRPEVDRLYUQFYRZBCQLCYZEABKLRXCJLKVZBVFUEYRATOMDRTHFPGOWQVTIFPPH",
"output": "YES"
},
{
"input": "WYXUZQJQNLASEGLHPMSARWMTTQMQLVAZLGHPIZTRVTCXDXBOLNXZPOFCTEHCXBZ\nBLQZRRWP\nGIQZXPLTTMNHQVWPPEAPLOCDMBSTHRCFLCQRRZXLVAOQEGZBRUZJXXZTMAWLZHSLWNQTYXB",
"output": "YES"
},
{
"input": "MKVJTSSTDGKPVVDPYSRJJYEVGKBMSIOKHLZQAEWLRIBINVRDAJIBCEITKDHUCCVY\nPUJJQFHOGZKTAVNUGKQUHMKTNHCCTI\nQVJKUSIGTSVYUMOMLEGHWYKSKQTGATTKBNTKCJKJPCAIRJIRMHKBIZISEGFHVUVQZBDERJCVAKDLNTHUDCHONDCVVJIYPP",
"output": "YES"
},
{
"input": "OKNJOEYVMZXJMLVJHCSPLUCNYGTDASKSGKKCRVIDGEIBEWRVBVRVZZTLMCJLXHJIA\nDJBFVRTARTFZOWN\nAGHNVUNJVCPLWSVYBJKZSVTFGLELZASLWTIXDDJXCZDICTVIJOTMVEYOVRNMJGRKKHRMEBORAKFCZJBR",
"output": "YES"
},
{
"input": "OQZACLPSAGYDWHFXDFYFRRXWGIEJGSXWUONAFWNFXDTGVNDEWNQPHUXUJNZWWLBPYL\nOHBKWRFDRQUAFRCMT\nWIQRYXRJQWWRUWCYXNXALKFZGXFTLOODWRDPGURFUFUQOHPWBASZNVWXNCAGHWEHFYESJNFBMNFDDAPLDGT",
"output": "YES"
},
{
"input": "OVIRQRFQOOWVDEPLCJETWQSINIOPLTLXHSQWUYUJNFBMKDNOSHNJQQCDHZOJVPRYVSV\nMYYDQKOOYPOOUELCRIT\nNZSOTVLJTTVQLFHDQEJONEOUOFOLYVSOIYUDNOSIQVIRMVOERCLMYSHPCQKIDRDOQPCUPQBWWRYYOXJWJQPNKH",
"output": "YES"
},
{
"input": "WGMBZWNMSJXNGDUQUJTCNXDSJJLYRDOPEGPQXYUGBESDLFTJRZDDCAAFGCOCYCQMDBWK\nYOBMOVYTUATTFGJLYUQD\nDYXVTLQCYFJUNJTUXPUYOPCBCLBWNSDUJRJGWDOJDSQAAMUOJWSYERDYDXYTMTOTMQCGQZDCGNFBALGGDFKZMEBG",
"output": "YES"
},
{
"input": "CWLRBPMEZCXAPUUQFXCUHAQTLPBTXUUKWVXKBHKNSSJFEXLZMXGVFHHVTPYAQYTIKXJJE\nMUFOSEUEXEQTOVLGDSCWM\nJUKEQCXOXWEHCGKFPBIGMWVJLXUONFXBYTUAXERYTXKCESKLXAEHVPZMMUFTHLXTTZSDMBJLQPEUWCVUHSQQVUASPF",
"output": "YES"
},
{
"input": "IDQRX\nWETHO\nODPDGBHVUVSSISROHQJTUKPUCLXABIZQQPPBPKOSEWGEHRSRRNBAVLYEMZISMWWGKHVTXKUGUXEFBSWOIWUHRJGMWBMHQLDZHBWA",
"output": "NO"
},
{
"input": "IXFDY\nJRMOU\nDF",
"output": "NO"
},
{
"input": "JPSPZ\nUGCUB\nJMZZZZZZZZ",
"output": "NO"
},
{
"input": "AC\nA\nBBA",
"output": "NO"
},
{
"input": "UIKWWKXLSHTOOZOVGXKYSOJEHAUEEG\nKZXQDWJJWRXFHKJDQHJK\nXMZHTFOGEXAUJXXJUYVJIFOTKLZHDKELJWERHMGAWGKWAQKEKHIDWGGZVYOHKXRPWSJDPESFJUMKQYWBYUTHQYEFZUGKQOBHYDWB",
"output": "NO"
},
{
"input": "PXWRXRPFLR\nPJRWWXIVHODV\nXW",
"output": "NO"
},
{
"input": "CHTAZVHGSHCVIBK\nEQINEBKXEPYJSAZIMLDF\nZCZZZZDZMCZZEZDZZEZZZZQZZBZZZOZZCZE",
"output": "NO"
},
{
"input": "GXPZFSELJJNDAXYRV\nUYBKPMVBSOVOJWMONLTJOJCNQKMTAHEWLHOWIIBH\nHCWNFWJPEJIWOVPTBMVCRJLSISSVNOHCKLBFMIUAIMASQWPXEYXBOXQGFEMYJLBKDCZIMJNHOJEDGGANIVYKQTUOSOVOPWHVJGXH",
"output": "NO"
},
{
"input": "LFGJCJJDUTUP\nOVSBILTIYCJCRHKCIXCETJQJJ\nGIJJTJCLTJJJ",
"output": "NO"
},
{
"input": "GIO\nPRL\nPRL",
"output": "NO"
},
{
"input": "A\nB\nABC",
"output": "NO"
},
{
"input": "KKK\nKKK\nZZZZZ",
"output": "NO"
},
{
"input": "ZMYGQLDBLAPN\nZFJBKWHROVNPSJQUDFTHOCGREUFLYIWYICD\nZMJZZEDAZANKZZZZZZEZZBZDZZZZZZKHZZFZZZDZNZMDZZA",
"output": "NO"
}
] | 1,684,173,812 | 2,147,483,647 | Python 3 | OK | TESTS | 54 | 92 | 0 | a=input()
b=input()
c=sorted(input())
d= a+b
if sorted(d) ==c:
print('YES')
else:
print('NO') | Title: Amusing Joke
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door.
The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters.
Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning.
Input Specification:
The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100.
Output Specification:
Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes.
Demo Input:
['SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n', 'PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n', 'BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left.
In the second sample letter "P" is missing from the pile and there's an extra letter "L".
In the third sample there's an extra letter "L". | ```python
a=input()
b=input()
c=sorted(input())
d= a+b
if sorted(d) ==c:
print('YES')
else:
print('NO')
``` | 3 |
|
437 | C | The Child and Toy | PROGRAMMING | 1,400 | [
"graphs",
"greedy",
"sortings"
] | null | null | On Children's Day, the child got a toy from Delayyy as a present. However, the child is so naughty that he can't wait to destroy the toy.
The toy consists of *n* parts and *m* ropes. Each rope links two parts, but every pair of parts is linked by at most one rope. To split the toy, the child must remove all its parts. The child can remove a single part at a time, and each remove consume an energy. Let's define an energy value of part *i* as *v**i*. The child spend *v**f*1<=+<=*v**f*2<=+<=...<=+<=*v**f**k* energy for removing part *i* where *f*1,<=*f*2,<=...,<=*f**k* are the parts that are directly connected to the *i*-th and haven't been removed.
Help the child to find out, what is the minimum total energy he should spend to remove all *n* parts. | The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=1000; 0<=≤<=*m*<=≤<=2000). The second line contains *n* integers: *v*1,<=*v*2,<=...,<=*v**n* (0<=≤<=*v**i*<=≤<=105). Then followed *m* lines, each line contains two integers *x**i* and *y**i*, representing a rope from part *x**i* to part *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=*n*; *x**i*<=≠<=*y**i*).
Consider all the parts are numbered from 1 to *n*. | Output the minimum total energy the child should spend to remove all *n* parts of the toy. | [
"4 3\n10 20 30 40\n1 4\n1 2\n2 3\n",
"4 4\n100 100 100 100\n1 2\n2 3\n2 4\n3 4\n",
"7 10\n40 10 20 10 20 80 40\n1 5\n4 7\n4 5\n5 2\n5 7\n6 4\n1 6\n1 3\n4 3\n1 4\n"
] | [
"40\n",
"400\n",
"160\n"
] | One of the optimal sequence of actions in the first sample is:
- First, remove part 3, cost of the action is 20. - Then, remove part 2, cost of the action is 10. - Next, remove part 4, cost of the action is 10. - At last, remove part 1, cost of the action is 0.
So the total energy the child paid is 20 + 10 + 10 + 0 = 40, which is the minimum.
In the second sample, the child will spend 400 no matter in what order he will remove the parts. | 1,500 | [
{
"input": "4 3\n10 20 30 40\n1 4\n1 2\n2 3",
"output": "40"
},
{
"input": "4 4\n100 100 100 100\n1 2\n2 3\n2 4\n3 4",
"output": "400"
},
{
"input": "7 10\n40 10 20 10 20 80 40\n1 5\n4 7\n4 5\n5 2\n5 7\n6 4\n1 6\n1 3\n4 3\n1 4",
"output": "160"
},
{
"input": "1 0\n23333",
"output": "0"
},
{
"input": "5 4\n1 2 2 2 2\n1 2\n1 3\n1 4\n1 5",
"output": "4"
},
{
"input": "10 30\n3 6 17 15 13 15 6 12 9 1\n3 8\n1 10\n4 7\n1 7\n3 7\n2 9\n8 10\n3 1\n3 4\n8 6\n10 3\n3 9\n2 3\n10 4\n2 10\n5 8\n9 5\n6 1\n2 1\n7 2\n7 6\n7 10\n4 8\n5 6\n3 6\n4 1\n8 9\n7 9\n4 2\n5 10",
"output": "188"
},
{
"input": "3 3\n1 1 1\n1 2\n2 3\n3 1",
"output": "3"
}
] | 1,652,796,595 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 31 | 4,505,600 | from sys import stdin, stdout
input = stdin.readline
print = stdout.write
n, m = map(int, input().rstrip().split())
s = 0
a = [int(i) for i in input().rstrip().split()]
while m:
some = input().rstrip.split()
s+=min(a[int(some[0])], a[int(some[1])])
m-=1
print(f"{s}\n") | Title: The Child and Toy
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
On Children's Day, the child got a toy from Delayyy as a present. However, the child is so naughty that he can't wait to destroy the toy.
The toy consists of *n* parts and *m* ropes. Each rope links two parts, but every pair of parts is linked by at most one rope. To split the toy, the child must remove all its parts. The child can remove a single part at a time, and each remove consume an energy. Let's define an energy value of part *i* as *v**i*. The child spend *v**f*1<=+<=*v**f*2<=+<=...<=+<=*v**f**k* energy for removing part *i* where *f*1,<=*f*2,<=...,<=*f**k* are the parts that are directly connected to the *i*-th and haven't been removed.
Help the child to find out, what is the minimum total energy he should spend to remove all *n* parts.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=1000; 0<=≤<=*m*<=≤<=2000). The second line contains *n* integers: *v*1,<=*v*2,<=...,<=*v**n* (0<=≤<=*v**i*<=≤<=105). Then followed *m* lines, each line contains two integers *x**i* and *y**i*, representing a rope from part *x**i* to part *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=*n*; *x**i*<=≠<=*y**i*).
Consider all the parts are numbered from 1 to *n*.
Output Specification:
Output the minimum total energy the child should spend to remove all *n* parts of the toy.
Demo Input:
['4 3\n10 20 30 40\n1 4\n1 2\n2 3\n', '4 4\n100 100 100 100\n1 2\n2 3\n2 4\n3 4\n', '7 10\n40 10 20 10 20 80 40\n1 5\n4 7\n4 5\n5 2\n5 7\n6 4\n1 6\n1 3\n4 3\n1 4\n']
Demo Output:
['40\n', '400\n', '160\n']
Note:
One of the optimal sequence of actions in the first sample is:
- First, remove part 3, cost of the action is 20. - Then, remove part 2, cost of the action is 10. - Next, remove part 4, cost of the action is 10. - At last, remove part 1, cost of the action is 0.
So the total energy the child paid is 20 + 10 + 10 + 0 = 40, which is the minimum.
In the second sample, the child will spend 400 no matter in what order he will remove the parts. | ```python
from sys import stdin, stdout
input = stdin.readline
print = stdout.write
n, m = map(int, input().rstrip().split())
s = 0
a = [int(i) for i in input().rstrip().split()]
while m:
some = input().rstrip.split()
s+=min(a[int(some[0])], a[int(some[1])])
m-=1
print(f"{s}\n")
``` | -1 |
|
393 | A | Nineteen | PROGRAMMING | 0 | [] | null | null | Alice likes word "nineteen" very much. She has a string *s* and wants the string to contain as many such words as possible. For that reason she can rearrange the letters of the string.
For example, if she has string "xiineteenppnnnewtnee", she can get string "xnineteenppnineteenw", containing (the occurrences marked) two such words. More formally, word "nineteen" occurs in the string the number of times you can read it starting from some letter of the string. Of course, you shouldn't skip letters.
Help her to find the maximum number of "nineteen"s that she can get in her string. | The first line contains a non-empty string *s*, consisting only of lowercase English letters. The length of string *s* doesn't exceed 100. | Print a single integer — the maximum number of "nineteen"s that she can get in her string. | [
"nniinneetteeeenn\n",
"nneteenabcnneteenabcnneteenabcnneteenabcnneteenabcii\n",
"nineteenineteen\n"
] | [
"2",
"2",
"2"
] | none | 500 | [
{
"input": "nniinneetteeeenn",
"output": "2"
},
{
"input": "nneteenabcnneteenabcnneteenabcnneteenabcnneteenabcii",
"output": "2"
},
{
"input": "nineteenineteen",
"output": "2"
},
{
"input": "nssemsnnsitjtihtthij",
"output": "0"
},
{
"input": "eehihnttehtherjsihihnrhimihrjinjiehmtjimnrss",
"output": "1"
},
{
"input": "rrrteiehtesisntnjirtitijnjjjthrsmhtneirjimniemmnrhirssjnhetmnmjejjnjjritjttnnrhnjs",
"output": "2"
},
{
"input": "mmrehtretseihsrjmtsenemniehssnisijmsnntesismmtmthnsieijjjnsnhisi",
"output": "2"
},
{
"input": "hshretttnntmmiertrrnjihnrmshnthirnnirrheinnnrjiirshthsrsijtrrtrmnjrrjnresnintnmtrhsnjrinsseimn",
"output": "1"
},
{
"input": "snmmensntritetnmmmerhhrmhnehehtesmhthseemjhmnrti",
"output": "2"
},
{
"input": "rmeetriiitijmrenmeiijt",
"output": "0"
},
{
"input": "ihimeitimrmhriemsjhrtjtijtesmhemnmmrsetmjttthtjhnnmirtimne",
"output": "1"
},
{
"input": "rhtsnmnesieernhstjnmmirthhieejsjttsiierhihhrrijhrrnejsjer",
"output": "2"
},
{
"input": "emmtjsjhretehmiiiestmtmnmissjrstnsnjmhimjmststsitemtttjrnhsrmsenjtjim",
"output": "2"
},
{
"input": "nmehhjrhirniitshjtrrtitsjsntjhrstjehhhrrerhemehjeermhmhjejjesnhsiirheijjrnrjmminneeehtm",
"output": "3"
},
{
"input": "hsntijjetmehejtsitnthietssmeenjrhhetsnjrsethisjrtrhrierjtmimeenjnhnijeesjttrmn",
"output": "3"
},
{
"input": "jnirirhmirmhisemittnnsmsttesjhmjnsjsmntisheneiinsrjsjirnrmnjmjhmistntersimrjni",
"output": "1"
},
{
"input": "neithjhhhtmejjnmieishethmtetthrienrhjmjenrmtejerernmthmsnrthhtrimmtmshm",
"output": "2"
},
{
"input": "sithnrsnemhijsnjitmijjhejjrinejhjinhtisttteermrjjrtsirmessejireihjnnhhemiirmhhjeet",
"output": "3"
},
{
"input": "jrjshtjstteh",
"output": "0"
},
{
"input": "jsihrimrjnnmhttmrtrenetimemjnshnimeiitmnmjishjjneisesrjemeshjsijithtn",
"output": "2"
},
{
"input": "hhtjnnmsemermhhtsstejehsssmnesereehnnsnnremjmmieethmirjjhn",
"output": "2"
},
{
"input": "tmnersmrtsehhntsietttrehrhneiireijnijjejmjhei",
"output": "1"
},
{
"input": "mtstiresrtmesritnjriirehtermtrtseirtjrhsejhhmnsineinsjsin",
"output": "2"
},
{
"input": "ssitrhtmmhtnmtreijteinimjemsiiirhrttinsnneshintjnin",
"output": "1"
},
{
"input": "rnsrsmretjiitrjthhritniijhjmm",
"output": "0"
},
{
"input": "hntrteieimrimteemenserntrejhhmijmtjjhnsrsrmrnsjseihnjmehtthnnithirnhj",
"output": "3"
},
{
"input": "nmmtsmjrntrhhtmimeresnrinstjnhiinjtnjjjnthsintmtrhijnrnmtjihtinmni",
"output": "0"
},
{
"input": "eihstiirnmteejeehimttrijittjsntjejmessstsemmtristjrhenithrrsssihnthheehhrnmimssjmejjreimjiemrmiis",
"output": "2"
},
{
"input": "srthnimimnemtnmhsjmmmjmmrsrisehjseinemienntetmitjtnnneseimhnrmiinsismhinjjnreehseh",
"output": "3"
},
{
"input": "etrsmrjehntjjimjnmsresjnrthjhehhtreiijjminnheeiinseenmmethiemmistsei",
"output": "3"
},
{
"input": "msjeshtthsieshejsjhsnhejsihisijsertenrshhrthjhiirijjneinjrtrmrs",
"output": "1"
},
{
"input": "mehsmstmeejrhhsjihntjmrjrihssmtnensttmirtieehimj",
"output": "1"
},
{
"input": "mmmsermimjmrhrhejhrrejermsneheihhjemnehrhihesnjsehthjsmmjeiejmmnhinsemjrntrhrhsmjtttsrhjjmejj",
"output": "2"
},
{
"input": "rhsmrmesijmmsnsmmhertnrhsetmisshriirhetmjihsmiinimtrnitrseii",
"output": "1"
},
{
"input": "iihienhirmnihh",
"output": "0"
},
{
"input": "ismtthhshjmhisssnmnhe",
"output": "0"
},
{
"input": "rhsmnrmhejshinnjrtmtsssijimimethnm",
"output": "0"
},
{
"input": "eehnshtiriejhiirntminrirnjihmrnittnmmnjejjhjtennremrnssnejtntrtsiejjijisermj",
"output": "3"
},
{
"input": "rnhmeesnhttrjintnhnrhristjrthhrmehrhjmjhjehmstrijemjmmistes",
"output": "2"
},
{
"input": "ssrmjmjeeetrnimemrhimes",
"output": "0"
},
{
"input": "n",
"output": "0"
},
{
"input": "ni",
"output": "0"
},
{
"input": "nine",
"output": "0"
},
{
"input": "nineteenineteenineteenineteenineteenineteenineteenineteenineteenineteenineteenineteenineteen",
"output": "13"
},
{
"input": "ninetee",
"output": "0"
},
{
"input": "mzbmweyydiadtlcouegmdbyfwurpwbpuvhifnuapwynd",
"output": "0"
},
{
"input": "zenudggmyopddhszhrbmftgzmjorabhgojdtfnzxjkayjlkgczsyshczutkdch",
"output": "0"
},
{
"input": "rtzxovxqfapkdmelxiyjroohufhbakpmmvaxq",
"output": "0"
},
{
"input": "zninetneeineteeniwnteeennieteenineteenineteenineteenineteenineteenineteenineteenineteeninetzeenz",
"output": "13"
},
{
"input": "nnnnnnniiiiiiiiiiiitttttttttteeeeeeeeeeeeeeeeee",
"output": "3"
},
{
"input": "ttttiiiieeeeeeeeeeeennnnnnnnn",
"output": "4"
},
{
"input": "ttttttttteeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiinnnnnnn",
"output": "3"
},
{
"input": "nnnnnnnnnneeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiiiiitttttttttttttttttttt",
"output": "4"
},
{
"input": "eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeiiiiiiiiiiiiiiiiittttttttttttttttnnnnnnn",
"output": "3"
},
{
"input": "nineeen",
"output": "0"
},
{
"input": "nineteeeeeeeeeeeeeeeeettttttttttttttttttiiiiiiiiiiiiiiiiii",
"output": "0"
},
{
"input": "nineteenieteenieteenieteenieteenieteenieteen",
"output": "4"
},
{
"input": "nineteenineteenineteenineteenineteen",
"output": "5"
}
] | 1,585,849,926 | 2,147,483,647 | Python 3 | OK | TESTS | 58 | 108 | 0 | s= input ()
pr=[]
e=s.count("e")
n=s.count("n")
t=s.count("t")
i=s.count("i")
pr.append(int((n-1)/2))
pr.append(i)
pr.append(int(e/3))
pr.append(t)
print(min(pr)) | Title: Nineteen
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alice likes word "nineteen" very much. She has a string *s* and wants the string to contain as many such words as possible. For that reason she can rearrange the letters of the string.
For example, if she has string "xiineteenppnnnewtnee", she can get string "xnineteenppnineteenw", containing (the occurrences marked) two such words. More formally, word "nineteen" occurs in the string the number of times you can read it starting from some letter of the string. Of course, you shouldn't skip letters.
Help her to find the maximum number of "nineteen"s that she can get in her string.
Input Specification:
The first line contains a non-empty string *s*, consisting only of lowercase English letters. The length of string *s* doesn't exceed 100.
Output Specification:
Print a single integer — the maximum number of "nineteen"s that she can get in her string.
Demo Input:
['nniinneetteeeenn\n', 'nneteenabcnneteenabcnneteenabcnneteenabcnneteenabcii\n', 'nineteenineteen\n']
Demo Output:
['2', '2', '2']
Note:
none | ```python
s= input ()
pr=[]
e=s.count("e")
n=s.count("n")
t=s.count("t")
i=s.count("i")
pr.append(int((n-1)/2))
pr.append(i)
pr.append(int(e/3))
pr.append(t)
print(min(pr))
``` | 3 |
|
948 | A | Protect Sheep | PROGRAMMING | 900 | [
"brute force",
"dfs and similar",
"graphs",
"implementation"
] | null | null | Bob is a farmer. He has a large pasture with many sheep. Recently, he has lost some of them due to wolf attacks. He thus decided to place some shepherd dogs in such a way that all his sheep are protected.
The pasture is a rectangle consisting of *R*<=×<=*C* cells. Each cell is either empty, contains a sheep, a wolf or a dog. Sheep and dogs always stay in place, but wolves can roam freely around the pasture, by repeatedly moving to the left, right, up or down to a neighboring cell. When a wolf enters a cell with a sheep, it consumes it. However, no wolf can enter a cell with a dog.
Initially there are no dogs. Place dogs onto the pasture in such a way that no wolf can reach any sheep, or determine that it is impossible. Note that since you have many dogs, you do not need to minimize their number. | First line contains two integers *R* (1<=≤<=*R*<=≤<=500) and *C* (1<=≤<=*C*<=≤<=500), denoting the number of rows and the numbers of columns respectively.
Each of the following *R* lines is a string consisting of exactly *C* characters, representing one row of the pasture. Here, 'S' means a sheep, 'W' a wolf and '.' an empty cell. | If it is impossible to protect all sheep, output a single line with the word "No".
Otherwise, output a line with the word "Yes". Then print *R* lines, representing the pasture after placing dogs. Again, 'S' means a sheep, 'W' a wolf, 'D' is a dog and '.' an empty space. You are not allowed to move, remove or add a sheep or a wolf.
If there are multiple solutions, you may print any of them. You don't have to minimize the number of dogs. | [
"6 6\n..S...\n..S.W.\n.S....\n..W...\n...W..\n......\n",
"1 2\nSW\n",
"5 5\n.S...\n...S.\nS....\n...S.\n.S...\n"
] | [
"Yes\n..SD..\n..SDW.\n.SD...\n.DW...\nDD.W..\n......\n",
"No\n",
"Yes\n.S...\n...S.\nS.D..\n...S.\n.S...\n"
] | In the first example, we can split the pasture into two halves, one containing wolves and one containing sheep. Note that the sheep at (2,1) is safe, as wolves cannot move diagonally.
In the second example, there are no empty spots to put dogs that would guard the lone sheep.
In the third example, there are no wolves, so the task is very easy. We put a dog in the center to observe the peacefulness of the meadow, but the solution would be correct even without him. | 500 | [
{
"input": "1 2\nSW",
"output": "No"
},
{
"input": "10 10\n....W.W.W.\n.........S\n.S.S...S..\nW.......SS\n.W..W.....\n.W...W....\nS..S...S.S\n....W...S.\n..S..S.S.S\nSS.......S",
"output": "Yes\nDDDDWDWDWD\nDDDDDDDDDS\nDSDSDDDSDD\nWDDDDDDDSS\nDWDDWDDDDD\nDWDDDWDDDD\nSDDSDDDSDS\nDDDDWDDDSD\nDDSDDSDSDS\nSSDDDDDDDS"
},
{
"input": "10 10\n....W.W.W.\n...W.....S\n.S.S...S..\nW......WSS\n.W..W.....\n.W...W....\nS..S...S.S\n...WWW..S.\n..S..S.S.S\nSS.......S",
"output": "No"
},
{
"input": "1 50\nW...S..............W.....S..S...............S...W.",
"output": "Yes\nWDDDSDDDDDDDDDDDDDDWDDDDDSDDSDDDDDDDDDDDDDDDSDDDWD"
},
{
"input": "2 4\n...S\n...W",
"output": "No"
},
{
"input": "4 2\n..\n..\n..\nSW",
"output": "No"
},
{
"input": "4 2\n..\n..\n..\nWS",
"output": "No"
},
{
"input": "2 4\n...W\n...S",
"output": "No"
},
{
"input": "50 1\nS\n.\n.\n.\n.\n.\n.\nS\n.\n.\n.\n.\n.\n.\n.\n.\nS\n.\nW\n.\nS\n.\n.\n.\n.\nS\n.\n.\n.\n.\n.\n.\n.\nW\n.\n.\n.\nW\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.\n.",
"output": "Yes\nS\nD\nD\nD\nD\nD\nD\nS\nD\nD\nD\nD\nD\nD\nD\nD\nS\nD\nW\nD\nS\nD\nD\nD\nD\nS\nD\nD\nD\nD\nD\nD\nD\nW\nD\nD\nD\nW\nD\nD\nD\nD\nD\nD\nD\nD\nD\nD\nD\nD"
},
{
"input": "4 4\nW..S\nW..S\nW..S\nW..S",
"output": "Yes\nWDDS\nWDDS\nWDDS\nWDDS"
},
{
"input": "4 4\nSSSS\n....\n....\nWWWW",
"output": "Yes\nSSSS\nDDDD\nDDDD\nWWWW"
},
{
"input": "4 4\nWWWW\n....\n....\nSSSS",
"output": "Yes\nWWWW\nDDDD\nDDDD\nSSSS"
},
{
"input": "4 4\nS..W\nS..W\nS..W\nS..W",
"output": "Yes\nSDDW\nSDDW\nSDDW\nSDDW"
},
{
"input": "1 1\n.",
"output": "Yes\nD"
},
{
"input": "1 1\nW",
"output": "Yes\nW"
},
{
"input": "1 1\nS",
"output": "Yes\nS"
},
{
"input": "4 2\n..\n..\n.W\n.S",
"output": "No"
},
{
"input": "4 2\n..\n..\n.S\n.W",
"output": "No"
},
{
"input": "4 2\n..\n..\nW.\nS.",
"output": "No"
},
{
"input": "4 2\n..\n..\nS.\nW.",
"output": "No"
},
{
"input": "2 4\n....\n..SW",
"output": "No"
},
{
"input": "2 4\n....\n..WS",
"output": "No"
},
{
"input": "1 2\nS.",
"output": "Yes\nSD"
}
] | 1,633,354,742 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 30 | 0 | r,c=list(map(int,input().split()))
l=[]
for i in range(r):
l.append(list(map(str,input())))
for i in range(1,r-1):
for j in range(1,c-1):
if l[i][j]=='W':
if l[i-1][j]=='S' or l[i+1][j]=='S' or l[i][j-1]=='S' or l[i][j+1]=='S':
print('no')
exit()
else:
if l[i][j]=='.':
l[i][j]='D'
if r>1:
for i in range(len(l[0])):
if (l[0][i] == 'W' and r > 1 and l[1][i] == 'S') or (l[0][i] == 'S' and r > 1 and l[1][i] == 'W'):
print('no')
exit()
for i in range(len(l[0])):
if (l[-1][i] == 'W' and r > 1 and l[-2][i] == 'S') or l[i][i] == 'S' and r > 1 and l[-2][i] == 'W':
print('no')
exit()
if c>1:
for i in range(r):
if (l[i][0] == 'W' and c > 1 and l[i][1] == 'S') or (l[i][0] == 'S' and c > 1 and l[i][1] == 'W'):
print('no')
exit()
for i in range(r):
if (l[i][-1] == 'W' and c > 1 and l[i][-1] == 'S') or (l[i][-1] == 'S' and c > 1 and l[i][-1] == 'W'):
print('no')
exit()
for i in l:
print(''.join(i))
| Title: Protect Sheep
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bob is a farmer. He has a large pasture with many sheep. Recently, he has lost some of them due to wolf attacks. He thus decided to place some shepherd dogs in such a way that all his sheep are protected.
The pasture is a rectangle consisting of *R*<=×<=*C* cells. Each cell is either empty, contains a sheep, a wolf or a dog. Sheep and dogs always stay in place, but wolves can roam freely around the pasture, by repeatedly moving to the left, right, up or down to a neighboring cell. When a wolf enters a cell with a sheep, it consumes it. However, no wolf can enter a cell with a dog.
Initially there are no dogs. Place dogs onto the pasture in such a way that no wolf can reach any sheep, or determine that it is impossible. Note that since you have many dogs, you do not need to minimize their number.
Input Specification:
First line contains two integers *R* (1<=≤<=*R*<=≤<=500) and *C* (1<=≤<=*C*<=≤<=500), denoting the number of rows and the numbers of columns respectively.
Each of the following *R* lines is a string consisting of exactly *C* characters, representing one row of the pasture. Here, 'S' means a sheep, 'W' a wolf and '.' an empty cell.
Output Specification:
If it is impossible to protect all sheep, output a single line with the word "No".
Otherwise, output a line with the word "Yes". Then print *R* lines, representing the pasture after placing dogs. Again, 'S' means a sheep, 'W' a wolf, 'D' is a dog and '.' an empty space. You are not allowed to move, remove or add a sheep or a wolf.
If there are multiple solutions, you may print any of them. You don't have to minimize the number of dogs.
Demo Input:
['6 6\n..S...\n..S.W.\n.S....\n..W...\n...W..\n......\n', '1 2\nSW\n', '5 5\n.S...\n...S.\nS....\n...S.\n.S...\n']
Demo Output:
['Yes\n..SD..\n..SDW.\n.SD...\n.DW...\nDD.W..\n......\n', 'No\n', 'Yes\n.S...\n...S.\nS.D..\n...S.\n.S...\n']
Note:
In the first example, we can split the pasture into two halves, one containing wolves and one containing sheep. Note that the sheep at (2,1) is safe, as wolves cannot move diagonally.
In the second example, there are no empty spots to put dogs that would guard the lone sheep.
In the third example, there are no wolves, so the task is very easy. We put a dog in the center to observe the peacefulness of the meadow, but the solution would be correct even without him. | ```python
r,c=list(map(int,input().split()))
l=[]
for i in range(r):
l.append(list(map(str,input())))
for i in range(1,r-1):
for j in range(1,c-1):
if l[i][j]=='W':
if l[i-1][j]=='S' or l[i+1][j]=='S' or l[i][j-1]=='S' or l[i][j+1]=='S':
print('no')
exit()
else:
if l[i][j]=='.':
l[i][j]='D'
if r>1:
for i in range(len(l[0])):
if (l[0][i] == 'W' and r > 1 and l[1][i] == 'S') or (l[0][i] == 'S' and r > 1 and l[1][i] == 'W'):
print('no')
exit()
for i in range(len(l[0])):
if (l[-1][i] == 'W' and r > 1 and l[-2][i] == 'S') or l[i][i] == 'S' and r > 1 and l[-2][i] == 'W':
print('no')
exit()
if c>1:
for i in range(r):
if (l[i][0] == 'W' and c > 1 and l[i][1] == 'S') or (l[i][0] == 'S' and c > 1 and l[i][1] == 'W'):
print('no')
exit()
for i in range(r):
if (l[i][-1] == 'W' and c > 1 and l[i][-1] == 'S') or (l[i][-1] == 'S' and c > 1 and l[i][-1] == 'W'):
print('no')
exit()
for i in l:
print(''.join(i))
``` | 0 |
|
518 | A | Vitaly and Strings | PROGRAMMING | 1,600 | [
"constructive algorithms",
"strings"
] | null | null | Vitaly is a diligent student who never missed a lesson in his five years of studying in the university. He always does his homework on time and passes his exams in time.
During the last lesson the teacher has provided two strings *s* and *t* to Vitaly. The strings have the same length, they consist of lowercase English letters, string *s* is lexicographically smaller than string *t*. Vitaly wondered if there is such string that is lexicographically larger than string *s* and at the same is lexicographically smaller than string *t*. This string should also consist of lowercase English letters and have the length equal to the lengths of strings *s* and *t*.
Let's help Vitaly solve this easy problem! | The first line contains string *s* (1<=≤<=|*s*|<=≤<=100), consisting of lowercase English letters. Here, |*s*| denotes the length of the string.
The second line contains string *t* (|*t*|<==<=|*s*|), consisting of lowercase English letters.
It is guaranteed that the lengths of strings *s* and *t* are the same and string *s* is lexicographically less than string *t*. | If the string that meets the given requirements doesn't exist, print a single string "No such string" (without the quotes).
If such string exists, print it. If there are multiple valid strings, you may print any of them. | [
"a\nc\n",
"aaa\nzzz\n",
"abcdefg\nabcdefh\n"
] | [
"b\n",
"kkk\n",
"No such string\n"
] | String *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">*n*</sub> is said to be lexicographically smaller than *t* = *t*<sub class="lower-index">1</sub>*t*<sub class="lower-index">2</sub>... *t*<sub class="lower-index">*n*</sub>, if there exists such *i*, that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, *s*<sub class="lower-index">2</sub> = *t*<sub class="lower-index">2</sub>, ... *s*<sub class="lower-index">*i* - 1</sub> = *t*<sub class="lower-index">*i* - 1</sub>, *s*<sub class="lower-index">*i*</sub> < *t*<sub class="lower-index">*i*</sub>. | 500 | [
{
"input": "a\nc",
"output": "b"
},
{
"input": "aaa\nzzz",
"output": "kkk"
},
{
"input": "abcdefg\nabcdefh",
"output": "No such string"
},
{
"input": "abcdefg\nabcfefg",
"output": "abcdefh"
},
{
"input": "frt\nfru",
"output": "No such string"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzx\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzy"
},
{
"input": "q\nz",
"output": "r"
},
{
"input": "pnzcl\npnzdf",
"output": "pnzcm"
},
{
"input": "vklldrxnfgyorgfpfezvhbouyzzzzz\nvklldrxnfgyorgfpfezvhbouzaaadv",
"output": "vklldrxnfgyorgfpfezvhbouzaaaaa"
},
{
"input": "pkjlxzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\npkjlyaaaaaaaaaaaaaaaaaaaaaaaaaaaahr",
"output": "pkjlyaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "exoudpymnspkocwszzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nexoudpymnspkocwtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabml",
"output": "exoudpymnspkocwtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "anarzvsklmwvovozwnmhklkpcseeogdgauoppmzrukynbjjoxytuvsiecuzfquxnowewebhtuoxepocyeamqfrblpwqiokbcubil\nanarzvsklmwvovozwnmhklkpcseeogdgauoppmzrukynbjjoxytuvsiecuzfquxnowewebhtuoxepocyeamqfrblpwqiokbcubim",
"output": "No such string"
},
{
"input": "uqyugulumzwlxsjnxxkutzqayskrbjoaaekbhckjryhjjllzzz\nuqyugulumzwlxsjnxxkutzqayskrbjoaaekbhckjryhjjlmaaa",
"output": "No such string"
},
{
"input": "esfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdacbzzzzzzzzzzzzzz\nesfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdaccaaaaaaaaaaaatf",
"output": "esfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdaccaaaaaaaaaaaaaa"
},
{
"input": "oisjtilteipnzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\noisjtilteipoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaao",
"output": "oisjtilteipoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "svpoxbsudndfnnpugbouawegyxgtmvqzbewxpcwhopdbwscimgzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nsvpoxbsudndfnnpugbouawegyxgtmvqzbewxpcwhopdbwscimhaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "No such string"
},
{
"input": "ddzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\ndeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaao",
"output": "deaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "xqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdavdzz\nxqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdavilj",
"output": "xqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdaveaa"
},
{
"input": "poflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawfoq\npoflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawujg",
"output": "poflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawfor"
},
{
"input": "vonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjnzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nvonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac",
"output": "vonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "bqycw\nquhod",
"output": "bqycx"
},
{
"input": "hceslswecf\nnmxshuymaa",
"output": "hceslswecg"
},
{
"input": "awqtzslxowuaefe\nvujscakjpvxviki",
"output": "awqtzslxowuaeff"
},
{
"input": "lerlcnaogdravnogfogcyoxgi\nojrbithvjdqtempegvqxmgmmw",
"output": "lerlcnaogdravnogfogcyoxgj"
},
{
"input": "jbrhvicytqaivheqeourrlosvnsujsxdinryyawgalidsaufxv\noevvkhujmhagaholrmsatdjjyfmyblvgetpnxgjcilugjsncjs",
"output": "jbrhvicytqaivheqeourrlosvnsujsxdinryyawgalidsaufxw"
},
{
"input": "jrpogrcuhqdpmyzpuabuhaptlxaeiqjxhqkmuzsjbhqxvdtoocrkusaeasqdwlunomwzww\nspvgaswympzlscnumemgiznngnxqgccbubmxgqmaakbnyngkxlxjjsafricchhpecdjgxw",
"output": "jrpogrcuhqdpmyzpuabuhaptlxaeiqjxhqkmuzsjbhqxvdtoocrkusaeasqdwlunomwzwx"
},
{
"input": "mzmhjmfxaxaplzjmjkbyadeweltagyyuzpvrmnyvirjpdmebxyzjvdoezhnayfrvtnccryhkvhcvakcf\nohhhhkujfpjbgouebtmmbzizuhuumvrsqfniwpmxdtzhyiaivdyxhywnqzagicydixjtvbqbevhbqttu",
"output": "mzmhjmfxaxaplzjmjkbyadeweltagyyuzpvrmnyvirjpdmebxyzjvdoezhnayfrvtnccryhkvhcvakcg"
},
{
"input": "cdmwmzutsicpzhcokbbhwktqbomozxvvjlhwdgtiledgurxsfreisgczdwgupzxmjnfyjxcpdwzkggludkcmgppndl\nuvuqvyrnhtyubpevizhjxdvmpueittksrnosmfuuzbimnqussasdjufrthrgjbyzomauaxbvwferfvtmydmwmjaoxg",
"output": "cdmwmzutsicpzhcokbbhwktqbomozxvvjlhwdgtiledgurxsfreisgczdwgupzxmjnfyjxcpdwzkggludkcmgppndm"
},
{
"input": "dpnmrwpbgzvcmrcodwgvvfwpyagdwlngmhrazyvalszhruprxzmwltftxmujfyrrnwzvphgqlcphreumqkytswxziugburwrlyay\nqibcfxdfovoejutaeetbbwrgexdrvqywwmhipxgfrvhzovxkfawpfnpjvlhkyahessodqcclangxefcaixysqijnitevwmpalkzd",
"output": "dpnmrwpbgzvcmrcodwgvvfwpyagdwlngmhrazyvalszhruprxzmwltftxmujfyrrnwzvphgqlcphreumqkytswxziugburwrlyaz"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab",
"output": "No such string"
},
{
"input": "phdvmuwqmvzyurtnshitcypuzbhpceovkibzbhhjwxkdtvqmbpoumeoiztxtvkvsjrlnhowsdmgftuiulzebdigmun\nphdvmuwqmvzyurtnshitcypuzbhpceovkibzbhhjwxkdtvqmbpoumeoiztxtvkvsjrlnhowsdmgftuiulzebdigmuo",
"output": "No such string"
},
{
"input": "hrsantdquixzjyjtqytcmnflnyehzbibkbgkqffgqpkgeuqmbmxzhbjwsnfkizvbcyoghyvnxxjavoahlqjxomtsouzoog\nhrsantdquixzjyjtqytcmnflnyehzbibkbgkqffgqpkgeuqmbmxzhbjwsnfkizvbcyoghyvnxxjavoahlqjxomtsouzooh",
"output": "No such string"
},
{
"input": "kexdbtpkjbwwyibjndbtmwqzolopqitgkomqggojevoankiepxirrcidxldlzsppehmoazdywltmjbxgsxgihwnwpmczjrcwpywl\nkexdbtpkjbwwyibjndbtmwqzolopqitgkomqggojevoankiepxirrcidxldlzsppehmoazdywltmjbxgsxgihwnwpmczjrcwpywm",
"output": "No such string"
},
{
"input": "yijdysvzfcnaedvnecswgoylhzgguxecmucepgstjbdkbjyfdlxxxejkrrxfiuwjpdmdhhqhlqeqzjwudtdryrfkpwfxdjlkowmk\nyijdysvzfcnaedvnecswgoylhzgguxecmucepgstjbdkbjyfdlxxxejkrrxfiuwjpdmdhhqhlqeqzjwudtdryrfkpwfxdjlkowml",
"output": "No such string"
},
{
"input": "a\nb",
"output": "No such string"
},
{
"input": "x\nz",
"output": "y"
},
{
"input": "a\nz",
"output": "b"
},
{
"input": "y\nz",
"output": "No such string"
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzy\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "No such string"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\nzaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "yzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyz"
},
{
"input": "aaa\naac",
"output": "aab"
},
{
"input": "aaa\naab",
"output": "No such string"
},
{
"input": "zzx\nzzz",
"output": "zzy"
},
{
"input": "zzy\nzzz",
"output": "No such string"
},
{
"input": "aba\naca",
"output": "abb"
},
{
"input": "aaa\nbbb",
"output": "aab"
},
{
"input": "azzz\ncaaa",
"output": "baaa"
}
] | 1,608,110,476 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 8 | 124 | 0 | s=list(input())
s1=list(input())
ans = "No such string"
for i in range(len(s)):
if ord(s[i])+1<ord(s1[i]):
ans = ''.join(s[:i]) + chr(ord(s[i])+1) + ''.join(s[i+1:])
break
if ord(s[i])+1==ord(s1[i]) and i+1<len(s) and ord(s[i+1])<ord(s1[i+1]):
ans = ''.join(s[:i]) + chr(ord(s[i])+1) + ''.join(s[i+1:])
break
print(ans)
| Title: Vitaly and Strings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vitaly is a diligent student who never missed a lesson in his five years of studying in the university. He always does his homework on time and passes his exams in time.
During the last lesson the teacher has provided two strings *s* and *t* to Vitaly. The strings have the same length, they consist of lowercase English letters, string *s* is lexicographically smaller than string *t*. Vitaly wondered if there is such string that is lexicographically larger than string *s* and at the same is lexicographically smaller than string *t*. This string should also consist of lowercase English letters and have the length equal to the lengths of strings *s* and *t*.
Let's help Vitaly solve this easy problem!
Input Specification:
The first line contains string *s* (1<=≤<=|*s*|<=≤<=100), consisting of lowercase English letters. Here, |*s*| denotes the length of the string.
The second line contains string *t* (|*t*|<==<=|*s*|), consisting of lowercase English letters.
It is guaranteed that the lengths of strings *s* and *t* are the same and string *s* is lexicographically less than string *t*.
Output Specification:
If the string that meets the given requirements doesn't exist, print a single string "No such string" (without the quotes).
If such string exists, print it. If there are multiple valid strings, you may print any of them.
Demo Input:
['a\nc\n', 'aaa\nzzz\n', 'abcdefg\nabcdefh\n']
Demo Output:
['b\n', 'kkk\n', 'No such string\n']
Note:
String *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">*n*</sub> is said to be lexicographically smaller than *t* = *t*<sub class="lower-index">1</sub>*t*<sub class="lower-index">2</sub>... *t*<sub class="lower-index">*n*</sub>, if there exists such *i*, that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, *s*<sub class="lower-index">2</sub> = *t*<sub class="lower-index">2</sub>, ... *s*<sub class="lower-index">*i* - 1</sub> = *t*<sub class="lower-index">*i* - 1</sub>, *s*<sub class="lower-index">*i*</sub> < *t*<sub class="lower-index">*i*</sub>. | ```python
s=list(input())
s1=list(input())
ans = "No such string"
for i in range(len(s)):
if ord(s[i])+1<ord(s1[i]):
ans = ''.join(s[:i]) + chr(ord(s[i])+1) + ''.join(s[i+1:])
break
if ord(s[i])+1==ord(s1[i]) and i+1<len(s) and ord(s[i+1])<ord(s1[i+1]):
ans = ''.join(s[:i]) + chr(ord(s[i])+1) + ''.join(s[i+1:])
break
print(ans)
``` | 0 |
|
817 | A | Treasure Hunt | PROGRAMMING | 1,200 | [
"implementation",
"math",
"number theory"
] | null | null | Captain Bill the Hummingbird and his crew recieved an interesting challenge offer. Some stranger gave them a map, potion of teleportation and said that only this potion might help them to reach the treasure.
Bottle with potion has two values *x* and *y* written on it. These values define four moves which can be performed using the potion:
- - - -
Map shows that the position of Captain Bill the Hummingbird is (*x*1,<=*y*1) and the position of the treasure is (*x*2,<=*y*2).
You task is to tell Captain Bill the Hummingbird whether he should accept this challenge or decline. If it is possible for Captain to reach the treasure using the potion then output "YES", otherwise "NO" (without quotes).
The potion can be used infinite amount of times. | The first line contains four integer numbers *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=105<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=105) — positions of Captain Bill the Hummingbird and treasure respectively.
The second line contains two integer numbers *x*,<=*y* (1<=≤<=*x*,<=*y*<=≤<=105) — values on the potion bottle. | Print "YES" if it is possible for Captain to reach the treasure using the potion, otherwise print "NO" (without quotes). | [
"0 0 0 6\n2 3\n",
"1 1 3 6\n1 5\n"
] | [
"YES\n",
"NO\n"
] | In the first example there exists such sequence of moves:
1. <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c939890fb4ed35688177327dac981bfa9216c00.png" style="max-width: 100.0%;max-height: 100.0%;"/> — the first type of move 1. <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/afbfa42fbac4e0641e7466e3aac74cbbb08ed597.png" style="max-width: 100.0%;max-height: 100.0%;"/> — the third type of move | 0 | [
{
"input": "0 0 0 6\n2 3",
"output": "YES"
},
{
"input": "1 1 3 6\n1 5",
"output": "NO"
},
{
"input": "5 4 6 -10\n1 1",
"output": "NO"
},
{
"input": "6 -3 -7 -7\n1 2",
"output": "NO"
},
{
"input": "2 -5 -8 8\n2 1",
"output": "YES"
},
{
"input": "70 -81 -17 80\n87 23",
"output": "YES"
},
{
"input": "41 366 218 -240\n3456 1234",
"output": "NO"
},
{
"input": "-61972 -39646 -42371 -24854\n573 238",
"output": "NO"
},
{
"input": "-84870 -42042 94570 98028\n8972 23345",
"output": "YES"
},
{
"input": "-58533 -50999 -1007 -59169\n8972 23345",
"output": "NO"
},
{
"input": "-100000 -100000 100000 100000\n100000 100000",
"output": "YES"
},
{
"input": "-100000 -100000 100000 100000\n1 1",
"output": "YES"
},
{
"input": "5 2 5 3\n1 1",
"output": "NO"
},
{
"input": "5 5 5 5\n5 5",
"output": "YES"
},
{
"input": "0 0 1000 1000\n1 1",
"output": "YES"
},
{
"input": "0 0 0 1\n1 1",
"output": "NO"
},
{
"input": "1 1 4 4\n2 2",
"output": "NO"
},
{
"input": "100000 100000 99999 99999\n100000 100000",
"output": "NO"
},
{
"input": "1 1 1 6\n1 5",
"output": "NO"
},
{
"input": "2 9 4 0\n2 3",
"output": "YES"
},
{
"input": "0 0 0 9\n2 3",
"output": "NO"
},
{
"input": "14 88 14 88\n100 500",
"output": "YES"
},
{
"input": "-1 0 3 0\n4 4",
"output": "NO"
},
{
"input": "0 0 8 9\n2 3",
"output": "NO"
},
{
"input": "-2 5 7 -6\n1 1",
"output": "YES"
},
{
"input": "3 7 -8 8\n2 2",
"output": "NO"
},
{
"input": "-4 -8 -6 -1\n1 3",
"output": "NO"
},
{
"input": "0 8 6 2\n1 1",
"output": "YES"
},
{
"input": "-5 -2 -8 -2\n1 1",
"output": "NO"
},
{
"input": "1 4 -5 0\n1 1",
"output": "YES"
},
{
"input": "8 -4 4 -7\n1 2",
"output": "NO"
},
{
"input": "5 2 2 4\n2 2",
"output": "NO"
},
{
"input": "2 0 -4 6\n1 2",
"output": "NO"
},
{
"input": "-2 6 -5 -4\n1 2",
"output": "YES"
},
{
"input": "-6 5 10 6\n2 4",
"output": "NO"
},
{
"input": "3 -7 1 -8\n1 2",
"output": "NO"
},
{
"input": "4 1 4 -4\n9 4",
"output": "NO"
},
{
"input": "9 -3 -9 -3\n2 2",
"output": "NO"
},
{
"input": "-6 -6 -10 -5\n6 7",
"output": "NO"
},
{
"input": "-5 -2 2 2\n1 7",
"output": "NO"
},
{
"input": "9 0 8 1\n7 10",
"output": "NO"
},
{
"input": "-1 6 -7 -6\n6 4",
"output": "YES"
},
{
"input": "2 2 -3 -3\n3 1",
"output": "NO"
},
{
"input": "2 -6 7 2\n2 1",
"output": "NO"
},
{
"input": "-6 2 -7 -7\n1 2",
"output": "NO"
},
{
"input": "-5 -5 -1 -5\n2 2",
"output": "YES"
},
{
"input": "0 5 3 -6\n2 2",
"output": "NO"
},
{
"input": "0 -6 2 -1\n1 1",
"output": "NO"
},
{
"input": "-6 6 -5 -4\n1 2",
"output": "YES"
},
{
"input": "7 -7 1 -7\n2 2",
"output": "NO"
},
{
"input": "99966 -99952 -99966 99923\n1 1",
"output": "NO"
},
{
"input": "99921 99980 -99956 -99907\n3 4",
"output": "NO"
},
{
"input": "100000 100000 -100000 -100000\n1 1",
"output": "YES"
},
{
"input": "1 0 2 0\n5 1",
"output": "NO"
},
{
"input": "-3 0 -8 0\n7 2",
"output": "NO"
},
{
"input": "-9 4 -5 -1\n8 2",
"output": "NO"
},
{
"input": "-99999 -100000 100000 100000\n1 1",
"output": "NO"
},
{
"input": "0 0 -100 -100\n2 2",
"output": "YES"
},
{
"input": "9 -5 -3 -2\n1 4",
"output": "NO"
},
{
"input": "1 -10 -10 5\n7 5",
"output": "NO"
},
{
"input": "6 -9 -1 -9\n1 9",
"output": "NO"
}
] | 1,619,680,442 | 2,147,483,647 | PyPy 3 | OK | TESTS | 61 | 109 | 307,200 | import sys
input=sys.stdin.readline
from collections import defaultdict as dc
from collections import Counter
from bisect import bisect_right, bisect_left,bisect
import math
from operator import itemgetter
from heapq import heapify, heappop, heappush
x1,y1,x2,y2=map(int,input().split())
x,y=map(int,input().split())
if abs(x2-x1)%x==0 and abs(y2-y1)%y==0 and (abs(x2-x1)//x)%2==(abs(y2-y1)//y)%2:
print("YES")
else:
print("NO")
| Title: Treasure Hunt
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Captain Bill the Hummingbird and his crew recieved an interesting challenge offer. Some stranger gave them a map, potion of teleportation and said that only this potion might help them to reach the treasure.
Bottle with potion has two values *x* and *y* written on it. These values define four moves which can be performed using the potion:
- - - -
Map shows that the position of Captain Bill the Hummingbird is (*x*1,<=*y*1) and the position of the treasure is (*x*2,<=*y*2).
You task is to tell Captain Bill the Hummingbird whether he should accept this challenge or decline. If it is possible for Captain to reach the treasure using the potion then output "YES", otherwise "NO" (without quotes).
The potion can be used infinite amount of times.
Input Specification:
The first line contains four integer numbers *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=105<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=105) — positions of Captain Bill the Hummingbird and treasure respectively.
The second line contains two integer numbers *x*,<=*y* (1<=≤<=*x*,<=*y*<=≤<=105) — values on the potion bottle.
Output Specification:
Print "YES" if it is possible for Captain to reach the treasure using the potion, otherwise print "NO" (without quotes).
Demo Input:
['0 0 0 6\n2 3\n', '1 1 3 6\n1 5\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first example there exists such sequence of moves:
1. <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c939890fb4ed35688177327dac981bfa9216c00.png" style="max-width: 100.0%;max-height: 100.0%;"/> — the first type of move 1. <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/afbfa42fbac4e0641e7466e3aac74cbbb08ed597.png" style="max-width: 100.0%;max-height: 100.0%;"/> — the third type of move | ```python
import sys
input=sys.stdin.readline
from collections import defaultdict as dc
from collections import Counter
from bisect import bisect_right, bisect_left,bisect
import math
from operator import itemgetter
from heapq import heapify, heappop, heappush
x1,y1,x2,y2=map(int,input().split())
x,y=map(int,input().split())
if abs(x2-x1)%x==0 and abs(y2-y1)%y==0 and (abs(x2-x1)//x)%2==(abs(y2-y1)//y)%2:
print("YES")
else:
print("NO")
``` | 3 |
|
965 | A | Paper Airplanes | PROGRAMMING | 800 | [
"math"
] | null | null | To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes.
A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy? | The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$) — the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively. | Print a single integer — the minimum number of packs they should buy. | [
"5 3 2 3\n",
"5 3 100 1\n"
] | [
"4\n",
"5\n"
] | In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs.
In the second sample they have to buy a pack for each person as they can't share sheets. | 500 | [
{
"input": "5 3 2 3",
"output": "4"
},
{
"input": "5 3 100 1",
"output": "5"
},
{
"input": "10000 10000 1 1",
"output": "100000000"
},
{
"input": "1 1 10000 10000",
"output": "1"
},
{
"input": "300 300 21 23",
"output": "196"
},
{
"input": "300 2 37 51",
"output": "6"
},
{
"input": "2 400 23 57",
"output": "1"
},
{
"input": "1 1 1 1",
"output": "1"
},
{
"input": "10000 10000 3 2",
"output": "16670000"
},
{
"input": "1 2 1 2",
"output": "1"
},
{
"input": "1 1 2 2",
"output": "1"
},
{
"input": "1 1 10 10",
"output": "1"
},
{
"input": "5324 5439 32 13",
"output": "69622"
},
{
"input": "9000 1 2432 1",
"output": "9000"
},
{
"input": "230 1234 9124 23",
"output": "10"
},
{
"input": "11 1 1 1",
"output": "11"
},
{
"input": "6246 8489 1227 9",
"output": "4858"
},
{
"input": "9 20 5 7",
"output": "6"
}
] | 1,579,525,880 | 2,147,483,647 | Python 3 | OK | TESTS | 18 | 109 | 0 | import math
a = [int(x) for x in input().split()]
x = math.ceil(a[1]/a[2])
y = math.ceil((x*a[0])/a[3])
print(int(y)) | Title: Paper Airplanes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes.
A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy?
Input Specification:
The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$) — the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively.
Output Specification:
Print a single integer — the minimum number of packs they should buy.
Demo Input:
['5 3 2 3\n', '5 3 100 1\n']
Demo Output:
['4\n', '5\n']
Note:
In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs.
In the second sample they have to buy a pack for each person as they can't share sheets. | ```python
import math
a = [int(x) for x in input().split()]
x = math.ceil(a[1]/a[2])
y = math.ceil((x*a[0])/a[3])
print(int(y))
``` | 3 |
|
551 | A | GukiZ and Contest | PROGRAMMING | 800 | [
"brute force",
"implementation",
"sortings"
] | null | null | Professor GukiZ likes programming contests. He especially likes to rate his students on the contests he prepares. Now, he has decided to prepare a new contest.
In total, *n* students will attend, and before the start, every one of them has some positive integer rating. Students are indexed from 1 to *n*. Let's denote the rating of *i*-th student as *a**i*. After the contest ends, every student will end up with some positive integer position. GukiZ expects that his students will take places according to their ratings.
He thinks that each student will take place equal to . In particular, if student *A* has rating strictly lower then student *B*, *A* will get the strictly better position than *B*, and if two students have equal ratings, they will share the same position.
GukiZ would like you to reconstruct the results by following his expectations. Help him and determine the position after the end of the contest for each of his students if everything goes as expected. | The first line contains integer *n* (1<=≤<=*n*<=≤<=2000), number of GukiZ's students.
The second line contains *n* numbers *a*1,<=*a*2,<=... *a**n* (1<=≤<=*a**i*<=≤<=2000) where *a**i* is the rating of *i*-th student (1<=≤<=*i*<=≤<=*n*). | In a single line, print the position after the end of the contest for each of *n* students in the same order as they appear in the input. | [
"3\n1 3 3\n",
"1\n1\n",
"5\n3 5 3 4 5\n"
] | [
"3 1 1\n",
"1\n",
"4 1 4 3 1\n"
] | In the first sample, students 2 and 3 are positioned first (there is no other student with higher rating), and student 1 is positioned third since there are two students with higher rating.
In the second sample, first student is the only one on the contest.
In the third sample, students 2 and 5 share the first position with highest rating, student 4 is next with third position, and students 1 and 3 are the last sharing fourth position. | 500 | [
{
"input": "3\n1 3 3",
"output": "3 1 1"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "5\n3 5 3 4 5",
"output": "4 1 4 3 1"
},
{
"input": "7\n1 3 5 4 2 2 1",
"output": "6 3 1 2 4 4 6"
},
{
"input": "11\n5 6 4 2 9 7 6 6 6 6 7",
"output": "9 4 10 11 1 2 4 4 4 4 2"
},
{
"input": "1\n2000",
"output": "1"
},
{
"input": "2\n2000 2000",
"output": "1 1"
},
{
"input": "3\n500 501 502",
"output": "3 2 1"
},
{
"input": "10\n105 106 1 1 1 11 1000 999 1000 999",
"output": "6 5 8 8 8 7 1 3 1 3"
},
{
"input": "6\n1 2 3 4 5 6",
"output": "6 5 4 3 2 1"
},
{
"input": "7\n6 5 4 3 2 1 1",
"output": "1 2 3 4 5 6 6"
},
{
"input": "8\n153 100 87 14 10 8 6 5",
"output": "1 2 3 4 5 6 7 8"
},
{
"input": "70\n11 54 37 62 1 46 13 17 38 47 28 15 63 5 61 34 49 66 32 59 3 41 58 28 23 62 41 64 20 5 14 41 10 37 51 32 65 46 61 8 15 19 16 44 31 42 19 46 66 25 26 58 60 5 19 18 69 53 20 40 45 27 24 41 32 23 57 56 62 10",
"output": "62 18 35 7 70 23 61 56 34 22 42 58 6 66 10 37 21 2 38 13 69 29 14 42 48 7 29 5 50 66 60 29 63 35 20 38 4 23 10 65 58 52 57 27 41 28 52 23 2 46 45 14 12 66 52 55 1 19 50 33 26 44 47 29 38 48 16 17 7 63"
},
{
"input": "5\n1 2000 1 1 2000",
"output": "3 1 3 3 1"
}
] | 1,596,255,464 | 2,147,483,647 | Python 3 | OK | TESTS | 36 | 124 | 6,963,200 | n=int(input())
l=list(map(int,input().split()))
s=sorted(l)
s=s[::-1]
for i in range(n):
l[i]=s.index(l[i])+1
print(*l)
| Title: GukiZ and Contest
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Professor GukiZ likes programming contests. He especially likes to rate his students on the contests he prepares. Now, he has decided to prepare a new contest.
In total, *n* students will attend, and before the start, every one of them has some positive integer rating. Students are indexed from 1 to *n*. Let's denote the rating of *i*-th student as *a**i*. After the contest ends, every student will end up with some positive integer position. GukiZ expects that his students will take places according to their ratings.
He thinks that each student will take place equal to . In particular, if student *A* has rating strictly lower then student *B*, *A* will get the strictly better position than *B*, and if two students have equal ratings, they will share the same position.
GukiZ would like you to reconstruct the results by following his expectations. Help him and determine the position after the end of the contest for each of his students if everything goes as expected.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=2000), number of GukiZ's students.
The second line contains *n* numbers *a*1,<=*a*2,<=... *a**n* (1<=≤<=*a**i*<=≤<=2000) where *a**i* is the rating of *i*-th student (1<=≤<=*i*<=≤<=*n*).
Output Specification:
In a single line, print the position after the end of the contest for each of *n* students in the same order as they appear in the input.
Demo Input:
['3\n1 3 3\n', '1\n1\n', '5\n3 5 3 4 5\n']
Demo Output:
['3 1 1\n', '1\n', '4 1 4 3 1\n']
Note:
In the first sample, students 2 and 3 are positioned first (there is no other student with higher rating), and student 1 is positioned third since there are two students with higher rating.
In the second sample, first student is the only one on the contest.
In the third sample, students 2 and 5 share the first position with highest rating, student 4 is next with third position, and students 1 and 3 are the last sharing fourth position. | ```python
n=int(input())
l=list(map(int,input().split()))
s=sorted(l)
s=s[::-1]
for i in range(n):
l[i]=s.index(l[i])+1
print(*l)
``` | 3 |
|
43 | A | Football | PROGRAMMING | 1,000 | [
"strings"
] | A. Football | 2 | 256 | One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie. | The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams. | Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. | [
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] | [
"ABC\n",
"A\n"
] | none | 500 | [
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
"output": "QCCYXL"
},
{
"input": "3\nAZID\nEERWBC\nEERWBC",
"output": "EERWBC"
},
{
"input": "3\nHNCGYL\nHNCGYL\nHNCGYL",
"output": "HNCGYL"
},
{
"input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG",
"output": "ZZWZTG"
},
{
"input": "4\nA\nA\nKUDLJMXCSE\nA",
"output": "A"
},
{
"input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW",
"output": "PHBTW"
},
{
"input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN",
"output": "PKUZYTFYWN"
},
{
"input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH",
"output": "HH"
},
{
"input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW",
"output": "W"
},
{
"input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP",
"output": "XBCP"
},
{
"input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS",
"output": "PYPAS"
},
{
"input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC",
"output": "NC"
},
{
"input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI",
"output": "VOCI"
},
{
"input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA",
"output": "HA"
},
{
"input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS",
"output": "G"
},
{
"input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL",
"output": "WL"
}
] | 1,472,400,769 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 124 | 0 | sl = []
for i in range(int(input())):
sl+=[input()]
ans = []
for s in set(sl):
ans+=[[sl.count(s), s]]
ans.sort(reverse=True)
print(ans[0][1]) | Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Output Specification:
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
Demo Input:
['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n']
Demo Output:
['ABC\n', 'A\n']
Note:
none | ```python
sl = []
for i in range(int(input())):
sl+=[input()]
ans = []
for s in set(sl):
ans+=[[sl.count(s), s]]
ans.sort(reverse=True)
print(ans[0][1])
``` | 3.969 |
805 | B | 3-palindrome | PROGRAMMING | 1,000 | [
"constructive algorithms"
] | null | null | In the beginning of the new year Keivan decided to reverse his name. He doesn't like palindromes, so he changed Naviek to Navick.
He is too selfish, so for a given *n* he wants to obtain a string of *n* characters, each of which is either 'a', 'b' or 'c', with no palindromes of length 3 appearing in the string as a substring. For example, the strings "abc" and "abca" suit him, while the string "aba" doesn't. He also want the number of letters 'c' in his string to be as little as possible. | The first line contains single integer *n* (1<=≤<=*n*<=≤<=2·105) — the length of the string. | Print the string that satisfies all the constraints.
If there are multiple answers, print any of them. | [
"2\n",
"3\n"
] | [
"aa\n",
"bba\n"
] | A palindrome is a sequence of characters which reads the same backward and forward. | 1,000 | [
{
"input": "2",
"output": "aa"
},
{
"input": "3",
"output": "aab"
},
{
"input": "38",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaa"
},
{
"input": "47",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "59",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "67",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "77",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "89",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "98",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaa"
},
{
"input": "109",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "117",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "1",
"output": "a"
},
{
"input": "200000",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "100000",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "143670",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "104217",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "17879",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "131809",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "140873",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "77859",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "153022",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "179227",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "182801",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "5188",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "86539",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "12802",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "120289",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "132866",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "133377",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "31775",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "160397",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "161415",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "163623",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "22942",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "134767",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "52257",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "64905",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "183758",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "60131",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "146883",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "6",
"output": "aabbaa"
},
{
"input": "4",
"output": "aabb"
}
] | 1,636,961,316 | 2,147,483,647 | PyPy 3 | OK | TESTS | 42 | 92 | 1,024,000 | s, n = "aabb", int(input())
print(s * ((n >> 1) >> 1) + s[0:n % 4]) | Title: 3-palindrome
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the beginning of the new year Keivan decided to reverse his name. He doesn't like palindromes, so he changed Naviek to Navick.
He is too selfish, so for a given *n* he wants to obtain a string of *n* characters, each of which is either 'a', 'b' or 'c', with no palindromes of length 3 appearing in the string as a substring. For example, the strings "abc" and "abca" suit him, while the string "aba" doesn't. He also want the number of letters 'c' in his string to be as little as possible.
Input Specification:
The first line contains single integer *n* (1<=≤<=*n*<=≤<=2·105) — the length of the string.
Output Specification:
Print the string that satisfies all the constraints.
If there are multiple answers, print any of them.
Demo Input:
['2\n', '3\n']
Demo Output:
['aa\n', 'bba\n']
Note:
A palindrome is a sequence of characters which reads the same backward and forward. | ```python
s, n = "aabb", int(input())
print(s * ((n >> 1) >> 1) + s[0:n % 4])
``` | 3 |
|
854 | A | Fraction | PROGRAMMING | 800 | [
"brute force",
"constructive algorithms",
"math"
] | null | null | Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem. | In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction. | Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum. | [
"3\n",
"4\n",
"12\n"
] | [
"1 2\n",
"1 3\n",
"5 7\n"
] | none | 500 | [
{
"input": "3",
"output": "1 2"
},
{
"input": "4",
"output": "1 3"
},
{
"input": "12",
"output": "5 7"
},
{
"input": "34",
"output": "15 19"
},
{
"input": "13",
"output": "6 7"
},
{
"input": "11",
"output": "5 6"
},
{
"input": "24",
"output": "11 13"
},
{
"input": "17",
"output": "8 9"
},
{
"input": "10",
"output": "3 7"
},
{
"input": "69",
"output": "34 35"
},
{
"input": "100",
"output": "49 51"
},
{
"input": "57",
"output": "28 29"
},
{
"input": "1000",
"output": "499 501"
},
{
"input": "999",
"output": "499 500"
},
{
"input": "998",
"output": "497 501"
},
{
"input": "997",
"output": "498 499"
},
{
"input": "996",
"output": "497 499"
},
{
"input": "995",
"output": "497 498"
},
{
"input": "994",
"output": "495 499"
},
{
"input": "5",
"output": "2 3"
},
{
"input": "6",
"output": "1 5"
},
{
"input": "8",
"output": "3 5"
},
{
"input": "9",
"output": "4 5"
},
{
"input": "423",
"output": "211 212"
},
{
"input": "876",
"output": "437 439"
},
{
"input": "29",
"output": "14 15"
}
] | 1,535,949,784 | 2,147,483,647 | Python 3 | OK | TESTS | 26 | 202 | 1,126,400 | from fractions import gcd
sum = input()
sum = int(sum)
div = sum/2
i = 1
gcdFlag = True
a = 0
b = 0
while gcdFlag:
a = int(div-i)
b = int(div+i)
if (sum%2!=0) :
a += 1
if(gcd(a,b)<=1):
gcdFlag = False
else:
i += 1
print(a," ",b)
| Title: Fraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya is a big fan of mathematics, especially its part related to fractions. Recently he learned that a fraction is called proper iff its numerator is smaller than its denominator (*a*<=<<=*b*) and that the fraction is called irreducible if its numerator and its denominator are coprime (they do not have positive common divisors except 1).
During his free time, Petya thinks about proper irreducible fractions and converts them to decimals using the calculator. One day he mistakenly pressed addition button (<=+<=) instead of division button (÷) and got sum of numerator and denominator that was equal to *n* instead of the expected decimal notation.
Petya wanted to restore the original fraction, but soon he realized that it might not be done uniquely. That's why he decided to determine maximum possible proper irreducible fraction such that sum of its numerator and denominator equals *n*. Help Petya deal with this problem.
Input Specification:
In the only line of input there is an integer *n* (3<=≤<=*n*<=≤<=1000), the sum of numerator and denominator of the fraction.
Output Specification:
Output two space-separated positive integers *a* and *b*, numerator and denominator of the maximum possible proper irreducible fraction satisfying the given sum.
Demo Input:
['3\n', '4\n', '12\n']
Demo Output:
['1 2\n', '1 3\n', '5 7\n']
Note:
none | ```python
from fractions import gcd
sum = input()
sum = int(sum)
div = sum/2
i = 1
gcdFlag = True
a = 0
b = 0
while gcdFlag:
a = int(div-i)
b = int(div+i)
if (sum%2!=0) :
a += 1
if(gcd(a,b)<=1):
gcdFlag = False
else:
i += 1
print(a," ",b)
``` | 3 |
|
143 | A | Help Vasilisa the Wise 2 | PROGRAMMING | 1,000 | [
"brute force",
"math"
] | null | null | Vasilisa the Wise from the Kingdom of Far Far Away got a magic box with a secret as a present from her friend Hellawisa the Wise from the Kingdom of A Little Closer. However, Vasilisa the Wise does not know what the box's secret is, since she cannot open it again. She hopes that you will help her one more time with that.
The box's lock looks as follows: it contains 4 identical deepenings for gems as a 2<=×<=2 square, and some integer numbers are written at the lock's edge near the deepenings. The example of a lock is given on the picture below.
The box is accompanied with 9 gems. Their shapes match the deepenings' shapes and each gem contains one number from 1 to 9 (each number is written on exactly one gem). The box will only open after it is decorated with gems correctly: that is, each deepening in the lock should be filled with exactly one gem. Also, the sums of numbers in the square's rows, columns and two diagonals of the square should match the numbers written at the lock's edge. For example, the above lock will open if we fill the deepenings with gems with numbers as is shown on the picture below.
Now Vasilisa the Wise wants to define, given the numbers on the box's lock, which gems she should put in the deepenings to open the box. Help Vasilisa to solve this challenging task. | The input contains numbers written on the edges of the lock of the box. The first line contains space-separated integers *r*1 and *r*2 that define the required sums of numbers in the rows of the square. The second line contains space-separated integers *c*1 and *c*2 that define the required sums of numbers in the columns of the square. The third line contains space-separated integers *d*1 and *d*2 that define the required sums of numbers on the main and on the side diagonals of the square (1<=≤<=*r*1,<=*r*2,<=*c*1,<=*c*2,<=*d*1,<=*d*2<=≤<=20). Correspondence between the above 6 variables and places where they are written is shown on the picture below. For more clarifications please look at the second sample test that demonstrates the example given in the problem statement. | Print the scheme of decorating the box with stones: two lines containing two space-separated integers from 1 to 9. The numbers should be pairwise different. If there is no solution for the given lock, then print the single number "-1" (without the quotes).
If there are several solutions, output any. | [
"3 7\n4 6\n5 5\n",
"11 10\n13 8\n5 16\n",
"1 2\n3 4\n5 6\n",
"10 10\n10 10\n10 10\n"
] | [
"1 2\n3 4\n",
"4 7\n9 1\n",
"-1\n",
"-1\n"
] | Pay attention to the last test from the statement: it is impossible to open the box because for that Vasilisa the Wise would need 4 identical gems containing number "5". However, Vasilisa only has one gem with each number from 1 to 9. | 500 | [
{
"input": "3 7\n4 6\n5 5",
"output": "1 2\n3 4"
},
{
"input": "11 10\n13 8\n5 16",
"output": "4 7\n9 1"
},
{
"input": "1 2\n3 4\n5 6",
"output": "-1"
},
{
"input": "10 10\n10 10\n10 10",
"output": "-1"
},
{
"input": "5 13\n8 10\n11 7",
"output": "3 2\n5 8"
},
{
"input": "12 17\n10 19\n13 16",
"output": "-1"
},
{
"input": "11 11\n17 5\n12 10",
"output": "9 2\n8 3"
},
{
"input": "12 11\n11 12\n16 7",
"output": "-1"
},
{
"input": "5 9\n7 7\n8 6",
"output": "3 2\n4 5"
},
{
"input": "10 7\n4 13\n11 6",
"output": "-1"
},
{
"input": "18 10\n16 12\n12 16",
"output": "-1"
},
{
"input": "13 6\n10 9\n6 13",
"output": "-1"
},
{
"input": "14 16\n16 14\n18 12",
"output": "-1"
},
{
"input": "16 10\n16 10\n12 14",
"output": "-1"
},
{
"input": "11 9\n12 8\n11 9",
"output": "-1"
},
{
"input": "5 14\n10 9\n10 9",
"output": "-1"
},
{
"input": "2 4\n1 5\n3 3",
"output": "-1"
},
{
"input": "17 16\n14 19\n18 15",
"output": "-1"
},
{
"input": "12 12\n14 10\n16 8",
"output": "9 3\n5 7"
},
{
"input": "15 11\n16 10\n9 17",
"output": "7 8\n9 2"
},
{
"input": "8 10\n9 9\n13 5",
"output": "6 2\n3 7"
},
{
"input": "13 7\n10 10\n5 15",
"output": "4 9\n6 1"
},
{
"input": "14 11\n9 16\n16 9",
"output": "-1"
},
{
"input": "12 8\n14 6\n8 12",
"output": "-1"
},
{
"input": "10 6\n6 10\n4 12",
"output": "-1"
},
{
"input": "10 8\n10 8\n4 14",
"output": "-1"
},
{
"input": "14 13\n9 18\n14 13",
"output": "-1"
},
{
"input": "9 14\n8 15\n8 15",
"output": "-1"
},
{
"input": "3 8\n2 9\n6 5",
"output": "-1"
},
{
"input": "14 17\n18 13\n15 16",
"output": "-1"
},
{
"input": "16 14\n15 15\n17 13",
"output": "9 7\n6 8"
},
{
"input": "14 11\n16 9\n13 12",
"output": "9 5\n7 4"
},
{
"input": "13 10\n11 12\n7 16",
"output": "4 9\n7 3"
},
{
"input": "14 8\n11 11\n13 9",
"output": "8 6\n3 5"
},
{
"input": "12 11\n13 10\n10 13",
"output": "-1"
},
{
"input": "6 5\n2 9\n5 6",
"output": "-1"
},
{
"input": "7 8\n8 7\n12 3",
"output": "-1"
},
{
"input": "7 11\n7 11\n6 12",
"output": "-1"
},
{
"input": "8 5\n11 2\n8 5",
"output": "-1"
},
{
"input": "10 16\n14 12\n14 12",
"output": "-1"
},
{
"input": "7 9\n4 12\n5 11",
"output": "-1"
},
{
"input": "11 13\n19 5\n12 12",
"output": "-1"
},
{
"input": "8 12\n5 15\n11 9",
"output": "2 6\n3 9"
},
{
"input": "16 5\n13 8\n10 11",
"output": "9 7\n4 1"
},
{
"input": "3 14\n8 9\n10 7",
"output": "2 1\n6 8"
},
{
"input": "12 14\n11 15\n9 17",
"output": "3 9\n8 6"
},
{
"input": "13 7\n9 11\n14 6",
"output": "8 5\n1 6"
},
{
"input": "13 8\n15 6\n11 10",
"output": "9 4\n6 2"
},
{
"input": "9 6\n5 10\n3 12",
"output": "1 8\n4 2"
},
{
"input": "12 7\n5 14\n8 11",
"output": "3 9\n2 5"
},
{
"input": "9 12\n3 17\n10 10",
"output": "-1"
},
{
"input": "3 8\n4 6\n5 5",
"output": "-1"
}
] | 1,573,490,400 | 2,147,483,647 | Python 3 | OK | TESTS | 52 | 280 | 307,200 |
r1, r2 = map(int, input().split())
c1, c2 = map(int, input().split())
d1, d2 = map(int, input().split())
l1 = []
l2 = []
for i in range(1, 10):
for j in range(1, 10):
if i + j == r1:
l1.append([i, j])
if i + j == r2:
l2.append([i, j])
lp = []
for i in l1:
for j in l2:
if i[0] + j[0] == c1 and i[1] + j[1] == c2:
lp.append([i, j])
li = []
for i in lp:
if i[0][0] + i[1][1] == d1 and i[0][1] + i[1][0] == d2:
li.append(i)
if len(li) == 0:
print(-1)
exit()
for i in li:
cl = [i[0][0], i[1][0], i[1][1], i[0][1]]
if len(cl) == len(set(cl)):
print(i[0][0], i[0][1])
print(i[1][0], i[1][1])
exit()
print(-1)
| Title: Help Vasilisa the Wise 2
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasilisa the Wise from the Kingdom of Far Far Away got a magic box with a secret as a present from her friend Hellawisa the Wise from the Kingdom of A Little Closer. However, Vasilisa the Wise does not know what the box's secret is, since she cannot open it again. She hopes that you will help her one more time with that.
The box's lock looks as follows: it contains 4 identical deepenings for gems as a 2<=×<=2 square, and some integer numbers are written at the lock's edge near the deepenings. The example of a lock is given on the picture below.
The box is accompanied with 9 gems. Their shapes match the deepenings' shapes and each gem contains one number from 1 to 9 (each number is written on exactly one gem). The box will only open after it is decorated with gems correctly: that is, each deepening in the lock should be filled with exactly one gem. Also, the sums of numbers in the square's rows, columns and two diagonals of the square should match the numbers written at the lock's edge. For example, the above lock will open if we fill the deepenings with gems with numbers as is shown on the picture below.
Now Vasilisa the Wise wants to define, given the numbers on the box's lock, which gems she should put in the deepenings to open the box. Help Vasilisa to solve this challenging task.
Input Specification:
The input contains numbers written on the edges of the lock of the box. The first line contains space-separated integers *r*1 and *r*2 that define the required sums of numbers in the rows of the square. The second line contains space-separated integers *c*1 and *c*2 that define the required sums of numbers in the columns of the square. The third line contains space-separated integers *d*1 and *d*2 that define the required sums of numbers on the main and on the side diagonals of the square (1<=≤<=*r*1,<=*r*2,<=*c*1,<=*c*2,<=*d*1,<=*d*2<=≤<=20). Correspondence between the above 6 variables and places where they are written is shown on the picture below. For more clarifications please look at the second sample test that demonstrates the example given in the problem statement.
Output Specification:
Print the scheme of decorating the box with stones: two lines containing two space-separated integers from 1 to 9. The numbers should be pairwise different. If there is no solution for the given lock, then print the single number "-1" (without the quotes).
If there are several solutions, output any.
Demo Input:
['3 7\n4 6\n5 5\n', '11 10\n13 8\n5 16\n', '1 2\n3 4\n5 6\n', '10 10\n10 10\n10 10\n']
Demo Output:
['1 2\n3 4\n', '4 7\n9 1\n', '-1\n', '-1\n']
Note:
Pay attention to the last test from the statement: it is impossible to open the box because for that Vasilisa the Wise would need 4 identical gems containing number "5". However, Vasilisa only has one gem with each number from 1 to 9. | ```python
r1, r2 = map(int, input().split())
c1, c2 = map(int, input().split())
d1, d2 = map(int, input().split())
l1 = []
l2 = []
for i in range(1, 10):
for j in range(1, 10):
if i + j == r1:
l1.append([i, j])
if i + j == r2:
l2.append([i, j])
lp = []
for i in l1:
for j in l2:
if i[0] + j[0] == c1 and i[1] + j[1] == c2:
lp.append([i, j])
li = []
for i in lp:
if i[0][0] + i[1][1] == d1 and i[0][1] + i[1][0] == d2:
li.append(i)
if len(li) == 0:
print(-1)
exit()
for i in li:
cl = [i[0][0], i[1][0], i[1][1], i[0][1]]
if len(cl) == len(set(cl)):
print(i[0][0], i[0][1])
print(i[1][0], i[1][1])
exit()
print(-1)
``` | 3 |
|
25 | A | IQ test | PROGRAMMING | 1,300 | [
"brute force"
] | A. IQ test | 2 | 256 | Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness. | The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. | Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. | [
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] | [
"3\n",
"2\n"
] | none | 0 | [
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output": "2"
},
{
"input": "4\n75 13 94 77",
"output": "3"
},
{
"input": "4\n97 8 27 3",
"output": "2"
},
{
"input": "10\n95 51 12 91 85 3 1 31 25 7",
"output": "3"
},
{
"input": "20\n88 96 66 51 14 88 2 92 18 72 18 88 20 30 4 82 90 100 24 46",
"output": "4"
},
{
"input": "30\n20 94 56 50 10 98 52 32 14 22 24 60 4 8 98 46 34 68 82 82 98 90 50 20 78 49 52 94 64 36",
"output": "26"
},
{
"input": "50\n79 27 77 57 37 45 27 49 65 33 57 21 71 19 75 85 65 61 23 97 85 9 23 1 9 3 99 77 77 21 79 69 15 37 15 7 93 81 13 89 91 31 45 93 15 97 55 80 85 83",
"output": "48"
},
{
"input": "60\n46 11 73 65 3 69 3 53 43 53 97 47 55 93 31 75 35 3 9 73 23 31 3 81 91 79 61 21 15 11 11 11 81 7 83 75 39 87 83 59 89 55 93 27 49 67 67 29 1 93 11 17 9 19 35 21 63 31 31 25",
"output": "1"
},
{
"input": "70\n28 42 42 92 64 54 22 38 38 78 62 38 4 38 14 66 4 92 66 58 94 26 4 44 41 88 48 82 44 26 74 44 48 4 16 92 34 38 26 64 94 4 30 78 50 54 12 90 8 16 80 98 28 100 74 50 36 42 92 18 76 98 8 22 2 50 58 50 64 46",
"output": "25"
},
{
"input": "100\n43 35 79 53 13 91 91 45 65 83 57 9 42 39 85 45 71 51 61 59 31 13 63 39 25 21 79 39 91 67 21 61 97 75 93 83 29 79 59 97 11 37 63 51 39 55 91 23 21 17 47 23 35 75 49 5 69 99 5 7 41 17 25 89 15 79 21 63 53 81 43 91 59 91 69 99 85 15 91 51 49 37 65 7 89 81 21 93 61 63 97 93 45 17 13 69 57 25 75 73",
"output": "13"
},
{
"input": "100\n50 24 68 60 70 30 52 22 18 74 68 98 20 82 4 46 26 68 100 78 84 58 74 98 38 88 68 86 64 80 82 100 20 22 98 98 52 6 94 10 48 68 2 18 38 22 22 82 44 20 66 72 36 58 64 6 36 60 4 96 76 64 12 90 10 58 64 60 74 28 90 26 24 60 40 58 2 16 76 48 58 36 82 60 24 44 4 78 28 38 8 12 40 16 38 6 66 24 31 76",
"output": "99"
},
{
"input": "100\n47 48 94 48 14 18 94 36 96 22 12 30 94 20 48 98 40 58 2 94 8 36 98 18 98 68 2 60 76 38 18 100 8 72 100 68 2 86 92 72 58 16 48 14 6 58 72 76 6 88 80 66 20 28 74 62 86 68 90 86 2 56 34 38 56 90 4 8 76 44 32 86 12 98 38 34 54 92 70 94 10 24 82 66 90 58 62 2 32 58 100 22 58 72 2 22 68 72 42 14",
"output": "1"
},
{
"input": "99\n38 20 68 60 84 16 28 88 60 48 80 28 4 92 70 60 46 46 20 34 12 100 76 2 40 10 8 86 6 80 50 66 12 34 14 28 26 70 46 64 34 96 10 90 98 96 56 88 50 74 70 94 2 94 24 66 68 46 22 30 6 10 64 32 88 14 98 100 64 58 50 18 50 50 8 38 8 16 54 2 60 54 62 84 92 98 4 72 66 26 14 88 99 16 10 6 88 56 22",
"output": "93"
},
{
"input": "99\n50 83 43 89 53 47 69 1 5 37 63 87 95 15 55 95 75 89 33 53 89 75 93 75 11 85 49 29 11 97 49 67 87 11 25 37 97 73 67 49 87 43 53 97 43 29 53 33 45 91 37 73 39 49 59 5 21 43 87 35 5 63 89 57 63 47 29 99 19 85 13 13 3 13 43 19 5 9 61 51 51 57 15 89 13 97 41 13 99 79 13 27 97 95 73 33 99 27 23",
"output": "1"
},
{
"input": "98\n61 56 44 30 58 14 20 24 88 28 46 56 96 52 58 42 94 50 46 30 46 80 72 88 68 16 6 60 26 90 10 98 76 20 56 40 30 16 96 20 88 32 62 30 74 58 36 76 60 4 24 36 42 54 24 92 28 14 2 74 86 90 14 52 34 82 40 76 8 64 2 56 10 8 78 16 70 86 70 42 70 74 22 18 76 98 88 28 62 70 36 72 20 68 34 48 80 98",
"output": "1"
},
{
"input": "98\n66 26 46 42 78 32 76 42 26 82 8 12 4 10 24 26 64 44 100 46 94 64 30 18 88 28 8 66 30 82 82 28 74 52 62 80 80 60 94 86 64 32 44 88 92 20 12 74 94 28 34 58 4 22 16 10 94 76 82 58 40 66 22 6 30 32 92 54 16 76 74 98 18 48 48 30 92 2 16 42 84 74 30 60 64 52 50 26 16 86 58 96 79 60 20 62 82 94",
"output": "93"
},
{
"input": "95\n9 31 27 93 17 77 75 9 9 53 89 39 51 99 5 1 11 39 27 49 91 17 27 79 81 71 37 75 35 13 93 4 99 55 85 11 23 57 5 43 5 61 15 35 23 91 3 81 99 85 43 37 39 27 5 67 7 33 75 59 13 71 51 27 15 93 51 63 91 53 43 99 25 47 17 71 81 15 53 31 59 83 41 23 73 25 91 91 13 17 25 13 55 57 29",
"output": "32"
},
{
"input": "100\n91 89 81 45 53 1 41 3 77 93 55 97 55 97 87 27 69 95 73 41 93 21 75 35 53 56 5 51 87 59 91 67 33 3 99 45 83 17 97 47 75 97 7 89 17 99 23 23 81 25 55 97 27 35 69 5 77 35 93 19 55 59 37 21 31 37 49 41 91 53 73 69 7 37 37 39 17 71 7 97 55 17 47 23 15 73 31 39 57 37 9 5 61 41 65 57 77 79 35 47",
"output": "26"
},
{
"input": "99\n38 56 58 98 80 54 26 90 14 16 78 92 52 74 40 30 84 14 44 80 16 90 98 68 26 24 78 72 42 16 84 40 14 44 2 52 50 2 12 96 58 66 8 80 44 52 34 34 72 98 74 4 66 74 56 21 8 38 76 40 10 22 48 32 98 34 12 62 80 68 64 82 22 78 58 74 20 22 48 56 12 38 32 72 6 16 74 24 94 84 26 38 18 24 76 78 98 94 72",
"output": "56"
},
{
"input": "100\n44 40 6 40 56 90 98 8 36 64 76 86 98 76 36 92 6 30 98 70 24 98 96 60 24 82 88 68 86 96 34 42 58 10 40 26 56 10 88 58 70 32 24 28 14 82 52 12 62 36 70 60 52 34 74 30 78 76 10 16 42 94 66 90 70 38 52 12 58 22 98 96 14 68 24 70 4 30 84 98 8 50 14 52 66 34 100 10 28 100 56 48 38 12 38 14 91 80 70 86",
"output": "97"
},
{
"input": "100\n96 62 64 20 90 46 56 90 68 36 30 56 70 28 16 64 94 34 6 32 34 50 94 22 90 32 40 2 72 10 88 38 28 92 20 26 56 80 4 100 100 90 16 74 74 84 8 2 30 20 80 32 16 46 92 56 42 12 96 64 64 42 64 58 50 42 74 28 2 4 36 32 70 50 54 92 70 16 45 76 28 16 18 50 48 2 62 94 4 12 52 52 4 100 70 60 82 62 98 42",
"output": "79"
},
{
"input": "99\n14 26 34 68 90 58 50 36 8 16 18 6 2 74 54 20 36 84 32 50 52 2 26 24 3 64 20 10 54 26 66 44 28 72 4 96 78 90 96 86 68 28 94 4 12 46 100 32 22 36 84 32 44 94 76 94 4 52 12 30 74 4 34 64 58 72 44 16 70 56 54 8 14 74 8 6 58 62 98 54 14 40 80 20 36 72 28 98 20 58 40 52 90 64 22 48 54 70 52",
"output": "25"
},
{
"input": "95\n82 86 30 78 6 46 80 66 74 72 16 24 18 52 52 38 60 36 86 26 62 28 22 46 96 26 94 84 20 46 66 88 76 32 12 86 74 18 34 88 4 48 94 6 58 6 100 82 4 24 88 32 54 98 34 48 6 76 42 88 42 28 100 4 22 2 10 66 82 54 98 20 60 66 38 98 32 47 86 58 6 100 12 46 2 42 8 84 78 28 24 70 34 28 86",
"output": "78"
},
{
"input": "90\n40 50 8 42 76 24 58 42 26 68 20 48 54 12 34 84 14 36 32 88 6 50 96 56 20 92 48 16 40 34 96 46 20 84 30 50 20 98 8 44 96 42 8 76 70 38 84 30 40 88 84 72 2 22 52 58 16 62 100 66 80 40 50 32 14 62 88 72 22 99 76 50 84 82 8 82 98 46 26 40 2 98 18 78 30 72 70 18 34 68",
"output": "70"
},
{
"input": "80\n81 43 87 1 55 43 53 61 27 19 43 13 89 9 33 83 75 55 97 71 91 37 95 5 21 69 81 93 95 69 31 83 55 7 97 7 79 57 8 61 27 85 49 1 15 97 63 79 29 73 41 85 5 41 31 93 67 11 63 59 15 99 91 77 43 69 23 23 81 73 19 1 67 51 1 75 99 67 3 81",
"output": "39"
},
{
"input": "98\n13 83 61 27 35 1 85 95 97 73 95 65 73 45 5 43 27 83 91 19 11 3 85 59 9 39 69 23 45 7 51 85 5 71 5 95 1 51 75 3 43 57 3 11 33 71 21 99 47 41 87 39 71 87 31 85 91 49 83 5 49 85 47 91 55 99 33 23 31 23 23 73 29 77 55 31 25 5 81 49 91 15 15 39 87 5 9 40 69 47 29 33 11 21 49 79 51 83",
"output": "88"
},
{
"input": "3\n100 100 1",
"output": "3"
}
] | 1,628,333,322 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 60 | 6,656,000 | n=int(input())
l=list(map(int(),input().rstrip().split(' ')))
for i in l:
if i%2!=0:
break
print(l.index(i)+1)
for i in l:
if i%2==0:
break
print(l.index(i)+1)
| Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
Input Specification:
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output Specification:
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
Demo Input:
['5\n2 4 7 8 10\n', '4\n1 2 1 1\n']
Demo Output:
['3\n', '2\n']
Note:
none | ```python
n=int(input())
l=list(map(int(),input().rstrip().split(' ')))
for i in l:
if i%2!=0:
break
print(l.index(i)+1)
for i in l:
if i%2==0:
break
print(l.index(i)+1)
``` | -1 |
673 | A | Bear and Game | PROGRAMMING | 800 | [
"implementation"
] | null | null | Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game. | The first line of the input contains one integer *n* (1<=≤<=*n*<=≤<=90) — the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=... *t**n*<=≤<=90), given in the increasing order. | Print the number of minutes Limak will watch the game. | [
"3\n7 20 88\n",
"9\n16 20 30 40 50 60 70 80 90\n",
"9\n15 20 30 40 50 60 70 80 90\n"
] | [
"35\n",
"15\n",
"90\n"
] | In the first sample, minutes 21, 22, ..., 35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game. | 500 | [
{
"input": "3\n7 20 88",
"output": "35"
},
{
"input": "9\n16 20 30 40 50 60 70 80 90",
"output": "15"
},
{
"input": "9\n15 20 30 40 50 60 70 80 90",
"output": "90"
},
{
"input": "30\n6 11 12 15 22 24 30 31 32 33 34 35 40 42 44 45 47 50 53 54 57 58 63 67 75 77 79 81 83 88",
"output": "90"
},
{
"input": "60\n1 2 4 5 6 7 11 14 16 18 20 21 22 23 24 25 26 33 34 35 36 37 38 39 41 42 43 44 46 47 48 49 52 55 56 57 58 59 60 61 63 64 65 67 68 70 71 72 73 74 75 77 78 80 82 83 84 85 86 88",
"output": "90"
},
{
"input": "90\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n1",
"output": "16"
},
{
"input": "5\n15 30 45 60 75",
"output": "90"
},
{
"input": "6\n14 29 43 59 70 74",
"output": "58"
},
{
"input": "1\n15",
"output": "30"
},
{
"input": "1\n16",
"output": "15"
},
{
"input": "14\n14 22 27 31 35 44 46 61 62 69 74 79 88 89",
"output": "90"
},
{
"input": "76\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n90",
"output": "15"
},
{
"input": "6\n13 17 32 47 60 66",
"output": "81"
},
{
"input": "84\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84",
"output": "90"
},
{
"input": "9\n6 20 27 28 40 53 59 70 85",
"output": "90"
},
{
"input": "12\n14 22 27 31 35 44 62 69 74 79 88 89",
"output": "59"
},
{
"input": "5\n15 30 45 60 74",
"output": "89"
},
{
"input": "72\n3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89",
"output": "54"
},
{
"input": "8\n1 16 30 31 32 33 34 50",
"output": "49"
},
{
"input": "12\n1 3 6 10 15 21 28 36 45 55 66 78",
"output": "90"
},
{
"input": "25\n1 2 3 4 5 6 7 8 9 10 11 23 36 50 65 81 82 83 84 85 86 87 88 89 90",
"output": "80"
},
{
"input": "8\n5 17 20 35 42 53 67 76",
"output": "90"
},
{
"input": "9\n15 28 39 48 55 60 63 64 74",
"output": "89"
},
{
"input": "10\n15 28 39 48 55 60 63 64 74 82",
"output": "90"
},
{
"input": "2\n1 18",
"output": "16"
},
{
"input": "9\n10 20 30 40 50 60 70 80 84",
"output": "90"
},
{
"input": "2\n16 50",
"output": "15"
},
{
"input": "6\n15 30 45 60 75 84",
"output": "90"
},
{
"input": "8\n15 20 30 40 50 60 73 83",
"output": "90"
},
{
"input": "8\n10 20 30 40 50 60 70 80",
"output": "90"
},
{
"input": "3\n1 20 90",
"output": "16"
},
{
"input": "6\n15 30 45 60 74 89",
"output": "90"
}
] | 1,540,396,331 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 124 | 0 | number = int(input())
list_array = str(input())
list_array = list_array.split()
list_array = list_array[0:number]
x = 0
for i in range(len(list_array)):
if (int(list_array[i]) - x) > 15:
x += 15
break
else:
if number == i + 1:
if int(list_array[i]) + 15 <= 90:
x = int(list_array[i]) + 15
else:
x = 90
else:
x = int(list_array[i])
print(x) | Title: Bear and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
Input Specification:
The first line of the input contains one integer *n* (1<=≤<=*n*<=≤<=90) — the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=... *t**n*<=≤<=90), given in the increasing order.
Output Specification:
Print the number of minutes Limak will watch the game.
Demo Input:
['3\n7 20 88\n', '9\n16 20 30 40 50 60 70 80 90\n', '9\n15 20 30 40 50 60 70 80 90\n']
Demo Output:
['35\n', '15\n', '90\n']
Note:
In the first sample, minutes 21, 22, ..., 35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game. | ```python
number = int(input())
list_array = str(input())
list_array = list_array.split()
list_array = list_array[0:number]
x = 0
for i in range(len(list_array)):
if (int(list_array[i]) - x) > 15:
x += 15
break
else:
if number == i + 1:
if int(list_array[i]) + 15 <= 90:
x = int(list_array[i]) + 15
else:
x = 90
else:
x = int(list_array[i])
print(x)
``` | 3 |
|
746 | A | Compote | PROGRAMMING | 800 | [
"implementation",
"math"
] | null | null | Nikolay has *a* lemons, *b* apples and *c* pears. He decided to cook a compote. According to the recipe the fruits should be in the ratio 1:<=2:<=4. It means that for each lemon in the compote should be exactly 2 apples and exactly 4 pears. You can't crumble up, break up or cut these fruits into pieces. These fruits — lemons, apples and pears — should be put in the compote as whole fruits.
Your task is to determine the maximum total number of lemons, apples and pears from which Nikolay can cook the compote. It is possible that Nikolay can't use any fruits, in this case print 0. | The first line contains the positive integer *a* (1<=≤<=*a*<=≤<=1000) — the number of lemons Nikolay has.
The second line contains the positive integer *b* (1<=≤<=*b*<=≤<=1000) — the number of apples Nikolay has.
The third line contains the positive integer *c* (1<=≤<=*c*<=≤<=1000) — the number of pears Nikolay has. | Print the maximum total number of lemons, apples and pears from which Nikolay can cook the compote. | [
"2\n5\n7\n",
"4\n7\n13\n",
"2\n3\n2\n"
] | [
"7\n",
"21\n",
"0\n"
] | In the first example Nikolay can use 1 lemon, 2 apples and 4 pears, so the answer is 1 + 2 + 4 = 7.
In the second example Nikolay can use 3 lemons, 6 apples and 12 pears, so the answer is 3 + 6 + 12 = 21.
In the third example Nikolay don't have enough pears to cook any compote, so the answer is 0. | 500 | [
{
"input": "2\n5\n7",
"output": "7"
},
{
"input": "4\n7\n13",
"output": "21"
},
{
"input": "2\n3\n2",
"output": "0"
},
{
"input": "1\n1\n1",
"output": "0"
},
{
"input": "1\n2\n4",
"output": "7"
},
{
"input": "1000\n1000\n1000",
"output": "1750"
},
{
"input": "1\n1\n4",
"output": "0"
},
{
"input": "1\n2\n3",
"output": "0"
},
{
"input": "1\n1000\n1000",
"output": "7"
},
{
"input": "1000\n1\n1000",
"output": "0"
},
{
"input": "1000\n2\n1000",
"output": "7"
},
{
"input": "1000\n500\n1000",
"output": "1750"
},
{
"input": "1000\n1000\n4",
"output": "7"
},
{
"input": "1000\n1000\n3",
"output": "0"
},
{
"input": "4\n8\n12",
"output": "21"
},
{
"input": "10\n20\n40",
"output": "70"
},
{
"input": "100\n200\n399",
"output": "693"
},
{
"input": "200\n400\n800",
"output": "1400"
},
{
"input": "199\n400\n800",
"output": "1393"
},
{
"input": "201\n400\n800",
"output": "1400"
},
{
"input": "200\n399\n800",
"output": "1393"
},
{
"input": "200\n401\n800",
"output": "1400"
},
{
"input": "200\n400\n799",
"output": "1393"
},
{
"input": "200\n400\n801",
"output": "1400"
},
{
"input": "139\n252\n871",
"output": "882"
},
{
"input": "109\n346\n811",
"output": "763"
},
{
"input": "237\n487\n517",
"output": "903"
},
{
"input": "161\n331\n725",
"output": "1127"
},
{
"input": "39\n471\n665",
"output": "273"
},
{
"input": "9\n270\n879",
"output": "63"
},
{
"input": "137\n422\n812",
"output": "959"
},
{
"input": "15\n313\n525",
"output": "105"
},
{
"input": "189\n407\n966",
"output": "1323"
},
{
"input": "18\n268\n538",
"output": "126"
},
{
"input": "146\n421\n978",
"output": "1022"
},
{
"input": "70\n311\n685",
"output": "490"
},
{
"input": "244\n405\n625",
"output": "1092"
},
{
"input": "168\n454\n832",
"output": "1176"
},
{
"input": "46\n344\n772",
"output": "322"
},
{
"input": "174\n438\n987",
"output": "1218"
},
{
"input": "144\n387\n693",
"output": "1008"
},
{
"input": "22\n481\n633",
"output": "154"
},
{
"input": "196\n280\n848",
"output": "980"
},
{
"input": "190\n454\n699",
"output": "1218"
},
{
"input": "231\n464\n928",
"output": "1617"
},
{
"input": "151\n308\n616",
"output": "1057"
},
{
"input": "88\n182\n364",
"output": "616"
},
{
"input": "12\n26\n52",
"output": "84"
},
{
"input": "204\n412\n824",
"output": "1428"
},
{
"input": "127\n256\n512",
"output": "889"
},
{
"input": "224\n446\n896",
"output": "1561"
},
{
"input": "146\n291\n584",
"output": "1015"
},
{
"input": "83\n164\n332",
"output": "574"
},
{
"input": "20\n38\n80",
"output": "133"
},
{
"input": "198\n393\n792",
"output": "1372"
},
{
"input": "120\n239\n480",
"output": "833"
},
{
"input": "208\n416\n831",
"output": "1449"
},
{
"input": "130\n260\n517",
"output": "903"
},
{
"input": "67\n134\n267",
"output": "462"
},
{
"input": "245\n490\n979",
"output": "1708"
},
{
"input": "182\n364\n727",
"output": "1267"
},
{
"input": "104\n208\n413",
"output": "721"
},
{
"input": "10\n2\n100",
"output": "7"
},
{
"input": "2\n100\n100",
"output": "14"
},
{
"input": "2\n3\n8",
"output": "7"
},
{
"input": "1\n2\n8",
"output": "7"
},
{
"input": "1\n2\n200",
"output": "7"
},
{
"input": "5\n4\n16",
"output": "14"
},
{
"input": "1\n10\n10",
"output": "7"
},
{
"input": "1\n4\n8",
"output": "7"
},
{
"input": "100\n4\n1000",
"output": "14"
},
{
"input": "2\n6\n12",
"output": "14"
},
{
"input": "10\n7\n4",
"output": "7"
},
{
"input": "2\n10\n100",
"output": "14"
},
{
"input": "2\n3\n4",
"output": "7"
},
{
"input": "1\n2\n999",
"output": "7"
},
{
"input": "1\n10\n20",
"output": "7"
},
{
"input": "100\n18\n20",
"output": "35"
},
{
"input": "100\n1\n100",
"output": "0"
},
{
"input": "3\n7\n80",
"output": "21"
},
{
"input": "2\n8\n24",
"output": "14"
},
{
"input": "1\n100\n100",
"output": "7"
},
{
"input": "2\n1\n8",
"output": "0"
},
{
"input": "10\n5\n23",
"output": "14"
}
] | 1,626,930,668 | 2,147,483,647 | Python 3 | OK | TESTS | 84 | 77 | 6,758,400 | x = int(input())
y = int(input())
z = int(input())
y = y // 2
z = z // 4
min = min(min(x, y), z)
print(min * 7)
| Title: Compote
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Nikolay has *a* lemons, *b* apples and *c* pears. He decided to cook a compote. According to the recipe the fruits should be in the ratio 1:<=2:<=4. It means that for each lemon in the compote should be exactly 2 apples and exactly 4 pears. You can't crumble up, break up or cut these fruits into pieces. These fruits — lemons, apples and pears — should be put in the compote as whole fruits.
Your task is to determine the maximum total number of lemons, apples and pears from which Nikolay can cook the compote. It is possible that Nikolay can't use any fruits, in this case print 0.
Input Specification:
The first line contains the positive integer *a* (1<=≤<=*a*<=≤<=1000) — the number of lemons Nikolay has.
The second line contains the positive integer *b* (1<=≤<=*b*<=≤<=1000) — the number of apples Nikolay has.
The third line contains the positive integer *c* (1<=≤<=*c*<=≤<=1000) — the number of pears Nikolay has.
Output Specification:
Print the maximum total number of lemons, apples and pears from which Nikolay can cook the compote.
Demo Input:
['2\n5\n7\n', '4\n7\n13\n', '2\n3\n2\n']
Demo Output:
['7\n', '21\n', '0\n']
Note:
In the first example Nikolay can use 1 lemon, 2 apples and 4 pears, so the answer is 1 + 2 + 4 = 7.
In the second example Nikolay can use 3 lemons, 6 apples and 12 pears, so the answer is 3 + 6 + 12 = 21.
In the third example Nikolay don't have enough pears to cook any compote, so the answer is 0. | ```python
x = int(input())
y = int(input())
z = int(input())
y = y // 2
z = z // 4
min = min(min(x, y), z)
print(min * 7)
``` | 3 |
|
276 | B | Little Girl and Game | PROGRAMMING | 1,300 | [
"games",
"greedy"
] | null | null | The Little Girl loves problems on games very much. Here's one of them.
Two players have got a string *s*, consisting of lowercase English letters. They play a game that is described by the following rules:
- The players move in turns; In one move the player can remove an arbitrary letter from string *s*. - If the player before his turn can reorder the letters in string *s* so as to get a palindrome, this player wins. A palindrome is a string that reads the same both ways (from left to right, and vice versa). For example, string "abba" is a palindrome and string "abc" isn't.
Determine which player will win, provided that both sides play optimally well — the one who moves first or the one who moves second. | The input contains a single line, containing string *s* (1<=≤<=|*s*|<=<=≤<=<=103). String *s* consists of lowercase English letters. | In a single line print word "First" if the first player wins (provided that both players play optimally well). Otherwise, print word "Second". Print the words without the quotes. | [
"aba\n",
"abca\n"
] | [
"First\n",
"Second\n"
] | none | 1,000 | [
{
"input": "aba",
"output": "First"
},
{
"input": "abca",
"output": "Second"
},
{
"input": "aabb",
"output": "First"
},
{
"input": "ctjxzuimsxnarlciuynqeoqmmbqtagszuo",
"output": "Second"
},
{
"input": "gevqgtaorjixsxnbcoybr",
"output": "First"
},
{
"input": "xvhtcbtouuddhylxhplgjxwlo",
"output": "First"
},
{
"input": "knaxhkbokmtfvnjvlsbrfoefpjpkqwlumeqqbeohodnwevhllkylposdpjuoizyunuxivzrjofiyxxiliuwhkjqpkqxukxroivfhikxjdtwcqngqswptdwrywxszxrqojjphzwzxqftnfhkapeejdgckfyrxtpuipfljsjwgpjfatmxpylpnerllshuvkbomlpghjrxcgxvktgeyuhrcwgvdmppqnkdmjtxukzlzqhfbgrishuhkyggkpstvqabpxoqjuovwjwcmazmvpfpnljdgpokpatjnvwacotkvxheorzbsrazldsquijzkmtmqahakjrjvzkquvayxpqrmqqcknilpqpjapagezonfpz",
"output": "Second"
},
{
"input": "desktciwoidfuswycratvovutcgjrcyzmilsmadzaegseetexygedzxdmorxzxgiqhcuppshcsjcozkopebegfmxzxxagzwoymlghgjexcgfojychyt",
"output": "First"
},
{
"input": "gfhuidxgxpxduqrfnqrnefgtyxgmrtehmddjkddwdiayyilaknxhlxszeslnsjpcrwnoqubmbpcehiftteirkfvbtfyibiikdaxmondnawtvqccctdxrjcfxqwqhvvrqmhqflbzskrayvruqvqijrmikucwzodxvufwxpxxjxlifdjzxrttjzatafkbzsjupsiefmipdufqltedjlytphzppoevxawjdhbxgennevbvdgpoeihasycctyddenzypoprchkoioouhcexjqwjflxvkgpgjatstlmledxasecfhwvabzwviywsiaryqrxyeceefblherqjevdzkfxslqiytwzz",
"output": "First"
},
{
"input": "fezzkpyctjvvqtncmmjsitrxaliyhirspnjjngvzdoudrkkvvdiwcwtcxobpobzukegtcrwsgxxzlcphdxkbxdximqbycaicfdeqlvzboptfimkzvjzdsvahorqqhcirpkhtwjkplitpacpkpbhnxtoxuoqsxcxnhtrmzvexmpvlethbkvmlzftimjnidrzvcunbpysvukzgwghjmwrvstsunaocnoqohcsggtrwxiworkliqejajewbrtdwgnyynpupbrrvtfqtlaaq",
"output": "Second"
},
{
"input": "tsvxmeixijyavdalmrvscwohzubhhgsocdvnjmjtctojbxxpezzbgfltixwgzmkfwdnlhidhrdgyajggmrvmwaoydodjmzqvgabyszfqcuhwdncyfqvmackvijgpjyiauxljvvwgiofdxccwmybdfcfcrqppbvbagmnvvvhngxauwbpourviyfokwjweypzzrrzjcmddnpoaqgqfgglssjnlshrerfffmrwhapzknxveiqixflykjbnpivogtdpyjakwrdoklsbvbkjhdojfnuwbpcfdycwxecysbyjfvoykxsxgg",
"output": "First"
},
{
"input": "upgqmhfmfnodsyosgqswugfvpdxhtkxvhlsxrjiqlojchoddxkpsamwmuvopdbncymcgrkurwlxerexgswricuqxhvqvgekeofkgqabypamozmyjyfvpifsaotnyzqydcenphcsmplekinwkmwzpjnlapfdbhxjdcnarlgkfgxzfbpgsuxqfyhnxjhtojrlnprnxprfbkkcyriqztjeeepkzgzcaiutvbqqofyhddfebozhvtvrigtidxqmydjxegxipakzjcnenjkdroyjmxugj",
"output": "Second"
},
{
"input": "aaaaaaaaaaaaaaaaaaaabbbbbbbbbbbbbbbbbbbbccccccccccccccccccccddddddddddeeeeeeeeeeffffgggghhhhiiiijjjjqqqqwwwweeeerrrrttttyyyyuuuuiiiiooooppppaaaassssddddffffgggghhhhjjjjkkkkllllzzzzxxxxccccvvvvbbbbnnnnmmmm",
"output": "First"
},
{
"input": "vnvtvnxjrtffdhrfvczzoyeokjabxcilmmsrhwuakghvuabcmfpmblyroodmhfivmhqoiqhapoglwaluewhqkunzitmvijaictjdncivccedfpaezcnpwemlohbhjjlqsonuclaumgbzjamsrhuzqdqtitygggsnruuccdtxkgbdd",
"output": "First"
},
{
"input": "vqdtkbvlbdyndheoiiwqhnvcmmhnhsmwwrvesnpdfxvprqbwzbodoihrywagphlsrcbtnvppjsquuuzkjazaenienjiyctyajsqdfsdiedzugkymgzllvpxfetkwfabbiotjcknzdwsvmbbuqrxrulvgljagvxdmfsqtcczhifhoghqgffkbviphbabwiaqburerfkbqfjbptkwlahysrrfwjbqfnrgnsnsukqqcxxwqtuhvdzqmpfwrbqzdwxcaifuyhvojgurmchh",
"output": "First"
},
{
"input": "hxueikegwnrctlciwguepdsgupguykrntbszeqzzbpdlouwnmqgzcxejidstxyxhdlnttnibxstduwiflouzfswfikdudkazoefawm",
"output": "Second"
},
{
"input": "ershkhsywqftixappwqzoojtnamvqjbyfauvuubwpctspioqusnnivwsiyszfhlrskbswaiaczurygcioonjcndntwvrlaejyrghfnecltqytfmkvjxuujifgtujrqsisdawpwgttxynewiqhdhronamabysvpxankxeybcjqttbqnciwuqiehzyfjoedaradqnfthuuwrezwrkjiytpgwfwbslawbiezdbdltenjlaygwaxddplgseiaojndqjcopvolqbvnacuvfvirzbrnlnyjixngeevcggmirzatenjihpgnyfjhgsjgzepohbyhmzbatfwuorwutavlqsogrvcjpqziuifrhurq",
"output": "First"
},
{
"input": "qilwpsuxogazrfgfznngwklnioueuccyjfatjoizcctgsweitzofwkyjustizbopzwtaqxbtovkdrxeplukrcuozhpymldstbbfynkgsmafigetvzkxloxqtphvtwkgfjkiczttcsxkjpsoutdpzxytrsqgjtbdljjrbmkudrkodfvcwkcuggbsthxdyogeeyfuyhmnwgyuatfkvchavpzadfacckdurlbqjkthqbnirzzbpusxcenkpgtizayjmsahvobobudfeaewcqmrlxxnocqzmkessnguxkiccrxyvnxxlqnqfwuzmupk",
"output": "First"
},
{
"input": "opfokvwzpllctflkphutcrkferbjyyrasqqkrcvoymyrxwaudgsugcqveccymdplxmtlzfoptmrapfeizpnnhbzlkuyznwacnswibxhqunazbhdvrlidghisuqunstbuevjzimvlfvopgqxrvahhngnaumgywscfrfwfpnfxwhfrelbunmedvkssykwjyartxjiplerntzkpiiaalijiwhyuhxlvhxpkgfypvrpqqsacuwocdampnnhvibsbolyduvscsjfayxpldyvqzjbqojjxdvxtctwtifcdfcaoonzbgegyllngwvjivtxeezoabhsihcuvgvdsgjtzbzwovjshvwrljkxavowovzrfpdufpogdtujkerdorpboufrxhyswirjehgsxthlvjufvahdpeajidqipwaxokbeycrievgcfkyuyavaq",
"output": "Second"
},
{
"input": "a",
"output": "First"
},
{
"input": "ab",
"output": "Second"
},
{
"input": "abacaba",
"output": "First"
},
{
"input": "abazaba",
"output": "First"
},
{
"input": "zz",
"output": "First"
},
{
"input": "aassddxyz",
"output": "First"
},
{
"input": "abcdefghijklmnopqrstuvwxyz",
"output": "Second"
},
{
"input": "aabc",
"output": "Second"
},
{
"input": "abcabc",
"output": "First"
},
{
"input": "aaabbbccdd",
"output": "Second"
},
{
"input": "aabbcccc",
"output": "First"
}
] | 1,651,422,407 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 51 | 124 | 0 | from sys import stdin, stdout
input, print = stdin.readline, stdout.write
def str_input():
s = input()
return s[:len(s)-1]
def main():
s = str_input()
cnt = [0 for _ in range(26)]
for ch in s:
cnt[ord(ch)-ord('a')] += 1
odd = 0
for i in range(26):
odd += cnt[i] & 1
if odd == 0:
print("First\n")
elif len(s) & 1:
print("First\n")
else:
print("Second\n")
if __name__ == "__main__":
main()
| Title: Little Girl and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Girl loves problems on games very much. Here's one of them.
Two players have got a string *s*, consisting of lowercase English letters. They play a game that is described by the following rules:
- The players move in turns; In one move the player can remove an arbitrary letter from string *s*. - If the player before his turn can reorder the letters in string *s* so as to get a palindrome, this player wins. A palindrome is a string that reads the same both ways (from left to right, and vice versa). For example, string "abba" is a palindrome and string "abc" isn't.
Determine which player will win, provided that both sides play optimally well — the one who moves first or the one who moves second.
Input Specification:
The input contains a single line, containing string *s* (1<=≤<=|*s*|<=<=≤<=<=103). String *s* consists of lowercase English letters.
Output Specification:
In a single line print word "First" if the first player wins (provided that both players play optimally well). Otherwise, print word "Second". Print the words without the quotes.
Demo Input:
['aba\n', 'abca\n']
Demo Output:
['First\n', 'Second\n']
Note:
none | ```python
from sys import stdin, stdout
input, print = stdin.readline, stdout.write
def str_input():
s = input()
return s[:len(s)-1]
def main():
s = str_input()
cnt = [0 for _ in range(26)]
for ch in s:
cnt[ord(ch)-ord('a')] += 1
odd = 0
for i in range(26):
odd += cnt[i] & 1
if odd == 0:
print("First\n")
elif len(s) & 1:
print("First\n")
else:
print("Second\n")
if __name__ == "__main__":
main()
``` | 3 |
|
380 | C | Sereja and Brackets | PROGRAMMING | 2,000 | [
"data structures",
"schedules"
] | null | null | Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes. | The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query. | Print the answer to each question on a single line. Print the answers in the order they go in the input. | [
"())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n"
] | [
"0\n0\n2\n10\n4\n6\n6\n"
] | A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())». | 1,500 | [
{
"input": "())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10",
"output": "0\n0\n2\n10\n4\n6\n6"
},
{
"input": "(((((()((((((((((()((()(((((\n1\n8 15",
"output": "0"
},
{
"input": "((()((())(((((((((()(()(()(((((((((((((((()(()((((((((((((((()(((((((((((((((((((()(((\n39\n28 56\n39 46\n57 63\n29 48\n51 75\n14 72\n5 70\n51 73\n10 64\n31 56\n50 54\n15 78\n78 82\n1 11\n1 70\n1 19\n10 22\n13 36\n3 10\n34 40\n51 76\n64 71\n36 75\n24 71\n1 63\n5 14\n46 67\n32 56\n39 43\n43 56\n61 82\n2 78\n1 21\n10 72\n49 79\n12 14\n53 79\n15 31\n7 47",
"output": "4\n4\n2\n4\n2\n12\n16\n2\n12\n4\n0\n12\n0\n6\n18\n6\n2\n6\n6\n0\n2\n0\n6\n8\n18\n4\n2\n4\n2\n2\n2\n18\n8\n12\n2\n0\n2\n6\n12"
},
{
"input": "))(()))))())())))))())((()()))))()))))))))))))\n9\n26 42\n21 22\n6 22\n7 26\n43 46\n25 27\n32 39\n22 40\n2 45",
"output": "4\n0\n6\n8\n0\n2\n2\n10\n20"
},
{
"input": "(()((((()(())((((((((()((((((()((((\n71\n15 29\n17 18\n5 26\n7 10\n16 31\n26 35\n2 30\n16 24\n2 24\n7 12\n15 18\n12 13\n25 30\n1 30\n12 13\n16 20\n6 35\n20 28\n18 23\n9 31\n12 35\n14 17\n8 16\n3 10\n12 33\n7 19\n2 33\n7 17\n21 27\n10 30\n29 32\n9 28\n18 32\n28 31\n31 33\n4 26\n15 27\n10 17\n8 14\n11 28\n8 23\n17 33\n4 14\n3 6\n6 34\n19 23\n4 21\n16 27\n14 27\n6 19\n31 32\n29 32\n9 17\n1 21\n2 31\n18 29\n16 26\n15 18\n4 5\n13 20\n9 28\n18 30\n1 32\n2 9\n16 24\n1 20\n4 15\n16 23\n19 34\n5 22\n5 23",
"output": "2\n0\n8\n2\n4\n2\n10\n2\n10\n4\n0\n0\n0\n10\n0\n0\n10\n2\n2\n8\n4\n0\n6\n2\n4\n6\n12\n6\n2\n6\n2\n6\n4\n2\n0\n8\n2\n4\n6\n4\n8\n4\n6\n0\n10\n2\n6\n2\n2\n6\n0\n2\n4\n8\n12\n2\n2\n0\n0\n0\n6\n2\n12\n4\n2\n8\n6\n2\n4\n6\n8"
},
{
"input": "(((())((((()()((((((()((()(((((((((((()((\n6\n20 37\n28 32\n12 18\n7 25\n21 33\n4 5",
"output": "4\n0\n2\n6\n4\n2"
},
{
"input": "(((()((((()()()(()))((((()(((()))()((((()))()((())\n24\n37 41\n13 38\n31 34\n14 16\n29 29\n12 46\n1 26\n15 34\n8 47\n11 23\n6 32\n2 22\n9 27\n17 40\n6 15\n4 49\n12 33\n3 48\n22 47\n19 48\n10 27\n23 25\n4 44\n27 48",
"output": "2\n16\n0\n2\n0\n26\n16\n12\n30\n8\n18\n14\n14\n12\n6\n34\n16\n32\n18\n18\n12\n0\n30\n16"
},
{
"input": ")()((((((((((((((((()(((()()(()((((((()(((((((()()))((((())(((((((((()(((((((((\n51\n29 53\n31 69\n54 59\n3 52\n26 46\n14 62\n6 54\n39 56\n17 27\n46 74\n60 72\n18 26\n38 46\n4 27\n22 52\n44 49\n42 77\n2 20\n39 57\n61 70\n33 54\n10 30\n67 70\n46 66\n17 77\n5 52\n33 77\n26 32\n1 72\n40 78\n38 68\n19 47\n30 53\n19 29\n52 71\n1 11\n22 53\n17 42\n2 51\n4 12\n24 76\n22 34\n21 69\n11 69\n36 52\n17 31\n57 58\n54 62\n23 71\n5 46\n51 53",
"output": "12\n14\n4\n18\n6\n22\n18\n8\n4\n12\n2\n4\n2\n4\n16\n2\n14\n2\n8\n2\n10\n6\n2\n10\n24\n18\n16\n4\n26\n14\n14\n10\n12\n6\n6\n2\n16\n10\n18\n0\n22\n6\n20\n22\n10\n8\n2\n4\n22\n10\n0"
},
{
"input": "(\n1\n1 1",
"output": "0"
},
{
"input": ")\n1\n1 1",
"output": "0"
},
{
"input": "()\n1\n1 2",
"output": "2"
},
{
"input": ")(\n1\n1 2",
"output": "0"
}
] | 1,645,418,445 | 2,147,483,647 | PyPy 3 | TIME_LIMIT_EXCEEDED | TESTS | 12 | 1,000 | 139,571,200 |
# ------------------- fast io --------------------
import os
import sys
from io import BytesIO, IOBase
BUFSIZE = 8192
class FastIO(IOBase):
newlines = 0
def __init__(self, file):
self._fd = file.fileno()
self.buffer = BytesIO()
self.writable = "x" in file.mode or "r" not in file.mode
self.write = self.buffer.write if self.writable else None
def read(self):
while True:
b = os.read(self._fd, max(os.fstat(self._fd).st_size, BUFSIZE))
if not b:
break
ptr = self.buffer.tell()
self.buffer.seek(0, 2), self.buffer.write(b), self.buffer.seek(ptr)
self.newlines = 0
return self.buffer.read()
def readline(self):
while self.newlines == 0:
b = os.read(self._fd, max(os.fstat(self._fd).st_size, BUFSIZE))
self.newlines = b.count(b"\n") + (not b)
ptr = self.buffer.tell()
self.buffer.seek(0, 2), self.buffer.write(b), self.buffer.seek(ptr)
self.newlines -= 1
return self.buffer.readline()
def flush(self):
if self.writable:
os.write(self._fd, self.buffer.getvalue())
self.buffer.truncate(0), self.buffer.seek(0)
class IOWrapper(IOBase):
def __init__(self, file):
self.buffer = FastIO(file)
self.flush = self.buffer.flush
self.writable = self.buffer.writable
self.write = lambda s: self.buffer.write(s.encode("ascii"))
self.read = lambda: self.buffer.read().decode("ascii")
self.readline = lambda: self.buffer.readline().decode("ascii")
sys.stdin, sys.stdout = IOWrapper(sys.stdin), IOWrapper(sys.stdout)
input = lambda: sys.stdin.readline().rstrip("\r\n")
# ------------------- fast io --------------------
def func_add(a, b):
t = min(a[1], b[2])
return [a[0]+b[0]+t, a[1]+b[1]-t, a[2]+b[2]-t]
class SegmentTree:
def __init__(self, data, default=0, func=func_add):
"""initialize the segment tree with data"""
self._default = default
self._func = func
self._len = len(data)
self._size = _size = 1 << (self._len - 1).bit_length()
self.data = [default] * (2 * _size)
self.data[_size:_size + self._len] = data
for i in reversed(range(_size)):
self.data[i] = func(self.data[i + i], self.data[i + i + 1])
def __delitem__(self, idx):
self[idx] = self._default
def __getitem__(self, idx):
return self.data[idx + self._size]
def __setitem__(self, idx, value):
idx += self._size
self.data[idx] = value
idx >>= 1
while idx:
self.data[idx] = self._func(self.data[2 * idx], self.data[2 * idx + 1])
idx >>= 1
def __len__(self):
return self._len
def query(self, start, stop):
"""func of data[start, stop)"""
start += self._size
stop += self._size
res_left = res_right = self._default
while start < stop:
if start & 1:
res_left = self._func(res_left, self.data[start])
start += 1
if stop & 1:
stop -= 1
res_right = self._func(self.data[stop], res_right)
start >>= 1
stop >>= 1
return self._func(res_left, res_right)
def __repr__(self):
return "SegmentTree({0})".format(self.data)
def solve(s, q, m):
n = len(s)
data = list()
for c in s:
if c == '(':
data.append([0, 1, 0])
else:
data.append([0, 0, 1])
sgt = SegmentTree(data, default=[0, 0, 0])
for l, r in q:
print(sgt.query(l-1, r)[0] * 2)
return
s = input()
m = int(input())
q = list()
for i in range(m):
q.append(list(map(int, input().split(' '))))
solve(s, q, m) | Title: Sereja and Brackets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes.
Input Specification:
The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query.
Output Specification:
Print the answer to each question on a single line. Print the answers in the order they go in the input.
Demo Input:
['())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n']
Demo Output:
['0\n0\n2\n10\n4\n6\n6\n']
Note:
A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())». | ```python
# ------------------- fast io --------------------
import os
import sys
from io import BytesIO, IOBase
BUFSIZE = 8192
class FastIO(IOBase):
newlines = 0
def __init__(self, file):
self._fd = file.fileno()
self.buffer = BytesIO()
self.writable = "x" in file.mode or "r" not in file.mode
self.write = self.buffer.write if self.writable else None
def read(self):
while True:
b = os.read(self._fd, max(os.fstat(self._fd).st_size, BUFSIZE))
if not b:
break
ptr = self.buffer.tell()
self.buffer.seek(0, 2), self.buffer.write(b), self.buffer.seek(ptr)
self.newlines = 0
return self.buffer.read()
def readline(self):
while self.newlines == 0:
b = os.read(self._fd, max(os.fstat(self._fd).st_size, BUFSIZE))
self.newlines = b.count(b"\n") + (not b)
ptr = self.buffer.tell()
self.buffer.seek(0, 2), self.buffer.write(b), self.buffer.seek(ptr)
self.newlines -= 1
return self.buffer.readline()
def flush(self):
if self.writable:
os.write(self._fd, self.buffer.getvalue())
self.buffer.truncate(0), self.buffer.seek(0)
class IOWrapper(IOBase):
def __init__(self, file):
self.buffer = FastIO(file)
self.flush = self.buffer.flush
self.writable = self.buffer.writable
self.write = lambda s: self.buffer.write(s.encode("ascii"))
self.read = lambda: self.buffer.read().decode("ascii")
self.readline = lambda: self.buffer.readline().decode("ascii")
sys.stdin, sys.stdout = IOWrapper(sys.stdin), IOWrapper(sys.stdout)
input = lambda: sys.stdin.readline().rstrip("\r\n")
# ------------------- fast io --------------------
def func_add(a, b):
t = min(a[1], b[2])
return [a[0]+b[0]+t, a[1]+b[1]-t, a[2]+b[2]-t]
class SegmentTree:
def __init__(self, data, default=0, func=func_add):
"""initialize the segment tree with data"""
self._default = default
self._func = func
self._len = len(data)
self._size = _size = 1 << (self._len - 1).bit_length()
self.data = [default] * (2 * _size)
self.data[_size:_size + self._len] = data
for i in reversed(range(_size)):
self.data[i] = func(self.data[i + i], self.data[i + i + 1])
def __delitem__(self, idx):
self[idx] = self._default
def __getitem__(self, idx):
return self.data[idx + self._size]
def __setitem__(self, idx, value):
idx += self._size
self.data[idx] = value
idx >>= 1
while idx:
self.data[idx] = self._func(self.data[2 * idx], self.data[2 * idx + 1])
idx >>= 1
def __len__(self):
return self._len
def query(self, start, stop):
"""func of data[start, stop)"""
start += self._size
stop += self._size
res_left = res_right = self._default
while start < stop:
if start & 1:
res_left = self._func(res_left, self.data[start])
start += 1
if stop & 1:
stop -= 1
res_right = self._func(self.data[stop], res_right)
start >>= 1
stop >>= 1
return self._func(res_left, res_right)
def __repr__(self):
return "SegmentTree({0})".format(self.data)
def solve(s, q, m):
n = len(s)
data = list()
for c in s:
if c == '(':
data.append([0, 1, 0])
else:
data.append([0, 0, 1])
sgt = SegmentTree(data, default=[0, 0, 0])
for l, r in q:
print(sgt.query(l-1, r)[0] * 2)
return
s = input()
m = int(input())
q = list()
for i in range(m):
q.append(list(map(int, input().split(' '))))
solve(s, q, m)
``` | 0 |
|
546 | A | Soldier and Bananas | PROGRAMMING | 800 | [
"brute force",
"implementation",
"math"
] | null | null | A soldier wants to buy *w* bananas in the shop. He has to pay *k* dollars for the first banana, 2*k* dollars for the second one and so on (in other words, he has to pay *i*·*k* dollars for the *i*-th banana).
He has *n* dollars. How many dollars does he have to borrow from his friend soldier to buy *w* bananas? | The first line contains three positive integers *k*,<=*n*,<=*w* (1<=<=≤<=<=*k*,<=*w*<=<=≤<=<=1000, 0<=≤<=*n*<=≤<=109), the cost of the first banana, initial number of dollars the soldier has and number of bananas he wants. | Output one integer — the amount of dollars that the soldier must borrow from his friend. If he doesn't have to borrow money, output 0. | [
"3 17 4\n"
] | [
"13"
] | none | 500 | [
{
"input": "3 17 4",
"output": "13"
},
{
"input": "1 2 1",
"output": "0"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "1 5 6",
"output": "16"
},
{
"input": "1 1000000000 1",
"output": "0"
},
{
"input": "1000 0 1000",
"output": "500500000"
},
{
"input": "859 453892 543",
"output": "126416972"
},
{
"input": "1000 1000000000 1000",
"output": "0"
},
{
"input": "1000 500500000 1000",
"output": "0"
},
{
"input": "1000 500500001 1000",
"output": "0"
},
{
"input": "1000 500499999 1000",
"output": "1"
},
{
"input": "634 87973 214",
"output": "14497197"
},
{
"input": "432 10000 241",
"output": "12587552"
},
{
"input": "111 111111111 111",
"output": "0"
},
{
"input": "20 43 3",
"output": "77"
}
] | 1,695,621,325 | 2,147,483,647 | Python 3 | OK | TESTS | 15 | 46 | 0 | k,n,w=map(int,input().split())
cost=0
for i in range(0,w+1):
cost= cost+k*i
output=abs(cost-n)
if cost<=n:
print(0)
else:
print(output) | Title: Soldier and Bananas
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A soldier wants to buy *w* bananas in the shop. He has to pay *k* dollars for the first banana, 2*k* dollars for the second one and so on (in other words, he has to pay *i*·*k* dollars for the *i*-th banana).
He has *n* dollars. How many dollars does he have to borrow from his friend soldier to buy *w* bananas?
Input Specification:
The first line contains three positive integers *k*,<=*n*,<=*w* (1<=<=≤<=<=*k*,<=*w*<=<=≤<=<=1000, 0<=≤<=*n*<=≤<=109), the cost of the first banana, initial number of dollars the soldier has and number of bananas he wants.
Output Specification:
Output one integer — the amount of dollars that the soldier must borrow from his friend. If he doesn't have to borrow money, output 0.
Demo Input:
['3 17 4\n']
Demo Output:
['13']
Note:
none | ```python
k,n,w=map(int,input().split())
cost=0
for i in range(0,w+1):
cost= cost+k*i
output=abs(cost-n)
if cost<=n:
print(0)
else:
print(output)
``` | 3 |
|
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square. | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,679,052,588 | 2,147,483,647 | Python 3 | OK | TESTS | 20 | 46 | 0 | n, m, a = (int(i) for i in input().split())
h = n // a
if n % a > 0:
h += 1
w = m // a
if m % a > 0:
w += 1
print(h * w)
| Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none | ```python
n, m, a = (int(i) for i in input().split())
h = n // a
if n % a > 0:
h += 1
w = m // a
if m % a > 0:
w += 1
print(h * w)
``` | 3.977 |
959 | A | Mahmoud and Ehab and the even-odd game | PROGRAMMING | 800 | [
"games",
"math"
] | null | null | Mahmoud and Ehab play a game called the even-odd game. Ehab chooses his favorite integer *n* and then they take turns, starting from Mahmoud. In each player's turn, he has to choose an integer *a* and subtract it from *n* such that:
- 1<=≤<=*a*<=≤<=*n*. - If it's Mahmoud's turn, *a* has to be even, but if it's Ehab's turn, *a* has to be odd.
If the current player can't choose any number satisfying the conditions, he loses. Can you determine the winner if they both play optimally? | The only line contains an integer *n* (1<=≤<=*n*<=≤<=109), the number at the beginning of the game. | Output "Mahmoud" (without quotes) if Mahmoud wins and "Ehab" (without quotes) otherwise. | [
"1\n",
"2\n"
] | [
"Ehab",
"Mahmoud"
] | In the first sample, Mahmoud can't choose any integer *a* initially because there is no positive even integer less than or equal to 1 so Ehab wins.
In the second sample, Mahmoud has to choose *a* = 2 and subtract it from *n*. It's Ehab's turn and *n* = 0. There is no positive odd integer less than or equal to 0 so Mahmoud wins. | 500 | [
{
"input": "1",
"output": "Ehab"
},
{
"input": "2",
"output": "Mahmoud"
},
{
"input": "10000",
"output": "Mahmoud"
},
{
"input": "33333",
"output": "Ehab"
},
{
"input": "5",
"output": "Ehab"
},
{
"input": "1000000000",
"output": "Mahmoud"
},
{
"input": "999999999",
"output": "Ehab"
},
{
"input": "123123123",
"output": "Ehab"
},
{
"input": "22222221",
"output": "Ehab"
},
{
"input": "22222220",
"output": "Mahmoud"
},
{
"input": "3",
"output": "Ehab"
},
{
"input": "4",
"output": "Mahmoud"
},
{
"input": "6",
"output": "Mahmoud"
},
{
"input": "7",
"output": "Ehab"
},
{
"input": "8",
"output": "Mahmoud"
},
{
"input": "9",
"output": "Ehab"
},
{
"input": "10",
"output": "Mahmoud"
},
{
"input": "536870912",
"output": "Mahmoud"
},
{
"input": "536870913",
"output": "Ehab"
},
{
"input": "536870911",
"output": "Ehab"
}
] | 1,623,909,847 | 2,147,483,647 | PyPy 3 | OK | TESTS | 20 | 93 | 0 | if __name__ == '__main__':
n = int(input())
if n == 1:
print("Ehab")
elif n % 2 == 0 and n >= 2:
print('Mahmoud')
else:
print('Ehab') | Title: Mahmoud and Ehab and the even-odd game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mahmoud and Ehab play a game called the even-odd game. Ehab chooses his favorite integer *n* and then they take turns, starting from Mahmoud. In each player's turn, he has to choose an integer *a* and subtract it from *n* such that:
- 1<=≤<=*a*<=≤<=*n*. - If it's Mahmoud's turn, *a* has to be even, but if it's Ehab's turn, *a* has to be odd.
If the current player can't choose any number satisfying the conditions, he loses. Can you determine the winner if they both play optimally?
Input Specification:
The only line contains an integer *n* (1<=≤<=*n*<=≤<=109), the number at the beginning of the game.
Output Specification:
Output "Mahmoud" (without quotes) if Mahmoud wins and "Ehab" (without quotes) otherwise.
Demo Input:
['1\n', '2\n']
Demo Output:
['Ehab', 'Mahmoud']
Note:
In the first sample, Mahmoud can't choose any integer *a* initially because there is no positive even integer less than or equal to 1 so Ehab wins.
In the second sample, Mahmoud has to choose *a* = 2 and subtract it from *n*. It's Ehab's turn and *n* = 0. There is no positive odd integer less than or equal to 0 so Mahmoud wins. | ```python
if __name__ == '__main__':
n = int(input())
if n == 1:
print("Ehab")
elif n % 2 == 0 and n >= 2:
print('Mahmoud')
else:
print('Ehab')
``` | 3 |
|
379 | A | New Year Candles | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number. | The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000). | Print a single integer — the number of hours Vasily can light up the room for. | [
"4 2\n",
"6 3\n"
] | [
"7\n",
"8\n"
] | Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours. | 500 | [
{
"input": "4 2",
"output": "7"
},
{
"input": "6 3",
"output": "8"
},
{
"input": "1000 1000",
"output": "1001"
},
{
"input": "123 5",
"output": "153"
},
{
"input": "1000 2",
"output": "1999"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "1 4",
"output": "1"
},
{
"input": "2 2",
"output": "3"
},
{
"input": "3 2",
"output": "5"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "999 2",
"output": "1997"
},
{
"input": "1000 3",
"output": "1499"
},
{
"input": "1000 4",
"output": "1333"
},
{
"input": "1 1000",
"output": "1"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "10 4",
"output": "13"
},
{
"input": "4 3",
"output": "5"
},
{
"input": "91 5",
"output": "113"
},
{
"input": "777 17",
"output": "825"
},
{
"input": "100 4",
"output": "133"
},
{
"input": "5 3",
"output": "7"
},
{
"input": "6 4",
"output": "7"
},
{
"input": "26 8",
"output": "29"
},
{
"input": "9 4",
"output": "11"
},
{
"input": "20 3",
"output": "29"
},
{
"input": "17 3",
"output": "25"
}
] | 1,646,464,463 | 2,147,483,647 | Python 3 | OK | TESTS | 32 | 46 | 0 | a, b = map(int, input().split())
count = 0
while a >= b:
used = a - a%b
count += used
a -= used - used//b
print(count + a) | Title: New Year Candles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number.
Input Specification:
The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000).
Output Specification:
Print a single integer — the number of hours Vasily can light up the room for.
Demo Input:
['4 2\n', '6 3\n']
Demo Output:
['7\n', '8\n']
Note:
Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours. | ```python
a, b = map(int, input().split())
count = 0
while a >= b:
used = a - a%b
count += used
a -= used - used//b
print(count + a)
``` | 3 |
|
115 | A | Party | PROGRAMMING | 900 | [
"dfs and similar",
"graphs",
"trees"
] | null | null | A company has *n* employees numbered from 1 to *n*. Each employee either has no immediate manager or exactly one immediate manager, who is another employee with a different number. An employee *A* is said to be the superior of another employee *B* if at least one of the following is true:
- Employee *A* is the immediate manager of employee *B* - Employee *B* has an immediate manager employee *C* such that employee *A* is the superior of employee *C*.
The company will not have a managerial cycle. That is, there will not exist an employee who is the superior of his/her own immediate manager.
Today the company is going to arrange a party. This involves dividing all *n* employees into several groups: every employee must belong to exactly one group. Furthermore, within any single group, there must not be two employees *A* and *B* such that *A* is the superior of *B*.
What is the minimum number of groups that must be formed? | The first line contains integer *n* (1<=≤<=*n*<=≤<=2000) — the number of employees.
The next *n* lines contain the integers *p**i* (1<=≤<=*p**i*<=≤<=*n* or *p**i*<==<=-1). Every *p**i* denotes the immediate manager for the *i*-th employee. If *p**i* is -1, that means that the *i*-th employee does not have an immediate manager.
It is guaranteed, that no employee will be the immediate manager of him/herself (*p**i*<=≠<=*i*). Also, there will be no managerial cycles. | Print a single integer denoting the minimum number of groups that will be formed in the party. | [
"5\n-1\n1\n2\n1\n-1\n"
] | [
"3\n"
] | For the first example, three groups are sufficient, for example:
- Employee 1 - Employees 2 and 4 - Employees 3 and 5 | 500 | [
{
"input": "5\n-1\n1\n2\n1\n-1",
"output": "3"
},
{
"input": "4\n-1\n1\n2\n3",
"output": "4"
},
{
"input": "12\n-1\n1\n2\n3\n-1\n5\n6\n7\n-1\n9\n10\n11",
"output": "4"
},
{
"input": "6\n-1\n-1\n2\n3\n1\n1",
"output": "3"
},
{
"input": "3\n-1\n1\n1",
"output": "2"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "2\n2\n-1",
"output": "2"
},
{
"input": "2\n-1\n-1",
"output": "1"
},
{
"input": "3\n2\n-1\n1",
"output": "3"
},
{
"input": "3\n-1\n-1\n-1",
"output": "1"
},
{
"input": "5\n4\n5\n1\n-1\n4",
"output": "3"
},
{
"input": "12\n-1\n1\n1\n1\n1\n1\n3\n4\n3\n3\n4\n7",
"output": "4"
},
{
"input": "12\n-1\n-1\n1\n-1\n1\n1\n5\n11\n8\n6\n6\n4",
"output": "5"
},
{
"input": "12\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n2\n-1\n-1\n-1",
"output": "2"
},
{
"input": "12\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1\n-1",
"output": "1"
},
{
"input": "12\n3\n4\n2\n8\n7\n1\n10\n12\n5\n-1\n9\n11",
"output": "12"
},
{
"input": "12\n5\n6\n7\n1\n-1\n9\n12\n4\n8\n-1\n3\n2",
"output": "11"
},
{
"input": "12\n-1\n9\n11\n6\n6\n-1\n6\n3\n8\n6\n1\n6",
"output": "6"
},
{
"input": "12\n7\n8\n4\n12\n7\n9\n-1\n-1\n-1\n8\n6\n-1",
"output": "3"
},
{
"input": "12\n-1\n10\n-1\n1\n-1\n5\n9\n12\n-1\n-1\n3\n-1",
"output": "2"
},
{
"input": "12\n-1\n7\n9\n12\n1\n7\n-1\n-1\n8\n5\n4\n-1",
"output": "3"
},
{
"input": "12\n11\n11\n8\n9\n1\n1\n2\n-1\n10\n3\n-1\n8",
"output": "5"
},
{
"input": "12\n-1\n8\n9\n-1\n4\n2\n11\n1\n-1\n6\n-1\n10",
"output": "6"
},
{
"input": "12\n7\n4\n4\n-1\n6\n7\n9\n7\n-1\n7\n4\n1",
"output": "4"
},
{
"input": "12\n-1\n6\n10\n6\n1\n11\n5\n9\n11\n5\n1\n9",
"output": "4"
},
{
"input": "12\n8\n6\n6\n8\n6\n-1\n6\n6\n8\n6\n8\n8",
"output": "3"
},
{
"input": "12\n3\n8\n9\n12\n2\n8\n11\n12\n2\n9\n-1\n11",
"output": "7"
},
{
"input": "7\n7\n6\n-1\n-1\n4\n4\n-1",
"output": "3"
},
{
"input": "77\n53\n-1\n48\n-1\n51\n-1\n54\n43\n70\n19\n64\n31\n45\n58\n6\n61\n41\n56\n34\n-1\n54\n-1\n66\n65\n74\n16\n38\n1\n2\n61\n-1\n34\n-1\n-1\n7\n19\n57\n13\n61\n42\n-1\n34\n65\n16\n31\n61\n6\n5\n34\n15\n-1\n13\n4\n22\n74\n7\n-1\n70\n38\n61\n45\n53\n46\n22\n-1\n65\n34\n19\n43\n48\n33\n58\n36\n-1\n47\n24\n34",
"output": "6"
},
{
"input": "5\n2\n3\n4\n5\n-1",
"output": "5"
}
] | 1,649,662,373 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 60 | 0 | n=int(input())
g=1;cnt=0
for i in range(1,n+1):
e=int(input())
if(i-e)>1:
g=max(g,cnt)
cnt=0
cnt+=1 | Title: Party
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A company has *n* employees numbered from 1 to *n*. Each employee either has no immediate manager or exactly one immediate manager, who is another employee with a different number. An employee *A* is said to be the superior of another employee *B* if at least one of the following is true:
- Employee *A* is the immediate manager of employee *B* - Employee *B* has an immediate manager employee *C* such that employee *A* is the superior of employee *C*.
The company will not have a managerial cycle. That is, there will not exist an employee who is the superior of his/her own immediate manager.
Today the company is going to arrange a party. This involves dividing all *n* employees into several groups: every employee must belong to exactly one group. Furthermore, within any single group, there must not be two employees *A* and *B* such that *A* is the superior of *B*.
What is the minimum number of groups that must be formed?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=2000) — the number of employees.
The next *n* lines contain the integers *p**i* (1<=≤<=*p**i*<=≤<=*n* or *p**i*<==<=-1). Every *p**i* denotes the immediate manager for the *i*-th employee. If *p**i* is -1, that means that the *i*-th employee does not have an immediate manager.
It is guaranteed, that no employee will be the immediate manager of him/herself (*p**i*<=≠<=*i*). Also, there will be no managerial cycles.
Output Specification:
Print a single integer denoting the minimum number of groups that will be formed in the party.
Demo Input:
['5\n-1\n1\n2\n1\n-1\n']
Demo Output:
['3\n']
Note:
For the first example, three groups are sufficient, for example:
- Employee 1 - Employees 2 and 4 - Employees 3 and 5 | ```python
n=int(input())
g=1;cnt=0
for i in range(1,n+1):
e=int(input())
if(i-e)>1:
g=max(g,cnt)
cnt=0
cnt+=1
``` | 0 |
|
527 | A | Playing with Paper | PROGRAMMING | 1,100 | [
"implementation",
"math"
] | null | null | One day Vasya was sitting on a not so interesting Maths lesson and making an origami from a rectangular *a* mm <=×<= *b* mm sheet of paper (*a*<=><=*b*). Usually the first step in making an origami is making a square piece of paper from the rectangular sheet by folding the sheet along the bisector of the right angle, and cutting the excess part.
After making a paper ship from the square piece, Vasya looked on the remaining (*a*<=-<=*b*) mm <=×<= *b* mm strip of paper. He got the idea to use this strip of paper in the same way to make an origami, and then use the remainder (if it exists) and so on. At the moment when he is left with a square piece of paper, he will make the last ship from it and stop.
Can you determine how many ships Vasya will make during the lesson? | The first line of the input contains two integers *a*, *b* (1<=≤<=*b*<=<<=*a*<=≤<=1012) — the sizes of the original sheet of paper. | Print a single integer — the number of ships that Vasya will make. | [
"2 1\n",
"10 7\n",
"1000000000000 1\n"
] | [
"2\n",
"6\n",
"1000000000000\n"
] | Pictures to the first and second sample test. | 500 | [
{
"input": "2 1",
"output": "2"
},
{
"input": "10 7",
"output": "6"
},
{
"input": "1000000000000 1",
"output": "1000000000000"
},
{
"input": "3 1",
"output": "3"
},
{
"input": "4 1",
"output": "4"
},
{
"input": "3 2",
"output": "3"
},
{
"input": "4 2",
"output": "2"
},
{
"input": "1000 700",
"output": "6"
},
{
"input": "959986566087 524054155168",
"output": "90"
},
{
"input": "4 3",
"output": "4"
},
{
"input": "7 6",
"output": "7"
},
{
"input": "1000 999",
"output": "1000"
},
{
"input": "1000 998",
"output": "500"
},
{
"input": "1000 997",
"output": "336"
},
{
"input": "42 1",
"output": "42"
},
{
"input": "1000 1",
"output": "1000"
},
{
"input": "8 5",
"output": "5"
},
{
"input": "13 8",
"output": "6"
},
{
"input": "987 610",
"output": "15"
},
{
"input": "442 42",
"output": "22"
},
{
"input": "754 466",
"output": "13"
},
{
"input": "1000000000000 999999999999",
"output": "1000000000000"
},
{
"input": "1000000000000 999999999998",
"output": "500000000000"
},
{
"input": "941 14",
"output": "74"
},
{
"input": "998 2",
"output": "499"
},
{
"input": "1000 42",
"output": "32"
},
{
"input": "1000 17",
"output": "66"
},
{
"input": "5 1",
"output": "5"
},
{
"input": "5 2",
"output": "4"
},
{
"input": "5 3",
"output": "4"
},
{
"input": "5 4",
"output": "5"
},
{
"input": "293 210",
"output": "17"
},
{
"input": "787878787878 424242424242",
"output": "8"
},
{
"input": "956722026041 591286729879",
"output": "58"
},
{
"input": "956722026041 365435296162",
"output": "58"
},
{
"input": "628625247282 464807889701",
"output": "102"
},
{
"input": "695928431619 424778620208",
"output": "167"
},
{
"input": "1000000000000 42",
"output": "23809523821"
},
{
"input": "987654345678 23",
"output": "42941493300"
},
{
"input": "10000000001 2",
"output": "5000000002"
},
{
"input": "1000000000000 2",
"output": "500000000000"
},
{
"input": "1000000000000 3",
"output": "333333333336"
},
{
"input": "100000000000 3",
"output": "33333333336"
},
{
"input": "100000000000 23",
"output": "4347826109"
},
{
"input": "999999999997 7",
"output": "142857142861"
},
{
"input": "8589934592 4294967296",
"output": "2"
}
] | 1,614,783,583 | 1,183 | PyPy 3 | OK | TESTS | 46 | 93 | 0 | n,m= map(int,input().split())
ans =0
while n%m>0:
c = n
d = m
ans = ans +n//m
n = max(c%d,d)
m = min(c%d,d)
print(ans+n//m)
| Title: Playing with Paper
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Vasya was sitting on a not so interesting Maths lesson and making an origami from a rectangular *a* mm <=×<= *b* mm sheet of paper (*a*<=><=*b*). Usually the first step in making an origami is making a square piece of paper from the rectangular sheet by folding the sheet along the bisector of the right angle, and cutting the excess part.
After making a paper ship from the square piece, Vasya looked on the remaining (*a*<=-<=*b*) mm <=×<= *b* mm strip of paper. He got the idea to use this strip of paper in the same way to make an origami, and then use the remainder (if it exists) and so on. At the moment when he is left with a square piece of paper, he will make the last ship from it and stop.
Can you determine how many ships Vasya will make during the lesson?
Input Specification:
The first line of the input contains two integers *a*, *b* (1<=≤<=*b*<=<<=*a*<=≤<=1012) — the sizes of the original sheet of paper.
Output Specification:
Print a single integer — the number of ships that Vasya will make.
Demo Input:
['2 1\n', '10 7\n', '1000000000000 1\n']
Demo Output:
['2\n', '6\n', '1000000000000\n']
Note:
Pictures to the first and second sample test. | ```python
n,m= map(int,input().split())
ans =0
while n%m>0:
c = n
d = m
ans = ans +n//m
n = max(c%d,d)
m = min(c%d,d)
print(ans+n//m)
``` | 3 |
|
501 | A | Contest | PROGRAMMING | 900 | [
"implementation"
] | null | null | Misha and Vasya participated in a Codeforces contest. Unfortunately, each of them solved only one problem, though successfully submitted it at the first attempt. Misha solved the problem that costs *a* points and Vasya solved the problem that costs *b* points. Besides, Misha submitted the problem *c* minutes after the contest started and Vasya submitted the problem *d* minutes after the contest started. As you know, on Codeforces the cost of a problem reduces as a round continues. That is, if you submit a problem that costs *p* points *t* minutes after the contest started, you get points.
Misha and Vasya are having an argument trying to find out who got more points. Help them to find out the truth. | The first line contains four integers *a*, *b*, *c*, *d* (250<=≤<=*a*,<=*b*<=≤<=3500, 0<=≤<=*c*,<=*d*<=≤<=180).
It is guaranteed that numbers *a* and *b* are divisible by 250 (just like on any real Codeforces round). | Output on a single line:
"Misha" (without the quotes), if Misha got more points than Vasya.
"Vasya" (without the quotes), if Vasya got more points than Misha.
"Tie" (without the quotes), if both of them got the same number of points. | [
"500 1000 20 30\n",
"1000 1000 1 1\n",
"1500 1000 176 177\n"
] | [
"Vasya\n",
"Tie\n",
"Misha\n"
] | none | 500 | [
{
"input": "500 1000 20 30",
"output": "Vasya"
},
{
"input": "1000 1000 1 1",
"output": "Tie"
},
{
"input": "1500 1000 176 177",
"output": "Misha"
},
{
"input": "1500 1000 74 177",
"output": "Misha"
},
{
"input": "750 2500 175 178",
"output": "Vasya"
},
{
"input": "750 1000 54 103",
"output": "Tie"
},
{
"input": "2000 1250 176 130",
"output": "Tie"
},
{
"input": "1250 1750 145 179",
"output": "Tie"
},
{
"input": "2000 2000 176 179",
"output": "Tie"
},
{
"input": "1500 1500 148 148",
"output": "Tie"
},
{
"input": "2750 1750 134 147",
"output": "Misha"
},
{
"input": "3250 250 175 173",
"output": "Misha"
},
{
"input": "500 500 170 176",
"output": "Misha"
},
{
"input": "250 1000 179 178",
"output": "Vasya"
},
{
"input": "3250 1000 160 138",
"output": "Misha"
},
{
"input": "3000 2000 162 118",
"output": "Tie"
},
{
"input": "1500 1250 180 160",
"output": "Tie"
},
{
"input": "1250 2500 100 176",
"output": "Tie"
},
{
"input": "3500 3500 177 178",
"output": "Tie"
},
{
"input": "3000 3250 16 34",
"output": "Tie"
},
{
"input": "1750 3000 137 49",
"output": "Vasya"
},
{
"input": "500 1500 179 71",
"output": "Vasya"
},
{
"input": "1250 2000 101 180",
"output": "Misha"
},
{
"input": "250 750 180 176",
"output": "Vasya"
},
{
"input": "2250 2250 163 145",
"output": "Vasya"
},
{
"input": "3000 3000 176 78",
"output": "Vasya"
},
{
"input": "250 3500 8 178",
"output": "Vasya"
},
{
"input": "1750 1250 179 180",
"output": "Misha"
},
{
"input": "2750 1750 13 164",
"output": "Misha"
},
{
"input": "1750 2250 178 53",
"output": "Vasya"
},
{
"input": "2500 2750 73 179",
"output": "Misha"
},
{
"input": "1000 3500 178 175",
"output": "Vasya"
},
{
"input": "1000 500 7 162",
"output": "Misha"
},
{
"input": "1000 250 175 48",
"output": "Misha"
},
{
"input": "1750 500 166 177",
"output": "Misha"
},
{
"input": "250 250 0 0",
"output": "Tie"
},
{
"input": "250 3500 0 0",
"output": "Vasya"
},
{
"input": "250 3500 0 180",
"output": "Vasya"
},
{
"input": "3500 3500 180 180",
"output": "Tie"
},
{
"input": "3500 250 0 180",
"output": "Misha"
}
] | 1,502,423,850 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 62 | 4,608,000 | [a, b, c, d] = [int(x) for x in input().split()]
misha = max((3*a)//10, a - c*(a//250))
vasya = max((3*b)//10, b - d*(b//250))
if misha > vasya:
print("Misha")
elif vasya > misha:
print("Vasya")
else:
print("Tie")
| Title: Contest
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Misha and Vasya participated in a Codeforces contest. Unfortunately, each of them solved only one problem, though successfully submitted it at the first attempt. Misha solved the problem that costs *a* points and Vasya solved the problem that costs *b* points. Besides, Misha submitted the problem *c* minutes after the contest started and Vasya submitted the problem *d* minutes after the contest started. As you know, on Codeforces the cost of a problem reduces as a round continues. That is, if you submit a problem that costs *p* points *t* minutes after the contest started, you get points.
Misha and Vasya are having an argument trying to find out who got more points. Help them to find out the truth.
Input Specification:
The first line contains four integers *a*, *b*, *c*, *d* (250<=≤<=*a*,<=*b*<=≤<=3500, 0<=≤<=*c*,<=*d*<=≤<=180).
It is guaranteed that numbers *a* and *b* are divisible by 250 (just like on any real Codeforces round).
Output Specification:
Output on a single line:
"Misha" (without the quotes), if Misha got more points than Vasya.
"Vasya" (without the quotes), if Vasya got more points than Misha.
"Tie" (without the quotes), if both of them got the same number of points.
Demo Input:
['500 1000 20 30\n', '1000 1000 1 1\n', '1500 1000 176 177\n']
Demo Output:
['Vasya\n', 'Tie\n', 'Misha\n']
Note:
none | ```python
[a, b, c, d] = [int(x) for x in input().split()]
misha = max((3*a)//10, a - c*(a//250))
vasya = max((3*b)//10, b - d*(b//250))
if misha > vasya:
print("Misha")
elif vasya > misha:
print("Vasya")
else:
print("Tie")
``` | 3 |
|
237 | C | Primes on Interval | PROGRAMMING | 1,600 | [
"binary search",
"number theory",
"two pointers"
] | null | null | You've decided to carry out a survey in the theory of prime numbers. Let us remind you that a prime number is a positive integer that has exactly two distinct positive integer divisors.
Consider positive integers *a*, *a*<=+<=1, ..., *b* (*a*<=≤<=*b*). You want to find the minimum integer *l* (1<=≤<=*l*<=≤<=*b*<=-<=*a*<=+<=1) such that for any integer *x* (*a*<=≤<=*x*<=≤<=*b*<=-<=*l*<=+<=1) among *l* integers *x*, *x*<=+<=1, ..., *x*<=+<=*l*<=-<=1 there are at least *k* prime numbers.
Find and print the required minimum *l*. If no value *l* meets the described limitations, print -1. | A single line contains three space-separated integers *a*,<=*b*,<=*k* (1<=≤<=*a*,<=*b*,<=*k*<=≤<=106; *a*<=≤<=*b*). | In a single line print a single integer — the required minimum *l*. If there's no solution, print -1. | [
"2 4 2\n",
"6 13 1\n",
"1 4 3\n"
] | [
"3\n",
"4\n",
"-1\n"
] | none | 1,500 | [
{
"input": "2 4 2",
"output": "3"
},
{
"input": "6 13 1",
"output": "4"
},
{
"input": "1 4 3",
"output": "-1"
},
{
"input": "5 8 2",
"output": "4"
},
{
"input": "8 10 3",
"output": "-1"
},
{
"input": "1 5 2",
"output": "3"
},
{
"input": "6 8 3",
"output": "-1"
},
{
"input": "21 29 2",
"output": "9"
},
{
"input": "17 27 3",
"output": "11"
},
{
"input": "1 1000000 10000",
"output": "137970"
},
{
"input": "690059 708971 10000",
"output": "-1"
},
{
"input": "12357 534133 2",
"output": "138"
},
{
"input": "838069 936843 3",
"output": "142"
},
{
"input": "339554 696485 4",
"output": "168"
},
{
"input": "225912 522197 5",
"output": "190"
},
{
"input": "404430 864261 6",
"output": "236"
},
{
"input": "689973 807140 7",
"output": "236"
},
{
"input": "177146 548389 8",
"output": "240"
},
{
"input": "579857 857749 9",
"output": "300"
},
{
"input": "35648 527231 10",
"output": "280"
},
{
"input": "2 1000000 10000",
"output": "137970"
},
{
"input": "1 999999 9999",
"output": "137958"
},
{
"input": "5 5 10",
"output": "-1"
},
{
"input": "11 11 6",
"output": "-1"
},
{
"input": "4 4 95",
"output": "-1"
},
{
"input": "1 1000000 1000000",
"output": "-1"
},
{
"input": "1 1000000 78498",
"output": "999999"
},
{
"input": "1 1000000 78499",
"output": "-1"
},
{
"input": "3459 94738 1",
"output": "72"
},
{
"input": "1 1000000 1",
"output": "114"
},
{
"input": "1 1000000 78498",
"output": "999999"
},
{
"input": "1 1000000 78497",
"output": "999998"
},
{
"input": "1 1000000 78490",
"output": "999978"
},
{
"input": "1000 10000 13",
"output": "168"
},
{
"input": "100000 1000000 7821",
"output": "108426"
},
{
"input": "20 1000000 40000",
"output": "539580"
},
{
"input": "1000 900000 50000",
"output": "659334"
},
{
"input": "10000 1000000 60000",
"output": "793662"
},
{
"input": "9999 99999 8000",
"output": "86572"
},
{
"input": "50 150 20",
"output": "100"
},
{
"input": "999953 999953 1",
"output": "1"
},
{
"input": "999953 999953 2",
"output": "-1"
},
{
"input": "999931 999953 2",
"output": "23"
},
{
"input": "999906 999984 4",
"output": "52"
},
{
"input": "999940 999983 3",
"output": "26"
},
{
"input": "1 1 1",
"output": "-1"
},
{
"input": "1 1 1000000",
"output": "-1"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "1 3 1",
"output": "2"
},
{
"input": "1 3 2",
"output": "3"
},
{
"input": "1 4 2",
"output": "3"
},
{
"input": "1 5 2",
"output": "3"
},
{
"input": "1 5 3",
"output": "5"
},
{
"input": "2 5 2",
"output": "3"
},
{
"input": "3 5 1",
"output": "2"
}
] | 1,632,334,541 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 61 | 6,963,200 | def main():
l=0
list=input().split(' ')
for i in range(int(list[0]),int(list[1])+1):
c=0
for j in range(1,i+1):
if i%j==0:
c+=1
if c==2:
l+=1
if l>=int(list[2]):
print(int(list[1])-int(list[0])+1)
else:
print(-1)
main()
| Title: Primes on Interval
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've decided to carry out a survey in the theory of prime numbers. Let us remind you that a prime number is a positive integer that has exactly two distinct positive integer divisors.
Consider positive integers *a*, *a*<=+<=1, ..., *b* (*a*<=≤<=*b*). You want to find the minimum integer *l* (1<=≤<=*l*<=≤<=*b*<=-<=*a*<=+<=1) such that for any integer *x* (*a*<=≤<=*x*<=≤<=*b*<=-<=*l*<=+<=1) among *l* integers *x*, *x*<=+<=1, ..., *x*<=+<=*l*<=-<=1 there are at least *k* prime numbers.
Find and print the required minimum *l*. If no value *l* meets the described limitations, print -1.
Input Specification:
A single line contains three space-separated integers *a*,<=*b*,<=*k* (1<=≤<=*a*,<=*b*,<=*k*<=≤<=106; *a*<=≤<=*b*).
Output Specification:
In a single line print a single integer — the required minimum *l*. If there's no solution, print -1.
Demo Input:
['2 4 2\n', '6 13 1\n', '1 4 3\n']
Demo Output:
['3\n', '4\n', '-1\n']
Note:
none | ```python
def main():
l=0
list=input().split(' ')
for i in range(int(list[0]),int(list[1])+1):
c=0
for j in range(1,i+1):
if i%j==0:
c+=1
if c==2:
l+=1
if l>=int(list[2]):
print(int(list[1])-int(list[0])+1)
else:
print(-1)
main()
``` | 0 |
|
702 | A | Maximum Increase | PROGRAMMING | 800 | [
"dp",
"greedy",
"implementation"
] | null | null | You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous. | The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print the maximum length of an increasing subarray of the given array. | [
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] | [
"3\n",
"1\n",
"3\n"
] | none | 0 | [
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 799843967 446173607 796619138 402690754",
"output": "3"
},
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "5\n1 2 3 3 4",
"output": "3"
},
{
"input": "4\n1 2 2 3",
"output": "2"
},
{
"input": "3\n2 1 1",
"output": "1"
},
{
"input": "3\n1 2 1",
"output": "2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 1 2",
"output": "2"
},
{
"input": "11\n1 2 3 1 2 3 2 1 2 3 4",
"output": "4"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "9\n1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "3\n3 2 1",
"output": "1"
},
{
"input": "7\n1 2 3 4 5 6 7",
"output": "7"
},
{
"input": "1\n1234394",
"output": "1"
}
] | 1,658,507,734 | 2,147,483,647 | Python 3 | OK | TESTS | 32 | 109 | 8,396,800 | n = int(input())
a = list(map(int, input().split()))
ans = []
cnt = 1
for i in range(n - 1):
if a[i + 1] > a[i]:
cnt += 1
else:
ans.append(cnt)
cnt = 1
ans.append(cnt)
print(max(ans))
| Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
Input Specification:
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print the maximum length of an increasing subarray of the given array.
Demo Input:
['5\n1 7 2 11 15\n', '6\n100 100 100 100 100 100\n', '3\n1 2 3\n']
Demo Output:
['3\n', '1\n', '3\n']
Note:
none | ```python
n = int(input())
a = list(map(int, input().split()))
ans = []
cnt = 1
for i in range(n - 1):
if a[i + 1] > a[i]:
cnt += 1
else:
ans.append(cnt)
cnt = 1
ans.append(cnt)
print(max(ans))
``` | 3 |
|
548 | B | Mike and Fun | PROGRAMMING | 1,400 | [
"brute force",
"dp",
"greedy",
"implementation"
] | null | null | Mike and some bears are playing a game just for fun. Mike is the judge. All bears except Mike are standing in an *n*<=×<=*m* grid, there's exactly one bear in each cell. We denote the bear standing in column number *j* of row number *i* by (*i*,<=*j*). Mike's hands are on his ears (since he's the judge) and each bear standing in the grid has hands either on his mouth or his eyes.
They play for *q* rounds. In each round, Mike chooses a bear (*i*,<=*j*) and tells him to change his state i. e. if his hands are on his mouth, then he'll put his hands on his eyes or he'll put his hands on his mouth otherwise. After that, Mike wants to know the score of the bears.
Score of the bears is the maximum over all rows of number of consecutive bears with hands on their eyes in that row.
Since bears are lazy, Mike asked you for help. For each round, tell him the score of these bears after changing the state of a bear selected in that round. | The first line of input contains three integers *n*, *m* and *q* (1<=≤<=*n*,<=*m*<=≤<=500 and 1<=≤<=*q*<=≤<=5000).
The next *n* lines contain the grid description. There are *m* integers separated by spaces in each line. Each of these numbers is either 0 (for mouth) or 1 (for eyes).
The next *q* lines contain the information about the rounds. Each of them contains two integers *i* and *j* (1<=≤<=*i*<=≤<=*n* and 1<=≤<=*j*<=≤<=*m*), the row number and the column number of the bear changing his state. | After each round, print the current score of the bears. | [
"5 4 5\n0 1 1 0\n1 0 0 1\n0 1 1 0\n1 0 0 1\n0 0 0 0\n1 1\n1 4\n1 1\n4 2\n4 3\n"
] | [
"3\n4\n3\n3\n4\n"
] | none | 1,000 | [
{
"input": "5 4 5\n0 1 1 0\n1 0 0 1\n0 1 1 0\n1 0 0 1\n0 0 0 0\n1 1\n1 4\n1 1\n4 2\n4 3",
"output": "3\n4\n3\n3\n4"
},
{
"input": "2 2 10\n1 1\n0 1\n1 1\n2 1\n1 1\n2 2\n1 1\n2 1\n2 2\n2 2\n1 1\n1 1",
"output": "1\n2\n2\n2\n1\n1\n1\n1\n2\n1"
},
{
"input": "2 2 10\n1 1\n0 1\n2 2\n2 2\n1 1\n2 1\n2 1\n1 1\n1 1\n2 1\n1 1\n2 1",
"output": "2\n2\n1\n2\n1\n2\n1\n2\n2\n2"
},
{
"input": "5 5 30\n0 1 1 1 0\n1 1 0 1 1\n0 1 1 1 1\n0 0 1 1 0\n0 0 0 0 0\n3 2\n2 2\n2 2\n4 3\n1 4\n3 2\n4 1\n2 4\n1 4\n2 1\n5 2\n4 1\n4 1\n5 1\n2 4\n2 4\n4 4\n1 2\n3 1\n4 5\n1 2\n2 3\n1 1\n5 1\n3 4\n1 1\n5 4\n1 5\n5 4\n2 2",
"output": "3\n3\n3\n3\n3\n4\n4\n4\n4\n4\n4\n4\n4\n4\n4\n4\n4\n4\n5\n5\n5\n5\n5\n5\n4\n3\n3\n4\n4\n4"
},
{
"input": "1 1 10\n0\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1",
"output": "1\n0\n1\n0\n1\n0\n1\n0\n1\n0"
},
{
"input": "1 1 3\n1\n1 1\n1 1\n1 1",
"output": "0\n1\n0"
},
{
"input": "1 5 5\n0 0 0 0 0\n1 2\n1 1\n1 4\n1 5\n1 3",
"output": "1\n2\n2\n2\n5"
},
{
"input": "5 1 5\n0\n0\n0\n0\n0\n1 1\n2 1\n3 1\n4 1\n5 1",
"output": "1\n1\n1\n1\n1"
},
{
"input": "1 1 1\n0\n1 1",
"output": "1"
},
{
"input": "2 2 1\n1 1\n1 1\n1 1",
"output": "2"
}
] | 1,432,660,866 | 2,766 | Python 3 | WRONG_ANSWER | PRETESTS | 0 | 46 | 102,400 | import re
def maxString(a,n):
y = 0
c = 0
for i in range(n):
s2 = ''.join(a[i])
if '1' not in s2:
r = 0
else:
r = len(max(re.findall("1+",s2),key=len))
if(r > y):
y = r
c = i
return [y,c]
def flip(x):
if(x == '1'):
return '0'
else:
return '1'
n,m,q = map(int,input().split())
a = []
x = []
for i in range(n):
x = list(input().split())
a.append(x)
y = maxString(a,n)
for i in range(q):
p,q = map(int,input().split())
d = a[p-1][q-1]
a[p-1][q-1] = flip(a[p-1][q-1])
if(p-1 == y[1]):
if(d == '0'):
y[0] += 1
else:
y = maxString(a,n)
print(y[0]) | Title: Mike and Fun
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mike and some bears are playing a game just for fun. Mike is the judge. All bears except Mike are standing in an *n*<=×<=*m* grid, there's exactly one bear in each cell. We denote the bear standing in column number *j* of row number *i* by (*i*,<=*j*). Mike's hands are on his ears (since he's the judge) and each bear standing in the grid has hands either on his mouth or his eyes.
They play for *q* rounds. In each round, Mike chooses a bear (*i*,<=*j*) and tells him to change his state i. e. if his hands are on his mouth, then he'll put his hands on his eyes or he'll put his hands on his mouth otherwise. After that, Mike wants to know the score of the bears.
Score of the bears is the maximum over all rows of number of consecutive bears with hands on their eyes in that row.
Since bears are lazy, Mike asked you for help. For each round, tell him the score of these bears after changing the state of a bear selected in that round.
Input Specification:
The first line of input contains three integers *n*, *m* and *q* (1<=≤<=*n*,<=*m*<=≤<=500 and 1<=≤<=*q*<=≤<=5000).
The next *n* lines contain the grid description. There are *m* integers separated by spaces in each line. Each of these numbers is either 0 (for mouth) or 1 (for eyes).
The next *q* lines contain the information about the rounds. Each of them contains two integers *i* and *j* (1<=≤<=*i*<=≤<=*n* and 1<=≤<=*j*<=≤<=*m*), the row number and the column number of the bear changing his state.
Output Specification:
After each round, print the current score of the bears.
Demo Input:
['5 4 5\n0 1 1 0\n1 0 0 1\n0 1 1 0\n1 0 0 1\n0 0 0 0\n1 1\n1 4\n1 1\n4 2\n4 3\n']
Demo Output:
['3\n4\n3\n3\n4\n']
Note:
none | ```python
import re
def maxString(a,n):
y = 0
c = 0
for i in range(n):
s2 = ''.join(a[i])
if '1' not in s2:
r = 0
else:
r = len(max(re.findall("1+",s2),key=len))
if(r > y):
y = r
c = i
return [y,c]
def flip(x):
if(x == '1'):
return '0'
else:
return '1'
n,m,q = map(int,input().split())
a = []
x = []
for i in range(n):
x = list(input().split())
a.append(x)
y = maxString(a,n)
for i in range(q):
p,q = map(int,input().split())
d = a[p-1][q-1]
a[p-1][q-1] = flip(a[p-1][q-1])
if(p-1 == y[1]):
if(d == '0'):
y[0] += 1
else:
y = maxString(a,n)
print(y[0])
``` | 0 |
|
465 | A | inc ARG | PROGRAMMING | 900 | [
"implementation"
] | null | null | Sergey is testing a next-generation processor. Instead of bytes the processor works with memory cells consisting of *n* bits. These bits are numbered from 1 to *n*. An integer is stored in the cell in the following way: the least significant bit is stored in the first bit of the cell, the next significant bit is stored in the second bit, and so on; the most significant bit is stored in the *n*-th bit.
Now Sergey wants to test the following instruction: "add 1 to the value of the cell". As a result of the instruction, the integer that is written in the cell must be increased by one; if some of the most significant bits of the resulting number do not fit into the cell, they must be discarded.
Sergey wrote certain values of the bits in the cell and is going to add one to its value. How many bits of the cell will change after the operation? | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of bits in the cell.
The second line contains a string consisting of *n* characters — the initial state of the cell. The first character denotes the state of the first bit of the cell. The second character denotes the second least significant bit and so on. The last character denotes the state of the most significant bit. | Print a single integer — the number of bits in the cell which change their state after we add 1 to the cell. | [
"4\n1100\n",
"4\n1111\n"
] | [
"3\n",
"4\n"
] | In the first sample the cell ends up with value 0010, in the second sample — with 0000. | 500 | [
{
"input": "4\n1100",
"output": "3"
},
{
"input": "4\n1111",
"output": "4"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n00",
"output": "1"
},
{
"input": "2\n01",
"output": "1"
},
{
"input": "2\n10",
"output": "2"
},
{
"input": "2\n11",
"output": "2"
},
{
"input": "10\n0000000000",
"output": "1"
},
{
"input": "20\n11111111110110001100",
"output": "11"
},
{
"input": "50\n01011110100010000001010000100001001101001101101011",
"output": "1"
},
{
"input": "60\n111111111101111111111111111111111111111111111111111111111111",
"output": "11"
},
{
"input": "60\n111111111111111111111111111111111111111111111111111111111111",
"output": "60"
},
{
"input": "66\n111111010010011001110011000111000100011110011001111110011111111101",
"output": "7"
},
{
"input": "90\n000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "1"
},
{
"input": "91\n1011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "2"
},
{
"input": "92\n11111111101011111011111111111111111111111011101111111111011111111111111101111111101011111101",
"output": "10"
},
{
"input": "100\n0001011110100011001100100010111001000001111101101001001001001011110100101101010000000110100101110010",
"output": "1"
},
{
"input": "100\n0111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "1"
},
{
"input": "100\n0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "1"
},
{
"input": "100\n0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000",
"output": "1"
},
{
"input": "100\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "100"
},
{
"input": "100\n1011001110001000011111110011000100001110010110111101110110011011011000010100110001111100000010110010",
"output": "2"
},
{
"input": "100\n1101111011001111111111110011110111101110111111111111111111111111111111011111111111110111111111111111",
"output": "3"
},
{
"input": "100\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111",
"output": "100"
},
{
"input": "100\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110",
"output": "100"
},
{
"input": "100\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111101",
"output": "99"
},
{
"input": "100\n1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111100000",
"output": "96"
},
{
"input": "100\n1111111111111111111111111111111110011000110110001010101100100100001000010010010010000100110000010101",
"output": "34"
}
] | 1,410,104,526 | 726 | Python 3 | OK | TESTS | 33 | 62 | 0 | input()
x = input()
a = 1
for i in range(len(x)):
if x[i] == '0':
break
else:
a += 1
if i == (len(x)-1):
a -= 1
print(a) | Title: inc ARG
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sergey is testing a next-generation processor. Instead of bytes the processor works with memory cells consisting of *n* bits. These bits are numbered from 1 to *n*. An integer is stored in the cell in the following way: the least significant bit is stored in the first bit of the cell, the next significant bit is stored in the second bit, and so on; the most significant bit is stored in the *n*-th bit.
Now Sergey wants to test the following instruction: "add 1 to the value of the cell". As a result of the instruction, the integer that is written in the cell must be increased by one; if some of the most significant bits of the resulting number do not fit into the cell, they must be discarded.
Sergey wrote certain values of the bits in the cell and is going to add one to its value. How many bits of the cell will change after the operation?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of bits in the cell.
The second line contains a string consisting of *n* characters — the initial state of the cell. The first character denotes the state of the first bit of the cell. The second character denotes the second least significant bit and so on. The last character denotes the state of the most significant bit.
Output Specification:
Print a single integer — the number of bits in the cell which change their state after we add 1 to the cell.
Demo Input:
['4\n1100\n', '4\n1111\n']
Demo Output:
['3\n', '4\n']
Note:
In the first sample the cell ends up with value 0010, in the second sample — with 0000. | ```python
input()
x = input()
a = 1
for i in range(len(x)):
if x[i] == '0':
break
else:
a += 1
if i == (len(x)-1):
a -= 1
print(a)
``` | 3 |
|
545 | D | Queue | PROGRAMMING | 1,300 | [
"greedy",
"implementation",
"sortings"
] | null | null | Little girl Susie went shopping with her mom and she wondered how to improve service quality.
There are *n* people in the queue. For each person we know time *t**i* needed to serve him. A person will be disappointed if the time he waits is more than the time needed to serve him. The time a person waits is the total time when all the people who stand in the queue in front of him are served. Susie thought that if we swap some people in the queue, then we can decrease the number of people who are disappointed.
Help Susie find out what is the maximum number of not disappointed people can be achieved by swapping people in the queue. | The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The next line contains *n* integers *t**i* (1<=≤<=*t**i*<=≤<=109), separated by spaces. | Print a single number — the maximum number of not disappointed people in the queue. | [
"5\n15 2 1 5 3\n"
] | [
"4\n"
] | Value 4 is achieved at such an arrangement, for example: 1, 2, 3, 5, 15. Thus, you can make everything feel not disappointed except for the person with time 5. | 1,750 | [
{
"input": "5\n15 2 1 5 3",
"output": "4"
},
{
"input": "15\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "2"
},
{
"input": "10\n13 2 5 55 21 34 1 8 1 3",
"output": "6"
},
{
"input": "10\n8 256 16 1 2 1 64 4 128 32",
"output": "10"
},
{
"input": "10\n10000 40000 10000 50000 20000 100000 10000 100 30000 500",
"output": "6"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "15\n9 11 45 86 52 65 35 3 93 7 21 45 15 11 39",
"output": "6"
},
{
"input": "20\n16839799 17525904 91276752 42650694 60106463 12243176 54892123 25142243 16015971 41250998 11150057 6994983 67700784 16562412 82163675 46178521 33914268 91966607 93976858 84100064",
"output": "5"
},
{
"input": "26\n1000 4110030 64221 131521030 942374833 1003 2055015 32110 513757 16440130 263042057 32880256 128439 557559573 16051 8220066 469240078 65760513 256878 790176315 4012 2005 1027508 928528684 8030 805074697",
"output": "21"
}
] | 1,698,134,214 | 2,147,483,647 | Python 3 | OK | TESTS | 61 | 124 | 13,619,200 | '''
2300015897
吴杰稀
光华管理学院
'''
n = int(input())
num_list = list(map(int,input().split()))
num_list.sort()
i = 0
happy_num = 0
total_time = 0
while i <= len(num_list) - 1:
if num_list[i] >= total_time:
total_time += num_list[i]
happy_num += 1
i += 1
print(happy_num)
| Title: Queue
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little girl Susie went shopping with her mom and she wondered how to improve service quality.
There are *n* people in the queue. For each person we know time *t**i* needed to serve him. A person will be disappointed if the time he waits is more than the time needed to serve him. The time a person waits is the total time when all the people who stand in the queue in front of him are served. Susie thought that if we swap some people in the queue, then we can decrease the number of people who are disappointed.
Help Susie find out what is the maximum number of not disappointed people can be achieved by swapping people in the queue.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The next line contains *n* integers *t**i* (1<=≤<=*t**i*<=≤<=109), separated by spaces.
Output Specification:
Print a single number — the maximum number of not disappointed people in the queue.
Demo Input:
['5\n15 2 1 5 3\n']
Demo Output:
['4\n']
Note:
Value 4 is achieved at such an arrangement, for example: 1, 2, 3, 5, 15. Thus, you can make everything feel not disappointed except for the person with time 5. | ```python
'''
2300015897
吴杰稀
光华管理学院
'''
n = int(input())
num_list = list(map(int,input().split()))
num_list.sort()
i = 0
happy_num = 0
total_time = 0
while i <= len(num_list) - 1:
if num_list[i] >= total_time:
total_time += num_list[i]
happy_num += 1
i += 1
print(happy_num)
``` | 3 |
|
833 | A | The Meaningless Game | PROGRAMMING | 1,700 | [
"math",
"number theory"
] | null | null | Slastyona and her loyal dog Pushok are playing a meaningless game that is indeed very interesting.
The game consists of multiple rounds. Its rules are very simple: in each round, a natural number *k* is chosen. Then, the one who says (or barks) it faster than the other wins the round. After that, the winner's score is multiplied by *k*2, and the loser's score is multiplied by *k*. In the beginning of the game, both Slastyona and Pushok have scores equal to one.
Unfortunately, Slastyona had lost her notepad where the history of all *n* games was recorded. She managed to recall the final results for each games, though, but all of her memories of them are vague. Help Slastyona verify their correctness, or, to put it another way, for each given pair of scores determine whether it was possible for a game to finish with such result or not. | In the first string, the number of games *n* (1<=≤<=*n*<=≤<=350000) is given.
Each game is represented by a pair of scores *a*, *b* (1<=≤<=*a*,<=*b*<=≤<=109) – the results of Slastyona and Pushok, correspondingly. | For each pair of scores, answer "Yes" if it's possible for a game to finish with given score, and "No" otherwise.
You can output each letter in arbitrary case (upper or lower). | [
"6\n2 4\n75 45\n8 8\n16 16\n247 994\n1000000000 1000000\n"
] | [
"Yes\nYes\nYes\nNo\nNo\nYes\n"
] | First game might have been consisted of one round, in which the number 2 would have been chosen and Pushok would have won.
The second game needs exactly two rounds to finish with such result: in the first one, Slastyona would have said the number 5, and in the second one, Pushok would have barked the number 3. | 500 | [
{
"input": "6\n2 4\n75 45\n8 8\n16 16\n247 994\n1000000000 1000000",
"output": "Yes\nYes\nYes\nNo\nNo\nYes"
},
{
"input": "3\n1 1\n8 27\n1000 1331",
"output": "Yes\nNo\nNo"
},
{
"input": "1\n12004 18012002",
"output": "Yes"
},
{
"input": "1\n3331 11095561",
"output": "Yes"
},
{
"input": "1\n2 3",
"output": "No"
},
{
"input": "1\n1062961 1031",
"output": "Yes"
},
{
"input": "1\n6 12",
"output": "No"
},
{
"input": "1\n3 1",
"output": "No"
},
{
"input": "1\n3 10",
"output": "No"
},
{
"input": "1\n31159 970883281",
"output": "Yes"
},
{
"input": "1\n9907 98148649",
"output": "Yes"
},
{
"input": "1\n16 8",
"output": "No"
},
{
"input": "1\n90 72",
"output": "No"
}
] | 1,676,979,519 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 7 | 1,000 | 0 | def GCD(a,b):
if a<b:
a,b=b,a
if b==0:
return a
return GCD(b,a%b)
def isCube(x):
i=1
j=5000
while i<=j:
m=(i+j)//2
# print(m)
t=m*m*m
if t==x:
return "Yes"
if t>x:
j=m-1
else:
i=m+1
return "No"
def ss(a,b):
l=GCD(a,b)
r=(a//l)*(b//l)
x=l//r
return isCube(x)
for _ in range(int(input())):
a,b=map(int, input().split())
print(ss(a,b)) | Title: The Meaningless Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Slastyona and her loyal dog Pushok are playing a meaningless game that is indeed very interesting.
The game consists of multiple rounds. Its rules are very simple: in each round, a natural number *k* is chosen. Then, the one who says (or barks) it faster than the other wins the round. After that, the winner's score is multiplied by *k*2, and the loser's score is multiplied by *k*. In the beginning of the game, both Slastyona and Pushok have scores equal to one.
Unfortunately, Slastyona had lost her notepad where the history of all *n* games was recorded. She managed to recall the final results for each games, though, but all of her memories of them are vague. Help Slastyona verify their correctness, or, to put it another way, for each given pair of scores determine whether it was possible for a game to finish with such result or not.
Input Specification:
In the first string, the number of games *n* (1<=≤<=*n*<=≤<=350000) is given.
Each game is represented by a pair of scores *a*, *b* (1<=≤<=*a*,<=*b*<=≤<=109) – the results of Slastyona and Pushok, correspondingly.
Output Specification:
For each pair of scores, answer "Yes" if it's possible for a game to finish with given score, and "No" otherwise.
You can output each letter in arbitrary case (upper or lower).
Demo Input:
['6\n2 4\n75 45\n8 8\n16 16\n247 994\n1000000000 1000000\n']
Demo Output:
['Yes\nYes\nYes\nNo\nNo\nYes\n']
Note:
First game might have been consisted of one round, in which the number 2 would have been chosen and Pushok would have won.
The second game needs exactly two rounds to finish with such result: in the first one, Slastyona would have said the number 5, and in the second one, Pushok would have barked the number 3. | ```python
def GCD(a,b):
if a<b:
a,b=b,a
if b==0:
return a
return GCD(b,a%b)
def isCube(x):
i=1
j=5000
while i<=j:
m=(i+j)//2
# print(m)
t=m*m*m
if t==x:
return "Yes"
if t>x:
j=m-1
else:
i=m+1
return "No"
def ss(a,b):
l=GCD(a,b)
r=(a//l)*(b//l)
x=l//r
return isCube(x)
for _ in range(int(input())):
a,b=map(int, input().split())
print(ss(a,b))
``` | 0 |
|
0 | none | none | none | 0 | [
"none"
] | null | null | Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days. | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out. | Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days. | [
"4\n1 3 2 0\n",
"7\n1 3 3 2 1 2 3\n",
"2\n2 2\n"
] | [
"2\n",
"0\n",
"1\n"
] | In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | 0 | [
{
"input": "4\n1 3 2 0",
"output": "2"
},
{
"input": "7\n1 3 3 2 1 2 3",
"output": "0"
},
{
"input": "2\n2 2",
"output": "1"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "10\n0 0 1 1 0 0 0 0 1 0",
"output": "8"
},
{
"input": "100\n3 2 3 3 3 2 3 1 3 2 2 3 2 3 3 3 3 3 3 1 2 2 3 1 3 3 2 2 2 3 1 0 3 3 3 2 3 3 1 1 3 1 3 3 3 1 3 1 3 0 1 3 2 3 2 1 1 3 2 3 3 3 2 3 1 3 3 3 3 2 2 2 1 3 1 3 3 3 3 1 3 2 3 3 0 3 3 3 3 3 1 0 2 1 3 3 0 2 3 3",
"output": "16"
},
{
"input": "10\n2 3 0 1 3 1 2 2 1 0",
"output": "3"
},
{
"input": "45\n3 3 2 3 2 3 3 3 0 3 3 3 3 3 3 3 1 3 2 3 2 3 2 2 2 3 2 3 3 3 3 3 1 2 3 3 2 2 2 3 3 3 3 1 3",
"output": "6"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "1\n2",
"output": "0"
},
{
"input": "1\n3",
"output": "0"
},
{
"input": "2\n1 1",
"output": "1"
},
{
"input": "2\n1 3",
"output": "0"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "2\n0 0",
"output": "2"
},
{
"input": "2\n3 3",
"output": "0"
},
{
"input": "3\n3 3 3",
"output": "0"
},
{
"input": "2\n3 2",
"output": "0"
},
{
"input": "2\n0 2",
"output": "1"
},
{
"input": "10\n2 2 3 3 3 3 2 1 3 2",
"output": "2"
},
{
"input": "15\n0 1 0 0 0 2 0 1 0 0 0 2 0 0 0",
"output": "11"
},
{
"input": "15\n1 3 2 2 2 3 3 3 3 2 3 2 2 1 1",
"output": "4"
},
{
"input": "15\n3 1 3 2 3 2 2 2 3 3 3 3 2 3 2",
"output": "3"
},
{
"input": "20\n0 2 0 1 0 0 0 1 2 0 1 1 1 0 1 1 0 1 1 0",
"output": "12"
},
{
"input": "20\n2 3 2 3 3 3 3 2 0 3 1 1 2 3 0 3 2 3 0 3",
"output": "5"
},
{
"input": "20\n3 3 3 3 2 3 3 2 1 3 3 2 2 2 3 2 2 2 2 2",
"output": "4"
},
{
"input": "25\n0 0 1 0 0 1 0 0 1 0 0 1 0 2 0 0 2 0 0 1 0 2 0 1 1",
"output": "16"
},
{
"input": "25\n1 3 3 2 2 3 3 3 3 3 1 2 2 3 2 0 2 1 0 1 3 2 2 3 3",
"output": "5"
},
{
"input": "25\n2 3 1 3 3 2 1 3 3 3 1 3 3 1 3 2 3 3 1 3 3 3 2 3 3",
"output": "3"
},
{
"input": "30\n0 0 1 0 1 0 1 1 0 0 0 0 0 0 1 0 0 1 1 0 0 2 0 0 1 1 2 0 0 0",
"output": "22"
},
{
"input": "30\n1 1 3 2 2 0 3 2 3 3 1 2 0 1 1 2 3 3 2 3 1 3 2 3 0 2 0 3 3 2",
"output": "9"
},
{
"input": "30\n1 2 3 2 2 3 3 3 3 3 3 3 3 3 3 1 2 2 3 2 3 3 3 2 1 3 3 3 1 3",
"output": "2"
},
{
"input": "35\n0 1 1 0 0 2 0 0 1 0 0 0 1 0 1 0 1 0 0 0 1 2 1 0 2 2 1 0 1 0 1 1 1 0 0",
"output": "21"
},
{
"input": "35\n2 2 0 3 2 2 0 3 3 1 1 3 3 1 2 2 0 2 2 2 2 3 1 0 2 1 3 2 2 3 2 3 3 1 2",
"output": "11"
},
{
"input": "35\n1 2 2 3 3 3 3 3 2 2 3 3 2 3 3 2 3 2 3 3 2 2 2 3 3 2 3 3 3 1 3 3 2 2 2",
"output": "7"
},
{
"input": "40\n2 0 1 1 0 0 0 0 2 0 1 1 1 0 0 1 0 0 0 0 0 2 0 0 0 2 1 1 1 3 0 0 0 0 0 0 0 1 1 0",
"output": "28"
},
{
"input": "40\n2 2 3 2 0 2 3 2 1 2 3 0 2 3 2 1 1 3 1 1 0 2 3 1 3 3 1 1 3 3 2 2 1 3 3 3 2 3 3 1",
"output": "10"
},
{
"input": "40\n1 3 2 3 3 2 3 3 2 2 3 1 2 1 2 2 3 1 2 2 1 2 2 2 1 2 2 3 2 3 2 3 2 3 3 3 1 3 2 3",
"output": "8"
},
{
"input": "45\n2 1 0 0 0 2 1 0 1 0 0 2 2 1 1 0 0 2 0 0 0 0 0 0 1 0 0 2 0 0 1 1 0 0 1 0 0 1 1 2 0 0 2 0 2",
"output": "29"
},
{
"input": "45\n3 3 2 3 3 3 2 2 3 2 3 1 3 2 3 2 2 1 1 3 2 3 2 1 3 1 2 3 2 2 0 3 3 2 3 2 3 2 3 2 0 3 1 1 3",
"output": "8"
},
{
"input": "50\n3 0 0 0 2 0 0 0 0 0 0 0 2 1 0 2 0 1 0 1 3 0 2 1 1 0 0 1 1 0 0 1 2 1 1 2 1 1 0 0 0 0 0 0 0 1 2 2 0 0",
"output": "32"
},
{
"input": "50\n3 3 3 3 1 0 3 3 0 2 3 1 1 1 3 2 3 3 3 3 3 1 0 1 2 2 3 3 2 3 0 0 0 2 1 0 1 2 2 2 2 0 2 2 2 1 2 3 3 2",
"output": "16"
},
{
"input": "50\n3 2 3 1 2 1 2 3 3 2 3 3 2 1 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 2 3 3 3 3 2 3 1 2 3 3 2 3 3 1 2 2 1 1 3 3",
"output": "7"
},
{
"input": "55\n0 0 1 1 0 1 0 0 1 0 1 0 0 0 2 0 0 1 0 0 0 1 0 0 0 0 3 1 0 0 0 1 0 0 0 0 2 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 2 0 0",
"output": "40"
},
{
"input": "55\n3 0 3 3 3 2 0 2 3 0 3 2 3 3 0 3 3 1 3 3 1 2 3 2 0 3 3 2 1 2 3 2 3 0 3 2 2 1 2 3 2 2 1 3 2 2 3 1 3 2 2 3 3 2 2",
"output": "13"
},
{
"input": "55\n3 3 1 3 2 3 2 3 2 2 3 3 3 3 3 1 1 3 3 2 3 2 3 2 0 1 3 3 3 3 2 3 2 3 1 1 2 2 2 3 3 3 3 3 2 2 2 3 2 3 3 3 3 1 3",
"output": "7"
},
{
"input": "60\n0 1 0 0 0 0 0 0 0 2 1 1 3 0 0 0 0 0 1 0 1 1 0 0 0 3 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 0",
"output": "44"
},
{
"input": "60\n3 2 1 3 2 2 3 3 3 1 1 3 2 2 3 3 1 3 2 2 3 3 2 2 2 2 0 2 2 3 2 3 0 3 3 3 2 3 3 0 1 3 2 1 3 1 1 2 1 3 1 1 2 2 1 3 3 3 2 2",
"output": "15"
},
{
"input": "60\n3 2 2 3 2 3 2 3 3 2 3 2 3 3 2 3 3 3 3 3 3 2 3 3 1 2 3 3 3 2 1 3 3 1 3 1 3 0 3 3 3 2 3 2 3 2 3 3 1 1 2 3 3 3 3 2 1 3 2 3",
"output": "8"
},
{
"input": "65\n1 0 2 1 1 0 1 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 1 2 0 2 1 0 2 1 0 1 0 1 1 0 1 1 1 2 1 0 1 0 0 0 0 1 2 2 1 0 0 1 2 1 2 0 2 0 0 0 1 1",
"output": "35"
},
{
"input": "65\n2 2 2 3 0 2 1 2 3 3 1 3 1 2 1 3 2 3 2 2 2 1 2 0 3 1 3 1 1 3 1 3 3 3 3 3 1 3 0 3 1 3 1 2 2 3 2 0 3 1 3 2 1 2 2 2 3 3 2 3 3 3 2 2 3",
"output": "13"
},
{
"input": "65\n3 2 3 3 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 3 3 2 2 2 3 3 2 3 3 2 3 3 3 3 2 3 3 3 2 2 3 3 3 3 3 3 2 2 3 3 2 3 3 1 3 3 3 3",
"output": "6"
},
{
"input": "70\n1 0 0 0 1 0 1 0 0 0 1 1 0 1 0 0 1 1 1 0 1 1 0 0 1 1 1 3 1 1 0 1 2 0 2 1 0 0 0 1 1 1 1 1 0 0 1 0 0 0 1 1 1 3 0 0 1 0 0 0 1 0 0 0 0 0 1 0 1 1",
"output": "43"
},
{
"input": "70\n2 3 3 3 1 3 3 1 2 1 1 2 2 3 0 2 3 3 1 3 3 2 2 3 3 3 2 2 2 2 1 3 3 0 2 1 1 3 2 3 3 2 2 3 1 3 1 2 3 2 3 3 2 2 2 3 1 1 2 1 3 3 2 2 3 3 3 1 1 1",
"output": "16"
},
{
"input": "70\n3 3 2 2 1 2 1 2 2 2 2 2 3 3 2 3 3 3 3 2 2 2 2 3 3 3 1 3 3 3 2 3 3 3 3 2 3 3 1 3 1 3 2 3 3 2 3 3 3 2 3 2 3 3 1 2 3 3 2 2 2 3 2 3 3 3 3 3 3 1",
"output": "10"
},
{
"input": "75\n1 0 0 1 1 0 0 1 0 1 2 0 0 2 1 1 0 0 0 0 0 0 2 1 1 0 0 0 0 1 0 1 0 1 1 1 0 1 0 0 1 0 0 0 0 0 0 1 1 0 0 1 2 1 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 1 1 0 1 0",
"output": "51"
},
{
"input": "75\n1 3 3 3 1 1 3 2 3 3 1 3 3 3 2 1 3 2 2 3 1 1 1 1 1 1 2 3 3 3 3 3 3 2 3 3 3 3 3 2 3 3 2 2 2 1 2 3 3 2 2 3 0 1 1 3 3 0 0 1 1 3 2 3 3 3 3 1 2 2 3 3 3 3 1",
"output": "16"
},
{
"input": "75\n3 3 3 3 2 2 3 2 2 3 2 2 1 2 3 3 2 2 3 3 1 2 2 2 1 3 3 3 1 2 2 3 3 3 2 3 2 2 2 3 3 1 3 2 2 3 3 3 0 3 2 1 3 3 2 3 3 3 3 1 2 3 3 3 2 2 3 3 3 3 2 2 3 3 1",
"output": "11"
},
{
"input": "80\n0 0 0 0 2 0 1 1 1 1 1 0 0 0 0 2 0 0 1 0 0 0 0 1 1 0 2 2 1 1 0 1 0 1 0 1 1 1 0 1 2 1 1 0 0 0 1 1 0 1 1 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 2 2 0 1 1 0 0 0 0 0 0 0 0 1",
"output": "56"
},
{
"input": "80\n2 2 3 3 2 1 0 1 0 3 2 2 3 2 1 3 1 3 3 2 3 3 3 2 3 3 3 2 1 3 3 1 3 3 3 3 3 3 2 2 2 1 3 2 1 3 2 1 1 0 1 1 2 1 3 0 1 2 3 2 2 3 2 3 1 3 3 2 1 1 0 3 3 3 3 1 2 1 2 0",
"output": "17"
},
{
"input": "80\n2 3 3 2 2 2 3 3 2 3 3 3 3 3 2 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 1 3 2 3 3 0 3 1 2 3 3 1 2 3 2 3 3 2 3 3 3 3 3 2 2 3 0 3 3 3 3 3 2 2 3 2 3 3 3 3 3 2 3 2 3 3 3 3 2 3",
"output": "9"
},
{
"input": "85\n0 1 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 1 0 0 2 0 1 1 0 0 0 0 2 2 0 0 0 1 0 0 0 1 2 0 1 0 0 0 2 1 1 2 0 3 1 0 2 2 1 0 0 1 1 0 0 0 0 1 0 2 1 1 2 1 0 0 1 2 1 2 0 0 1 0 1 0",
"output": "54"
},
{
"input": "85\n2 3 1 3 2 3 1 3 3 2 1 2 1 2 2 3 2 2 3 2 0 3 3 2 1 2 2 2 3 3 2 3 3 3 2 1 1 3 1 3 2 2 2 3 3 2 3 2 3 1 1 3 2 3 1 3 3 2 3 3 2 2 3 0 1 1 2 2 2 2 1 2 3 1 3 3 1 3 2 2 3 2 3 3 3",
"output": "19"
},
{
"input": "85\n1 2 1 2 3 2 3 3 3 3 3 3 3 2 1 3 2 3 3 3 3 2 3 3 3 1 3 3 3 3 2 3 3 3 3 3 3 2 2 1 3 3 3 3 2 2 3 1 1 2 3 3 3 2 3 3 3 3 3 2 3 3 3 2 2 3 3 1 1 1 3 3 3 3 1 3 3 3 1 3 3 1 3 2 3",
"output": "9"
},
{
"input": "90\n2 0 1 0 0 0 0 0 0 1 1 2 0 0 0 0 0 0 0 2 2 0 2 0 0 2 1 0 2 0 1 0 1 0 0 1 2 2 0 0 1 0 0 1 0 1 0 2 0 1 1 1 0 1 1 0 1 0 2 0 1 0 1 0 0 0 1 0 0 1 2 0 0 0 1 0 0 2 2 0 0 0 0 0 1 3 1 1 0 1",
"output": "57"
},
{
"input": "90\n2 3 3 3 2 3 2 1 3 0 3 2 3 3 2 1 3 3 2 3 2 3 3 2 1 3 1 3 3 1 2 2 3 3 2 1 2 3 2 3 0 3 3 2 2 3 1 0 3 3 1 3 3 3 3 2 1 2 2 1 3 2 1 3 3 1 2 0 2 2 3 2 2 3 3 3 1 3 2 1 2 3 3 2 3 2 3 3 2 1",
"output": "17"
},
{
"input": "90\n2 3 2 3 2 2 3 3 2 3 2 1 2 3 3 3 2 3 2 3 3 2 3 3 3 1 3 3 1 3 2 3 2 2 1 3 3 3 3 3 3 3 3 3 3 2 3 2 3 2 1 3 3 3 3 2 2 3 3 3 3 3 3 3 3 3 3 3 3 2 2 3 3 3 3 1 3 2 3 3 3 2 2 3 2 3 2 1 3 2",
"output": "9"
},
{
"input": "95\n0 0 3 0 2 0 1 0 0 2 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 2 1 0 0 1 0 0 0 1 0 0 0 0 1 0 1 0 0 1 0 1 2 0 1 2 2 0 0 1 0 2 0 0 0 1 0 2 1 2 1 0 1 0 0 0 1 0 0 1 1 2 1 1 1 1 2 0 0 0 0 0 1 1 0 1",
"output": "61"
},
{
"input": "95\n2 3 3 2 1 1 3 3 3 2 3 3 3 2 3 2 3 3 3 2 3 2 2 3 3 2 1 2 3 3 3 1 3 0 3 3 1 3 3 1 0 1 3 3 3 0 2 1 3 3 3 3 0 1 3 2 3 3 2 1 3 1 2 1 1 2 3 0 3 3 2 1 3 2 1 3 3 3 2 2 3 2 3 3 3 2 1 3 3 3 2 3 3 1 2",
"output": "15"
},
{
"input": "95\n2 3 3 2 3 2 2 1 3 1 2 1 2 3 1 2 3 3 1 3 3 3 1 2 3 2 2 2 2 3 3 3 2 2 3 3 3 3 3 1 2 2 3 3 3 3 2 3 2 2 2 3 3 2 3 3 3 3 3 3 3 0 3 2 0 3 3 1 3 3 3 2 3 2 3 2 3 3 3 3 2 2 1 1 3 3 3 3 3 1 3 3 3 3 2",
"output": "14"
},
{
"input": "100\n1 0 2 0 0 0 0 2 0 0 0 1 0 1 0 0 1 0 1 2 0 1 1 0 0 1 0 1 1 0 0 0 2 0 1 0 0 2 0 0 0 0 0 1 1 1 0 0 1 0 2 0 0 0 0 1 0 1 0 1 0 1 0 1 2 2 0 0 2 0 1 0 1 0 1 0 0 0 1 0 0 2 1 1 1 0 0 1 0 0 0 2 0 0 2 1 1 0 0 2",
"output": "63"
},
{
"input": "100\n3 2 1 3 2 3 2 3 2 2 3 1 3 3 3 3 3 2 2 3 2 2 3 2 3 3 3 2 3 1 2 1 3 3 3 3 1 3 3 3 3 3 2 3 2 1 3 3 1 2 2 3 1 3 3 1 2 2 1 3 1 3 2 2 3 3 1 3 2 3 1 2 1 2 3 3 2 2 1 2 3 3 3 3 3 1 3 3 3 3 2 1 3 0 3 3 3 2 3 3",
"output": "15"
},
{
"input": "100\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "0"
},
{
"input": "100\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "0"
},
{
"input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
},
{
"input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "50"
},
{
"input": "99\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "49"
},
{
"input": "100\n2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1",
"output": "0"
},
{
"input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
"output": "100"
},
{
"input": "2\n0 3",
"output": "1"
},
{
"input": "2\n1 0",
"output": "1"
},
{
"input": "2\n1 2",
"output": "0"
},
{
"input": "2\n2 0",
"output": "1"
},
{
"input": "2\n2 1",
"output": "0"
},
{
"input": "2\n2 3",
"output": "0"
},
{
"input": "2\n3 0",
"output": "1"
},
{
"input": "2\n3 1",
"output": "0"
},
{
"input": "100\n3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0",
"output": "50"
}
] | 1,468,937,395 | 3,895 | Python 3 | OK | TESTS | 88 | 77 | 512,000 | from collections import deque
n = int(input())
A = list(map(int, input().split()))
answer = 0
t = 0
answer = 0
for i in range(n):
if A[i] == 0:
t = 0
elif A[i] == 1:
if t != 1:
answer +=1
t = 1
else:
t = 0
elif A[i] == 2:
if t!=2:
answer +=1
t = 2
else:
t = 0
else:
if t == 1:
t = 2
answer+=1
elif t == 2:
t = 1
answer +=1
else:
t = 0
answer+=1
print(n-answer) | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options:
1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out.
On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day).
Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has — he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of days of Vasya's vacations.
The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=3) separated by space, where:
- *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out.
Output Specification:
Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses:
- to do sport on any two consecutive days, - to write the contest on any two consecutive days.
Demo Input:
['4\n1 3 2 0\n', '7\n1 3 3 2 1 2 3\n', '2\n2 2\n']
Demo Output:
['2\n', '0\n', '1\n']
Note:
In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days.
In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day.
In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day. | ```python
from collections import deque
n = int(input())
A = list(map(int, input().split()))
answer = 0
t = 0
answer = 0
for i in range(n):
if A[i] == 0:
t = 0
elif A[i] == 1:
if t != 1:
answer +=1
t = 1
else:
t = 0
elif A[i] == 2:
if t!=2:
answer +=1
t = 2
else:
t = 0
else:
if t == 1:
t = 2
answer+=1
elif t == 2:
t = 1
answer +=1
else:
t = 0
answer+=1
print(n-answer)
``` | 3 |
|
596 | C | Wilbur and Points | PROGRAMMING | 1,700 | [
"combinatorics",
"greedy",
"sortings"
] | null | null | Wilbur is playing with a set of *n* points on the coordinate plane. All points have non-negative integer coordinates. Moreover, if some point (*x*, *y*) belongs to the set, then all points (*x*', *y*'), such that 0<=≤<=*x*'<=≤<=*x* and 0<=≤<=*y*'<=≤<=*y* also belong to this set.
Now Wilbur wants to number the points in the set he has, that is assign them distinct integer numbers from 1 to *n*. In order to make the numbering aesthetically pleasing, Wilbur imposes the condition that if some point (*x*, *y*) gets number *i*, then all (*x*',*y*') from the set, such that *x*'<=≥<=*x* and *y*'<=≥<=*y* must be assigned a number not less than *i*. For example, for a set of four points (0, 0), (0, 1), (1, 0) and (1, 1), there are two aesthetically pleasing numberings. One is 1, 2, 3, 4 and another one is 1, 3, 2, 4.
Wilbur's friend comes along and challenges Wilbur. For any point he defines it's special value as *s*(*x*,<=*y*)<==<=*y*<=-<=*x*. Now he gives Wilbur some *w*1, *w*2,..., *w**n*, and asks him to find an aesthetically pleasing numbering of the points in the set, such that the point that gets number *i* has it's special value equal to *w**i*, that is *s*(*x**i*,<=*y**i*)<==<=*y**i*<=-<=*x**i*<==<=*w**i*.
Now Wilbur asks you to help him with this challenge. | The first line of the input consists of a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of points in the set Wilbur is playing with.
Next follow *n* lines with points descriptions. Each line contains two integers *x* and *y* (0<=≤<=*x*,<=*y*<=≤<=100<=000), that give one point in Wilbur's set. It's guaranteed that all points are distinct. Also, it is guaranteed that if some point (*x*, *y*) is present in the input, then all points (*x*', *y*'), such that 0<=≤<=*x*'<=≤<=*x* and 0<=≤<=*y*'<=≤<=*y*, are also present in the input.
The last line of the input contains *n* integers. The *i*-th of them is *w**i* (<=-<=100<=000<=≤<=*w**i*<=≤<=100<=000) — the required special value of the point that gets number *i* in any aesthetically pleasing numbering. | If there exists an aesthetically pleasant numbering of points in the set, such that *s*(*x**i*,<=*y**i*)<==<=*y**i*<=-<=*x**i*<==<=*w**i*, then print "YES" on the first line of the output. Otherwise, print "NO".
If a solution exists, proceed output with *n* lines. On the *i*-th of these lines print the point of the set that gets number *i*. If there are multiple solutions, print any of them. | [
"5\n2 0\n0 0\n1 0\n1 1\n0 1\n0 -1 -2 1 0\n",
"3\n1 0\n0 0\n2 0\n0 1 2\n"
] | [
"YES\n0 0\n1 0\n2 0\n0 1\n1 1\n",
"NO\n"
] | In the first sample, point (2, 0) gets number 3, point (0, 0) gets number one, point (1, 0) gets number 2, point (1, 1) gets number 5 and point (0, 1) gets number 4. One can easily check that this numbering is aesthetically pleasing and *y*<sub class="lower-index">*i*</sub> - *x*<sub class="lower-index">*i*</sub> = *w*<sub class="lower-index">*i*</sub>.
In the second sample, the special values of the points in the set are 0, - 1, and - 2 while the sequence that the friend gives to Wilbur is 0, 1, 2. Therefore, the answer does not exist. | 1,500 | [
{
"input": "5\n2 0\n0 0\n1 0\n1 1\n0 1\n0 -1 -2 1 0",
"output": "YES\n0 0\n1 0\n2 0\n0 1\n1 1"
},
{
"input": "3\n1 0\n0 0\n2 0\n0 1 2",
"output": "NO"
},
{
"input": "9\n0 0\n1 0\n2 0\n0 1\n1 1\n2 1\n1 2\n2 2\n0 2\n0 0 0 -1 -1 -2 1 1 2",
"output": "NO"
},
{
"input": "18\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n0 10\n0 11\n0 12\n0 13\n0 14\n0 15\n0 16\n1 0\n0 1 2 3 4 5 6 7 8 9 -1 10 11 12 13 14 15 16",
"output": "YES\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n1 0\n0 10\n0 11\n0 12\n0 13\n0 14\n0 15\n0 16"
},
{
"input": "1\n0 0\n0",
"output": "YES\n0 0"
},
{
"input": "37\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n0 10\n0 11\n0 12\n0 13\n0 14\n0 15\n0 16\n0 17\n0 18\n0 19\n0 20\n0 21\n0 22\n0 23\n0 24\n0 25\n0 26\n0 27\n0 28\n0 29\n0 30\n0 31\n0 32\n0 33\n0 34\n0 35\n1 0\n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 -1 26 27 28 29 30 31 32 33 34 35",
"output": "YES\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n0 10\n0 11\n0 12\n0 13\n0 14\n0 15\n0 16\n0 17\n0 18\n0 19\n0 20\n0 21\n0 22\n0 23\n0 24\n0 25\n1 0\n0 26\n0 27\n0 28\n0 29\n0 30\n0 31\n0 32\n0 33\n0 34\n0 35"
},
{
"input": "31\n0 0\n0 1\n0 2\n0 3\n1 0\n1 1\n2 0\n2 1\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n12 0\n13 0\n14 0\n15 0\n16 0\n17 0\n18 0\n19 0\n20 0\n21 0\n22 0\n23 0\n24 0\n25 0\n0 -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 -11 -12 -13 -14 1 -15 2 -16 -17 -18 3 -19 -20 0 -21 -22 -23 -24 -25 -1",
"output": "YES\n0 0\n1 0\n2 0\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n12 0\n13 0\n14 0\n0 1\n15 0\n0 2\n16 0\n17 0\n18 0\n0 3\n19 0\n20 0\n1 1\n21 0\n22 0\n23 0\n24 0\n25 0\n2 1"
},
{
"input": "40\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n0 10\n0 11\n0 12\n1 0\n1 1\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n2 0\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n12 0\n13 0\n14 0\n15 0\n16 0\n17 0\n18 0\n19 0\n20 0\n0 1 2 -1 -2 3 4 -3 5 6 7 8 0 -4 -5 1 -6 -7 -8 -9 -10 -11 9 2 -12 -13 -14 3 10 -15 11 4 -16 -17 -18 -19 5 6 12 -20",
"output": "YES\n0 0\n0 1\n0 2\n1 0\n2 0\n0 3\n0 4\n3 0\n0 5\n0 6\n0 7\n0 8\n1 1\n4 0\n5 0\n1 2\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n0 9\n1 3\n12 0\n13 0\n14 0\n1 4\n0 10\n15 0\n0 11\n1 5\n16 0\n17 0\n18 0\n19 0\n1 6\n1 7\n0 12\n20 0"
},
{
"input": "21\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n1 0\n1 1\n1 2\n1 3\n2 0\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n86174 -26039 -13726 25840 85990 -62633 -29634 -68400 39255 1313 77388 830 -45558 -90862 97867 46376 58592 17103 32820 27220 94751",
"output": "NO"
},
{
"input": "31\n0 0\n0 1\n0 2\n0 3\n0 4\n0 5\n0 6\n0 7\n0 8\n0 9\n1 0\n1 1\n1 2\n1 3\n1 4\n1 5\n2 0\n2 1\n2 2\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n12 0\n13 0\n14 0\n-8 1 4 -11 0 -4 -10 3 4 -5 -9 8 7 6 2 -2 -1 9 -3 -14 2 3 -6 0 -7 -1 5 0 -13 -12 1",
"output": "NO"
},
{
"input": "1\n0 0\n-9876",
"output": "NO"
},
{
"input": "16\n0 0\n0 1\n1 0\n2 0\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n11 0\n12 0\n13 0\n14 0\n0 -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 1 -11 -12 -13 -14",
"output": "YES\n0 0\n1 0\n2 0\n3 0\n4 0\n5 0\n6 0\n7 0\n8 0\n9 0\n10 0\n0 1\n11 0\n12 0\n13 0\n14 0"
},
{
"input": "5\n1 1\n0 1\n2 0\n1 0\n0 0\n0 -1 -2 1 0",
"output": "YES\n0 0\n1 0\n2 0\n0 1\n1 1"
},
{
"input": "2\n0 0\n1 0\n-1 0",
"output": "NO"
}
] | 1,447,607,084 | 1,784 | Python 3 | WRONG_ANSWER | PRETESTS | 2 | 46 | 0 | N=int(input())
a={}
c=[]
for i in range(N):
x,y=tuple(map(int,input().split()))
if y-x in a:
a[y-x]+=[[x,y]]
else:
a[y-x]=[[x,y]]
c.append(y-x)
b=list(map(int,input().split()))
if sorted(b)!=sorted(c):
print("NO")
else:
print("YES")
for i in range(N):
print("{} {}".format(a[b[i]][0][0],a[b[i]][0][1]))
a[b[i]]=a[b[i]][1:]
| Title: Wilbur and Points
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Wilbur is playing with a set of *n* points on the coordinate plane. All points have non-negative integer coordinates. Moreover, if some point (*x*, *y*) belongs to the set, then all points (*x*', *y*'), such that 0<=≤<=*x*'<=≤<=*x* and 0<=≤<=*y*'<=≤<=*y* also belong to this set.
Now Wilbur wants to number the points in the set he has, that is assign them distinct integer numbers from 1 to *n*. In order to make the numbering aesthetically pleasing, Wilbur imposes the condition that if some point (*x*, *y*) gets number *i*, then all (*x*',*y*') from the set, such that *x*'<=≥<=*x* and *y*'<=≥<=*y* must be assigned a number not less than *i*. For example, for a set of four points (0, 0), (0, 1), (1, 0) and (1, 1), there are two aesthetically pleasing numberings. One is 1, 2, 3, 4 and another one is 1, 3, 2, 4.
Wilbur's friend comes along and challenges Wilbur. For any point he defines it's special value as *s*(*x*,<=*y*)<==<=*y*<=-<=*x*. Now he gives Wilbur some *w*1, *w*2,..., *w**n*, and asks him to find an aesthetically pleasing numbering of the points in the set, such that the point that gets number *i* has it's special value equal to *w**i*, that is *s*(*x**i*,<=*y**i*)<==<=*y**i*<=-<=*x**i*<==<=*w**i*.
Now Wilbur asks you to help him with this challenge.
Input Specification:
The first line of the input consists of a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of points in the set Wilbur is playing with.
Next follow *n* lines with points descriptions. Each line contains two integers *x* and *y* (0<=≤<=*x*,<=*y*<=≤<=100<=000), that give one point in Wilbur's set. It's guaranteed that all points are distinct. Also, it is guaranteed that if some point (*x*, *y*) is present in the input, then all points (*x*', *y*'), such that 0<=≤<=*x*'<=≤<=*x* and 0<=≤<=*y*'<=≤<=*y*, are also present in the input.
The last line of the input contains *n* integers. The *i*-th of them is *w**i* (<=-<=100<=000<=≤<=*w**i*<=≤<=100<=000) — the required special value of the point that gets number *i* in any aesthetically pleasing numbering.
Output Specification:
If there exists an aesthetically pleasant numbering of points in the set, such that *s*(*x**i*,<=*y**i*)<==<=*y**i*<=-<=*x**i*<==<=*w**i*, then print "YES" on the first line of the output. Otherwise, print "NO".
If a solution exists, proceed output with *n* lines. On the *i*-th of these lines print the point of the set that gets number *i*. If there are multiple solutions, print any of them.
Demo Input:
['5\n2 0\n0 0\n1 0\n1 1\n0 1\n0 -1 -2 1 0\n', '3\n1 0\n0 0\n2 0\n0 1 2\n']
Demo Output:
['YES\n0 0\n1 0\n2 0\n0 1\n1 1\n', 'NO\n']
Note:
In the first sample, point (2, 0) gets number 3, point (0, 0) gets number one, point (1, 0) gets number 2, point (1, 1) gets number 5 and point (0, 1) gets number 4. One can easily check that this numbering is aesthetically pleasing and *y*<sub class="lower-index">*i*</sub> - *x*<sub class="lower-index">*i*</sub> = *w*<sub class="lower-index">*i*</sub>.
In the second sample, the special values of the points in the set are 0, - 1, and - 2 while the sequence that the friend gives to Wilbur is 0, 1, 2. Therefore, the answer does not exist. | ```python
N=int(input())
a={}
c=[]
for i in range(N):
x,y=tuple(map(int,input().split()))
if y-x in a:
a[y-x]+=[[x,y]]
else:
a[y-x]=[[x,y]]
c.append(y-x)
b=list(map(int,input().split()))
if sorted(b)!=sorted(c):
print("NO")
else:
print("YES")
for i in range(N):
print("{} {}".format(a[b[i]][0][0],a[b[i]][0][1]))
a[b[i]]=a[b[i]][1:]
``` | 0 |
|
234 | B | Reading | PROGRAMMING | 1,000 | [
"sortings"
] | null | null | Vasya is going to the Olympics in the city Ntown by train. The boy wants to read the textbook to prepare for the Olympics. He counted that he needed *k* hours for this. He also found that the light in the train changes every hour. The light is measured on a scale from 0 to 100, where 0 is very dark, and 100 is very light.
Vasya has a train lighting schedule for all *n* hours of the trip — *n* numbers from 0 to 100 each (the light level in the first hour, the second hour and so on). During each of those hours he will either read the whole time, or not read at all. He wants to choose *k* hours to read a book, not necessarily consecutive, so that the minimum level of light among the selected hours were maximum. Vasya is very excited before the upcoming contest, help him choose reading hours. | The first input line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*k*<=≤<=*n*) — the number of hours on the train and the number of hours to read, correspondingly. The second line contains *n* space-separated integers *a**i* (0<=≤<=*a**i*<=≤<=100), *a**i* is the light level at the *i*-th hour. | In the first output line print the minimum light level Vasya will read at. In the second line print *k* distinct space-separated integers *b*1,<=*b*2,<=...,<=*b**k*, — the indexes of hours Vasya will read at (1<=≤<=*b**i*<=≤<=*n*). The hours are indexed starting from 1. If there are multiple optimal solutions, print any of them. Print the numbers *b**i* in an arbitrary order. | [
"5 3\n20 10 30 40 10\n",
"6 5\n90 20 35 40 60 100\n"
] | [
"20\n1 3 4 \n",
"35\n1 3 4 5 6 \n"
] | In the first sample Vasya should read at the first hour (light 20), third hour (light 30) and at the fourth hour (light 40). The minimum light Vasya will have to read at is 20. | 0 | [
{
"input": "5 3\n20 10 30 40 10",
"output": "20\n1 3 4 "
},
{
"input": "6 5\n90 20 35 40 60 100",
"output": "35\n1 3 4 5 6 "
},
{
"input": "100 7\n85 66 9 91 50 46 61 12 55 65 95 1 25 97 95 4 59 59 52 34 94 30 60 11 68 36 17 84 87 68 72 87 46 99 24 66 75 77 75 2 19 3 33 19 7 20 22 3 71 29 88 63 89 47 7 52 47 55 87 77 9 81 44 13 30 43 66 74 9 42 9 72 97 61 9 94 92 29 18 7 92 68 76 43 35 71 54 49 77 50 77 68 57 24 84 73 32 85 24 37",
"output": "94\n11 14 15 21 34 73 76 "
},
{
"input": "1 1\n10",
"output": "10\n1 "
},
{
"input": "1 1\n86",
"output": "86\n1 "
},
{
"input": "100 79\n83 83 83 83 83 94 94 83 83 83 83 90 83 99 83 91 83 83 83 83 83 83 83 83 83 83 83 91 83 83 83 83 83 96 83 83 83 91 83 83 92 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 98 83 83 91 97 83 83 83 83 83 83 83 92 83 83 83 83 83 83 83 93 83 83 91 83 83 83 83 83 83 83 83 83 83 83 96 83 83 83 83 83",
"output": "83\n6 7 12 14 16 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "20 3\n17 76 98 17 55 17 17 99 65 17 17 17 17 52 17 17 69 88 17 17",
"output": "88\n3 8 18 "
},
{
"input": "15 1\n0 78 24 24 61 60 0 65 52 57 97 51 56 13 10",
"output": "97\n11 "
},
{
"input": "50 50\n59 40 52 0 65 49 3 58 57 22 86 37 55 72 11 3 30 30 20 64 44 45 12 48 96 96 39 14 8 53 40 37 8 58 97 16 96 48 30 89 66 19 31 50 23 80 67 16 11 7",
"output": "0\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 "
},
{
"input": "60 8\n59 12 34 86 57 65 42 24 62 18 94 92 43 29 95 33 73 3 69 18 36 18 34 97 85 65 74 25 26 70 46 31 57 73 78 89 95 77 94 71 38 23 30 97 69 97 76 43 76 31 38 50 13 16 55 85 47 5 71 4",
"output": "92\n11 12 15 24 37 39 44 46 "
},
{
"input": "70 5\n76 16 20 60 5 96 32 50 35 9 79 42 38 35 72 45 98 33 55 0 86 92 49 87 22 79 35 27 69 35 89 29 31 43 88 1 48 95 3 92 82 97 53 80 79 0 78 58 37 38 45 9 5 38 53 49 71 7 91 3 75 17 76 44 77 31 78 91 59 91",
"output": "92\n6 17 38 40 42 "
},
{
"input": "12 3\n18 64 98 27 36 27 65 43 39 41 69 47",
"output": "65\n3 7 11 "
},
{
"input": "15 13\n6 78 78 78 78 20 78 78 8 3 78 18 32 56 78",
"output": "8\n2 3 4 5 6 7 8 9 11 12 13 14 15 "
},
{
"input": "17 4\n75 52 24 74 70 24 24 53 24 48 24 0 67 47 24 24 6",
"output": "67\n1 4 5 13 "
},
{
"input": "14 2\n31 18 78 90 96 2 90 27 86 9 94 98 94 34",
"output": "96\n5 12 "
},
{
"input": "100 56\n56 64 54 22 46 0 51 27 8 10 5 26 68 37 51 53 4 64 82 23 38 89 97 20 23 31 7 95 55 27 33 23 95 6 64 69 27 54 36 4 96 61 68 26 46 10 61 53 32 19 28 62 7 32 86 84 12 88 92 51 53 23 80 7 36 46 48 29 12 98 72 99 16 0 94 22 83 23 12 37 29 13 93 16 53 21 8 37 67 33 33 67 35 72 3 97 46 30 9 57",
"output": "33\n1 2 3 5 7 13 14 15 16 18 19 21 22 23 28 29 33 35 36 38 39 41 42 43 45 47 48 52 55 56 58 59 60 61 63 65 66 67 70 71 72 75 77 80 83 85 88 89 90 91 92 93 94 96 97 100 "
},
{
"input": "90 41\n43 24 4 69 54 87 33 34 9 77 87 66 66 0 71 43 42 10 78 48 26 40 8 61 80 38 76 63 7 47 99 69 77 43 29 74 86 93 39 28 99 98 11 27 43 58 50 61 1 79 45 17 23 13 10 98 41 28 19 98 87 51 26 28 88 60 42 25 19 3 29 18 0 56 84 27 43 92 93 97 25 90 13 90 75 52 99 6 66 87",
"output": "52\n4 5 6 10 11 12 13 15 19 24 25 27 28 31 32 33 36 37 38 41 42 46 48 50 56 60 61 65 66 74 75 78 79 80 82 84 85 86 87 89 90 "
},
{
"input": "100 71\n29 56 85 57 40 89 93 81 92 38 81 41 18 9 89 21 81 6 95 94 38 11 90 38 6 81 61 43 81 12 36 35 33 10 81 49 59 37 81 61 95 34 43 20 94 88 57 81 42 81 50 24 85 81 1 90 33 8 59 87 17 52 91 54 81 98 28 11 24 51 95 31 98 29 5 81 91 52 41 81 7 9 81 81 13 81 3 81 10 0 37 47 62 50 81 81 81 94 93 38",
"output": "35\n2 3 4 5 6 7 8 9 10 11 12 15 17 19 20 21 23 24 26 27 28 29 31 32 35 36 37 38 39 40 41 43 45 46 47 48 49 50 51 53 54 56 59 60 62 63 64 65 66 70 71 73 76 77 78 79 80 83 84 86 88 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 55\n72 70 77 90 86 96 60 60 60 60 87 62 60 87 0 60 82 60 86 74 60 60 60 60 60 60 78 60 60 60 96 60 60 0 60 60 89 99 60 60 60 60 60 60 89 60 88 84 60 93 0 60 60 60 75 60 67 64 65 60 65 60 72 60 76 4 60 60 60 63 96 62 78 71 63 81 89 98 60 60 69 60 61 60 60 60 85 71 82 79 67 60 60 60 79 96 2 60 60 60",
"output": "60\n1 2 3 4 5 6 11 12 14 17 19 20 27 31 37 38 45 47 48 50 55 57 58 59 61 63 65 70 71 72 73 74 75 76 77 78 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 98 99 100 "
},
{
"input": "100 27\n25 87 25 25 77 78 25 73 91 25 25 70 84 25 61 75 82 25 25 25 25 65 25 25 82 63 93 25 93 75 25 25 25 89 98 25 25 72 70 25 72 25 25 25 70 25 25 98 90 25 25 25 25 25 91 25 78 71 63 69 25 25 25 63 25 25 75 94 25 25 25 25 25 97 25 78 66 87 25 89 25 25 73 85 25 91 72 25 25 80 25 70 25 96 25 25 25 25 25 25",
"output": "75\n2 5 6 9 13 16 17 25 27 29 30 34 35 48 49 55 57 67 68 74 76 78 80 84 86 90 94 "
},
{
"input": "100 99\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 50\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "2\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 100 "
},
{
"input": "100 51\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 99 100 "
},
{
"input": "100 75\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 45\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "2\n12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 100 "
},
{
"input": "2 2\n2 2",
"output": "2\n1 2 "
},
{
"input": "2 1\n2 1",
"output": "2\n1 "
},
{
"input": "2 1\n1 2",
"output": "2\n2 "
},
{
"input": "3 1\n1 2 0",
"output": "2\n2 "
},
{
"input": "3 2\n0 0 0",
"output": "0\n2 3 "
},
{
"input": "3 3\n0 1 0",
"output": "0\n1 2 3 "
},
{
"input": "3 2\n99 100 99",
"output": "99\n2 3 "
},
{
"input": "1 1\n0",
"output": "0\n1 "
},
{
"input": "4 1\n100 100 0 100",
"output": "100\n4 "
},
{
"input": "4 2\n0 1 0 1",
"output": "1\n2 4 "
},
{
"input": "10 3\n0 1 2 3 0 1 2 3 0 1",
"output": "2\n4 7 8 "
},
{
"input": "10 9\n0 1 0 1 100 100 1 0 1 0",
"output": "0\n2 3 4 5 6 7 8 9 10 "
},
{
"input": "7 7\n1 0 0 0 0 0 0",
"output": "0\n1 2 3 4 5 6 7 "
},
{
"input": "7 6\n0 0 0 0 0 0 1",
"output": "0\n2 3 4 5 6 7 "
},
{
"input": "7 1\n12 33 12 88 10 0 3",
"output": "88\n4 "
},
{
"input": "7 1\n0 1 1 1 1 1 1",
"output": "1\n7 "
},
{
"input": "7 6\n1 1 1 1 1 1 0",
"output": "1\n1 2 3 4 5 6 "
},
{
"input": "7 2\n1 0 1 1 1 1 1",
"output": "1\n6 7 "
},
{
"input": "8 4\n1 1 1 1 0 0 0 0",
"output": "1\n1 2 3 4 "
},
{
"input": "7 5\n1 1 1 2 0 0 0",
"output": "0\n1 2 3 4 7 "
}
] | 1,620,236,408 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 60 | 6,963,200 | input=open("input.txt","r")
output=open("output.txt","w")
x,y=map(int,F.readline().split())
awnserlist = []
z=list(map(int,F.readline().split()))
a=sorted(z)
a.reverse()
minimum = 71891789178921875126571562#I just need a big number
for c in range(n):
if len(awnserlist)== y:break
for d in range(x):
if z[d]==a[c]:
awnserlist.append(j+1)
if z[d]<e:
e= z[d]
break
f=(sorted((list(b))))
o.write(e)
o.write(f)
| Title: Reading
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya is going to the Olympics in the city Ntown by train. The boy wants to read the textbook to prepare for the Olympics. He counted that he needed *k* hours for this. He also found that the light in the train changes every hour. The light is measured on a scale from 0 to 100, where 0 is very dark, and 100 is very light.
Vasya has a train lighting schedule for all *n* hours of the trip — *n* numbers from 0 to 100 each (the light level in the first hour, the second hour and so on). During each of those hours he will either read the whole time, or not read at all. He wants to choose *k* hours to read a book, not necessarily consecutive, so that the minimum level of light among the selected hours were maximum. Vasya is very excited before the upcoming contest, help him choose reading hours.
Input Specification:
The first input line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*k*<=≤<=*n*) — the number of hours on the train and the number of hours to read, correspondingly. The second line contains *n* space-separated integers *a**i* (0<=≤<=*a**i*<=≤<=100), *a**i* is the light level at the *i*-th hour.
Output Specification:
In the first output line print the minimum light level Vasya will read at. In the second line print *k* distinct space-separated integers *b*1,<=*b*2,<=...,<=*b**k*, — the indexes of hours Vasya will read at (1<=≤<=*b**i*<=≤<=*n*). The hours are indexed starting from 1. If there are multiple optimal solutions, print any of them. Print the numbers *b**i* in an arbitrary order.
Demo Input:
['5 3\n20 10 30 40 10\n', '6 5\n90 20 35 40 60 100\n']
Demo Output:
['20\n1 3 4 \n', '35\n1 3 4 5 6 \n']
Note:
In the first sample Vasya should read at the first hour (light 20), third hour (light 30) and at the fourth hour (light 40). The minimum light Vasya will have to read at is 20. | ```python
input=open("input.txt","r")
output=open("output.txt","w")
x,y=map(int,F.readline().split())
awnserlist = []
z=list(map(int,F.readline().split()))
a=sorted(z)
a.reverse()
minimum = 71891789178921875126571562#I just need a big number
for c in range(n):
if len(awnserlist)== y:break
for d in range(x):
if z[d]==a[c]:
awnserlist.append(j+1)
if z[d]<e:
e= z[d]
break
f=(sorted((list(b))))
o.write(e)
o.write(f)
``` | -1 |
|
186 | A | Comparing Strings | PROGRAMMING | 1,100 | [
"implementation",
"strings"
] | null | null | Some dwarves that are finishing the StUDY (State University for Dwarven Youngsters) Bachelor courses, have been told "no genome, no degree". That means that all dwarves should write a thesis on genome. Dwarven genome is far from simple. It is represented by a string that consists of lowercase Latin letters.
Dwarf Misha has already chosen the subject for his thesis: determining by two dwarven genomes, whether they belong to the same race. Two dwarves belong to the same race if we can swap two characters in the first dwarf's genome and get the second dwarf's genome as a result. Help Dwarf Misha and find out whether two gnomes belong to the same race or not. | The first line contains the first dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The second line contains the second dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The number of letters in each genome doesn't exceed 105. It is guaranteed that the strings that correspond to the genomes are different. The given genomes may have different length. | Print "YES", if the dwarves belong to the same race. Otherwise, print "NO". | [
"ab\nba\n",
"aa\nab\n"
] | [
"YES\n",
"NO\n"
] | - First example: you can simply swap two letters in string "ab". So we get "ba". - Second example: we can't change string "aa" into string "ab", because "aa" does not contain letter "b". | 500 | [
{
"input": "ab\nba",
"output": "YES"
},
{
"input": "aa\nab",
"output": "NO"
},
{
"input": "a\nza",
"output": "NO"
},
{
"input": "vvea\nvvae",
"output": "YES"
},
{
"input": "rtfabanpc\natfabrnpc",
"output": "YES"
},
{
"input": "mt\ntm",
"output": "YES"
},
{
"input": "qxolmbkkt\naovlajmlf",
"output": "NO"
},
{
"input": "b\ng",
"output": "NO"
},
{
"input": "ab\naba",
"output": "NO"
},
{
"input": "ba\na",
"output": "NO"
},
{
"input": "a\nab",
"output": "NO"
},
{
"input": "a\naa",
"output": "NO"
},
{
"input": "a\nz",
"output": "NO"
},
{
"input": "aabb\nbbaa",
"output": "NO"
},
{
"input": "ab\nbd",
"output": "NO"
},
{
"input": "bac\ndae",
"output": "NO"
},
{
"input": "abc\nakl",
"output": "NO"
},
{
"input": "cb\naa",
"output": "NO"
},
{
"input": "abaab\naabba",
"output": "NO"
},
{
"input": "aab\naaa",
"output": "NO"
},
{
"input": "abcde\nedcba",
"output": "NO"
},
{
"input": "abab\nbaba",
"output": "NO"
},
{
"input": "ab\nbac",
"output": "NO"
},
{
"input": "abcd\naqcb",
"output": "NO"
},
{
"input": "abc\nbad",
"output": "NO"
},
{
"input": "ab\nca",
"output": "NO"
},
{
"input": "abc\nab",
"output": "NO"
},
{
"input": "ab\nbae",
"output": "NO"
},
{
"input": "aaaabcccca\naaaadccccb",
"output": "NO"
},
{
"input": "acaa\nabca",
"output": "NO"
},
{
"input": "aba\naab",
"output": "YES"
},
{
"input": "ah\nla",
"output": "NO"
},
{
"input": "aab\naa",
"output": "NO"
},
{
"input": "abab\nabcd",
"output": "NO"
},
{
"input": "ed\nab",
"output": "NO"
}
] | 1,589,021,081 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 6 | 278 | 20,172,800 | n = list(input())
m = list(input())
indp = None
indn =None
if len(n) == len(m):
for i in range(len(n)):
if n[i]!=m[i]:
if indp == None:
indp = i
else:
indn = i
n[indp], n[i] = n[i], n[indp]
if "".join(n) == "".join(m):
print("YES")
else:
print("NO")
if indn == None:
print("NO")
if indp == None:
print("YES")
else:
print("NO") | Title: Comparing Strings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Some dwarves that are finishing the StUDY (State University for Dwarven Youngsters) Bachelor courses, have been told "no genome, no degree". That means that all dwarves should write a thesis on genome. Dwarven genome is far from simple. It is represented by a string that consists of lowercase Latin letters.
Dwarf Misha has already chosen the subject for his thesis: determining by two dwarven genomes, whether they belong to the same race. Two dwarves belong to the same race if we can swap two characters in the first dwarf's genome and get the second dwarf's genome as a result. Help Dwarf Misha and find out whether two gnomes belong to the same race or not.
Input Specification:
The first line contains the first dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The second line contains the second dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The number of letters in each genome doesn't exceed 105. It is guaranteed that the strings that correspond to the genomes are different. The given genomes may have different length.
Output Specification:
Print "YES", if the dwarves belong to the same race. Otherwise, print "NO".
Demo Input:
['ab\nba\n', 'aa\nab\n']
Demo Output:
['YES\n', 'NO\n']
Note:
- First example: you can simply swap two letters in string "ab". So we get "ba". - Second example: we can't change string "aa" into string "ab", because "aa" does not contain letter "b". | ```python
n = list(input())
m = list(input())
indp = None
indn =None
if len(n) == len(m):
for i in range(len(n)):
if n[i]!=m[i]:
if indp == None:
indp = i
else:
indn = i
n[indp], n[i] = n[i], n[indp]
if "".join(n) == "".join(m):
print("YES")
else:
print("NO")
if indn == None:
print("NO")
if indp == None:
print("YES")
else:
print("NO")
``` | 0 |
|
499 | A | Watching a movie | PROGRAMMING | 1,000 | [
"greedy",
"implementation"
] | null | null | You have decided to watch the best moments of some movie. There are two buttons on your player:
1. Watch the current minute of the movie. By pressing this button, you watch the current minute of the movie and the player automatically proceeds to the next minute of the movie. 1. Skip exactly *x* minutes of the movie (*x* is some fixed positive integer). If the player is now at the *t*-th minute of the movie, then as a result of pressing this button, it proceeds to the minute (*t*<=+<=*x*).
Initially the movie is turned on in the player on the first minute, and you want to watch exactly *n* best moments of the movie, the *i*-th best moment starts at the *l**i*-th minute and ends at the *r**i*-th minute (more formally, the *i*-th best moment consists of minutes: *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i*).
Determine, what is the minimum number of minutes of the movie you have to watch if you want to watch all the best moments? | The first line contains two space-separated integers *n*, *x* (1<=≤<=*n*<=≤<=50, 1<=≤<=*x*<=≤<=105) — the number of the best moments of the movie and the value of *x* for the second button.
The following *n* lines contain the descriptions of the best moments of the movie, the *i*-th line of the description contains two integers separated by a space *l**i*, *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=105).
It is guaranteed that for all integers *i* from 2 to *n* the following condition holds: *r**i*<=-<=1<=<<=*l**i*. | Output a single number — the answer to the problem. | [
"2 3\n5 6\n10 12\n",
"1 1\n1 100000\n"
] | [
"6\n",
"100000\n"
] | In the first sample, the player was initially standing on the first minute. As the minutes from the 1-st to the 4-th one don't contain interesting moments, we press the second button. Now we can not press the second button and skip 3 more minutes, because some of them contain interesting moments. Therefore, we watch the movie from the 4-th to the 6-th minute, after that the current time is 7. Similarly, we again skip 3 minutes and then watch from the 10-th to the 12-th minute of the movie. In total, we watch 6 minutes of the movie.
In the second sample, the movie is very interesting, so you'll have to watch all 100000 minutes of the movie. | 500 | [
{
"input": "2 3\n5 6\n10 12",
"output": "6"
},
{
"input": "1 1\n1 100000",
"output": "100000"
},
{
"input": "10 1\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "53974"
},
{
"input": "10 3\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "53983"
},
{
"input": "10 10\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "54038"
},
{
"input": "10 1000\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "58728"
},
{
"input": "12 14\n2156 3497\n4784 7775\n14575 23857\n29211 30739\n31932 33447\n35902 36426\n47202 48772\n60522 63982\n68417 78537\n79445 86918\n90081 90629\n94325 95728",
"output": "41870"
},
{
"input": "12 17\n2156 3497\n4784 7775\n14575 23857\n29211 30739\n31932 33447\n35902 36426\n47202 48772\n60522 63982\n68417 78537\n79445 86918\n90081 90629\n94325 95728",
"output": "41872"
},
{
"input": "18 111\n1449 2156\n3497 4784\n7775 14575\n23857 24593\n29211 30739\n31932 33447\n35902 36426\n36991 38506\n39679 47202\n48772 60016\n60522 61868\n63340 63982\n68417 78537\n79445 86568\n86918 87940\n90081 90310\n90629 94325\n95728 96263",
"output": "58967"
},
{
"input": "1 1\n14575 60522",
"output": "45948"
},
{
"input": "1 10\n14575 60522",
"output": "45952"
},
{
"input": "2 10\n14575 36426\n60522 79445",
"output": "40785"
},
{
"input": "3 1\n14575 36426\n48772 60522\n79445 90081",
"output": "44240"
},
{
"input": "1 100000\n1 100000",
"output": "100000"
},
{
"input": "1 2\n2 100000",
"output": "100000"
},
{
"input": "1 3\n4 100000",
"output": "99997"
},
{
"input": "2 100\n5 6\n7 7",
"output": "7"
},
{
"input": "1 10000\n500 600",
"output": "600"
},
{
"input": "2 3\n1 3\n4 8",
"output": "8"
},
{
"input": "3 1\n1 2\n3 4\n6 7",
"output": "6"
},
{
"input": "1 1\n1 1",
"output": "1"
},
{
"input": "1 3\n5 6",
"output": "3"
},
{
"input": "1 5\n7 10",
"output": "5"
},
{
"input": "1 100\n5 6",
"output": "6"
},
{
"input": "1 2\n1 1",
"output": "1"
},
{
"input": "1 100000\n100000 100000",
"output": "100000"
},
{
"input": "2 3\n1 1\n5 6",
"output": "3"
}
] | 1,668,827,937 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 41 | 77 | 0 | n, m = list(map(int, input().split()))
count = 0
c = 1
l = []
for i in range(n):
l.append(list(map(int, input().split())))
for p in l:
a = p[0]
b = p[1]
count += (a-c) % m + (b-a) + 1
c = b + 1
print(count) | Title: Watching a movie
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have decided to watch the best moments of some movie. There are two buttons on your player:
1. Watch the current minute of the movie. By pressing this button, you watch the current minute of the movie and the player automatically proceeds to the next minute of the movie. 1. Skip exactly *x* minutes of the movie (*x* is some fixed positive integer). If the player is now at the *t*-th minute of the movie, then as a result of pressing this button, it proceeds to the minute (*t*<=+<=*x*).
Initially the movie is turned on in the player on the first minute, and you want to watch exactly *n* best moments of the movie, the *i*-th best moment starts at the *l**i*-th minute and ends at the *r**i*-th minute (more formally, the *i*-th best moment consists of minutes: *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i*).
Determine, what is the minimum number of minutes of the movie you have to watch if you want to watch all the best moments?
Input Specification:
The first line contains two space-separated integers *n*, *x* (1<=≤<=*n*<=≤<=50, 1<=≤<=*x*<=≤<=105) — the number of the best moments of the movie and the value of *x* for the second button.
The following *n* lines contain the descriptions of the best moments of the movie, the *i*-th line of the description contains two integers separated by a space *l**i*, *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=105).
It is guaranteed that for all integers *i* from 2 to *n* the following condition holds: *r**i*<=-<=1<=<<=*l**i*.
Output Specification:
Output a single number — the answer to the problem.
Demo Input:
['2 3\n5 6\n10 12\n', '1 1\n1 100000\n']
Demo Output:
['6\n', '100000\n']
Note:
In the first sample, the player was initially standing on the first minute. As the minutes from the 1-st to the 4-th one don't contain interesting moments, we press the second button. Now we can not press the second button and skip 3 more minutes, because some of them contain interesting moments. Therefore, we watch the movie from the 4-th to the 6-th minute, after that the current time is 7. Similarly, we again skip 3 minutes and then watch from the 10-th to the 12-th minute of the movie. In total, we watch 6 minutes of the movie.
In the second sample, the movie is very interesting, so you'll have to watch all 100000 minutes of the movie. | ```python
n, m = list(map(int, input().split()))
count = 0
c = 1
l = []
for i in range(n):
l.append(list(map(int, input().split())))
for p in l:
a = p[0]
b = p[1]
count += (a-c) % m + (b-a) + 1
c = b + 1
print(count)
``` | 3 |
|
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square. | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,683,617,257 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 31 | 0 | n = list(map(int, input().split(" ")))
if n[0] % n[2] == 0:
b = n[0] // n[0]
else:
b = n[0] // n[0] + 1
if n[1] % n[2] == 0:
c = n[1] // n[2]
else:
c = n[1] // n[2] + 1
so_vien = b * c
print(so_vien) | Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none | ```python
n = list(map(int, input().split(" ")))
if n[0] % n[2] == 0:
b = n[0] // n[0]
else:
b = n[0] // n[0] + 1
if n[1] % n[2] == 0:
c = n[1] // n[2]
else:
c = n[1] // n[2] + 1
so_vien = b * c
print(so_vien)
``` | 0 |
614 | A | Link/Cut Tree | PROGRAMMING | 1,500 | [
"brute force",
"implementation"
] | null | null | Programmer Rostislav got seriously interested in the Link/Cut Tree data structure, which is based on Splay trees. Specifically, he is now studying the *expose* procedure.
Unfortunately, Rostislav is unable to understand the definition of this procedure, so he decided to ask programmer Serezha to help him. Serezha agreed to help if Rostislav solves a simple task (and if he doesn't, then why would he need Splay trees anyway?)
Given integers *l*, *r* and *k*, you need to print all powers of number *k* within range from *l* to *r* inclusive. However, Rostislav doesn't want to spent time doing this, as he got interested in playing a network game called Agar with Gleb. Help him! | The first line of the input contains three space-separated integers *l*, *r* and *k* (1<=≤<=*l*<=≤<=*r*<=≤<=1018, 2<=≤<=*k*<=≤<=109). | Print all powers of number *k*, that lie within range from *l* to *r* in the increasing order. If there are no such numbers, print "-1" (without the quotes). | [
"1 10 2\n",
"2 4 5\n"
] | [
"1 2 4 8 ",
"-1"
] | Note to the first sample: numbers 2<sup class="upper-index">0</sup> = 1, 2<sup class="upper-index">1</sup> = 2, 2<sup class="upper-index">2</sup> = 4, 2<sup class="upper-index">3</sup> = 8 lie within the specified range. The number 2<sup class="upper-index">4</sup> = 16 is greater then 10, thus it shouldn't be printed. | 500 | [
{
"input": "1 10 2",
"output": "1 2 4 8 "
},
{
"input": "2 4 5",
"output": "-1"
},
{
"input": "18102 43332383920 28554",
"output": "28554 815330916 "
},
{
"input": "19562 31702689720 17701",
"output": "313325401 "
},
{
"input": "11729 55221128400 313",
"output": "97969 30664297 9597924961 "
},
{
"input": "5482 100347128000 342",
"output": "116964 40001688 13680577296 "
},
{
"input": "3680 37745933600 10",
"output": "10000 100000 1000000 10000000 100000000 1000000000 10000000000 "
},
{
"input": "17098 191120104800 43",
"output": "79507 3418801 147008443 6321363049 "
},
{
"input": "10462 418807699200 2",
"output": "16384 32768 65536 131072 262144 524288 1048576 2097152 4194304 8388608 16777216 33554432 67108864 134217728 268435456 536870912 1073741824 2147483648 4294967296 8589934592 17179869184 34359738368 68719476736 137438953472 274877906944 "
},
{
"input": "30061 641846400000 3",
"output": "59049 177147 531441 1594323 4782969 14348907 43046721 129140163 387420489 1162261467 3486784401 10460353203 31381059609 94143178827 282429536481 "
},
{
"input": "1 1000000000000000000 2",
"output": "1 2 4 8 16 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 131072 262144 524288 1048576 2097152 4194304 8388608 16777216 33554432 67108864 134217728 268435456 536870912 1073741824 2147483648 4294967296 8589934592 17179869184 34359738368 68719476736 137438953472 274877906944 549755813888 1099511627776 2199023255552 4398046511104 8796093022208 17592186044416 35184372088832 70368744177664 140737488355328 281474976710656 562949953421312 1125899906842624 2251799813685248 4503599627370496 900719925474099..."
},
{
"input": "32 2498039712000 4",
"output": "64 256 1024 4096 16384 65536 262144 1048576 4194304 16777216 67108864 268435456 1073741824 4294967296 17179869184 68719476736 274877906944 1099511627776 "
},
{
"input": "1 2576683920000 2",
"output": "1 2 4 8 16 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 131072 262144 524288 1048576 2097152 4194304 8388608 16777216 33554432 67108864 134217728 268435456 536870912 1073741824 2147483648 4294967296 8589934592 17179869184 34359738368 68719476736 137438953472 274877906944 549755813888 1099511627776 2199023255552 "
},
{
"input": "5 25 5",
"output": "5 25 "
},
{
"input": "1 90 90",
"output": "1 90 "
},
{
"input": "95 2200128528000 68",
"output": "4624 314432 21381376 1453933568 98867482624 "
},
{
"input": "64 426314644000 53",
"output": "2809 148877 7890481 418195493 22164361129 "
},
{
"input": "198765 198765 198765",
"output": "198765 "
},
{
"input": "42 2845016496000 12",
"output": "144 1728 20736 248832 2985984 35831808 429981696 5159780352 61917364224 743008370688 "
},
{
"input": "6 6 3",
"output": "-1"
},
{
"input": "1 10 11",
"output": "1 "
},
{
"input": "2 10 11",
"output": "-1"
},
{
"input": "87 160 41",
"output": "-1"
},
{
"input": "237171123124584251 923523399718980912 7150",
"output": "-1"
},
{
"input": "101021572000739548 453766043506276015 8898",
"output": "-1"
},
{
"input": "366070689449360724 928290634811046396 8230",
"output": "-1"
},
{
"input": "438133886369772308 942612870269666780 7193",
"output": "-1"
},
{
"input": "10 10 10",
"output": "10 "
},
{
"input": "16 16 256",
"output": "-1"
},
{
"input": "1 1000000000000000000 1000000000",
"output": "1 1000000000 1000000000000000000 "
},
{
"input": "1000000000000000000 1000000000000000000 1000000000",
"output": "1000000000000000000 "
},
{
"input": "1000000000 1000000000000000000 1000000000",
"output": "1000000000 1000000000000000000 "
},
{
"input": "1 1 4",
"output": "1 "
},
{
"input": "1 999999999999999999 1000000000",
"output": "1 1000000000 "
},
{
"input": "1 1000000000000000000 999999990",
"output": "1 999999990 999999980000000100 "
},
{
"input": "1 1000000000000000000 999999984",
"output": "1 999999984 999999968000000256 "
},
{
"input": "1 1000000000000000000 324325",
"output": "1 324325 105186705625 34114678301828125 "
},
{
"input": "1 1000000000000000000 999999523",
"output": "1 999999523 999999046000227529 "
},
{
"input": "1 243 3",
"output": "1 3 9 27 81 243 "
},
{
"input": "62769392426654367 567152589733560993 688813",
"output": "326816522793383797 "
},
{
"input": "1 1000000000000000000 690852001",
"output": "1 690852001 477276487285704001 "
},
{
"input": "1 1000000000000000000 918745157",
"output": "1 918745157 844092663510954649 "
},
{
"input": "1 1000000000000000000 131299843",
"output": "1 131299843 17239648771824649 "
},
{
"input": "2861381721051425 2861381721051425 1234",
"output": "-1"
}
] | 1,485,327,212 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 4,608,000 | #!/usr/bin/env python3
# -*- coding: UTF-8 -*-
import math
txt=input()
nums=txt.split(" ")
l=int(nums[0])
r=int(nums[1])
k=int(nums[2])
q=math.pow(k, math.floor(math.log10(l/k)))
if q<1:
q=1
while q<=l:
q=q*k
if q>=r:
print("-1", end="")
exit()
print("%d" % q, end="")
q=q*k
while q<r:
print(" %d" % q, end="")
q=q*k
| Title: Link/Cut Tree
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Programmer Rostislav got seriously interested in the Link/Cut Tree data structure, which is based on Splay trees. Specifically, he is now studying the *expose* procedure.
Unfortunately, Rostislav is unable to understand the definition of this procedure, so he decided to ask programmer Serezha to help him. Serezha agreed to help if Rostislav solves a simple task (and if he doesn't, then why would he need Splay trees anyway?)
Given integers *l*, *r* and *k*, you need to print all powers of number *k* within range from *l* to *r* inclusive. However, Rostislav doesn't want to spent time doing this, as he got interested in playing a network game called Agar with Gleb. Help him!
Input Specification:
The first line of the input contains three space-separated integers *l*, *r* and *k* (1<=≤<=*l*<=≤<=*r*<=≤<=1018, 2<=≤<=*k*<=≤<=109).
Output Specification:
Print all powers of number *k*, that lie within range from *l* to *r* in the increasing order. If there are no such numbers, print "-1" (without the quotes).
Demo Input:
['1 10 2\n', '2 4 5\n']
Demo Output:
['1 2 4 8 ', '-1']
Note:
Note to the first sample: numbers 2<sup class="upper-index">0</sup> = 1, 2<sup class="upper-index">1</sup> = 2, 2<sup class="upper-index">2</sup> = 4, 2<sup class="upper-index">3</sup> = 8 lie within the specified range. The number 2<sup class="upper-index">4</sup> = 16 is greater then 10, thus it shouldn't be printed. | ```python
#!/usr/bin/env python3
# -*- coding: UTF-8 -*-
import math
txt=input()
nums=txt.split(" ")
l=int(nums[0])
r=int(nums[1])
k=int(nums[2])
q=math.pow(k, math.floor(math.log10(l/k)))
if q<1:
q=1
while q<=l:
q=q*k
if q>=r:
print("-1", end="")
exit()
print("%d" % q, end="")
q=q*k
while q<r:
print(" %d" % q, end="")
q=q*k
``` | 0 |
|
16 | A | Flag | PROGRAMMING | 800 | [
"implementation"
] | A. Flag | 2 | 64 | According to a new ISO standard, a flag of every country should have a chequered field *n*<=×<=*m*, each square should be of one of 10 colours, and the flag should be «striped»: each horizontal row of the flag should contain squares of the same colour, and the colours of adjacent horizontal rows should be different. Berland's government asked you to find out whether their flag meets the new ISO standard. | The first line of the input contains numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100), *n* — the amount of rows, *m* — the amount of columns on the flag of Berland. Then there follows the description of the flag: each of the following *n* lines contain *m* characters. Each character is a digit between 0 and 9, and stands for the colour of the corresponding square. | Output YES, if the flag meets the new ISO standard, and NO otherwise. | [
"3 3\n000\n111\n222\n",
"3 3\n000\n000\n111\n",
"3 3\n000\n111\n002\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 0 | [
{
"input": "3 3\n000\n111\n222",
"output": "YES"
},
{
"input": "3 3\n000\n000\n111",
"output": "NO"
},
{
"input": "3 3\n000\n111\n002",
"output": "NO"
},
{
"input": "10 10\n2222222222\n5555555555\n0000000000\n4444444444\n1111111111\n3333333393\n3333333333\n5555555555\n0000000000\n8888888888",
"output": "NO"
},
{
"input": "10 13\n4442444444444\n8888888888888\n6666666666666\n0000000000000\n3333333333333\n4444444444444\n7777777777777\n8388888888888\n1111111111111\n5555555555555",
"output": "NO"
},
{
"input": "10 8\n33333333\n44444444\n11111115\n81888888\n44444444\n11111111\n66666666\n33330333\n33333333\n33333333",
"output": "NO"
},
{
"input": "5 5\n88888\n44444\n66666\n55555\n88888",
"output": "YES"
},
{
"input": "20 19\n1111111111111111111\n5555555555555555555\n0000000000000000000\n3333333333333333333\n1111111111111111111\n2222222222222222222\n4444444444444444444\n5555555555555555555\n0000000000000000000\n4444444444444444444\n0000000000000000000\n5555555555555555555\n7777777777777777777\n9999999999999999999\n2222222222222222222\n4444444444444444444\n1111111111111111111\n6666666666666666666\n7777777777777777777\n2222222222222222222",
"output": "YES"
},
{
"input": "1 100\n8888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888",
"output": "YES"
},
{
"input": "100 1\n5\n7\n9\n4\n7\n2\n5\n1\n6\n7\n2\n7\n6\n8\n7\n4\n0\n2\n9\n8\n9\n1\n6\n4\n3\n4\n7\n1\n9\n3\n0\n8\n3\n1\n7\n5\n3\n9\n5\n1\n3\n5\n8\n1\n9\n3\n9\n0\n6\n0\n7\n6\n5\n2\n8\n3\n7\n6\n5\n1\n8\n3\n6\n9\n6\n0\n5\n8\n5\n2\n9\n1\n0\n1\n8\n3\n2\n1\n0\n3\n9\n0\n5\n1\n0\n4\n9\n3\n0\n4\n8\n4\n8\n6\n3\n0\n4\n6\n8\n4",
"output": "YES"
},
{
"input": "1 1\n2",
"output": "YES"
},
{
"input": "1 100\n1111111111111111111111111111111111111111111111111111111111111111111111111111181111111111111111111111",
"output": "NO"
},
{
"input": "100 1\n3\n6\n4\n3\n0\n2\n8\n7\n3\n2\n1\n7\n1\n3\n2\n3\n6\n9\n0\n8\n5\n9\n7\n9\n2\n1\n4\n5\n1\n9\n2\n5\n1\n4\n6\n4\n9\n1\n0\n2\n1\n4\n7\n1\n4\n8\n0\n9\n2\n1\n6\n2\n8\n6\n9\n5\n8\n6\n4\n5\n9\n2\n7\n4\n1\n5\n8\n0\n9\n5\n4\n6\n5\n0\n6\n3\n6\n9\n7\n2\n0\n9\n7\n3\n2\n4\n9\n4\n7\n1\n2\n3\n1\n7\n9\n1\n9\n0\n4\n0",
"output": "YES"
}
] | 1,591,862,935 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 218 | 307,200 | n , m = map(int,input().split())
l = []
flag = 0
for i in range(n):
s = input()
if len(set(s))!=1:
flag = 1
print("NO")
break
if flag==1:
break
else:
l.append(s)
for k in range(1,len(l)):
if l[k-1]==l[k]:
print("NO")
flag = 1
break
if flag==1:
break
if flag==0:
print("YES") | Title: Flag
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
According to a new ISO standard, a flag of every country should have a chequered field *n*<=×<=*m*, each square should be of one of 10 colours, and the flag should be «striped»: each horizontal row of the flag should contain squares of the same colour, and the colours of adjacent horizontal rows should be different. Berland's government asked you to find out whether their flag meets the new ISO standard.
Input Specification:
The first line of the input contains numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100), *n* — the amount of rows, *m* — the amount of columns on the flag of Berland. Then there follows the description of the flag: each of the following *n* lines contain *m* characters. Each character is a digit between 0 and 9, and stands for the colour of the corresponding square.
Output Specification:
Output YES, if the flag meets the new ISO standard, and NO otherwise.
Demo Input:
['3 3\n000\n111\n222\n', '3 3\n000\n000\n111\n', '3 3\n000\n111\n002\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none | ```python
n , m = map(int,input().split())
l = []
flag = 0
for i in range(n):
s = input()
if len(set(s))!=1:
flag = 1
print("NO")
break
if flag==1:
break
else:
l.append(s)
for k in range(1,len(l)):
if l[k-1]==l[k]:
print("NO")
flag = 1
break
if flag==1:
break
if flag==0:
print("YES")
``` | 3.943211 |
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions. | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,656,635,196 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 2 | 156 | 0 | board = list(map(int,input().split()))
m =board[0]
n =board[1]
an = int (n/2)
if (m%2 == 0):
am = int (m/2)
print (am*n)
elif(m%2 != 0 and m%2 >= 1):
am = m + an
print(am) | Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none | ```python
board = list(map(int,input().split()))
m =board[0]
n =board[1]
an = int (n/2)
if (m%2 == 0):
am = int (m/2)
print (am*n)
elif(m%2 != 0 and m%2 >= 1):
am = m + an
print(am)
``` | 0 |
228 | A | Is your horseshoe on the other hoof? | PROGRAMMING | 800 | [
"implementation"
] | null | null | Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party. | The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers. | Print a single integer — the minimum number of horseshoes Valera needs to buy. | [
"1 7 3 3\n",
"7 7 7 7\n"
] | [
"1\n",
"3\n"
] | none | 500 | [
{
"input": "1 7 3 3",
"output": "1"
},
{
"input": "7 7 7 7",
"output": "3"
},
{
"input": "81170865 673572653 756938629 995577259",
"output": "0"
},
{
"input": "3491663 217797045 522540872 715355328",
"output": "0"
},
{
"input": "251590420 586975278 916631563 586975278",
"output": "1"
},
{
"input": "259504825 377489979 588153796 377489979",
"output": "1"
},
{
"input": "652588203 931100304 931100304 652588203",
"output": "2"
},
{
"input": "391958720 651507265 391958720 651507265",
"output": "2"
},
{
"input": "90793237 90793237 90793237 90793237",
"output": "3"
},
{
"input": "551651653 551651653 551651653 551651653",
"output": "3"
},
{
"input": "156630260 609654355 668943582 973622757",
"output": "0"
},
{
"input": "17061017 110313588 434481173 796661222",
"output": "0"
},
{
"input": "24975422 256716298 337790533 690960249",
"output": "0"
},
{
"input": "255635360 732742923 798648949 883146723",
"output": "0"
},
{
"input": "133315691 265159773 734556507 265159773",
"output": "1"
},
{
"input": "28442865 741657755 978106882 978106882",
"output": "1"
},
{
"input": "131245479 174845575 497483467 131245479",
"output": "1"
},
{
"input": "139159884 616215581 958341883 616215581",
"output": "1"
},
{
"input": "147784432 947653080 947653080 947653080",
"output": "2"
},
{
"input": "94055790 756126496 756126496 94055790",
"output": "2"
},
{
"input": "240458500 511952208 240458500 511952208",
"output": "2"
},
{
"input": "681828506 972810624 972810624 681828506",
"output": "2"
},
{
"input": "454961014 454961014 454961014 454961014",
"output": "3"
},
{
"input": "915819430 915819430 915819430 915819430",
"output": "3"
},
{
"input": "671645142 671645142 671645142 671645142",
"output": "3"
},
{
"input": "132503558 132503558 132503558 132503558",
"output": "3"
},
{
"input": "5 5 999999 6",
"output": "1"
},
{
"input": "1 1 2 5",
"output": "1"
},
{
"input": "2 1 2 3",
"output": "1"
},
{
"input": "1 1 3 5",
"output": "1"
},
{
"input": "1 1 3 3",
"output": "2"
},
{
"input": "2 2 2 1",
"output": "2"
},
{
"input": "3 1 1 1",
"output": "2"
},
{
"input": "1 2 2 2",
"output": "2"
}
] | 1,693,127,134 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 92 | 0 | s = list(map(int,input().split()))
x=0
for i in range(3):
if s[i] == s[i+1]:
x+=1
print(x)
| Title: Is your horseshoe on the other hoof?
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
Input Specification:
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
Output Specification:
Print a single integer — the minimum number of horseshoes Valera needs to buy.
Demo Input:
['1 7 3 3\n', '7 7 7 7\n']
Demo Output:
['1\n', '3\n']
Note:
none | ```python
s = list(map(int,input().split()))
x=0
for i in range(3):
if s[i] == s[i+1]:
x+=1
print(x)
``` | 0 |
|
496 | A | Minimum Difficulty | PROGRAMMING | 900 | [
"brute force",
"implementation",
"math"
] | null | null | Mike is trying rock climbing but he is awful at it.
There are *n* holds on the wall, *i*-th hold is at height *a**i* off the ground. Besides, let the sequence *a**i* increase, that is, *a**i*<=<<=*a**i*<=+<=1 for all *i* from 1 to *n*<=-<=1; we will call such sequence a track. Mike thinks that the track *a*1, ..., *a**n* has difficulty . In other words, difficulty equals the maximum distance between two holds that are adjacent in height.
Today Mike decided to cover the track with holds hanging on heights *a*1, ..., *a**n*. To make the problem harder, Mike decided to remove one hold, that is, remove one element of the sequence (for example, if we take the sequence (1,<=2,<=3,<=4,<=5) and remove the third element from it, we obtain the sequence (1,<=2,<=4,<=5)). However, as Mike is awful at climbing, he wants the final difficulty (i.e. the maximum difference of heights between adjacent holds after removing the hold) to be as small as possible among all possible options of removing a hold. The first and last holds must stay at their positions.
Help Mike determine the minimum difficulty of the track after removing one hold. | The first line contains a single integer *n* (3<=≤<=*n*<=≤<=100) — the number of holds.
The next line contains *n* space-separated integers *a**i* (1<=≤<=*a**i*<=≤<=1000), where *a**i* is the height where the hold number *i* hangs. The sequence *a**i* is increasing (i.e. each element except for the first one is strictly larger than the previous one). | Print a single number — the minimum difficulty of the track after removing a single hold. | [
"3\n1 4 6\n",
"5\n1 2 3 4 5\n",
"5\n1 2 3 7 8\n"
] | [
"5\n",
"2\n",
"4\n"
] | In the first sample you can remove only the second hold, then the sequence looks like (1, 6), the maximum difference of the neighboring elements equals 5.
In the second test after removing every hold the difficulty equals 2.
In the third test you can obtain sequences (1, 3, 7, 8), (1, 2, 7, 8), (1, 2, 3, 8), for which the difficulty is 4, 5 and 5, respectively. Thus, after removing the second element we obtain the optimal answer — 4. | 500 | [
{
"input": "3\n1 4 6",
"output": "5"
},
{
"input": "5\n1 2 3 4 5",
"output": "2"
},
{
"input": "5\n1 2 3 7 8",
"output": "4"
},
{
"input": "3\n1 500 1000",
"output": "999"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "2"
},
{
"input": "10\n1 4 9 16 25 36 49 64 81 100",
"output": "19"
},
{
"input": "10\n300 315 325 338 350 365 379 391 404 416",
"output": "23"
},
{
"input": "15\n87 89 91 92 93 95 97 99 101 103 105 107 109 111 112",
"output": "2"
},
{
"input": "60\n3 5 7 8 15 16 18 21 24 26 40 41 43 47 48 49 50 51 52 54 55 60 62 71 74 84 85 89 91 96 406 407 409 412 417 420 423 424 428 431 432 433 436 441 445 446 447 455 458 467 469 471 472 475 480 485 492 493 497 500",
"output": "310"
},
{
"input": "3\n159 282 405",
"output": "246"
},
{
"input": "81\n6 7 22 23 27 38 40 56 59 71 72 78 80 83 86 92 95 96 101 122 125 127 130 134 154 169 170 171 172 174 177 182 184 187 195 197 210 211 217 223 241 249 252 253 256 261 265 269 274 277 291 292 297 298 299 300 302 318 338 348 351 353 381 386 387 397 409 410 419 420 428 430 453 460 461 473 478 493 494 500 741",
"output": "241"
},
{
"input": "10\n218 300 388 448 535 629 680 740 836 925",
"output": "111"
},
{
"input": "100\n6 16 26 36 46 56 66 76 86 96 106 116 126 136 146 156 166 176 186 196 206 216 226 236 246 256 266 276 286 296 306 316 326 336 346 356 366 376 386 396 406 416 426 436 446 456 466 476 486 496 506 516 526 536 546 556 566 576 586 596 606 616 626 636 646 656 666 676 686 696 706 716 726 736 746 756 766 776 786 796 806 816 826 836 846 856 866 876 886 896 906 916 926 936 946 956 966 976 986 996",
"output": "20"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000",
"output": "901"
},
{
"input": "100\n1 9 15 17 28 29 30 31 32 46 48 49 52 56 62 77 82 85 90 91 94 101 102 109 111 113 116 118 124 125 131 132 136 138 139 143 145 158 161 162 165 167 171 173 175 177 179 183 189 196 801 802 804 806 817 819 827 830 837 840 842 846 850 855 858 862 863 866 869 870 878 881 883 884 896 898 899 901 904 906 908 909 910 911 912 917 923 924 925 935 939 943 945 956 963 964 965 972 976 978",
"output": "605"
},
{
"input": "100\n2 43 47 49 50 57 59 67 74 98 901 903 904 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 938 939 940 942 943 944 945 946 947 948 949 950 952 953 954 956 957 958 959 960 961 962 963 965 966 967 968 969 970 971 972 973 974 975 976 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 998 999",
"output": "803"
},
{
"input": "72\n178 186 196 209 217 226 236 248 260 273 281 291 300 309 322 331 343 357 366 377 389 399 409 419 429 442 450 459 469 477 491 501 512 524 534 548 557 568 582 593 602 616 630 643 652 660 670 679 693 707 715 728 737 750 759 768 776 789 797 807 815 827 837 849 863 873 881 890 901 910 920 932",
"output": "17"
},
{
"input": "38\n1 28 55 82 109 136 163 190 217 244 271 298 325 352 379 406 433 460 487 514 541 568 595 622 649 676 703 730 757 784 811 838 865 892 919 946 973 1000",
"output": "54"
},
{
"input": "28\n1 38 75 112 149 186 223 260 297 334 371 408 445 482 519 556 593 630 667 704 741 778 815 852 889 926 963 1000",
"output": "74"
}
] | 1,512,703,685 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 5,529,600 | n = int(input())
a = list(map(int,input().split()))
if(n==3):
print(a[2]-a[0])
else:
large = 0
small = a[3]-a[1]
index = 2
for i in range (3,n-1):
large = a[i]-a[i-2]
if large < small:
small = large
index = i-1
a.pop(index)
print(max(a[i]-a[i-1] for i in range (1,n-1))) | Title: Minimum Difficulty
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mike is trying rock climbing but he is awful at it.
There are *n* holds on the wall, *i*-th hold is at height *a**i* off the ground. Besides, let the sequence *a**i* increase, that is, *a**i*<=<<=*a**i*<=+<=1 for all *i* from 1 to *n*<=-<=1; we will call such sequence a track. Mike thinks that the track *a*1, ..., *a**n* has difficulty . In other words, difficulty equals the maximum distance between two holds that are adjacent in height.
Today Mike decided to cover the track with holds hanging on heights *a*1, ..., *a**n*. To make the problem harder, Mike decided to remove one hold, that is, remove one element of the sequence (for example, if we take the sequence (1,<=2,<=3,<=4,<=5) and remove the third element from it, we obtain the sequence (1,<=2,<=4,<=5)). However, as Mike is awful at climbing, he wants the final difficulty (i.e. the maximum difference of heights between adjacent holds after removing the hold) to be as small as possible among all possible options of removing a hold. The first and last holds must stay at their positions.
Help Mike determine the minimum difficulty of the track after removing one hold.
Input Specification:
The first line contains a single integer *n* (3<=≤<=*n*<=≤<=100) — the number of holds.
The next line contains *n* space-separated integers *a**i* (1<=≤<=*a**i*<=≤<=1000), where *a**i* is the height where the hold number *i* hangs. The sequence *a**i* is increasing (i.e. each element except for the first one is strictly larger than the previous one).
Output Specification:
Print a single number — the minimum difficulty of the track after removing a single hold.
Demo Input:
['3\n1 4 6\n', '5\n1 2 3 4 5\n', '5\n1 2 3 7 8\n']
Demo Output:
['5\n', '2\n', '4\n']
Note:
In the first sample you can remove only the second hold, then the sequence looks like (1, 6), the maximum difference of the neighboring elements equals 5.
In the second test after removing every hold the difficulty equals 2.
In the third test you can obtain sequences (1, 3, 7, 8), (1, 2, 7, 8), (1, 2, 3, 8), for which the difficulty is 4, 5 and 5, respectively. Thus, after removing the second element we obtain the optimal answer — 4. | ```python
n = int(input())
a = list(map(int,input().split()))
if(n==3):
print(a[2]-a[0])
else:
large = 0
small = a[3]-a[1]
index = 2
for i in range (3,n-1):
large = a[i]-a[i-2]
if large < small:
small = large
index = i-1
a.pop(index)
print(max(a[i]-a[i-1] for i in range (1,n-1)))
``` | 0 |
|
363 | B | Fence | PROGRAMMING | 1,100 | [
"brute force",
"dp"
] | null | null | There is a fence in front of Polycarpus's home. The fence consists of *n* planks of the same width which go one after another from left to right. The height of the *i*-th plank is *h**i* meters, distinct planks can have distinct heights.
Polycarpus has bought a posh piano and is thinking about how to get it into the house. In order to carry out his plan, he needs to take exactly *k* consecutive planks from the fence. Higher planks are harder to tear off the fence, so Polycarpus wants to find such *k* consecutive planks that the sum of their heights is minimal possible.
Write the program that finds the indexes of *k* consecutive planks with minimal total height. Pay attention, the fence is not around Polycarpus's home, it is in front of home (in other words, the fence isn't cyclic). | The first line of the input contains integers *n* and *k* (1<=≤<=*n*<=≤<=1.5·105,<=1<=≤<=*k*<=≤<=*n*) — the number of planks in the fence and the width of the hole for the piano. The second line contains the sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≤<=*h**i*<=≤<=100), where *h**i* is the height of the *i*-th plank of the fence. | Print such integer *j* that the sum of the heights of planks *j*, *j*<=+<=1, ..., *j*<=+<=*k*<=-<=1 is the minimum possible. If there are multiple such *j*'s, print any of them. | [
"7 3\n1 2 6 1 1 7 1\n"
] | [
"3\n"
] | In the sample, your task is to find three consecutive planks with the minimum sum of heights. In the given case three planks with indexes 3, 4 and 5 have the required attribute, their total height is 8. | 1,000 | [
{
"input": "7 3\n1 2 6 1 1 7 1",
"output": "3"
},
{
"input": "1 1\n100",
"output": "1"
},
{
"input": "2 1\n10 20",
"output": "1"
},
{
"input": "10 5\n1 2 3 1 2 2 3 1 4 5",
"output": "1"
},
{
"input": "10 2\n3 1 4 1 4 6 2 1 4 6",
"output": "7"
},
{
"input": "2 2\n20 10",
"output": "1"
},
{
"input": "2 1\n20 1",
"output": "2"
},
{
"input": "3 1\n1 2 3",
"output": "1"
},
{
"input": "3 1\n2 1 3",
"output": "2"
},
{
"input": "3 1\n3 2 1",
"output": "3"
},
{
"input": "3 2\n1 2 3",
"output": "1"
},
{
"input": "3 2\n3 2 1",
"output": "2"
},
{
"input": "3 3\n1 2 3",
"output": "1"
},
{
"input": "4 2\n9 8 11 7",
"output": "1"
},
{
"input": "4 2\n10 1 2 3",
"output": "2"
},
{
"input": "6 3\n56 56 56 2 1 2",
"output": "4"
},
{
"input": "8 3\n1 1 1 1 2 60 90 1",
"output": "1"
},
{
"input": "4 1\n1 5 2 2",
"output": "1"
},
{
"input": "4 2\n4 6 7 4",
"output": "1"
},
{
"input": "10 4\n1 1 1 4 4 4 4 4 4 3",
"output": "1"
},
{
"input": "6 3\n1 2 1 3 1 1",
"output": "1"
},
{
"input": "5 2\n100 100 100 1 1",
"output": "4"
}
] | 1,672,103,713 | 2,147,483,647 | Python 3 | OK | TESTS | 51 | 93 | 8,499,200 | def fence(data, k):
prev=sum(data[:k])
index=1
total=prev
for i in range(k,len(data)):
total-=data[i-k]
total+=data[i]
if total<prev:
prev=total
index=i-k+2
return index
def main():
n, k = list(map(int, input().split()))
data = list(map(int, input().split()))
print(fence(data,k))
if __name__ == "__main__":
main()
| Title: Fence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a fence in front of Polycarpus's home. The fence consists of *n* planks of the same width which go one after another from left to right. The height of the *i*-th plank is *h**i* meters, distinct planks can have distinct heights.
Polycarpus has bought a posh piano and is thinking about how to get it into the house. In order to carry out his plan, he needs to take exactly *k* consecutive planks from the fence. Higher planks are harder to tear off the fence, so Polycarpus wants to find such *k* consecutive planks that the sum of their heights is minimal possible.
Write the program that finds the indexes of *k* consecutive planks with minimal total height. Pay attention, the fence is not around Polycarpus's home, it is in front of home (in other words, the fence isn't cyclic).
Input Specification:
The first line of the input contains integers *n* and *k* (1<=≤<=*n*<=≤<=1.5·105,<=1<=≤<=*k*<=≤<=*n*) — the number of planks in the fence and the width of the hole for the piano. The second line contains the sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≤<=*h**i*<=≤<=100), where *h**i* is the height of the *i*-th plank of the fence.
Output Specification:
Print such integer *j* that the sum of the heights of planks *j*, *j*<=+<=1, ..., *j*<=+<=*k*<=-<=1 is the minimum possible. If there are multiple such *j*'s, print any of them.
Demo Input:
['7 3\n1 2 6 1 1 7 1\n']
Demo Output:
['3\n']
Note:
In the sample, your task is to find three consecutive planks with the minimum sum of heights. In the given case three planks with indexes 3, 4 and 5 have the required attribute, their total height is 8. | ```python
def fence(data, k):
prev=sum(data[:k])
index=1
total=prev
for i in range(k,len(data)):
total-=data[i-k]
total+=data[i]
if total<prev:
prev=total
index=i-k+2
return index
def main():
n, k = list(map(int, input().split()))
data = list(map(int, input().split()))
print(fence(data,k))
if __name__ == "__main__":
main()
``` | 3 |
|
844 | A | Diversity | PROGRAMMING | 1,000 | [
"greedy",
"implementation",
"strings"
] | null | null | Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too. | First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26). | Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible. | [
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] | [
"0\n",
"1\n",
"impossible\n"
] | In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6. | 500 | [
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,683,830,879 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 11 | 31 | 0 | from sys import stdin
from math import ceil
rd = stdin.readline
s = rd().strip()
k = int(rd())
if k > len(s): print("impossible")
else:
print(k - len(set(s)))
| Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6. | ```python
from sys import stdin
from math import ceil
rd = stdin.readline
s = rd().strip()
k = int(rd())
if k > len(s): print("impossible")
else:
print(k - len(set(s)))
``` | 0 |
|
121 | A | Lucky Sum | PROGRAMMING | 1,100 | [
"implementation"
] | null | null | Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Let *next*(*x*) be the minimum lucky number which is larger than or equals *x*. Petya is interested what is the value of the expression *next*(*l*)<=+<=*next*(*l*<=+<=1)<=+<=...<=+<=*next*(*r*<=-<=1)<=+<=*next*(*r*). Help him solve this problem. | The single line contains two integers *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=109) — the left and right interval limits. | In the single line print the only number — the sum *next*(*l*)<=+<=*next*(*l*<=+<=1)<=+<=...<=+<=*next*(*r*<=-<=1)<=+<=*next*(*r*).
Please do not use the %lld specificator to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specificator. | [
"2 7\n",
"7 7\n"
] | [
"33\n",
"7\n"
] | In the first sample: *next*(2) + *next*(3) + *next*(4) + *next*(5) + *next*(6) + *next*(7) = 4 + 4 + 4 + 7 + 7 + 7 = 33
In the second sample: *next*(7) = 7 | 500 | [
{
"input": "2 7",
"output": "33"
},
{
"input": "7 7",
"output": "7"
},
{
"input": "1 9",
"output": "125"
},
{
"input": "4 7",
"output": "25"
},
{
"input": "12 47",
"output": "1593"
},
{
"input": "6 77",
"output": "4012"
},
{
"input": "1 100",
"output": "14247"
},
{
"input": "1000000000 1000000000",
"output": "4444444444"
},
{
"input": "77 77",
"output": "77"
},
{
"input": "69 788",
"output": "452195"
},
{
"input": "474 747",
"output": "202794"
},
{
"input": "4 77777",
"output": "4070145675"
},
{
"input": "1 1000000",
"output": "1394675359387"
},
{
"input": "47 744447",
"output": "381286992761"
},
{
"input": "47444 1000000000",
"output": "1394672348253941136"
},
{
"input": "48 854888",
"output": "749733199853"
},
{
"input": "854444 985555",
"output": "582719941728"
},
{
"input": "774744 774747",
"output": "3098985"
},
{
"input": "654 987654",
"output": "1339803940266"
},
{
"input": "477777 1000000000",
"output": "1394672167300009765"
},
{
"input": "77777 777777777",
"output": "407018021649898097"
},
{
"input": "963 85555574",
"output": "7526978888069560"
},
{
"input": "47 7444",
"output": "38125896"
},
{
"input": "1 1000000000",
"output": "1394672350065645019"
},
{
"input": "474 999888555",
"output": "1394177038954402791"
},
{
"input": "777 1000000000",
"output": "1394672350065239125"
},
{
"input": "7 777777774",
"output": "407018023386632646"
},
{
"input": "369 852",
"output": "606732"
},
{
"input": "47 47",
"output": "47"
},
{
"input": "747 748",
"output": "1521"
},
{
"input": "77777440 77777444",
"output": "388887220"
},
{
"input": "987545885 999875584",
"output": "54798666661186800"
},
{
"input": "2 777777776",
"output": "407018024942188226"
},
{
"input": "1 1",
"output": "4"
},
{
"input": "1 2",
"output": "8"
},
{
"input": "999999999 1000000000",
"output": "8888888888"
},
{
"input": "777777777 1000000000",
"output": "987654325123456789"
},
{
"input": "777777778 1000000000",
"output": "987654324345679012"
},
{
"input": "5 6",
"output": "14"
},
{
"input": "49 49",
"output": "74"
},
{
"input": "6 6",
"output": "7"
},
{
"input": "3 4",
"output": "8"
}
] | 1,635,135,319 | 2,147,483,647 | PyPy 3 | OK | TESTS | 42 | 93 | 20,787,200 | # Author Name: Ajay Meena
# Codeforce : https://codeforces.com/profile/majay1638
import sys
import math
import bisect
import heapq
from bisect import bisect_right
from sys import stdin, stdout
# -------------- INPUT FUNCTIONS ------------------
def get_ints_in_variables(): return map(
int, sys.stdin.readline().strip().split())
def get_int(): return int(sys.stdin.readline())
def get_ints_in_list(): return list(
map(int, sys.stdin.readline().strip().split()))
def get_list_of_list(n): return [list(
map(int, sys.stdin.readline().strip().split())) for _ in range(n)]
def get_string(): return sys.stdin.readline().strip()
# -------- SOME CUSTOMIZED FUNCTIONS-----------
def myceil(x, y): return (x + y - 1) // y
# -------------- SOLUTION FUNCTION ------------------
def luckyNumbers(n, r, lucky_nums):
lucky_nums.append(n)
if n > r*10:
return
luckyNumbers((10*n)+4, r, lucky_nums)
luckyNumbers((10*n)+7, r, lucky_nums)
def helper(n, res):
ans = 0
for i in range(1, len(res)):
ans += (res[i]*(min(res[i], n)-min(res[i-1], n)))
return ans
def Solution(l, r):
# Write Your Code Here
luckyNums = []
luckyNumbers(0, r, luckyNums)
luckyNums = sorted(luckyNums)
# print(luckyNums)
print(helper(r, luckyNums)-helper(l-1, luckyNums))
def main():
# Take input Here and Call solution function
l, r = get_ints_in_variables()
Solution(l, r)
# calling main Function
if __name__ == '__main__':
main()
| Title: Lucky Sum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Let *next*(*x*) be the minimum lucky number which is larger than or equals *x*. Petya is interested what is the value of the expression *next*(*l*)<=+<=*next*(*l*<=+<=1)<=+<=...<=+<=*next*(*r*<=-<=1)<=+<=*next*(*r*). Help him solve this problem.
Input Specification:
The single line contains two integers *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=109) — the left and right interval limits.
Output Specification:
In the single line print the only number — the sum *next*(*l*)<=+<=*next*(*l*<=+<=1)<=+<=...<=+<=*next*(*r*<=-<=1)<=+<=*next*(*r*).
Please do not use the %lld specificator to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specificator.
Demo Input:
['2 7\n', '7 7\n']
Demo Output:
['33\n', '7\n']
Note:
In the first sample: *next*(2) + *next*(3) + *next*(4) + *next*(5) + *next*(6) + *next*(7) = 4 + 4 + 4 + 7 + 7 + 7 = 33
In the second sample: *next*(7) = 7 | ```python
# Author Name: Ajay Meena
# Codeforce : https://codeforces.com/profile/majay1638
import sys
import math
import bisect
import heapq
from bisect import bisect_right
from sys import stdin, stdout
# -------------- INPUT FUNCTIONS ------------------
def get_ints_in_variables(): return map(
int, sys.stdin.readline().strip().split())
def get_int(): return int(sys.stdin.readline())
def get_ints_in_list(): return list(
map(int, sys.stdin.readline().strip().split()))
def get_list_of_list(n): return [list(
map(int, sys.stdin.readline().strip().split())) for _ in range(n)]
def get_string(): return sys.stdin.readline().strip()
# -------- SOME CUSTOMIZED FUNCTIONS-----------
def myceil(x, y): return (x + y - 1) // y
# -------------- SOLUTION FUNCTION ------------------
def luckyNumbers(n, r, lucky_nums):
lucky_nums.append(n)
if n > r*10:
return
luckyNumbers((10*n)+4, r, lucky_nums)
luckyNumbers((10*n)+7, r, lucky_nums)
def helper(n, res):
ans = 0
for i in range(1, len(res)):
ans += (res[i]*(min(res[i], n)-min(res[i-1], n)))
return ans
def Solution(l, r):
# Write Your Code Here
luckyNums = []
luckyNumbers(0, r, luckyNums)
luckyNums = sorted(luckyNums)
# print(luckyNums)
print(helper(r, luckyNums)-helper(l-1, luckyNums))
def main():
# Take input Here and Call solution function
l, r = get_ints_in_variables()
Solution(l, r)
# calling main Function
if __name__ == '__main__':
main()
``` | 3 |
|
454 | B | Little Pony and Sort by Shift | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence? | The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105). | If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it. | [
"2\n2 1\n",
"3\n1 3 2\n",
"2\n1 2\n"
] | [
"1\n",
"-1\n",
"0\n"
] | none | 1,000 | [
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "3\n1 3 2",
"output": "-1"
},
{
"input": "2\n1 2",
"output": "0"
},
{
"input": "6\n3 4 5 6 3 2",
"output": "-1"
},
{
"input": "3\n1 2 1",
"output": "1"
},
{
"input": "5\n1 1 2 1 1",
"output": "2"
},
{
"input": "4\n5 4 5 4",
"output": "-1"
},
{
"input": "7\n3 4 5 5 5 1 2",
"output": "2"
},
{
"input": "5\n2 2 1 2 2",
"output": "3"
},
{
"input": "5\n5 4 1 2 3",
"output": "-1"
},
{
"input": "4\n6 1 2 7",
"output": "-1"
},
{
"input": "5\n4 5 6 2 3",
"output": "2"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "4\n1 2 2 1",
"output": "1"
},
{
"input": "9\n4 5 6 7 1 2 3 4 10",
"output": "-1"
},
{
"input": "7\n2 3 4 1 2 3 4",
"output": "-1"
},
{
"input": "6\n1 2 1 2 1 2",
"output": "-1"
},
{
"input": "3\n3 2 1",
"output": "-1"
},
{
"input": "4\n1 4 4 1",
"output": "1"
},
{
"input": "5\n1 2 1 1 1",
"output": "3"
},
{
"input": "5\n4 6 7 3 5",
"output": "-1"
},
{
"input": "4\n2 3 1 4",
"output": "-1"
},
{
"input": "5\n5 4 3 2 1",
"output": "-1"
},
{
"input": "4\n2 4 1 4",
"output": "-1"
},
{
"input": "6\n4 5 6 1 2 7",
"output": "-1"
},
{
"input": "6\n1 2 3 1 1 1",
"output": "3"
},
{
"input": "5\n1 3 3 3 1",
"output": "1"
},
{
"input": "6\n5 6 7 5 5 5",
"output": "3"
},
{
"input": "5\n3 4 2 1 2",
"output": "-1"
},
{
"input": "3\n3 4 2",
"output": "1"
},
{
"input": "6\n1 1 2 2 1 1",
"output": "2"
},
{
"input": "4\n2 3 4 2",
"output": "1"
},
{
"input": "5\n3 5 7 7 3",
"output": "1"
},
{
"input": "4\n1 1 4 1",
"output": "1"
},
{
"input": "7\n1 5 6 1 1 1 1",
"output": "4"
},
{
"input": "5\n7 8 6 7 8",
"output": "-1"
},
{
"input": "4\n2 4 1 3",
"output": "-1"
}
] | 1,660,976,724 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 5 | 93 | 13,414,400 | n=int(input())
l=list(map(int,input().split()))
res=0
while(True):
if l[-1]==l[0]:
l.pop()
res+=1
else:
break
l1=l.copy()
l1.sort()
el=l1[0]
i=0
f=True
for j in range(len(l)):
if l[j]==el:
i=j
break
x=0
for j in range(i,len(l)):
if l1[x]!=l[j]:
f=False
x+=1
for j in range(0,i):
if l1[x]!=l[j]:
f=False
x+=1
if f:
if i==0:
print(0+res)
else:
print(n-i+res)
else:
print(-1) | Title: Little Pony and Sort by Shift
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence?
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105).
Output Specification:
If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it.
Demo Input:
['2\n2 1\n', '3\n1 3 2\n', '2\n1 2\n']
Demo Output:
['1\n', '-1\n', '0\n']
Note:
none | ```python
n=int(input())
l=list(map(int,input().split()))
res=0
while(True):
if l[-1]==l[0]:
l.pop()
res+=1
else:
break
l1=l.copy()
l1.sort()
el=l1[0]
i=0
f=True
for j in range(len(l)):
if l[j]==el:
i=j
break
x=0
for j in range(i,len(l)):
if l1[x]!=l[j]:
f=False
x+=1
for j in range(0,i):
if l1[x]!=l[j]:
f=False
x+=1
if f:
if i==0:
print(0+res)
else:
print(n-i+res)
else:
print(-1)
``` | 0 |
|
767 | A | Snacktower | PROGRAMMING | 1,100 | [
"data structures",
"implementation"
] | null | null | According to an old legeng, a long time ago Ankh-Morpork residents did something wrong to miss Fortune, and she cursed them. She said that at some time *n* snacks of distinct sizes will fall on the city, and the residents should build a Snacktower of them by placing snacks one on another. Of course, big snacks should be at the bottom of the tower, while small snacks should be at the top.
Years passed, and once different snacks started to fall onto the city, and the residents began to build the Snacktower.
However, they faced some troubles. Each day exactly one snack fell onto the city, but their order was strange. So, at some days the residents weren't able to put the new stack on the top of the Snacktower: they had to wait until all the bigger snacks fell. Of course, in order to not to anger miss Fortune again, the residents placed each snack on the top of the tower immediately as they could do it.
Write a program that models the behavior of Ankh-Morpork residents. | The first line contains single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the total number of snacks.
The second line contains *n* integers, the *i*-th of them equals the size of the snack which fell on the *i*-th day. Sizes are distinct integers from 1 to *n*. | Print *n* lines. On the *i*-th of them print the sizes of the snacks which the residents placed on the top of the Snacktower on the *i*-th day in the order they will do that. If no snack is placed on some day, leave the corresponding line empty. | [
"3\n3 1 2\n",
"5\n4 5 1 2 3\n"
] | [
"3\n \n2 1",
"5 4\n \n \n3 2 1\n"
] | In the example a snack of size 3 fell on the first day, and the residents immediately placed it. On the second day a snack of size 1 fell, and the residents weren't able to place it because they were missing the snack of size 2. On the third day a snack of size 2 fell, and the residents immediately placed it. Right after that they placed the snack of size 1 which had fallen before. | 500 | [
{
"input": "3\n3 1 2",
"output": "3 \n\n2 1 "
},
{
"input": "5\n4 5 1 2 3",
"output": "5 4 \n\n\n3 2 1 "
},
{
"input": "1\n1",
"output": "1 "
},
{
"input": "2\n1 2",
"output": "2 1 "
},
{
"input": "10\n5 1 6 2 8 3 4 10 9 7",
"output": "10 \n9 8 \n7 6 5 4 3 2 1 "
},
{
"input": "30\n16 10 4 29 5 28 12 21 11 30 18 6 14 3 17 22 20 15 9 1 27 19 24 26 13 25 2 23 8 7",
"output": "30 29 28 \n\n\n\n\n\n\n\n\n\n\n27 \n\n\n26 \n\n25 24 \n\n23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 \n8 \n7 6 5 4 3 2 1 "
},
{
"input": "100\n98 52 63 2 18 96 31 58 84 40 41 45 66 100 46 71 26 48 81 20 73 91 68 76 13 93 17 29 64 95 79 21 55 75 19 85 54 51 89 78 15 87 43 59 36 1 90 35 65 56 62 28 86 5 82 49 3 99 33 9 92 32 74 69 27 22 77 16 44 94 34 6 57 70 23 12 61 25 8 11 67 47 83 88 10 14 30 7 97 60 42 37 24 38 53 50 4 80 72 39",
"output": "100 \n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n99 98 \n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 \n\n\n\n\n\n\n\n\n80 79 78 77 76 75 74 73 \n72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 \n39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 "
},
{
"input": "2\n2 1",
"output": "2 \n1 "
}
] | 1,594,414,191 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 0 | 140 | 20,172,800 | a=int(input())
b=list(map(int,input().split()))
maxi=b[0]
for i in range(1,len(b)):
if(maxi<b[i]):
print(b[i])
print()
maxi=b[i]
else:
print(b[i]) | Title: Snacktower
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
According to an old legeng, a long time ago Ankh-Morpork residents did something wrong to miss Fortune, and she cursed them. She said that at some time *n* snacks of distinct sizes will fall on the city, and the residents should build a Snacktower of them by placing snacks one on another. Of course, big snacks should be at the bottom of the tower, while small snacks should be at the top.
Years passed, and once different snacks started to fall onto the city, and the residents began to build the Snacktower.
However, they faced some troubles. Each day exactly one snack fell onto the city, but their order was strange. So, at some days the residents weren't able to put the new stack on the top of the Snacktower: they had to wait until all the bigger snacks fell. Of course, in order to not to anger miss Fortune again, the residents placed each snack on the top of the tower immediately as they could do it.
Write a program that models the behavior of Ankh-Morpork residents.
Input Specification:
The first line contains single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the total number of snacks.
The second line contains *n* integers, the *i*-th of them equals the size of the snack which fell on the *i*-th day. Sizes are distinct integers from 1 to *n*.
Output Specification:
Print *n* lines. On the *i*-th of them print the sizes of the snacks which the residents placed on the top of the Snacktower on the *i*-th day in the order they will do that. If no snack is placed on some day, leave the corresponding line empty.
Demo Input:
['3\n3 1 2\n', '5\n4 5 1 2 3\n']
Demo Output:
['3\n\xa0\n2 1', '5 4\n\xa0\n\xa0\n3 2 1\n']
Note:
In the example a snack of size 3 fell on the first day, and the residents immediately placed it. On the second day a snack of size 1 fell, and the residents weren't able to place it because they were missing the snack of size 2. On the third day a snack of size 2 fell, and the residents immediately placed it. Right after that they placed the snack of size 1 which had fallen before. | ```python
a=int(input())
b=list(map(int,input().split()))
maxi=b[0]
for i in range(1,len(b)):
if(maxi<b[i]):
print(b[i])
print()
maxi=b[i]
else:
print(b[i])
``` | 0 |
|
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,666,965,820 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 60 | 0 | word = input()
print(word[::-1]) | Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none | ```python
word = input()
print(word[::-1])
``` | 0 |
652 | B | z-sort | PROGRAMMING | 1,000 | [
"sortings"
] | null | null | A student of *z*-school found a kind of sorting called *z*-sort. The array *a* with *n* elements are *z*-sorted if two conditions hold:
1. *a**i*<=≥<=*a**i*<=-<=1 for all even *i*, 1. *a**i*<=≤<=*a**i*<=-<=1 for all odd *i*<=><=1.
For example the arrays [1,2,1,2] and [1,1,1,1] are *z*-sorted while the array [1,2,3,4] isn’t *z*-sorted.
Can you make the array *z*-sorted? | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in the array *a*.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the elements of the array *a*. | If it's possible to make the array *a* *z*-sorted print *n* space separated integers *a**i* — the elements after *z*-sort. Otherwise print the only word "Impossible". | [
"4\n1 2 2 1\n",
"5\n1 3 2 2 5\n"
] | [
"1 2 1 2\n",
"1 5 2 3 2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 1",
"output": "1 2 1 2"
},
{
"input": "5\n1 3 2 2 5",
"output": "1 5 2 3 2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "10\n1 1 1 1 1 1 1 1 1 1",
"output": "1 1 1 1 1 1 1 1 1 1"
},
{
"input": "10\n1 9 7 6 2 4 7 8 1 3",
"output": "1 9 1 8 2 7 3 7 4 6"
},
{
"input": "100\n82 51 81 14 37 17 78 92 64 15 8 86 89 8 87 77 66 10 15 12 100 25 92 47 21 78 20 63 13 49 41 36 41 79 16 87 87 69 3 76 80 60 100 49 70 59 72 8 38 71 45 97 71 14 76 54 81 4 59 46 39 29 92 3 49 22 53 99 59 52 74 31 92 43 42 23 44 9 82 47 7 40 12 9 3 55 37 85 46 22 84 52 98 41 21 77 63 17 62 91",
"output": "3 100 3 100 3 99 4 98 7 97 8 92 8 92 8 92 9 92 9 91 10 89 12 87 12 87 13 87 14 86 14 85 15 84 15 82 16 82 17 81 17 81 20 80 21 79 21 78 22 78 22 77 23 77 25 76 29 76 31 74 36 72 37 71 37 71 38 70 39 69 40 66 41 64 41 63 41 63 42 62 43 60 44 59 45 59 46 59 46 55 47 54 47 53 49 52 49 52 49 51"
},
{
"input": "3\n1 2 6",
"output": "1 6 2"
},
{
"input": "136\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1"
},
{
"input": "3\n1 2 3",
"output": "1 3 2"
},
{
"input": "7\n999999998 999999999 999999999 999999999 999999999 999999999 1000000000",
"output": "999999998 1000000000 999999999 999999999 999999999 999999999 999999999"
},
{
"input": "3\n100 1 2",
"output": "1 100 2"
}
] | 1,639,314,208 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 77 | 0 | def check_sorting(array):
for i in range(len(array)):
if (i + 1) % 2 == 0:
if arr[i] < arr[i - 1]:
return False
else:
if arr[i] > arr[i - 1] and i > 1:
return False
return True
n = int(input())
arr = list(map(int, input().split()))
flag = False
for _ in range(10000):
for i in range(len(arr)):
if (i + 1) % 2 == 0:
if arr[i] < arr[i - 1]:
arr[i], arr[i - 1] = arr[i - 1], arr[i]
else:
if arr[i] > arr[i - 1] and i > 1:
arr[i], arr[i - 1] = arr[i - 1], arr[i]
if check_sorting(arr):
flag = True
print(arr)
break
if not flag:
print('Impossible') | Title: z-sort
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A student of *z*-school found a kind of sorting called *z*-sort. The array *a* with *n* elements are *z*-sorted if two conditions hold:
1. *a**i*<=≥<=*a**i*<=-<=1 for all even *i*, 1. *a**i*<=≤<=*a**i*<=-<=1 for all odd *i*<=><=1.
For example the arrays [1,2,1,2] and [1,1,1,1] are *z*-sorted while the array [1,2,3,4] isn’t *z*-sorted.
Can you make the array *z*-sorted?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of elements in the array *a*.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the elements of the array *a*.
Output Specification:
If it's possible to make the array *a* *z*-sorted print *n* space separated integers *a**i* — the elements after *z*-sort. Otherwise print the only word "Impossible".
Demo Input:
['4\n1 2 2 1\n', '5\n1 3 2 2 5\n']
Demo Output:
['1 2 1 2\n', '1 5 2 3 2\n']
Note:
none | ```python
def check_sorting(array):
for i in range(len(array)):
if (i + 1) % 2 == 0:
if arr[i] < arr[i - 1]:
return False
else:
if arr[i] > arr[i - 1] and i > 1:
return False
return True
n = int(input())
arr = list(map(int, input().split()))
flag = False
for _ in range(10000):
for i in range(len(arr)):
if (i + 1) % 2 == 0:
if arr[i] < arr[i - 1]:
arr[i], arr[i - 1] = arr[i - 1], arr[i]
else:
if arr[i] > arr[i - 1] and i > 1:
arr[i], arr[i - 1] = arr[i - 1], arr[i]
if check_sorting(arr):
flag = True
print(arr)
break
if not flag:
print('Impossible')
``` | 0 |
|
58 | A | Chat room | PROGRAMMING | 1,000 | [
"greedy",
"strings"
] | A. Chat room | 1 | 256 | Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*. | The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters. | If Vasya managed to say hello, print "YES", otherwise print "NO". | [
"ahhellllloou\n",
"hlelo\n"
] | [
"YES\n",
"NO\n"
] | none | 500 | [
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,660,307,528 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 46 | 0 | s = input()
w = []
hello = 'hello'
c = 0
if s.find('e') < s.find('h'):
c += 1
if s.find('l') < s.find('e'):
c+=1
if s.find('o') < s.find('l'):
c+=1
for letter in hello:
z = s.find(letter)
if z != -1:
w.append(z)
s = s.replace(letter,'x',1)
y = [x for x in w]
y.sort()
if w == y and len(w) == 5 and c==0:
print('YES')
else:
print('NO') | Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none | ```python
s = input()
w = []
hello = 'hello'
c = 0
if s.find('e') < s.find('h'):
c += 1
if s.find('l') < s.find('e'):
c+=1
if s.find('o') < s.find('l'):
c+=1
for letter in hello:
z = s.find(letter)
if z != -1:
w.append(z)
s = s.replace(letter,'x',1)
y = [x for x in w]
y.sort()
if w == y and len(w) == 5 and c==0:
print('YES')
else:
print('NO')
``` | 0 |
228 | A | Is your horseshoe on the other hoof? | PROGRAMMING | 800 | [
"implementation"
] | null | null | Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party. | The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers. | Print a single integer — the minimum number of horseshoes Valera needs to buy. | [
"1 7 3 3\n",
"7 7 7 7\n"
] | [
"1\n",
"3\n"
] | none | 500 | [
{
"input": "1 7 3 3",
"output": "1"
},
{
"input": "7 7 7 7",
"output": "3"
},
{
"input": "81170865 673572653 756938629 995577259",
"output": "0"
},
{
"input": "3491663 217797045 522540872 715355328",
"output": "0"
},
{
"input": "251590420 586975278 916631563 586975278",
"output": "1"
},
{
"input": "259504825 377489979 588153796 377489979",
"output": "1"
},
{
"input": "652588203 931100304 931100304 652588203",
"output": "2"
},
{
"input": "391958720 651507265 391958720 651507265",
"output": "2"
},
{
"input": "90793237 90793237 90793237 90793237",
"output": "3"
},
{
"input": "551651653 551651653 551651653 551651653",
"output": "3"
},
{
"input": "156630260 609654355 668943582 973622757",
"output": "0"
},
{
"input": "17061017 110313588 434481173 796661222",
"output": "0"
},
{
"input": "24975422 256716298 337790533 690960249",
"output": "0"
},
{
"input": "255635360 732742923 798648949 883146723",
"output": "0"
},
{
"input": "133315691 265159773 734556507 265159773",
"output": "1"
},
{
"input": "28442865 741657755 978106882 978106882",
"output": "1"
},
{
"input": "131245479 174845575 497483467 131245479",
"output": "1"
},
{
"input": "139159884 616215581 958341883 616215581",
"output": "1"
},
{
"input": "147784432 947653080 947653080 947653080",
"output": "2"
},
{
"input": "94055790 756126496 756126496 94055790",
"output": "2"
},
{
"input": "240458500 511952208 240458500 511952208",
"output": "2"
},
{
"input": "681828506 972810624 972810624 681828506",
"output": "2"
},
{
"input": "454961014 454961014 454961014 454961014",
"output": "3"
},
{
"input": "915819430 915819430 915819430 915819430",
"output": "3"
},
{
"input": "671645142 671645142 671645142 671645142",
"output": "3"
},
{
"input": "132503558 132503558 132503558 132503558",
"output": "3"
},
{
"input": "5 5 999999 6",
"output": "1"
},
{
"input": "1 1 2 5",
"output": "1"
},
{
"input": "2 1 2 3",
"output": "1"
},
{
"input": "1 1 3 5",
"output": "1"
},
{
"input": "1 1 3 3",
"output": "2"
},
{
"input": "2 2 2 1",
"output": "2"
},
{
"input": "3 1 1 1",
"output": "2"
},
{
"input": "1 2 2 2",
"output": "2"
}
] | 1,697,302,856 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 92 | 307,200 | from collections import Counter
import math
ls = set(map(int, input().split()))
print(4 - len(ls))
| Title: Is your horseshoe on the other hoof?
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera the Horse is going to the party with friends. He has been following the fashion trends for a while, and he knows that it is very popular to wear all horseshoes of different color. Valera has got four horseshoes left from the last year, but maybe some of them have the same color. In this case he needs to go to the store and buy some few more horseshoes, not to lose face in front of his stylish comrades.
Fortunately, the store sells horseshoes of all colors under the sun and Valera has enough money to buy any four of them. However, in order to save the money, he would like to spend as little money as possible, so you need to help Valera and determine what is the minimum number of horseshoes he needs to buy to wear four horseshoes of different colors to a party.
Input Specification:
The first line contains four space-separated integers *s*1,<=*s*2,<=*s*3,<=*s*4 (1<=≤<=*s*1,<=*s*2,<=*s*3,<=*s*4<=≤<=109) — the colors of horseshoes Valera has.
Consider all possible colors indexed with integers.
Output Specification:
Print a single integer — the minimum number of horseshoes Valera needs to buy.
Demo Input:
['1 7 3 3\n', '7 7 7 7\n']
Demo Output:
['1\n', '3\n']
Note:
none | ```python
from collections import Counter
import math
ls = set(map(int, input().split()))
print(4 - len(ls))
``` | 3 |
|
988 | A | Diverse Team | PROGRAMMING | 800 | [
"brute force",
"implementation"
] | null | null | There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct.
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them. | The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form.
The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student. | If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them.
Assume that the students are numbered from $1$ to $n$. | [
"5 3\n15 13 15 15 12\n",
"5 4\n15 13 15 15 12\n",
"4 4\n20 10 40 30\n"
] | [
"YES\n1 2 5 \n",
"NO\n",
"YES\n1 2 3 4 \n"
] | All possible answers for the first example:
- {1 2 5} - {2 3 5} - {2 4 5}
Note that the order does not matter. | 0 | [
{
"input": "5 3\n15 13 15 15 12",
"output": "YES\n1 2 5 "
},
{
"input": "5 4\n15 13 15 15 12",
"output": "NO"
},
{
"input": "4 4\n20 10 40 30",
"output": "YES\n1 2 3 4 "
},
{
"input": "1 1\n1",
"output": "YES\n1 "
},
{
"input": "100 53\n16 17 1 2 27 5 9 9 53 24 17 33 35 24 20 48 56 73 12 14 39 55 58 13 59 73 29 26 40 33 22 29 34 22 55 38 63 66 36 13 60 42 10 15 21 9 11 5 23 37 79 47 26 3 79 53 44 8 71 75 42 11 34 39 79 33 10 26 23 23 17 14 54 41 60 31 83 5 45 4 14 35 6 60 28 48 23 18 60 36 21 28 7 34 9 25 52 43 54 19",
"output": "YES\n1 2 3 4 5 6 7 9 10 12 13 15 16 17 18 19 20 21 22 23 24 25 27 28 29 31 33 36 37 38 39 41 42 43 44 45 47 49 50 51 52 54 57 58 59 60 73 74 76 77 79 80 83 "
},
{
"input": "2 2\n100 100",
"output": "NO"
},
{
"input": "2 2\n100 99",
"output": "YES\n1 2 "
},
{
"input": "100 100\n63 100 75 32 53 24 73 98 76 15 70 48 8 81 88 58 95 78 27 92 14 16 72 43 46 39 66 38 64 42 59 9 22 51 4 6 10 94 28 99 68 80 35 50 45 20 47 7 30 26 49 91 77 19 96 57 65 1 11 13 31 12 82 87 93 34 62 3 21 79 56 41 89 18 44 23 74 86 2 33 69 36 61 67 25 83 5 84 90 37 40 29 97 60 52 55 54 71 17 85",
"output": "YES\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 41\n54 16 42 3 45 6 9 72 100 13 24 57 35 5 89 13 97 27 43 9 73 89 48 16 48 55 18 15 55 28 30 6 18 41 100 61 9 42 35 54 57 25 73 15 42 54 49 5 72 48 30 55 4 43 94 5 60 92 93 23 89 75 53 92 74 93 89 28 69 6 3 49 15 28 49 57 54 55 30 57 69 18 89 6 25 23 93 74 30 13 87 53 6 42 4 54 60 30 4 35",
"output": "NO"
},
{
"input": "100 2\n70 64 70 32 70 64 32 70 64 32 32 64 70 64 64 32 64 64 64 70 70 64 64 64 64 70 32 64 70 64 32 70 70 70 64 70 64 70 64 32 70 32 70 64 64 64 32 70 64 70 70 32 70 32 32 32 70 32 70 32 64 64 70 32 32 64 70 64 32 32 64 64 32 32 70 70 32 70 32 64 32 70 64 64 32 64 32 64 70 32 70 32 70 64 64 64 70 70 64 70",
"output": "YES\n1 2 "
}
] | 1,617,551,493 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 61 | 0 | n,k=map(int,input().split())
l=list(map(int,input().split()))
d={}
for i in range(n):
if(l[i] not in d):
d[l[i]]=i+1
if(len(d)<k):
print('NO')
else:
print('YES')
for i in d:
print(d[i],end=' ')
| Title: Diverse Team
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are $n$ students in a school class, the rating of the $i$-th student on Codehorses is $a_i$. You have to form a team consisting of $k$ students ($1 \le k \le n$) such that the ratings of all team members are distinct.
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct numbers which should be the indices of students in the team you form. If there are multiple answers, print any of them.
Input Specification:
The first line contains two integers $n$ and $k$ ($1 \le k \le n \le 100$) — the number of students and the size of the team you have to form.
The second line contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the rating of $i$-th student.
Output Specification:
If it is impossible to form a suitable team, print "NO" (without quotes). Otherwise print "YES", and then print $k$ distinct integers from $1$ to $n$ which should be the indices of students in the team you form. All the ratings of the students in the team should be distinct. You may print the indices in any order. If there are multiple answers, print any of them.
Assume that the students are numbered from $1$ to $n$.
Demo Input:
['5 3\n15 13 15 15 12\n', '5 4\n15 13 15 15 12\n', '4 4\n20 10 40 30\n']
Demo Output:
['YES\n1 2 5 \n', 'NO\n', 'YES\n1 2 3 4 \n']
Note:
All possible answers for the first example:
- {1 2 5} - {2 3 5} - {2 4 5}
Note that the order does not matter. | ```python
n,k=map(int,input().split())
l=list(map(int,input().split()))
d={}
for i in range(n):
if(l[i] not in d):
d[l[i]]=i+1
if(len(d)<k):
print('NO')
else:
print('YES')
for i in d:
print(d[i],end=' ')
``` | 0 |
|
862 | B | Mahmoud and Ehab and the bipartiteness | PROGRAMMING | 1,300 | [
"dfs and similar",
"graphs",
"trees"
] | null | null | Mahmoud and Ehab continue their adventures! As everybody in the evil land knows, Dr. Evil likes bipartite graphs, especially trees.
A tree is a connected acyclic graph. A bipartite graph is a graph, whose vertices can be partitioned into 2 sets in such a way, that for each edge (*u*,<=*v*) that belongs to the graph, *u* and *v* belong to different sets. You can find more formal definitions of a tree and a bipartite graph in the notes section below.
Dr. Evil gave Mahmoud and Ehab a tree consisting of *n* nodes and asked them to add edges to it in such a way, that the graph is still bipartite. Besides, after adding these edges the graph should be simple (doesn't contain loops or multiple edges). What is the maximum number of edges they can add?
A loop is an edge, which connects a node with itself. Graph doesn't contain multiple edges when for each pair of nodes there is no more than one edge between them. A cycle and a loop aren't the same . | The first line of input contains an integer *n* — the number of nodes in the tree (1<=≤<=*n*<=≤<=105).
The next *n*<=-<=1 lines contain integers *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*) — the description of the edges of the tree.
It's guaranteed that the given graph is a tree. | Output one integer — the maximum number of edges that Mahmoud and Ehab can add to the tree while fulfilling the conditions. | [
"3\n1 2\n1 3\n",
"5\n1 2\n2 3\n3 4\n4 5\n"
] | [
"0\n",
"2\n"
] | Tree definition: [https://en.wikipedia.org/wiki/Tree_(graph_theory)](https://en.wikipedia.org/wiki/Tree_(graph_theory))
Bipartite graph definition: [https://en.wikipedia.org/wiki/Bipartite_graph](https://en.wikipedia.org/wiki/Bipartite_graph)
In the first test case the only edge that can be added in such a way, that graph won't contain loops or multiple edges is (2, 3), but adding this edge will make the graph non-bipartite so the answer is 0.
In the second test case Mahmoud and Ehab can add edges (1, 4) and (2, 5). | 1,000 | [
{
"input": "3\n1 2\n1 3",
"output": "0"
},
{
"input": "5\n1 2\n2 3\n3 4\n4 5",
"output": "2"
},
{
"input": "10\n3 8\n6 2\n9 7\n10 1\n3 5\n1 3\n6 7\n5 4\n3 6",
"output": "16"
},
{
"input": "10\n7 6\n2 7\n4 1\n8 5\n9 4\n5 3\n8 7\n10 8\n10 4",
"output": "16"
},
{
"input": "10\n2 6\n3 7\n8 4\n4 10\n6 9\n9 7\n3 10\n1 2\n5 8",
"output": "16"
},
{
"input": "10\n6 9\n9 7\n9 4\n10 9\n9 1\n9 8\n9 2\n9 5\n3 9",
"output": "0"
},
{
"input": "2\n1 2",
"output": "0"
}
] | 1,662,185,873 | 2,147,483,647 | Python 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | #include<iostream>
#include<vector>
using namespace std;
void dfs(vector< vector<int> > adj, int v, int color, vector<int> &colored){
colored[v] = color;
for(auto u: adj[v]){
if( colored[u]==-1 )
dfs(adj,u,color^1, colored);
}
}
void read_graph(){
int n,m;
int u,v;
cin >> n >> m;
vector< vector<int> > adj(n);
for(int i=0;i<m;i++){
cin >> u >> v;
u--;v--;
adj[u].push_back(v);
adj[v].push_back(u);
}
vector<int> colored(n,-1);
int start = 0;
for(start=0;start<n;start++)
if(colored[start]==-1)
dfs(adj,start,0,colored);
bool isbipartite=true;
for(int i=0;i<n;i++)
for(auto j:adj[i])
if( colored[i] == colored[j] )
isbipartite = false;
cout << (isbipartite? "No suspicious bugs found!\n": "Suspicious bugs found!\n");
}
int main(){
int cases;
cin >> cases;
for(int i=1;i<=cases;i++){
cout << "Scenario #" << i << ":" << endl;
read_graph();
}
return 0;
}
| Title: Mahmoud and Ehab and the bipartiteness
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mahmoud and Ehab continue their adventures! As everybody in the evil land knows, Dr. Evil likes bipartite graphs, especially trees.
A tree is a connected acyclic graph. A bipartite graph is a graph, whose vertices can be partitioned into 2 sets in such a way, that for each edge (*u*,<=*v*) that belongs to the graph, *u* and *v* belong to different sets. You can find more formal definitions of a tree and a bipartite graph in the notes section below.
Dr. Evil gave Mahmoud and Ehab a tree consisting of *n* nodes and asked them to add edges to it in such a way, that the graph is still bipartite. Besides, after adding these edges the graph should be simple (doesn't contain loops or multiple edges). What is the maximum number of edges they can add?
A loop is an edge, which connects a node with itself. Graph doesn't contain multiple edges when for each pair of nodes there is no more than one edge between them. A cycle and a loop aren't the same .
Input Specification:
The first line of input contains an integer *n* — the number of nodes in the tree (1<=≤<=*n*<=≤<=105).
The next *n*<=-<=1 lines contain integers *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*) — the description of the edges of the tree.
It's guaranteed that the given graph is a tree.
Output Specification:
Output one integer — the maximum number of edges that Mahmoud and Ehab can add to the tree while fulfilling the conditions.
Demo Input:
['3\n1 2\n1 3\n', '5\n1 2\n2 3\n3 4\n4 5\n']
Demo Output:
['0\n', '2\n']
Note:
Tree definition: [https://en.wikipedia.org/wiki/Tree_(graph_theory)](https://en.wikipedia.org/wiki/Tree_(graph_theory))
Bipartite graph definition: [https://en.wikipedia.org/wiki/Bipartite_graph](https://en.wikipedia.org/wiki/Bipartite_graph)
In the first test case the only edge that can be added in such a way, that graph won't contain loops or multiple edges is (2, 3), but adding this edge will make the graph non-bipartite so the answer is 0.
In the second test case Mahmoud and Ehab can add edges (1, 4) and (2, 5). | ```python
#include<iostream>
#include<vector>
using namespace std;
void dfs(vector< vector<int> > adj, int v, int color, vector<int> &colored){
colored[v] = color;
for(auto u: adj[v]){
if( colored[u]==-1 )
dfs(adj,u,color^1, colored);
}
}
void read_graph(){
int n,m;
int u,v;
cin >> n >> m;
vector< vector<int> > adj(n);
for(int i=0;i<m;i++){
cin >> u >> v;
u--;v--;
adj[u].push_back(v);
adj[v].push_back(u);
}
vector<int> colored(n,-1);
int start = 0;
for(start=0;start<n;start++)
if(colored[start]==-1)
dfs(adj,start,0,colored);
bool isbipartite=true;
for(int i=0;i<n;i++)
for(auto j:adj[i])
if( colored[i] == colored[j] )
isbipartite = false;
cout << (isbipartite? "No suspicious bugs found!\n": "Suspicious bugs found!\n");
}
int main(){
int cases;
cin >> cases;
for(int i=1;i<=cases;i++){
cout << "Scenario #" << i << ":" << endl;
read_graph();
}
return 0;
}
``` | -1 |
|
601 | A | The Two Routes | PROGRAMMING | 1,600 | [
"graphs",
"shortest paths"
] | null | null | In Absurdistan, there are *n* towns (numbered 1 through *n*) and *m* bidirectional railways. There is also an absurdly simple road network — for each pair of different towns *x* and *y*, there is a bidirectional road between towns *x* and *y* if and only if there is no railway between them. Travelling to a different town using one railway or one road always takes exactly one hour.
A train and a bus leave town 1 at the same time. They both have the same destination, town *n*, and don't make any stops on the way (but they can wait in town *n*). The train can move only along railways and the bus can move only along roads.
You've been asked to plan out routes for the vehicles; each route can use any road/railway multiple times. One of the most important aspects to consider is safety — in order to avoid accidents at railway crossings, the train and the bus must not arrive at the same town (except town *n*) simultaneously.
Under these constraints, what is the minimum number of hours needed for both vehicles to reach town *n* (the maximum of arrival times of the bus and the train)? Note, that bus and train are not required to arrive to the town *n* at the same moment of time, but are allowed to do so. | The first line of the input contains two integers *n* and *m* (2<=≤<=*n*<=≤<=400, 0<=≤<=*m*<=≤<=*n*(*n*<=-<=1)<=/<=2) — the number of towns and the number of railways respectively.
Each of the next *m* lines contains two integers *u* and *v*, denoting a railway between towns *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*).
You may assume that there is at most one railway connecting any two towns. | Output one integer — the smallest possible time of the later vehicle's arrival in town *n*. If it's impossible for at least one of the vehicles to reach town *n*, output <=-<=1. | [
"4 2\n1 3\n3 4\n",
"4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4\n",
"5 5\n4 2\n3 5\n4 5\n5 1\n1 2\n"
] | [
"2\n",
"-1\n",
"3\n"
] | In the first sample, the train can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c0aa60a06309ef607b7159fd7f3687ea0d943ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> and the bus can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a26c2f3e93c9d9be6c21cb5d2bd6ac1f99f4ff55.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Note that they can arrive at town 4 at the same time.
In the second sample, Absurdistan is ruled by railwaymen. There are no roads, so there's no way for the bus to reach town 4. | 500 | [
{
"input": "4 2\n1 3\n3 4",
"output": "2"
},
{
"input": "4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4",
"output": "-1"
},
{
"input": "5 5\n4 2\n3 5\n4 5\n5 1\n1 2",
"output": "3"
},
{
"input": "5 4\n1 2\n3 2\n3 4\n5 4",
"output": "4"
},
{
"input": "3 1\n1 2",
"output": "-1"
},
{
"input": "2 1\n1 2",
"output": "-1"
},
{
"input": "2 0",
"output": "-1"
},
{
"input": "20 0",
"output": "-1"
},
{
"input": "381 0",
"output": "-1"
},
{
"input": "3 3\n1 2\n2 3\n3 1",
"output": "-1"
},
{
"input": "3 0",
"output": "-1"
},
{
"input": "3 1\n1 3",
"output": "2"
},
{
"input": "3 2\n2 3\n3 1",
"output": "-1"
},
{
"input": "4 1\n1 4",
"output": "2"
},
{
"input": "4 5\n1 3\n2 1\n3 4\n4 2\n2 3",
"output": "2"
},
{
"input": "20 1\n20 1",
"output": "2"
},
{
"input": "21 1\n21 1",
"output": "2"
},
{
"input": "100 1\n100 1",
"output": "2"
},
{
"input": "400 1\n1 400",
"output": "2"
},
{
"input": "5 5\n2 5\n1 2\n1 4\n1 3\n3 2",
"output": "2"
}
] | 1,595,547,462 | 2,147,483,647 | PyPy 3 | OK | TESTS | 59 | 686 | 26,828,800 | n,m=map(int,input().split())
graph=[[0]*(n+1) for _ in range(n+1)]
for i in range(m):
x,y=map(int,input().split())
graph[x][y]=graph[y][x]=1
vis=[-1]*(n+1)
vis[1]=0
q=[1]
while q:
x=q.pop(0)
for y in range(1,n+1):
if graph[x][y]!=graph[1][n] and vis[y]==-1:
vis[y]=vis[x]+1
q.append(y)
print(vis[-1])
| Title: The Two Routes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In Absurdistan, there are *n* towns (numbered 1 through *n*) and *m* bidirectional railways. There is also an absurdly simple road network — for each pair of different towns *x* and *y*, there is a bidirectional road between towns *x* and *y* if and only if there is no railway between them. Travelling to a different town using one railway or one road always takes exactly one hour.
A train and a bus leave town 1 at the same time. They both have the same destination, town *n*, and don't make any stops on the way (but they can wait in town *n*). The train can move only along railways and the bus can move only along roads.
You've been asked to plan out routes for the vehicles; each route can use any road/railway multiple times. One of the most important aspects to consider is safety — in order to avoid accidents at railway crossings, the train and the bus must not arrive at the same town (except town *n*) simultaneously.
Under these constraints, what is the minimum number of hours needed for both vehicles to reach town *n* (the maximum of arrival times of the bus and the train)? Note, that bus and train are not required to arrive to the town *n* at the same moment of time, but are allowed to do so.
Input Specification:
The first line of the input contains two integers *n* and *m* (2<=≤<=*n*<=≤<=400, 0<=≤<=*m*<=≤<=*n*(*n*<=-<=1)<=/<=2) — the number of towns and the number of railways respectively.
Each of the next *m* lines contains two integers *u* and *v*, denoting a railway between towns *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*n*, *u*<=≠<=*v*).
You may assume that there is at most one railway connecting any two towns.
Output Specification:
Output one integer — the smallest possible time of the later vehicle's arrival in town *n*. If it's impossible for at least one of the vehicles to reach town *n*, output <=-<=1.
Demo Input:
['4 2\n1 3\n3 4\n', '4 6\n1 2\n1 3\n1 4\n2 3\n2 4\n3 4\n', '5 5\n4 2\n3 5\n4 5\n5 1\n1 2\n']
Demo Output:
['2\n', '-1\n', '3\n']
Note:
In the first sample, the train can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/7c0aa60a06309ef607b7159fd7f3687ea0d943ce.png" style="max-width: 100.0%;max-height: 100.0%;"/> and the bus can take the route <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a26c2f3e93c9d9be6c21cb5d2bd6ac1f99f4ff55.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Note that they can arrive at town 4 at the same time.
In the second sample, Absurdistan is ruled by railwaymen. There are no roads, so there's no way for the bus to reach town 4. | ```python
n,m=map(int,input().split())
graph=[[0]*(n+1) for _ in range(n+1)]
for i in range(m):
x,y=map(int,input().split())
graph[x][y]=graph[y][x]=1
vis=[-1]*(n+1)
vis[1]=0
q=[1]
while q:
x=q.pop(0)
for y in range(1,n+1):
if graph[x][y]!=graph[1][n] and vis[y]==-1:
vis[y]=vis[x]+1
q.append(y)
print(vis[-1])
``` | 3 |
|
112 | A | Petya and Strings | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Petya and Strings | 2 | 256 | Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison. | Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters. | If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared. | [
"aaaa\naaaA\n",
"abs\nAbz\n",
"abcdefg\nAbCdEfF\n"
] | [
"0\n",
"-1\n",
"1\n"
] | If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order | 500 | [
{
"input": "aaaa\naaaA",
"output": "0"
},
{
"input": "abs\nAbz",
"output": "-1"
},
{
"input": "abcdefg\nAbCdEfF",
"output": "1"
},
{
"input": "asadasdasd\nasdwasdawd",
"output": "-1"
},
{
"input": "aslkjlkasdd\nasdlkjdajwi",
"output": "1"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "0"
},
{
"input": "aAaaaAAaAaaAzZsssSsdDfeEaeqZlpP\nAaaaAaaAaaAaZzSSSSsDdFeeAeQZLpp",
"output": "0"
},
{
"input": "bwuEhEveouaTECagLZiqmUdxEmhRSOzMauJRWLQMppZOumxhAmwuGeDIkvkBLvMXwUoFmpAfDprBcFtEwOULcZWRQhcTbTbX\nHhoDWbcxwiMnCNexOsKsujLiSGcLllXOkRSbnOzThAjnnliLYFFmsYkOfpTxRNEfBsoUHfoLTiqAINRPxWRqrTJhgfkKcDOH",
"output": "-1"
},
{
"input": "kGWUuguKzcvxqKTNpxeDWXpXkrXDvGMFGoXKDfPBZvWSDUyIYBynbKOUonHvmZaKeirUhfmVRKtGhAdBfKMWXDUoqvbfpfHYcg\ncvOULleuIIiYVVxcLZmHVpNGXuEpzcWZZWyMOwIwbpkKPwCfkVbKkUuosvxYCKjqfVmHfJKbdrsAcatPYgrCABaFcoBuOmMfFt",
"output": "1"
},
{
"input": "nCeNVIzHqPceNhjHeHvJvgBsNFiXBATRrjSTXJzhLMDMxiJztphxBRlDlqwDFImWeEPkggZCXSRwelOdpNrYnTepiOqpvkr\nHJbjJFtlvNxIbkKlxQUwmZHJFVNMwPAPDRslIoXISBYHHfymyIaQHLgECPxAmqnOCizwXnIUBRmpYUBVPenoUKhCobKdOjL",
"output": "1"
},
{
"input": "ttXjenUAlfixytHEOrPkgXmkKTSGYuyVXGIHYmWWYGlBYpHkujueqBSgjLguSgiMGJWATIGEUjjAjKXdMiVbHozZUmqQtFrT\nJziDBFBDmDJCcGqFsQwDFBYdOidLxxhBCtScznnDgnsiStlWFnEXQrJxqTXKPxZyIGfLIToETKWZBPUIBmLeImrlSBWCkTNo",
"output": "1"
},
{
"input": "AjQhPqSVhwQQjcgCycjKorWBgFCRuQBwgdVuAPSMJAvTyxGVuFHjfJzkKfsmfhFbKqFrFIohSZBbpjgEHebezmVlGLTPSCTMf\nXhxWuSnMmKFrCUOwkTUmvKAfbTbHWzzOTzxJatLLCdlGnHVaBUnxDlsqpvjLHMThOPAFBggVKDyKBrZAmjnjrhHlrnSkyzBja",
"output": "-1"
},
{
"input": "HCIgYtnqcMyjVngziNflxKHtdTmcRJhzMAjFAsNdWXFJYEhiTzsQUtFNkAbdrFBRmvLirkuirqTDvIpEfyiIqkrwsjvpPWTEdI\nErqiiWKsmIjyZuzgTlTqxYZwlrpvRyaVhRTOYUqtPMVGGtWOkDCOOQRKrkkRzPftyQCkYkzKkzTPqqXmeZhvvEEiEhkdOmoMvy",
"output": "1"
},
{
"input": "mtBeJYILXcECGyEVSyzLFdQJbiVnnfkbsYYsdUJSIRmyzLfTTtFwIBmRLVnwcewIqcuydkcLpflHAFyDaToLiFMgeHvQorTVbI\nClLvyejznjbRfCDcrCzkLvqQaGzTjwmWONBdCctJAPJBcQrcYvHaSLQgPIJbmkFBhFzuQLBiRzAdNHulCjIAkBvZxxlkdzUWLR",
"output": "1"
},
{
"input": "tjucSbGESVmVridTBjTmpVBCwwdWKBPeBvmgdxgIVLwQxveETnSdxkTVJpXoperWSgdpPMKNmwDiGeHfxnuqaDissgXPlMuNZIr\nHfjOOJhomqNIKHvqSgfySjlsWJQBuWYwhLQhlZYlpZwboMpoLoluGsBmhhlYgeIouwdkPfiaAIrkYRlxtiFazOPOllPsNZHcIZd",
"output": "1"
},
{
"input": "AanbDfbZNlUodtBQlvPMyomStKNhgvSGhSbTdabxGFGGXCdpsJDimsAykKjfBDPMulkhBMsqLmVKLDoesHZsRAEEdEzqigueXInY\ncwfyjoppiJNrjrOLNZkqcGimrpTsiyFBVgMWEPXsMrxLJDDbtYzerXiFGuLBcQYitLdqhGHBpdjRnkUegmnwhGHAKXGyFtscWDSI",
"output": "-1"
},
{
"input": "HRfxniwuJCaHOcaOVgjOGHXKrwxrDQxJpppeGDXnTAowyKbCsCQPbchCKeTWOcKbySSYnoaTJDnmRcyGPbfXJyZoPcARHBu\nxkLXvwkvGIWSQaFTznLOctUXNuzzBBOlqvzmVfTSejekTAlwidRrsxkbZTsGGeEWxCXHzqWVuLGoCyrGjKkQoHqduXwYQKC",
"output": "-1"
},
{
"input": "OjYwwNuPESIazoyLFREpObIaMKhCaKAMWMfRGgucEuyNYRantwdwQkmflzfqbcFRaXBnZoIUGsFqXZHGKwlaBUXABBcQEWWPvkjW\nRxLqGcTTpBwHrHltCOllnTpRKLDofBUqqHxnOtVWPgvGaeHIevgUSOeeDOJubfqonFpVNGVbHFcAhjnyFvrrqnRgKhkYqQZmRfUl",
"output": "-1"
},
{
"input": "tatuhQPIzjptlzzJpCAPXSRTKZRlwgfoCIsFjJquRoIDyZZYRSPdFUTjjUPhLBBfeEIfLQpygKXRcyQFiQsEtRtLnZErBqW\ntkHUjllbafLUWhVCnvblKjgYIEoHhsjVmrDBmAWbvtkHxDbRFvsXAjHIrujaDbYwOZmacknhZPeCcorbRgHjjgAgoJdjvLo",
"output": "-1"
},
{
"input": "cymCPGqdXKUdADEWDdUaLEEMHiXHsdAZuDnJDMUvxvrLRBrPSDpXPAgMRoGplLtniFRTomDTAHXWAdgUveTxaqKVSvnOyhOwiRN\nuhmyEWzapiRNPFDisvHTbenXMfeZaHqOFlKjrfQjUBwdFktNpeiRoDWuBftZLcCZZAVfioOihZVNqiNCNDIsUdIhvbcaxpTRWoV",
"output": "-1"
},
{
"input": "sSvpcITJAwghVfJaLKBmyjOkhltTGjYJVLWCYMFUomiJaKQYhXTajvZVHIMHbyckYROGQZzjWyWCcnmDmrkvTKfHSSzCIhsXgEZa\nvhCXkCwAmErGVBPBAnkSYEYvseFKbWSktoqaHYXUmYkHfOkRwuEyBRoGoBrOXBKVxXycjZGStuvDarnXMbZLWrbjrisDoJBdSvWJ",
"output": "-1"
},
{
"input": "hJDANKUNBisOOINDsTixJmYgHNogtpwswwcvVMptfGwIjvqgwTYFcqTdyAqaqlnhOCMtsnWXQqtjFwQlEcBtMFAtSqnqthVb\nrNquIcjNWESjpPVWmzUJFrelpUZeGDmSvCurCqVmKHKVAAPkaHksniOlzjiKYIJtvbuQWZRufMebpTFPqyxIWWjfPaWYiNlK",
"output": "-1"
},
{
"input": "ycLoapxsfsDTHMSfAAPIUpiEhQKUIXUcXEiopMBuuZLHtfPpLmCHwNMNQUwsEXxCEmKHTBSnKhtQhGWUvppUFZUgSpbeChX\ndCZhgVXofkGousCzObxZSJwXcHIaqUDSCPKzXntcVmPxtNcXmVcjsetZYxedmgQzXTZHMvzjoaXCMKsncGciSDqQWIIRlys",
"output": "1"
},
{
"input": "nvUbnrywIePXcoukIhwTfUVcHUEgXcsMyNQhmMlTltZiCooyZiIKRIGVHMCnTKgzXXIuvoNDEZswKoACOBGSyVNqTNQqMhAG\nplxuGSsyyJjdvpddrSebOARSAYcZKEaKjqbCwvjhNykuaECoQVHTVFMKXwvrQXRaqXsHsBaGVhCxGRxNyGUbMlxOarMZNXxy",
"output": "-1"
},
{
"input": "EncmXtAblQzcVRzMQqdDqXfAhXbtJKQwZVWyHoWUckohnZqfoCmNJDzexFgFJYrwNHGgzCJTzQQFnxGlhmvQTpicTkEeVICKac\nNIUNZoMLFMyAjVgQLITELJSodIXcGSDWfhFypRoGYuogJpnqGTotWxVqpvBHjFOWcDRDtARsaHarHaOkeNWEHGTaGOFCOFEwvK",
"output": "-1"
},
{
"input": "UG\nak",
"output": "1"
},
{
"input": "JZR\nVae",
"output": "-1"
},
{
"input": "a\nZ",
"output": "-1"
},
{
"input": "rk\nkv",
"output": "1"
},
{
"input": "RvuT\nbJzE",
"output": "1"
},
{
"input": "PPS\nydq",
"output": "-1"
},
{
"input": "q\nq",
"output": "0"
},
{
"input": "peOw\nIgSJ",
"output": "1"
},
{
"input": "PyK\noKN",
"output": "1"
},
{
"input": "O\ni",
"output": "1"
},
{
"input": "NmGY\npDlP",
"output": "-1"
},
{
"input": "nG\nZf",
"output": "-1"
},
{
"input": "m\na",
"output": "1"
},
{
"input": "MWyB\nWZEV",
"output": "-1"
},
{
"input": "Gre\nfxc",
"output": "1"
},
{
"input": "Ooq\nwap",
"output": "-1"
},
{
"input": "XId\nlbB",
"output": "1"
},
{
"input": "lfFpECEqUMEOJhipvkZjDPcpDNJedOVXiSMgBvBZbtfzIKekcvpWPCazKAhJyHircRtgcBIJwwstpHaLAgxFOngAWUZRgCef\nLfFPEcequmeojHIpVkzjDPcpdNJEDOVXiSmGBVBZBtfZikEKcvPwpCAzKAHJyHIrCRTgCbIJWwSTphALagXfOnGAwUzRGcEF",
"output": "0"
},
{
"input": "DQBdtSEDtFGiNRUeJNbOIfDZnsryUlzJHGTXGFXnwsVyxNtLgmklmFvRCzYETBVdmkpJJIvIOkMDgCFHZOTODiYrkwXd\nDQbDtsEdTFginRUEJNBOIfdZnsryulZJHGtxGFxnwSvYxnTLgmKlmFVRCzyEtBVdmKpJjiVioKMDgCFhzoTODiYrKwXD",
"output": "0"
},
{
"input": "tYWRijFQSzHBpCjUzqBtNvBKyzZRnIdWEuyqnORBQTLyOQglIGfYJIRjuxnbLvkqZakNqPiGDvgpWYkfxYNXsdoKXZtRkSasfa\nTYwRiJfqsZHBPcJuZQBTnVbkyZZRnidwEuYQnorbQTLYOqGligFyjirJUxnblVKqZaknQpigDVGPwyKfxyNXSDoKxztRKSaSFA",
"output": "0"
},
{
"input": "KhScXYiErQIUtmVhNTCXSLAviefIeHIIdiGhsYnPkSBaDTvMkyanfMLBOvDWgRybLtDqvXVdVjccNunDyijhhZEAKBrdz\nkHsCXyiErqIuTMVHNTCxSLaViEFIEhIIDiGHsYNpKsBAdTvMKyANFMLBovdwGRYbLtdQVxvDVJCcNUndYiJHhzeakBrdZ",
"output": "0"
},
{
"input": "cpPQMpjRQJKQVXjWDYECXbagSmNcVfOuBWNZxihdERraVuiOpSVDCPgTGuSQALNoVjySceHcKXwOEpSzXrEqWwwrYeppNiWhDVg\nCPPqmPjRqJkQvxJwdyECXBAGsMNcVfOuBWNzxIhderRavUiOpSvDCpGTgusqAlNovjyScEhCKXwoePSZxrEQwWwryEPPniWHDvG",
"output": "0"
},
{
"input": "SajcCGMepaLjZIWLRBGFcrZRCRvvoCsIyKsQerbrwsIamxxpRmQSZSalasJLVFbCHCuXJlubciQAvLxXYBazLsMKLHLdDQ\nsaJcCgmEpaLJziWlrBgFcRzrCrVVOcSIykSQerBrwSIamxxPrMqSzSalASjLVFbChCUxjLUbCIQAVlxxybAZLsmkLhLDdQ",
"output": "0"
},
{
"input": "kigPrWNTOUNDBskAfefjhHYZNYdnfZWuXWzHiBxFQryBbAkPtenFwWvCSTYGpzOntUNzNUhxRWjKmicTwLwJAnbAxj\nkigpRWntOUNdBsKaFEFjhhYZnYDNfzWuXwZhibxFQRybbakPteNfwwvcStyGPzoNTunznuHXrWjKMIctWLWJANBAxJ",
"output": "0"
},
{
"input": "nTomZZuTTRTAAPoUsySVFGElrpQRNLjqvFmcYytiheQnjUhPLnqNBiYtQkljbcvmjuNAVKbvQOWpqqFlQhAhULIhquoCnjUI\nntOmzZuttrtAAPOUSySVFgeLRPQrNLjQvfmCyYTiHEQnjuHPlNQNbIYtqKLJBCVmjunavkbvQOWPQQFlqHaHULIHQuOcnJUi",
"output": "0"
},
{
"input": "abac\nadaa",
"output": "-1"
},
{
"input": "Bbc\nabc",
"output": "1"
},
{
"input": "aaaba\naaaab",
"output": "1"
}
] | 1,697,997,706 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 53 | 124 | 0 | import math
a=input()
b=input()
a1=a.upper()
b1=b.upper()
if a1==b1:
print(0)
elif a1<b1:
print(-1)
else:
print(1) | Title: Petya and Strings
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
Input Specification:
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
Output Specification:
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
Demo Input:
['aaaa\naaaA\n', 'abs\nAbz\n', 'abcdefg\nAbCdEfF\n']
Demo Output:
['0\n', '-1\n', '1\n']
Note:
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order | ```python
import math
a=input()
b=input()
a1=a.upper()
b1=b.upper()
if a1==b1:
print(0)
elif a1<b1:
print(-1)
else:
print(1)
``` | 3.969 |
460 | A | Vasya and Socks | PROGRAMMING | 900 | [
"brute force",
"implementation",
"math"
] | null | null | Vasya has *n* pairs of socks. In the morning of each day Vasya has to put on a pair of socks before he goes to school. When he comes home in the evening, Vasya takes off the used socks and throws them away. Every *m*-th day (at days with numbers *m*,<=2*m*,<=3*m*,<=...) mom buys a pair of socks to Vasya. She does it late in the evening, so that Vasya cannot put on a new pair of socks before the next day. How many consecutive days pass until Vasya runs out of socks? | The single line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100; 2<=≤<=*m*<=≤<=100), separated by a space. | Print a single integer — the answer to the problem. | [
"2 2\n",
"9 3\n"
] | [
"3\n",
"13\n"
] | In the first sample Vasya spends the first two days wearing the socks that he had initially. Then on day three he puts on the socks that were bought on day two.
In the second sample Vasya spends the first nine days wearing the socks that he had initially. Then he spends three days wearing the socks that were bought on the third, sixth and ninth days. Than he spends another day wearing the socks that were bought on the twelfth day. | 500 | [
{
"input": "2 2",
"output": "3"
},
{
"input": "9 3",
"output": "13"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "1 99",
"output": "1"
},
{
"input": "4 4",
"output": "5"
},
{
"input": "10 2",
"output": "19"
},
{
"input": "10 9",
"output": "11"
},
{
"input": "100 100",
"output": "101"
},
{
"input": "2 27",
"output": "2"
},
{
"input": "99 100",
"output": "99"
},
{
"input": "99 2",
"output": "197"
},
{
"input": "100 3",
"output": "149"
},
{
"input": "98 3",
"output": "146"
},
{
"input": "4 4",
"output": "5"
},
{
"input": "100 2",
"output": "199"
},
{
"input": "62 4",
"output": "82"
},
{
"input": "99 10",
"output": "109"
},
{
"input": "100 5",
"output": "124"
},
{
"input": "80 80",
"output": "81"
},
{
"input": "95 16",
"output": "101"
},
{
"input": "75 16",
"output": "79"
},
{
"input": "99 74",
"output": "100"
},
{
"input": "20 21",
"output": "20"
},
{
"input": "52 96",
"output": "52"
},
{
"input": "24 5",
"output": "29"
}
] | 1,647,890,345 | 2,147,483,647 | Python 3 | OK | TESTS | 26 | 31 | 0 | n,m=list(map(int,input().split()))
cnt=n
while n>=m:
cnt+=(n//m)
n=((n//m)+(n%m))
print(cnt) | Title: Vasya and Socks
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* pairs of socks. In the morning of each day Vasya has to put on a pair of socks before he goes to school. When he comes home in the evening, Vasya takes off the used socks and throws them away. Every *m*-th day (at days with numbers *m*,<=2*m*,<=3*m*,<=...) mom buys a pair of socks to Vasya. She does it late in the evening, so that Vasya cannot put on a new pair of socks before the next day. How many consecutive days pass until Vasya runs out of socks?
Input Specification:
The single line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100; 2<=≤<=*m*<=≤<=100), separated by a space.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['2 2\n', '9 3\n']
Demo Output:
['3\n', '13\n']
Note:
In the first sample Vasya spends the first two days wearing the socks that he had initially. Then on day three he puts on the socks that were bought on day two.
In the second sample Vasya spends the first nine days wearing the socks that he had initially. Then he spends three days wearing the socks that were bought on the third, sixth and ninth days. Than he spends another day wearing the socks that were bought on the twelfth day. | ```python
n,m=list(map(int,input().split()))
cnt=n
while n>=m:
cnt+=(n//m)
n=((n//m)+(n%m))
print(cnt)
``` | 3 |
|
979 | A | Pizza, Pizza, Pizza!!! | PROGRAMMING | 1,000 | [
"math"
] | null | null | Katie, Kuro and Shiro are best friends. They have known each other since kindergarten. That's why they often share everything with each other and work together on some very hard problems.
Today is Shiro's birthday. She really loves pizza so she wants to invite her friends to the pizza restaurant near her house to celebrate her birthday, including her best friends Katie and Kuro.
She has ordered a very big round pizza, in order to serve her many friends. Exactly $n$ of Shiro's friends are here. That's why she has to divide the pizza into $n + 1$ slices (Shiro also needs to eat). She wants the slices to be exactly the same size and shape. If not, some of her friends will get mad and go home early, and the party will be over.
Shiro is now hungry. She wants to cut the pizza with minimum of straight cuts. A cut is a straight segment, it might have ends inside or outside the pizza. But she is too lazy to pick up the calculator.
As usual, she will ask Katie and Kuro for help. But they haven't come yet. Could you help Shiro with this problem? | A single line contains one non-negative integer $n$ ($0 \le n \leq 10^{18}$) — the number of Shiro's friends. The circular pizza has to be sliced into $n + 1$ pieces. | A single integer — the number of straight cuts Shiro needs. | [
"3\n",
"4\n"
] | [
"2",
"5"
] | To cut the round pizza into quarters one has to make two cuts through the center with angle $90^{\circ}$ between them.
To cut the round pizza into five equal parts one has to make five cuts. | 500 | [
{
"input": "3",
"output": "2"
},
{
"input": "4",
"output": "5"
},
{
"input": "10",
"output": "11"
},
{
"input": "10000000000",
"output": "10000000001"
},
{
"input": "1234567891",
"output": "617283946"
},
{
"input": "7509213957",
"output": "3754606979"
},
{
"input": "99999999999999999",
"output": "50000000000000000"
},
{
"input": "21",
"output": "11"
},
{
"input": "712394453192",
"output": "712394453193"
},
{
"input": "172212168",
"output": "172212169"
},
{
"input": "822981260158260519",
"output": "411490630079130260"
},
{
"input": "28316250877914571",
"output": "14158125438957286"
},
{
"input": "779547116602436424",
"output": "779547116602436425"
},
{
"input": "578223540024979436",
"output": "578223540024979437"
},
{
"input": "335408917861648766",
"output": "335408917861648767"
},
{
"input": "74859962623690078",
"output": "74859962623690079"
},
{
"input": "252509054433933439",
"output": "126254527216966720"
},
{
"input": "760713016476190622",
"output": "760713016476190623"
},
{
"input": "919845426262703496",
"output": "919845426262703497"
},
{
"input": "585335723211047194",
"output": "585335723211047195"
},
{
"input": "522842184971407769",
"output": "261421092485703885"
},
{
"input": "148049062628894320",
"output": "148049062628894321"
},
{
"input": "84324828731963974",
"output": "84324828731963975"
},
{
"input": "354979173822804781",
"output": "177489586911402391"
},
{
"input": "1312150450968413",
"output": "656075225484207"
},
{
"input": "269587449430302150",
"output": "269587449430302151"
},
{
"input": "645762258982631926",
"output": "645762258982631927"
},
{
"input": "615812229161735895",
"output": "307906114580867948"
},
{
"input": "0",
"output": "0"
},
{
"input": "349993004923078531",
"output": "174996502461539266"
},
{
"input": "891351282707723851",
"output": "445675641353861926"
},
{
"input": "563324731189330734",
"output": "563324731189330735"
},
{
"input": "520974001910286909",
"output": "260487000955143455"
},
{
"input": "666729339802329204",
"output": "666729339802329205"
},
{
"input": "856674611404539671",
"output": "428337305702269836"
},
{
"input": "791809296303238499",
"output": "395904648151619250"
},
{
"input": "711066337317063338",
"output": "711066337317063339"
},
{
"input": "931356503492686566",
"output": "931356503492686567"
},
{
"input": "234122432773361866",
"output": "234122432773361867"
},
{
"input": "1000000000000000000",
"output": "1000000000000000001"
},
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "3"
},
{
"input": "7",
"output": "4"
},
{
"input": "63",
"output": "32"
},
{
"input": "24",
"output": "25"
},
{
"input": "8",
"output": "9"
},
{
"input": "15",
"output": "8"
}
] | 1,567,653,434 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 28 | 124 | 0 | friends = int(input()) + 1
if friends % 2 == 0:
res = friends//2
print(res)
else:
print(friends)
| Title: Pizza, Pizza, Pizza!!!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Katie, Kuro and Shiro are best friends. They have known each other since kindergarten. That's why they often share everything with each other and work together on some very hard problems.
Today is Shiro's birthday. She really loves pizza so she wants to invite her friends to the pizza restaurant near her house to celebrate her birthday, including her best friends Katie and Kuro.
She has ordered a very big round pizza, in order to serve her many friends. Exactly $n$ of Shiro's friends are here. That's why she has to divide the pizza into $n + 1$ slices (Shiro also needs to eat). She wants the slices to be exactly the same size and shape. If not, some of her friends will get mad and go home early, and the party will be over.
Shiro is now hungry. She wants to cut the pizza with minimum of straight cuts. A cut is a straight segment, it might have ends inside or outside the pizza. But she is too lazy to pick up the calculator.
As usual, she will ask Katie and Kuro for help. But they haven't come yet. Could you help Shiro with this problem?
Input Specification:
A single line contains one non-negative integer $n$ ($0 \le n \leq 10^{18}$) — the number of Shiro's friends. The circular pizza has to be sliced into $n + 1$ pieces.
Output Specification:
A single integer — the number of straight cuts Shiro needs.
Demo Input:
['3\n', '4\n']
Demo Output:
['2', '5']
Note:
To cut the round pizza into quarters one has to make two cuts through the center with angle $90^{\circ}$ between them.
To cut the round pizza into five equal parts one has to make five cuts. | ```python
friends = int(input()) + 1
if friends % 2 == 0:
res = friends//2
print(res)
else:
print(friends)
``` | 0 |
|
916 | A | Jamie and Alarm Snooze | PROGRAMMING | 900 | [
"brute force",
"implementation",
"math"
] | null | null | Jamie loves sleeping. One day, he decides that he needs to wake up at exactly *hh*:<=*mm*. However, he hates waking up, so he wants to make waking up less painful by setting the alarm at a lucky time. He will then press the snooze button every *x* minutes until *hh*:<=*mm* is reached, and only then he will wake up. He wants to know what is the smallest number of times he needs to press the snooze button.
A time is considered lucky if it contains a digit '7'. For example, 13:<=07 and 17:<=27 are lucky, while 00:<=48 and 21:<=34 are not lucky.
Note that it is not necessary that the time set for the alarm and the wake-up time are on the same day. It is guaranteed that there is a lucky time Jamie can set so that he can wake at *hh*:<=*mm*.
Formally, find the smallest possible non-negative integer *y* such that the time representation of the time *x*·*y* minutes before *hh*:<=*mm* contains the digit '7'.
Jamie uses 24-hours clock, so after 23:<=59 comes 00:<=00. | The first line contains a single integer *x* (1<=≤<=*x*<=≤<=60).
The second line contains two two-digit integers, *hh* and *mm* (00<=≤<=*hh*<=≤<=23,<=00<=≤<=*mm*<=≤<=59). | Print the minimum number of times he needs to press the button. | [
"3\n11 23\n",
"5\n01 07\n"
] | [
"2\n",
"0\n"
] | In the first sample, Jamie needs to wake up at 11:23. So, he can set his alarm at 11:17. He would press the snooze button when the alarm rings at 11:17 and at 11:20.
In the second sample, Jamie can set his alarm at exactly at 01:07 which is lucky. | 500 | [
{
"input": "3\n11 23",
"output": "2"
},
{
"input": "5\n01 07",
"output": "0"
},
{
"input": "34\n09 24",
"output": "3"
},
{
"input": "2\n14 37",
"output": "0"
},
{
"input": "14\n19 54",
"output": "9"
},
{
"input": "42\n15 44",
"output": "12"
},
{
"input": "46\n02 43",
"output": "1"
},
{
"input": "14\n06 41",
"output": "1"
},
{
"input": "26\n04 58",
"output": "26"
},
{
"input": "54\n16 47",
"output": "0"
},
{
"input": "38\n20 01",
"output": "3"
},
{
"input": "11\n02 05",
"output": "8"
},
{
"input": "55\n22 10",
"output": "5"
},
{
"input": "23\n10 08",
"output": "6"
},
{
"input": "23\n23 14",
"output": "9"
},
{
"input": "51\n03 27",
"output": "0"
},
{
"input": "35\n15 25",
"output": "13"
},
{
"input": "3\n12 15",
"output": "6"
},
{
"input": "47\n00 28",
"output": "3"
},
{
"input": "31\n13 34",
"output": "7"
},
{
"input": "59\n17 32",
"output": "0"
},
{
"input": "25\n11 03",
"output": "8"
},
{
"input": "9\n16 53",
"output": "4"
},
{
"input": "53\n04 06",
"output": "3"
},
{
"input": "37\n00 12",
"output": "5"
},
{
"input": "5\n13 10",
"output": "63"
},
{
"input": "50\n01 59",
"output": "10"
},
{
"input": "34\n06 13",
"output": "4"
},
{
"input": "2\n18 19",
"output": "1"
},
{
"input": "46\n06 16",
"output": "17"
},
{
"input": "14\n03 30",
"output": "41"
},
{
"input": "40\n13 37",
"output": "0"
},
{
"input": "24\n17 51",
"output": "0"
},
{
"input": "8\n14 57",
"output": "0"
},
{
"input": "52\n18 54",
"output": "2"
},
{
"input": "20\n15 52",
"output": "24"
},
{
"input": "20\n03 58",
"output": "30"
},
{
"input": "48\n07 11",
"output": "0"
},
{
"input": "32\n04 01",
"output": "2"
},
{
"input": "60\n08 15",
"output": "1"
},
{
"input": "44\n20 20",
"output": "4"
},
{
"input": "55\n15 35",
"output": "9"
},
{
"input": "55\n03 49",
"output": "11"
},
{
"input": "23\n16 39",
"output": "4"
},
{
"input": "7\n20 36",
"output": "7"
},
{
"input": "35\n16 42",
"output": "1"
},
{
"input": "35\n05 56",
"output": "21"
},
{
"input": "3\n17 45",
"output": "0"
},
{
"input": "47\n05 59",
"output": "6"
},
{
"input": "15\n10 13",
"output": "9"
},
{
"input": "59\n06 18",
"output": "9"
},
{
"input": "34\n17 18",
"output": "0"
},
{
"input": "18\n05 23",
"output": "2"
},
{
"input": "46\n17 21",
"output": "0"
},
{
"input": "30\n06 27",
"output": "0"
},
{
"input": "14\n18 40",
"output": "3"
},
{
"input": "58\n22 54",
"output": "6"
},
{
"input": "26\n19 44",
"output": "5"
},
{
"input": "10\n15 57",
"output": "0"
},
{
"input": "54\n20 47",
"output": "0"
},
{
"input": "22\n08 45",
"output": "3"
},
{
"input": "48\n18 08",
"output": "1"
},
{
"input": "32\n07 06",
"output": "0"
},
{
"input": "60\n19 19",
"output": "2"
},
{
"input": "45\n07 25",
"output": "0"
},
{
"input": "29\n12 39",
"output": "8"
},
{
"input": "13\n08 28",
"output": "3"
},
{
"input": "41\n21 42",
"output": "5"
},
{
"input": "41\n09 32",
"output": "3"
},
{
"input": "9\n21 45",
"output": "2"
},
{
"input": "37\n10 43",
"output": "5"
},
{
"input": "3\n20 50",
"output": "1"
},
{
"input": "47\n00 04",
"output": "1"
},
{
"input": "15\n13 10",
"output": "21"
},
{
"input": "15\n17 23",
"output": "0"
},
{
"input": "43\n22 13",
"output": "2"
},
{
"input": "27\n10 26",
"output": "6"
},
{
"input": "55\n22 24",
"output": "5"
},
{
"input": "55\n03 30",
"output": "11"
},
{
"input": "24\n23 27",
"output": "0"
},
{
"input": "52\n11 33",
"output": "3"
},
{
"input": "18\n22 48",
"output": "17"
},
{
"input": "1\n12 55",
"output": "8"
},
{
"input": "1\n04 27",
"output": "0"
},
{
"input": "1\n12 52",
"output": "5"
},
{
"input": "1\n20 16",
"output": "9"
},
{
"input": "1\n04 41",
"output": "4"
},
{
"input": "1\n20 21",
"output": "4"
},
{
"input": "1\n04 45",
"output": "8"
},
{
"input": "1\n12 18",
"output": "1"
},
{
"input": "1\n04 42",
"output": "5"
},
{
"input": "1\n02 59",
"output": "2"
},
{
"input": "1\n18 24",
"output": "7"
},
{
"input": "1\n02 04",
"output": "7"
},
{
"input": "1\n18 28",
"output": "1"
},
{
"input": "1\n18 01",
"output": "2"
},
{
"input": "1\n10 25",
"output": "8"
},
{
"input": "1\n02 49",
"output": "2"
},
{
"input": "1\n02 30",
"output": "3"
},
{
"input": "1\n18 54",
"output": "7"
},
{
"input": "1\n02 19",
"output": "2"
},
{
"input": "1\n05 25",
"output": "8"
},
{
"input": "60\n23 55",
"output": "6"
},
{
"input": "60\n08 19",
"output": "1"
},
{
"input": "60\n00 00",
"output": "7"
},
{
"input": "60\n08 24",
"output": "1"
},
{
"input": "60\n16 13",
"output": "9"
},
{
"input": "60\n08 21",
"output": "1"
},
{
"input": "60\n16 45",
"output": "9"
},
{
"input": "60\n08 26",
"output": "1"
},
{
"input": "60\n08 50",
"output": "1"
},
{
"input": "60\n05 21",
"output": "12"
},
{
"input": "60\n13 29",
"output": "6"
},
{
"input": "60\n05 18",
"output": "12"
},
{
"input": "60\n13 42",
"output": "6"
},
{
"input": "60\n05 07",
"output": "0"
},
{
"input": "60\n05 47",
"output": "0"
},
{
"input": "60\n21 55",
"output": "4"
},
{
"input": "60\n05 36",
"output": "12"
},
{
"input": "60\n21 08",
"output": "4"
},
{
"input": "60\n21 32",
"output": "4"
},
{
"input": "60\n16 31",
"output": "9"
},
{
"input": "5\n00 00",
"output": "73"
},
{
"input": "2\n06 58",
"output": "390"
},
{
"input": "60\n00 00",
"output": "7"
},
{
"input": "2\n00 00",
"output": "181"
},
{
"input": "10\n00 00",
"output": "37"
},
{
"input": "60\n01 00",
"output": "8"
},
{
"input": "12\n00 06",
"output": "31"
},
{
"input": "1\n00 01",
"output": "4"
},
{
"input": "5\n00 05",
"output": "74"
},
{
"input": "60\n01 01",
"output": "8"
},
{
"input": "11\n18 11",
"output": "2"
},
{
"input": "60\n01 15",
"output": "8"
},
{
"input": "10\n00 16",
"output": "38"
},
{
"input": "60\n00 59",
"output": "7"
},
{
"input": "30\n00 00",
"output": "13"
},
{
"input": "60\n01 05",
"output": "8"
},
{
"input": "4\n00 03",
"output": "4"
},
{
"input": "4\n00 00",
"output": "91"
},
{
"input": "60\n00 01",
"output": "7"
},
{
"input": "6\n00 03",
"output": "1"
},
{
"input": "13\n00 00",
"output": "1"
},
{
"input": "1\n18 01",
"output": "2"
},
{
"input": "5\n06 00",
"output": "145"
},
{
"input": "60\n04 08",
"output": "11"
},
{
"input": "5\n01 55",
"output": "96"
},
{
"input": "8\n00 08",
"output": "47"
},
{
"input": "23\n18 23",
"output": "2"
},
{
"input": "6\n00 06",
"output": "62"
},
{
"input": "59\n18 59",
"output": "2"
},
{
"input": "11\n00 10",
"output": "3"
},
{
"input": "10\n00 01",
"output": "37"
},
{
"input": "59\n00 00",
"output": "7"
},
{
"input": "10\n18 10",
"output": "2"
},
{
"input": "5\n00 01",
"output": "73"
},
{
"input": "1\n00 00",
"output": "3"
},
{
"input": "8\n00 14",
"output": "47"
},
{
"input": "60\n03 00",
"output": "10"
},
{
"input": "60\n00 10",
"output": "7"
},
{
"input": "5\n01 13",
"output": "87"
},
{
"input": "30\n02 43",
"output": "18"
},
{
"input": "17\n00 08",
"output": "3"
},
{
"input": "3\n00 00",
"output": "1"
},
{
"input": "60\n00 05",
"output": "7"
},
{
"input": "5\n18 05",
"output": "2"
},
{
"input": "30\n00 30",
"output": "14"
},
{
"input": "1\n00 06",
"output": "9"
},
{
"input": "55\n00 00",
"output": "7"
},
{
"input": "8\n02 08",
"output": "62"
},
{
"input": "7\n00 00",
"output": "9"
},
{
"input": "6\n08 06",
"output": "2"
},
{
"input": "48\n06 24",
"output": "16"
},
{
"input": "8\n06 58",
"output": "98"
},
{
"input": "3\n12 00",
"output": "1"
},
{
"input": "5\n01 06",
"output": "86"
},
{
"input": "2\n00 08",
"output": "185"
},
{
"input": "3\n18 03",
"output": "2"
},
{
"input": "1\n17 00",
"output": "0"
},
{
"input": "59\n00 48",
"output": "7"
},
{
"input": "5\n12 01",
"output": "49"
},
{
"input": "55\n01 25",
"output": "9"
},
{
"input": "2\n07 23",
"output": "0"
},
{
"input": "10\n01 10",
"output": "44"
},
{
"input": "2\n00 01",
"output": "2"
},
{
"input": "59\n00 01",
"output": "6"
},
{
"input": "5\n00 02",
"output": "1"
},
{
"input": "4\n01 02",
"output": "106"
},
{
"input": "5\n00 06",
"output": "74"
},
{
"input": "42\n00 08",
"output": "9"
},
{
"input": "60\n01 20",
"output": "8"
},
{
"input": "3\n06 00",
"output": "1"
},
{
"input": "4\n00 01",
"output": "1"
},
{
"input": "2\n00 06",
"output": "184"
},
{
"input": "1\n00 57",
"output": "0"
},
{
"input": "6\n00 00",
"output": "61"
},
{
"input": "5\n08 40",
"output": "9"
},
{
"input": "58\n00 55",
"output": "1"
},
{
"input": "2\n00 02",
"output": "182"
},
{
"input": "1\n08 01",
"output": "2"
},
{
"input": "10\n10 10",
"output": "14"
},
{
"input": "60\n01 11",
"output": "8"
},
{
"input": "2\n07 00",
"output": "0"
},
{
"input": "15\n00 03",
"output": "25"
},
{
"input": "6\n04 34",
"output": "106"
},
{
"input": "16\n00 16",
"output": "24"
},
{
"input": "2\n00 59",
"output": "1"
},
{
"input": "59\n00 08",
"output": "7"
},
{
"input": "10\n03 10",
"output": "56"
},
{
"input": "3\n08 03",
"output": "2"
},
{
"input": "20\n06 11",
"output": "37"
},
{
"input": "4\n01 00",
"output": "106"
},
{
"input": "38\n01 08",
"output": "12"
},
{
"input": "60\n00 06",
"output": "7"
},
{
"input": "5\n12 00",
"output": "49"
},
{
"input": "6\n01 42",
"output": "78"
},
{
"input": "4\n00 04",
"output": "92"
},
{
"input": "60\n04 05",
"output": "11"
},
{
"input": "1\n00 53",
"output": "6"
},
{
"input": "5\n08 05",
"output": "2"
},
{
"input": "60\n18 45",
"output": "1"
},
{
"input": "60\n06 23",
"output": "13"
},
{
"input": "6\n00 15",
"output": "3"
},
{
"input": "58\n00 06",
"output": "7"
},
{
"input": "2\n06 44",
"output": "383"
},
{
"input": "1\n08 00",
"output": "1"
},
{
"input": "10\n06 58",
"output": "78"
},
{
"input": "59\n00 58",
"output": "8"
},
{
"input": "1\n18 00",
"output": "1"
},
{
"input": "50\n00 42",
"output": "9"
},
{
"input": "30\n18 30",
"output": "2"
},
{
"input": "60\n21 59",
"output": "4"
},
{
"input": "2\n10 52",
"output": "87"
},
{
"input": "56\n00 00",
"output": "7"
},
{
"input": "16\n18 16",
"output": "2"
},
{
"input": "5\n01 05",
"output": "86"
},
{
"input": "5\n05 00",
"output": "133"
},
{
"input": "5\n23 59",
"output": "72"
},
{
"input": "7\n17 13",
"output": "0"
},
{
"input": "58\n00 00",
"output": "7"
},
{
"input": "15\n00 07",
"output": "0"
},
{
"input": "59\n08 00",
"output": "1"
},
{
"input": "46\n00 00",
"output": "8"
},
{
"input": "59\n01 05",
"output": "2"
},
{
"input": "2\n01 00",
"output": "211"
},
{
"input": "60\n00 24",
"output": "7"
},
{
"input": "10\n00 08",
"output": "37"
},
{
"input": "10\n00 06",
"output": "37"
},
{
"input": "60\n01 24",
"output": "8"
},
{
"input": "50\n00 10",
"output": "8"
},
{
"input": "2\n03 00",
"output": "271"
},
{
"input": "4\n19 04",
"output": "17"
},
{
"input": "25\n00 23",
"output": "16"
},
{
"input": "10\n01 01",
"output": "43"
}
] | 1,650,010,063 | 2,147,483,647 | PyPy 3-64 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | #include <bits/stdc++.h>
using namespace std;
#define d(...) " [" << #__VA_ARGS__ ": " << (__VA_ARGS__) << "] "
#define ll long long
void solve(){
int x, h, m; cin >> x >> h >> m;
int ans = 0;
while (m % 10 != 7 && (m/10)%10 != 7) {
m = (m-x)%60;
ans++;
}
cout << ans << endl;
}
int main(){
ios::sync_with_stdio(0);
cin.tie(0);
//int t; cin >> t;
//while(t--){
solve();
//}
}
| Title: Jamie and Alarm Snooze
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Jamie loves sleeping. One day, he decides that he needs to wake up at exactly *hh*:<=*mm*. However, he hates waking up, so he wants to make waking up less painful by setting the alarm at a lucky time. He will then press the snooze button every *x* minutes until *hh*:<=*mm* is reached, and only then he will wake up. He wants to know what is the smallest number of times he needs to press the snooze button.
A time is considered lucky if it contains a digit '7'. For example, 13:<=07 and 17:<=27 are lucky, while 00:<=48 and 21:<=34 are not lucky.
Note that it is not necessary that the time set for the alarm and the wake-up time are on the same day. It is guaranteed that there is a lucky time Jamie can set so that he can wake at *hh*:<=*mm*.
Formally, find the smallest possible non-negative integer *y* such that the time representation of the time *x*·*y* minutes before *hh*:<=*mm* contains the digit '7'.
Jamie uses 24-hours clock, so after 23:<=59 comes 00:<=00.
Input Specification:
The first line contains a single integer *x* (1<=≤<=*x*<=≤<=60).
The second line contains two two-digit integers, *hh* and *mm* (00<=≤<=*hh*<=≤<=23,<=00<=≤<=*mm*<=≤<=59).
Output Specification:
Print the minimum number of times he needs to press the button.
Demo Input:
['3\n11 23\n', '5\n01 07\n']
Demo Output:
['2\n', '0\n']
Note:
In the first sample, Jamie needs to wake up at 11:23. So, he can set his alarm at 11:17. He would press the snooze button when the alarm rings at 11:17 and at 11:20.
In the second sample, Jamie can set his alarm at exactly at 01:07 which is lucky. | ```python
#include <bits/stdc++.h>
using namespace std;
#define d(...) " [" << #__VA_ARGS__ ": " << (__VA_ARGS__) << "] "
#define ll long long
void solve(){
int x, h, m; cin >> x >> h >> m;
int ans = 0;
while (m % 10 != 7 && (m/10)%10 != 7) {
m = (m-x)%60;
ans++;
}
cout << ans << endl;
}
int main(){
ios::sync_with_stdio(0);
cin.tie(0);
//int t; cin >> t;
//while(t--){
solve();
//}
}
``` | -1 |
|
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,650,687,378 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 92 | 0 | string1 = input()
string2 = input()
flag = True
j = len(string2) - 1
for i in range(len(string1)):
if string1[i] != string2[j]:
flag = False
break
j = j - 1
if flag == True: print("YES")
else: print("NO")
| Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none | ```python
string1 = input()
string2 = input()
flag = True
j = len(string2) - 1
for i in range(len(string1)):
if string1[i] != string2[j]:
flag = False
break
j = j - 1
if flag == True: print("YES")
else: print("NO")
``` | 3.977 |
702 | A | Maximum Increase | PROGRAMMING | 800 | [
"dp",
"greedy",
"implementation"
] | null | null | You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous. | The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print the maximum length of an increasing subarray of the given array. | [
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] | [
"3\n",
"1\n",
"3\n"
] | none | 0 | [
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 799843967 446173607 796619138 402690754",
"output": "3"
},
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "5\n1 2 3 3 4",
"output": "3"
},
{
"input": "4\n1 2 2 3",
"output": "2"
},
{
"input": "3\n2 1 1",
"output": "1"
},
{
"input": "3\n1 2 1",
"output": "2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 1 2",
"output": "2"
},
{
"input": "11\n1 2 3 1 2 3 2 1 2 3 4",
"output": "4"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "9\n1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "3\n3 2 1",
"output": "1"
},
{
"input": "7\n1 2 3 4 5 6 7",
"output": "7"
},
{
"input": "1\n1234394",
"output": "1"
}
] | 1,691,411,155 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 4 | 46 | 0 | n = int(input())
a = list(map(int, input().split()))
ans = 1
for i in range(n):
for j in range(i+2, n):
h = a[i:j]
if h == sorted(set(h)):
ans = max(ans, j-i+1)
print(ans)
| Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
Input Specification:
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print the maximum length of an increasing subarray of the given array.
Demo Input:
['5\n1 7 2 11 15\n', '6\n100 100 100 100 100 100\n', '3\n1 2 3\n']
Demo Output:
['3\n', '1\n', '3\n']
Note:
none | ```python
n = int(input())
a = list(map(int, input().split()))
ans = 1
for i in range(n):
for j in range(i+2, n):
h = a[i:j]
if h == sorted(set(h)):
ans = max(ans, j-i+1)
print(ans)
``` | 0 |
|
204 | A | Little Elephant and Interval | PROGRAMMING | 1,500 | [
"binary search",
"combinatorics",
"dp"
] | null | null | The Little Elephant very much loves sums on intervals.
This time he has a pair of integers *l* and *r* (*l*<=≤<=*r*). The Little Elephant has to find the number of such integers *x* (*l*<=≤<=*x*<=≤<=*r*), that the first digit of integer *x* equals the last one (in decimal notation). For example, such numbers as 101, 477474 or 9 will be included in the answer and 47, 253 or 1020 will not.
Help him and count the number of described numbers *x* for a given pair *l* and *r*. | The single line contains a pair of integers *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=1018) — the boundaries of the interval.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specifier. | On a single line print a single integer — the answer to the problem. | [
"2 47\n",
"47 1024\n"
] | [
"12\n",
"98\n"
] | In the first sample the answer includes integers 2, 3, 4, 5, 6, 7, 8, 9, 11, 22, 33, 44. | 500 | [
{
"input": "2 47",
"output": "12"
},
{
"input": "47 1024",
"output": "98"
},
{
"input": "1 1000",
"output": "108"
},
{
"input": "1 10000",
"output": "1008"
},
{
"input": "47 8545",
"output": "849"
},
{
"input": "1000 1000",
"output": "0"
},
{
"input": "47547 4587554587754542",
"output": "458755458770699"
},
{
"input": "1 1000000",
"output": "100008"
},
{
"input": "47 74",
"output": "2"
},
{
"input": "10001 10000002",
"output": "999001"
},
{
"input": "10000 100000",
"output": "9000"
},
{
"input": "458754 4588754",
"output": "413001"
},
{
"input": "111 111",
"output": "1"
},
{
"input": "110 147",
"output": "4"
},
{
"input": "1 1000000000",
"output": "100000008"
},
{
"input": "12 10000000000",
"output": "999999998"
},
{
"input": "1000000000 1000000000",
"output": "0"
},
{
"input": "1 1000000000000000000",
"output": "100000000000000008"
},
{
"input": "11 111111111111111100",
"output": "11111111111111109"
},
{
"input": "100000000000000000 1000000000000000000",
"output": "90000000000000000"
},
{
"input": "45481484484 848469844684844",
"output": "84842436320036"
},
{
"input": "975400104587000 48754000000000001",
"output": "4777859989541300"
},
{
"input": "11220451511 51511665251233335",
"output": "5151165403078183"
},
{
"input": "77 77",
"output": "1"
},
{
"input": "99 102",
"output": "2"
},
{
"input": "9997 87878000008",
"output": "8787799002"
},
{
"input": "10000000001 111111111111100001",
"output": "11111110111110001"
},
{
"input": "7777 88888",
"output": "8112"
},
{
"input": "999999999 10000000000",
"output": "900000001"
},
{
"input": "235 236",
"output": "0"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "2 2",
"output": "1"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "4 7",
"output": "4"
},
{
"input": "7 10",
"output": "3"
},
{
"input": "1 11",
"output": "10"
},
{
"input": "1 10",
"output": "9"
},
{
"input": "7 8",
"output": "2"
},
{
"input": "88 990",
"output": "91"
},
{
"input": "458985985498001244 985458425544874008",
"output": "52647244004687276"
},
{
"input": "115998725487587451 245744899758754501",
"output": "12974617427116705"
},
{
"input": "595754249475458004 615044544745124547",
"output": "1929029526966655"
},
{
"input": "9754875457700 1000000000000000000",
"output": "99999024512454230"
},
{
"input": "8758754570000 999999999999999999",
"output": "99999124124543000"
},
{
"input": "111111111111111111 333333333444444445",
"output": "22222222233333334"
},
{
"input": "822981258385599125 841978899930248528",
"output": "1899764154464941"
},
{
"input": "779547115376367013 980561039207670775",
"output": "20101392383130376"
},
{
"input": "335408916782916802 416495628489807285",
"output": "8108671170689049"
},
{
"input": "252509053898415172 285803555062529649",
"output": "3329450116411448"
},
{
"input": "919845424847912645 970651082117950285",
"output": "5080565727003764"
},
{
"input": "522842183413115088 853628713003942530",
"output": "33078652959082744"
},
{
"input": "84324827171274023 607953653548585226",
"output": "52362882637731121"
},
{
"input": "1312148742261681 277460340506883334",
"output": "27614819176462166"
},
{
"input": "645762257531682046 885295120956158518",
"output": "23953286342447648"
},
{
"input": "819875140559301752 946247219812473271",
"output": "12637207925317152"
},
{
"input": "4 19",
"output": "7"
},
{
"input": "5 45",
"output": "9"
},
{
"input": "9999999999999987 99999999999999711",
"output": "8999999999999973"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "1827171 232817181719384635",
"output": "23281718171755747"
},
{
"input": "999999999999999999 1000000000000000000",
"output": "1"
},
{
"input": "73 678",
"output": "61"
}
] | 1,398,238,187 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 124 | 0 | p = [0, 1, 1]
p.extend([10 ** x for x in range(1,16)])
#print(p)
#a, b = input().split()
#I need to find the num which are smaller then this
def get_count(num):
if len(num) == 1:
return int(num)
elif len(num) == 2:
return int(num[0]) + 8 if num[0] > num[1] else int(num[0]) + 9
else:
result = 18
for i in range(3, len(num)):
result += p[i] * 9
firstDig = int(num[0])
lastDig = int(num[-1])
result += (firstDig - 1) * (10 ** (len(num) - 2) )
if firstDig <= lastDig:
result += int(num[1:-1]) + 1
return result
a, b = input().split()
ca = (get_count(a))
cb = (get_count(b))
print(cb - ca + 1 if a[0] == a[-1] else cb - ca )
# base = p[len(num)]
# result = 0
# i = 1
# while i < len(num):
# result += p[i] * 9
# i += 1
# start = int(num[0])
# end = int(num[-1])
# result += (start - 1) * (p[len(num) - 2] * 9)
# if start <= end:
# result += int(num[1:-1]) + 1
| Title: Little Elephant and Interval
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant very much loves sums on intervals.
This time he has a pair of integers *l* and *r* (*l*<=≤<=*r*). The Little Elephant has to find the number of such integers *x* (*l*<=≤<=*x*<=≤<=*r*), that the first digit of integer *x* equals the last one (in decimal notation). For example, such numbers as 101, 477474 or 9 will be included in the answer and 47, 253 or 1020 will not.
Help him and count the number of described numbers *x* for a given pair *l* and *r*.
Input Specification:
The single line contains a pair of integers *l* and *r* (1<=≤<=*l*<=≤<=*r*<=≤<=1018) — the boundaries of the interval.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specifier.
Output Specification:
On a single line print a single integer — the answer to the problem.
Demo Input:
['2 47\n', '47 1024\n']
Demo Output:
['12\n', '98\n']
Note:
In the first sample the answer includes integers 2, 3, 4, 5, 6, 7, 8, 9, 11, 22, 33, 44. | ```python
p = [0, 1, 1]
p.extend([10 ** x for x in range(1,16)])
#print(p)
#a, b = input().split()
#I need to find the num which are smaller then this
def get_count(num):
if len(num) == 1:
return int(num)
elif len(num) == 2:
return int(num[0]) + 8 if num[0] > num[1] else int(num[0]) + 9
else:
result = 18
for i in range(3, len(num)):
result += p[i] * 9
firstDig = int(num[0])
lastDig = int(num[-1])
result += (firstDig - 1) * (10 ** (len(num) - 2) )
if firstDig <= lastDig:
result += int(num[1:-1]) + 1
return result
a, b = input().split()
ca = (get_count(a))
cb = (get_count(b))
print(cb - ca + 1 if a[0] == a[-1] else cb - ca )
# base = p[len(num)]
# result = 0
# i = 1
# while i < len(num):
# result += p[i] * 9
# i += 1
# start = int(num[0])
# end = int(num[-1])
# result += (start - 1) * (p[len(num) - 2] * 9)
# if start <= end:
# result += int(num[1:-1]) + 1
``` | 0 |
|
764 | A | Taymyr is calling you | PROGRAMMING | 800 | [
"brute force",
"implementation",
"math"
] | null | null | Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist.
Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute. | The only string contains three integers — *n*, *m* and *z* (1<=≤<=*n*,<=*m*,<=*z*<=≤<=104). | Print single integer — the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls. | [
"1 1 10\n",
"1 2 5\n",
"2 3 9\n"
] | [
"10\n",
"2\n",
"1\n"
] | Taymyr is a place in the north of Russia.
In the first test the artists come each minute, as well as the calls, so we need to kill all of them.
In the second test we need to kill artists which come on the second and the fourth minutes.
In the third test — only the artist which comes on the sixth minute. | 500 | [
{
"input": "1 1 10",
"output": "10"
},
{
"input": "1 2 5",
"output": "2"
},
{
"input": "2 3 9",
"output": "1"
},
{
"input": "4 8 9",
"output": "1"
},
{
"input": "7 9 2",
"output": "0"
},
{
"input": "10000 10000 10000",
"output": "1"
},
{
"input": "24 22 9235",
"output": "34"
},
{
"input": "74 8 417",
"output": "1"
},
{
"input": "972 1 203",
"output": "0"
},
{
"input": "550 1 754",
"output": "1"
},
{
"input": "860 1 884",
"output": "1"
},
{
"input": "358 2 809",
"output": "2"
},
{
"input": "33 27 216",
"output": "0"
},
{
"input": "2940 1 9311",
"output": "3"
},
{
"input": "4624 1 1953",
"output": "0"
},
{
"input": "2696 2 7345",
"output": "2"
},
{
"input": "3443 2 6701",
"output": "0"
},
{
"input": "3 613 2275",
"output": "1"
},
{
"input": "1 10000 10000",
"output": "1"
},
{
"input": "10000 1 10000",
"output": "1"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "1 1 10000",
"output": "10000"
},
{
"input": "34 27 10000",
"output": "10"
},
{
"input": "2 2 9999",
"output": "4999"
},
{
"input": "2 2 1",
"output": "0"
},
{
"input": "6 4 36",
"output": "3"
},
{
"input": "33 6 3005",
"output": "45"
},
{
"input": "5 1 20",
"output": "4"
},
{
"input": "1 2 10",
"output": "5"
},
{
"input": "2 1 100",
"output": "50"
},
{
"input": "10 20 10000",
"output": "500"
},
{
"input": "8 12 12",
"output": "0"
}
] | 1,494,181,405 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 46 | 0 | call, performance, day = (int(x) for x in input().split())
calls_per_day = [n * call for n in range(1,day + 1)]
performances_per_day = [n * performance for n in range(1, day + 1)]
ans = 0
for acall in calls_per_day:
for aperformance in performances_per_day:
if acall == aperformance:
ans += 1
print(ans) | Title: Taymyr is calling you
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist.
Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute.
Input Specification:
The only string contains three integers — *n*, *m* and *z* (1<=≤<=*n*,<=*m*,<=*z*<=≤<=104).
Output Specification:
Print single integer — the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls.
Demo Input:
['1 1 10\n', '1 2 5\n', '2 3 9\n']
Demo Output:
['10\n', '2\n', '1\n']
Note:
Taymyr is a place in the north of Russia.
In the first test the artists come each minute, as well as the calls, so we need to kill all of them.
In the second test we need to kill artists which come on the second and the fourth minutes.
In the third test — only the artist which comes on the sixth minute. | ```python
call, performance, day = (int(x) for x in input().split())
calls_per_day = [n * call for n in range(1,day + 1)]
performances_per_day = [n * performance for n in range(1, day + 1)]
ans = 0
for acall in calls_per_day:
for aperformance in performances_per_day:
if acall == aperformance:
ans += 1
print(ans)
``` | 0 |
|
492 | A | Vanya and Cubes | PROGRAMMING | 800 | [
"implementation"
] | null | null | Vanya got *n* cubes. He decided to build a pyramid from them. Vanya wants to build the pyramid as follows: the top level of the pyramid must consist of 1 cube, the second level must consist of 1<=+<=2<==<=3 cubes, the third level must have 1<=+<=2<=+<=3<==<=6 cubes, and so on. Thus, the *i*-th level of the pyramid must have 1<=+<=2<=+<=...<=+<=(*i*<=-<=1)<=+<=*i* cubes.
Vanya wants to know what is the maximum height of the pyramid that he can make using the given cubes. | The first line contains integer *n* (1<=≤<=*n*<=≤<=104) — the number of cubes given to Vanya. | Print the maximum possible height of the pyramid in the single line. | [
"1\n",
"25\n"
] | [
"1\n",
"4\n"
] | Illustration to the second sample: | 500 | [
{
"input": "1",
"output": "1"
},
{
"input": "25",
"output": "4"
},
{
"input": "2",
"output": "1"
},
{
"input": "4115",
"output": "28"
},
{
"input": "9894",
"output": "38"
},
{
"input": "7969",
"output": "35"
},
{
"input": "6560",
"output": "33"
},
{
"input": "4",
"output": "2"
},
{
"input": "3",
"output": "1"
},
{
"input": "5",
"output": "2"
},
{
"input": "19",
"output": "3"
},
{
"input": "20",
"output": "4"
},
{
"input": "9880",
"output": "38"
},
{
"input": "9879",
"output": "37"
},
{
"input": "7770",
"output": "35"
},
{
"input": "7769",
"output": "34"
},
{
"input": "2925",
"output": "25"
},
{
"input": "220",
"output": "10"
},
{
"input": "219",
"output": "9"
},
{
"input": "3046",
"output": "25"
},
{
"input": "7590",
"output": "34"
},
{
"input": "1014",
"output": "17"
},
{
"input": "7142",
"output": "34"
},
{
"input": "9999",
"output": "38"
},
{
"input": "10000",
"output": "38"
}
] | 1,684,748,658 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 25 | 62 | 0 | n = int(input())
counter = 1
while n > 0:
n -= (counter * (counter + 1)) // 2
counter += 1
if n < 0:
print(counter - 2)
else:
print(counter - 1)
| Title: Vanya and Cubes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vanya got *n* cubes. He decided to build a pyramid from them. Vanya wants to build the pyramid as follows: the top level of the pyramid must consist of 1 cube, the second level must consist of 1<=+<=2<==<=3 cubes, the third level must have 1<=+<=2<=+<=3<==<=6 cubes, and so on. Thus, the *i*-th level of the pyramid must have 1<=+<=2<=+<=...<=+<=(*i*<=-<=1)<=+<=*i* cubes.
Vanya wants to know what is the maximum height of the pyramid that he can make using the given cubes.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=104) — the number of cubes given to Vanya.
Output Specification:
Print the maximum possible height of the pyramid in the single line.
Demo Input:
['1\n', '25\n']
Demo Output:
['1\n', '4\n']
Note:
Illustration to the second sample: | ```python
n = int(input())
counter = 1
while n > 0:
n -= (counter * (counter + 1)) // 2
counter += 1
if n < 0:
print(counter - 2)
else:
print(counter - 1)
``` | 3 |
|
999 | E | Reachability from the Capital | PROGRAMMING | 2,000 | [
"dfs and similar",
"graphs",
"greedy"
] | null | null | There are $n$ cities and $m$ roads in Berland. Each road connects a pair of cities. The roads in Berland are one-way.
What is the minimum number of new roads that need to be built to make all the cities reachable from the capital?
New roads will also be one-way. | The first line of input consists of three integers $n$, $m$ and $s$ ($1 \le n \le 5000, 0 \le m \le 5000, 1 \le s \le n$) — the number of cities, the number of roads and the index of the capital. Cities are indexed from $1$ to $n$.
The following $m$ lines contain roads: road $i$ is given as a pair of cities $u_i$, $v_i$ ($1 \le u_i, v_i \le n$, $u_i \ne v_i$). For each pair of cities $(u, v)$, there can be at most one road from $u$ to $v$. Roads in opposite directions between a pair of cities are allowed (i.e. from $u$ to $v$ and from $v$ to $u$). | Print one integer — the minimum number of extra roads needed to make all the cities reachable from city $s$. If all the cities are already reachable from $s$, print 0. | [
"9 9 1\n1 2\n1 3\n2 3\n1 5\n5 6\n6 1\n1 8\n9 8\n7 1\n",
"5 4 5\n1 2\n2 3\n3 4\n4 1\n"
] | [
"3\n",
"1\n"
] | The first example is illustrated by the following:
For example, you can add roads ($6, 4$), ($7, 9$), ($1, 7$) to make all the cities reachable from $s = 1$.
The second example is illustrated by the following:
In this example, you can add any one of the roads ($5, 1$), ($5, 2$), ($5, 3$), ($5, 4$) to make all the cities reachable from $s = 5$. | 0 | [
{
"input": "9 9 1\n1 2\n1 3\n2 3\n1 5\n5 6\n6 1\n1 8\n9 8\n7 1",
"output": "3"
},
{
"input": "5 4 5\n1 2\n2 3\n3 4\n4 1",
"output": "1"
},
{
"input": "5000 0 2956",
"output": "4999"
},
{
"input": "2 0 2",
"output": "1"
},
{
"input": "2 1 1\n1 2",
"output": "0"
},
{
"input": "2 1 2\n1 2",
"output": "1"
},
{
"input": "2 2 2\n1 2\n2 1",
"output": "0"
},
{
"input": "5000 2 238\n3212 238\n238 3212",
"output": "4998"
},
{
"input": "5000 2 3810\n3225 1137\n1137 3225",
"output": "4998"
},
{
"input": "100 1 30\n69 81",
"output": "98"
},
{
"input": "500 1 209\n183 107",
"output": "498"
},
{
"input": "1000 1 712\n542 916",
"output": "998"
},
{
"input": "39 40 38\n4 8\n24 28\n16 17\n7 25\n4 29\n34 35\n16 24\n21 10\n23 36\n36 14\n28 16\n34 19\n15 21\n22 38\n22 37\n37 27\n28 33\n3 29\n32 22\n12 30\n9 15\n5 19\n23 27\n19 17\n25 17\n24 11\n39 10\n6 20\n16 6\n3 18\n34 21\n15 38\n11 19\n11 3\n32 4\n15 13\n16 11\n11 7\n33 7\n3 33",
"output": "12"
},
{
"input": "8 8 1\n3 2\n3 4\n4 5\n5 3\n6 4\n6 7\n7 8\n8 6",
"output": "1"
},
{
"input": "7 7 1\n2 3\n4 2\n7 4\n5 7\n4 5\n4 6\n6 4",
"output": "1"
},
{
"input": "2333 1 1\n1 2",
"output": "2331"
},
{
"input": "7 4 2\n1 2\n3 4\n5 6\n7 1",
"output": "3"
},
{
"input": "1 0 1",
"output": "0"
},
{
"input": "9 9 1\n2 3\n3 4\n4 5\n6 2\n7 6\n8 7\n6 8\n5 9\n9 2",
"output": "1"
},
{
"input": "30 30 29\n29 9\n1 3\n15 5\n14 24\n7 18\n17 12\n5 9\n22 7\n26 20\n7 29\n8 2\n10 12\n17 18\n17 24\n8 12\n23 28\n10 15\n18 2\n29 13\n25 29\n9 2\n7 13\n11 5\n19 26\n10 5\n25 5\n20 10\n5 26\n24 23\n22 8",
"output": "13"
},
{
"input": "30 30 28\n16 28\n5 30\n7 17\n6 1\n12 28\n15 28\n14 30\n25 11\n25 10\n25 8\n12 30\n27 5\n30 10\n22 14\n30 13\n20 27\n15 25\n24 20\n20 15\n1 30\n3 10\n3 4\n3 18\n15 14\n18 22\n20 26\n10 3\n15 27\n23 29\n10 24",
"output": "9"
}
] | 1,657,113,090 | 2,147,483,647 | PyPy 3-64 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | #include <bits/stdc++.h>
using namespace std;
#define int long long
#define F first
#define S second
typedef vector<int> vi;
typedef vector<vi> vii;
void dfs(int i, vi& order, vi& vis, vii& g)
{
if (vis[i])
return;
vis[i] = 1;
for (int ot : g[i])
dfs(ot, order, vis, g);
order.push_back(i);
}
void grp(int i, int gn, vi& vis, vii& g)
{
if (vis[i])
return;
vis[i] = gn;
for (int ot : g[i])
grp(ot, gn, vis, g);
}
signed main()
{
ios_base::sync_with_stdio(0);
cin.tie(0);
int n, m;
cin >> n >> m;
vii g(n);
vii inv(n);
vector<pair<int, int>> edg(m);
for (int i = 0; i < m; i++) {
int u, v;
cin >> u >> v;
u--;
v--;
g[u].push_back(v);
inv[v].push_back(u);
edg[i] = { u, v };
}
vi order, vis(n);
for (int i = 0; i < n; i++)
dfs(i, order, vis, g);
reverse(order.begin(), order.end());
int gn = 0;
vi ngrp(n);
for (int i = 0; i < n; i++)
if (!ngrp[order[i]]) {
grp(order[i], gn, ngrp, inv);
gn++;
}
vi ent(gn);
for (auto p : edg) {
ent[ngrp[p.S]]++;
}
int cnt = 0;
for (int i = 0; i < n; i++) {
if (i == ngrp[0])
continue;
if (!ent[i])
cnt++;
}
cout << cnt << endl;
}
| Title: Reachability from the Capital
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are $n$ cities and $m$ roads in Berland. Each road connects a pair of cities. The roads in Berland are one-way.
What is the minimum number of new roads that need to be built to make all the cities reachable from the capital?
New roads will also be one-way.
Input Specification:
The first line of input consists of three integers $n$, $m$ and $s$ ($1 \le n \le 5000, 0 \le m \le 5000, 1 \le s \le n$) — the number of cities, the number of roads and the index of the capital. Cities are indexed from $1$ to $n$.
The following $m$ lines contain roads: road $i$ is given as a pair of cities $u_i$, $v_i$ ($1 \le u_i, v_i \le n$, $u_i \ne v_i$). For each pair of cities $(u, v)$, there can be at most one road from $u$ to $v$. Roads in opposite directions between a pair of cities are allowed (i.e. from $u$ to $v$ and from $v$ to $u$).
Output Specification:
Print one integer — the minimum number of extra roads needed to make all the cities reachable from city $s$. If all the cities are already reachable from $s$, print 0.
Demo Input:
['9 9 1\n1 2\n1 3\n2 3\n1 5\n5 6\n6 1\n1 8\n9 8\n7 1\n', '5 4 5\n1 2\n2 3\n3 4\n4 1\n']
Demo Output:
['3\n', '1\n']
Note:
The first example is illustrated by the following:
For example, you can add roads ($6, 4$), ($7, 9$), ($1, 7$) to make all the cities reachable from $s = 1$.
The second example is illustrated by the following:
In this example, you can add any one of the roads ($5, 1$), ($5, 2$), ($5, 3$), ($5, 4$) to make all the cities reachable from $s = 5$. | ```python
#include <bits/stdc++.h>
using namespace std;
#define int long long
#define F first
#define S second
typedef vector<int> vi;
typedef vector<vi> vii;
void dfs(int i, vi& order, vi& vis, vii& g)
{
if (vis[i])
return;
vis[i] = 1;
for (int ot : g[i])
dfs(ot, order, vis, g);
order.push_back(i);
}
void grp(int i, int gn, vi& vis, vii& g)
{
if (vis[i])
return;
vis[i] = gn;
for (int ot : g[i])
grp(ot, gn, vis, g);
}
signed main()
{
ios_base::sync_with_stdio(0);
cin.tie(0);
int n, m;
cin >> n >> m;
vii g(n);
vii inv(n);
vector<pair<int, int>> edg(m);
for (int i = 0; i < m; i++) {
int u, v;
cin >> u >> v;
u--;
v--;
g[u].push_back(v);
inv[v].push_back(u);
edg[i] = { u, v };
}
vi order, vis(n);
for (int i = 0; i < n; i++)
dfs(i, order, vis, g);
reverse(order.begin(), order.end());
int gn = 0;
vi ngrp(n);
for (int i = 0; i < n; i++)
if (!ngrp[order[i]]) {
grp(order[i], gn, ngrp, inv);
gn++;
}
vi ent(gn);
for (auto p : edg) {
ent[ngrp[p.S]]++;
}
int cnt = 0;
for (int i = 0; i < n; i++) {
if (i == ngrp[0])
continue;
if (!ent[i])
cnt++;
}
cout << cnt << endl;
}
``` | -1 |
|
431 | A | Black Square | PROGRAMMING | 800 | [
"implementation"
] | null | null | Quite recently, a very smart student named Jury decided that lectures are boring, so he downloaded a game called "Black Square" on his super cool touchscreen phone.
In this game, the phone's screen is divided into four vertical strips. Each second, a black square appears on some of the strips. According to the rules of the game, Jury must use this second to touch the corresponding strip to make the square go away. As Jury is both smart and lazy, he counted that he wastes exactly *a**i* calories on touching the *i*-th strip.
You've got a string *s*, describing the process of the game and numbers *a*1,<=*a*2,<=*a*3,<=*a*4. Calculate how many calories Jury needs to destroy all the squares? | The first line contains four space-separated integers *a*1, *a*2, *a*3, *a*4 (0<=≤<=*a*1,<=*a*2,<=*a*3,<=*a*4<=≤<=104).
The second line contains string *s* (1<=≤<=|*s*|<=≤<=105), where the *і*-th character of the string equals "1", if on the *i*-th second of the game the square appears on the first strip, "2", if it appears on the second strip, "3", if it appears on the third strip, "4", if it appears on the fourth strip. | Print a single integer — the total number of calories that Jury wastes. | [
"1 2 3 4\n123214\n",
"1 5 3 2\n11221\n"
] | [
"13\n",
"13\n"
] | none | 500 | [
{
"input": "1 2 3 4\n123214",
"output": "13"
},
{
"input": "1 5 3 2\n11221",
"output": "13"
},
{
"input": "5 5 5 1\n3422",
"output": "16"
},
{
"input": "4 3 2 1\n2",
"output": "3"
},
{
"input": "5651 6882 6954 4733\n2442313421",
"output": "60055"
},
{
"input": "0 0 0 0\n4132",
"output": "0"
},
{
"input": "3163 5778 83 7640\n11141442444",
"output": "64270"
},
{
"input": "1809 1302 7164 6122\n3144121413113111223311232232114144321414421243443243422322144324121433444342231344234443332241322442",
"output": "420780"
},
{
"input": "0 0 0 0\n1",
"output": "0"
},
{
"input": "1 2 3 4\n4",
"output": "4"
},
{
"input": "2343 7653 1242 5432\n1",
"output": "2343"
},
{
"input": "2343 7653 1242 5432\n2",
"output": "7653"
},
{
"input": "2343 7653 1242 5432\n3",
"output": "1242"
},
{
"input": "2343 7653 1242 5432\n4",
"output": "5432"
},
{
"input": "1 2 3 4\n123412",
"output": "13"
},
{
"input": "50 50 50 50\n11111111111111111111111111111111111111111111111111111",
"output": "2650"
},
{
"input": "1 2 3 4\n11111111111111111111111111111111111111111111111111",
"output": "50"
},
{
"input": "1 2 3 4\n23123231321231231231231231221232123121312321",
"output": "87"
},
{
"input": "1 2 3 4\n1111111111111222222222233333333333444444444444444",
"output": "126"
},
{
"input": "2 3 1 4\n121321232412342112312313213123123412131231231232",
"output": "105"
}
] | 1,658,997,710 | 2,147,483,647 | Python 3 | OK | TESTS | 49 | 78 | 0 | arr1 = input().split(' ')
arr = []
for s in arr1:
arr.append(int(s))
res = 0
seq = input()
for c in seq:
res += arr[int(c)-1]
print(res) | Title: Black Square
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Quite recently, a very smart student named Jury decided that lectures are boring, so he downloaded a game called "Black Square" on his super cool touchscreen phone.
In this game, the phone's screen is divided into four vertical strips. Each second, a black square appears on some of the strips. According to the rules of the game, Jury must use this second to touch the corresponding strip to make the square go away. As Jury is both smart and lazy, he counted that he wastes exactly *a**i* calories on touching the *i*-th strip.
You've got a string *s*, describing the process of the game and numbers *a*1,<=*a*2,<=*a*3,<=*a*4. Calculate how many calories Jury needs to destroy all the squares?
Input Specification:
The first line contains four space-separated integers *a*1, *a*2, *a*3, *a*4 (0<=≤<=*a*1,<=*a*2,<=*a*3,<=*a*4<=≤<=104).
The second line contains string *s* (1<=≤<=|*s*|<=≤<=105), where the *і*-th character of the string equals "1", if on the *i*-th second of the game the square appears on the first strip, "2", if it appears on the second strip, "3", if it appears on the third strip, "4", if it appears on the fourth strip.
Output Specification:
Print a single integer — the total number of calories that Jury wastes.
Demo Input:
['1 2 3 4\n123214\n', '1 5 3 2\n11221\n']
Demo Output:
['13\n', '13\n']
Note:
none | ```python
arr1 = input().split(' ')
arr = []
for s in arr1:
arr.append(int(s))
res = 0
seq = input()
for c in seq:
res += arr[int(c)-1]
print(res)
``` | 3 |
|
412 | A | Poster | PROGRAMMING | 900 | [
"greedy",
"implementation"
] | null | null | The R1 company has recently bought a high rise building in the centre of Moscow for its main office. It's time to decorate the new office, and the first thing to do is to write the company's slogan above the main entrance to the building.
The slogan of the company consists of *n* characters, so the decorators hung a large banner, *n* meters wide and 1 meter high, divided into *n* equal squares. The first character of the slogan must be in the first square (the leftmost) of the poster, the second character must be in the second square, and so on.
Of course, the R1 programmers want to write the slogan on the poster themselves. To do this, they have a large (and a very heavy) ladder which was put exactly opposite the *k*-th square of the poster. To draw the *i*-th character of the slogan on the poster, you need to climb the ladder, standing in front of the *i*-th square of the poster. This action (along with climbing up and down the ladder) takes one hour for a painter. The painter is not allowed to draw characters in the adjacent squares when the ladder is in front of the *i*-th square because the uncomfortable position of the ladder may make the characters untidy. Besides, the programmers can move the ladder. In one hour, they can move the ladder either a meter to the right or a meter to the left.
Drawing characters and moving the ladder is very tiring, so the programmers want to finish the job in as little time as possible. Develop for them an optimal poster painting plan! | The first line contains two integers, *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=100) — the number of characters in the slogan and the initial position of the ladder, correspondingly. The next line contains the slogan as *n* characters written without spaces. Each character of the slogan is either a large English letter, or digit, or one of the characters: '.', '!', ',', '?'. | In *t* lines, print the actions the programmers need to make. In the *i*-th line print:
- "LEFT" (without the quotes), if the *i*-th action was "move the ladder to the left"; - "RIGHT" (without the quotes), if the *i*-th action was "move the ladder to the right"; - "PRINT *x*" (without the quotes), if the *i*-th action was to "go up the ladder, paint character *x*, go down the ladder".
The painting time (variable *t*) must be minimum possible. If there are multiple optimal painting plans, you can print any of them. | [
"2 2\nR1\n",
"2 1\nR1\n",
"6 4\nGO?GO!\n"
] | [
"PRINT 1\nLEFT\nPRINT R\n",
"PRINT R\nRIGHT\nPRINT 1\n",
"RIGHT\nRIGHT\nPRINT !\nLEFT\nPRINT O\nLEFT\nPRINT G\nLEFT\nPRINT ?\nLEFT\nPRINT O\nLEFT\nPRINT G\n"
] | Note that the ladder cannot be shifted by less than one meter. The ladder can only stand in front of some square of the poster. For example, you cannot shift a ladder by half a meter and position it between two squares. Then go up and paint the first character and the second character. | 500 | [
{
"input": "2 2\nR1",
"output": "PRINT 1\nLEFT\nPRINT R"
},
{
"input": "2 1\nR1",
"output": "PRINT R\nRIGHT\nPRINT 1"
},
{
"input": "6 4\nGO?GO!",
"output": "RIGHT\nRIGHT\nPRINT !\nLEFT\nPRINT O\nLEFT\nPRINT G\nLEFT\nPRINT ?\nLEFT\nPRINT O\nLEFT\nPRINT G"
},
{
"input": "7 3\nME,YOU.",
"output": "LEFT\nLEFT\nPRINT M\nRIGHT\nPRINT E\nRIGHT\nPRINT ,\nRIGHT\nPRINT Y\nRIGHT\nPRINT O\nRIGHT\nPRINT U\nRIGHT\nPRINT ."
},
{
"input": "10 1\nEK5JQMS5QN",
"output": "PRINT E\nRIGHT\nPRINT K\nRIGHT\nPRINT 5\nRIGHT\nPRINT J\nRIGHT\nPRINT Q\nRIGHT\nPRINT M\nRIGHT\nPRINT S\nRIGHT\nPRINT 5\nRIGHT\nPRINT Q\nRIGHT\nPRINT N"
},
{
"input": "85 84\n73IW80UODC8B,UR7S8WMNATV0JSRF4W0B2VV8LCAX6SGCYY8?LHDKJEO29WXQWT9.WY1VY7408S1W04GNDZPK",
"output": "RIGHT\nPRINT K\nLEFT\nPRINT P\nLEFT\nPRINT Z\nLEFT\nPRINT D\nLEFT\nPRINT N\nLEFT\nPRINT G\nLEFT\nPRINT 4\nLEFT\nPRINT 0\nLEFT\nPRINT W\nLEFT\nPRINT 1\nLEFT\nPRINT S\nLEFT\nPRINT 8\nLEFT\nPRINT 0\nLEFT\nPRINT 4\nLEFT\nPRINT 7\nLEFT\nPRINT Y\nLEFT\nPRINT V\nLEFT\nPRINT 1\nLEFT\nPRINT Y\nLEFT\nPRINT W\nLEFT\nPRINT .\nLEFT\nPRINT 9\nLEFT\nPRINT T\nLEFT\nPRINT W\nLEFT\nPRINT Q\nLEFT\nPRINT X\nLEFT\nPRINT W\nLEFT\nPRINT 9\nLEFT\nPRINT 2\nLEFT\nPRINT O\nLEFT\nPRINT E\nLEFT\nPRINT J\nLEFT\nPRINT K\nLEFT\nPRINT D\n..."
},
{
"input": "59 53\n7NWD!9PC11C8S4TQABBTJO,?CO6YGOM!W0QR94CZJBD9U1YJY23YB354,8F",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT F\nLEFT\nPRINT 8\nLEFT\nPRINT ,\nLEFT\nPRINT 4\nLEFT\nPRINT 5\nLEFT\nPRINT 3\nLEFT\nPRINT B\nLEFT\nPRINT Y\nLEFT\nPRINT 3\nLEFT\nPRINT 2\nLEFT\nPRINT Y\nLEFT\nPRINT J\nLEFT\nPRINT Y\nLEFT\nPRINT 1\nLEFT\nPRINT U\nLEFT\nPRINT 9\nLEFT\nPRINT D\nLEFT\nPRINT B\nLEFT\nPRINT J\nLEFT\nPRINT Z\nLEFT\nPRINT C\nLEFT\nPRINT 4\nLEFT\nPRINT 9\nLEFT\nPRINT R\nLEFT\nPRINT Q\nLEFT\nPRINT 0\nLEFT\nPRINT W\nLEFT\nPRINT !\nLEFT\nPRINT M\nLEFT\nPRINT O\nLEFT\nPRINT G\nLEFT\nPRIN..."
},
{
"input": "100 79\nF2.58O.L4A!QX!,.,YQUE.RZW.ENQCZKUFNG?.J6FT?L59BIHKFB?,44MAHSTD8?Z.UP3N!76YW6KVI?4AKWDPP0?3HPERM3PCUR",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT R\nLEFT\nPRINT U\nLEFT\nPRINT C\nLEFT\nPRINT P\nLEFT\nPRINT 3\nLEFT\nPRINT M\nLEFT\nPRINT R\nLEFT\nPRINT E\nLEFT\nPRINT P\nLEFT\nPRINT H\nLEFT\nPRINT 3\nLEFT\nPRINT ?\nLEFT\nPRINT 0\nLEFT\nPRINT P\nLEFT\nPRINT P\nLEFT\nPRINT D\nLEFT\nPRINT W\nLEFT\nPRINT K\nLEFT\nPRINT A\nLEFT\nPRINT 4\nLEFT\nPRINT ?\nLEFT\nPRINT I\nLEFT\nPRINT V\nLEFT\nPRINT K\nLEFT\nPRIN..."
},
{
"input": "1 1\n!",
"output": "PRINT !"
},
{
"input": "34 20\n.C0QPPSWQKGBSH0,VGM!N,5SX.M9Q,D1DT",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT T\nLEFT\nPRINT D\nLEFT\nPRINT 1\nLEFT\nPRINT D\nLEFT\nPRINT ,\nLEFT\nPRINT Q\nLEFT\nPRINT 9\nLEFT\nPRINT M\nLEFT\nPRINT .\nLEFT\nPRINT X\nLEFT\nPRINT S\nLEFT\nPRINT 5\nLEFT\nPRINT ,\nLEFT\nPRINT N\nLEFT\nPRINT !\nLEFT\nPRINT M\nLEFT\nPRINT G\nLEFT\nPRINT V\nLEFT\nPRINT ,\nLEFT\nPRINT 0\nLEFT\nPRINT H\nLEFT\nPRINT S\nLEFT\nPRINT B\nLEFT\nPRINT G\nLEFT\nPRINT K\nLEFT\nPRINT Q\nLEFT\nPRINT W\nLEFT\nPRINT S\n..."
},
{
"input": "99 98\nR8MZTEG240LNHY33H7.2CMWM73ZK,P5R,RGOA,KYKMIOG7CMPNHV3R2KM,N374IP8HN97XVMG.PSIPS8H3AXFGK0CJ76,EVKRZ9",
"output": "RIGHT\nPRINT 9\nLEFT\nPRINT Z\nLEFT\nPRINT R\nLEFT\nPRINT K\nLEFT\nPRINT V\nLEFT\nPRINT E\nLEFT\nPRINT ,\nLEFT\nPRINT 6\nLEFT\nPRINT 7\nLEFT\nPRINT J\nLEFT\nPRINT C\nLEFT\nPRINT 0\nLEFT\nPRINT K\nLEFT\nPRINT G\nLEFT\nPRINT F\nLEFT\nPRINT X\nLEFT\nPRINT A\nLEFT\nPRINT 3\nLEFT\nPRINT H\nLEFT\nPRINT 8\nLEFT\nPRINT S\nLEFT\nPRINT P\nLEFT\nPRINT I\nLEFT\nPRINT S\nLEFT\nPRINT P\nLEFT\nPRINT .\nLEFT\nPRINT G\nLEFT\nPRINT M\nLEFT\nPRINT V\nLEFT\nPRINT X\nLEFT\nPRINT 7\nLEFT\nPRINT 9\nLEFT\nPRINT N\nLEFT\nPRINT H\n..."
},
{
"input": "98 72\n.1?7CJ!EFZHO5WUKDZV,0EE92PTAGY078WKN!!41E,Q7381U60!9C,VONEZ6!SFFNDBI86MACX0?D?9!U2UV7S,977PNDSF0HY",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT Y\nLEFT\nPRINT H\nLEFT\nPRINT 0\nLEFT\nPRINT F\nLEFT\nPRINT S\nLEFT\nPRINT D\nLEFT\nPRINT N\nLEFT\nPRINT P\nLEFT\nPRINT 7\nLEFT\nPRINT 7\nLEFT\nPRINT 9\nLEFT\nPRINT ,\nLEFT\nPRINT S\nLEFT\nPRINT 7\nLEFT\nPRINT V\nLEFT\nPRINT U\nLEFT\nPRINT 2\nLEFT\nPRINT U\nLEFT\nPRINT !\nLEFT\nPRINT 9\nLEFT\nPRINT ?\nLEFT\nPRINT D\nLEFT\n..."
},
{
"input": "97 41\nGQSPZGGRZ0KWUMI79GOXP7!RR9E?Z5YO?6WUL!I7GCXRS8T,PEFQM7CZOUG8HLC7198J1?C69JD00Q!QY1AK!27I?WB?UAUIG",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT G\nRIGHT\nPRINT Q\nRIGHT\nPRINT S\nRIGHT\nPRINT P\nRIGHT\nPRINT Z\nRIGHT\nPRINT G\nRIGHT\nPRINT G\nRIGHT\nPRINT R\nRIGHT\nPRINT Z\nRIGHT\nPRINT 0\nRIGHT\nPRINT K\nRIGHT\nPRINT W\nRIGHT\nPRINT U\nRIGHT\nPRINT M\nRIGHT\nPRINT I\nRIGHT\nPRINT 7\nRIGHT\nPRINT 9\nRIGHT\n..."
},
{
"input": "96 28\nZCF!PLS27YGXHK8P46H,C.A7MW90ED,4BA!T0!XKIR2GE0HD..YZ0O20O8TA7E35G5YT3L4W5ESSYBHG8.TIQENS4I.R8WE,",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT Z\nRIGHT\nPRINT C\nRIGHT\nPRINT F\nRIGHT\nPRINT !\nRIGHT\nPRINT P\nRIGHT\nPRINT L\nRIGHT\nPRINT S\nRIGHT\nPRINT 2\nRIGHT\nPRINT 7\nRIGHT\nPRINT Y\nRIGHT\nPRINT G\nRIGHT\nPRINT X\nRIGHT\nPRINT H\nRIGHT\nPRINT K\nRIGHT\nPRINT 8\nRIGHT\nPRINT P\nRIGHT\nPRINT 4\nRIGHT\nPRINT 6\nRIGHT\nPRINT H\nRIGHT\nPRINT ,\nRIGHT\nPRINT C\nRIGHT\nPRINT .\nRIGH..."
},
{
"input": "15 3\n!..!?!,!,..,?!.",
"output": "LEFT\nLEFT\nPRINT !\nRIGHT\nPRINT .\nRIGHT\nPRINT .\nRIGHT\nPRINT !\nRIGHT\nPRINT ?\nRIGHT\nPRINT !\nRIGHT\nPRINT ,\nRIGHT\nPRINT !\nRIGHT\nPRINT ,\nRIGHT\nPRINT .\nRIGHT\nPRINT .\nRIGHT\nPRINT ,\nRIGHT\nPRINT ?\nRIGHT\nPRINT !\nRIGHT\nPRINT ."
},
{
"input": "93 81\nGMIBVKYLURQLWHBGTFNJZZAZNUJJTPQKCPGDMGCDTTGXOANWKTDZSIYBUPFUXGQHCMVIEQCTINRTIUSPGMVZPGWBHPIXC",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT C\nLEFT\nPRINT X\nLEFT\nPRINT I\nLEFT\nPRINT P\nLEFT\nPRINT H\nLEFT\nPRINT B\nLEFT\nPRINT W\nLEFT\nPRINT G\nLEFT\nPRINT P\nLEFT\nPRINT Z\nLEFT\nPRINT V\nLEFT\nPRINT M\nLEFT\nPRINT G\nLEFT\nPRINT P\nLEFT\nPRINT S\nLEFT\nPRINT U\nLEFT\nPRINT I\nLEFT\nPRINT T\nLEFT\nPRINT R\nLEFT\nPRINT N\nLEFT\nPRINT I\nLEFT\nPRINT T\nLEFT\nPRINT C\nLEFT\nPRINT Q\nLEFT\nPRINT E\nLEFT\nPRINT I\nLEFT\nPRINT V\nLEFT\nPRINT M\nLEFT\nPRINT C..."
},
{
"input": "88 30\n5847857685475132927321580125243001071762130696139249809763381765504146602574972381323476",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT 5\nRIGHT\nPRINT 8\nRIGHT\nPRINT 4\nRIGHT\nPRINT 7\nRIGHT\nPRINT 8\nRIGHT\nPRINT 5\nRIGHT\nPRINT 7\nRIGHT\nPRINT 6\nRIGHT\nPRINT 8\nRIGHT\nPRINT 5\nRIGHT\nPRINT 4\nRIGHT\nPRINT 7\nRIGHT\nPRINT 5\nRIGHT\nPRINT 1\nRIGHT\nPRINT 3\nRIGHT\nPRINT 2\nRIGHT\nPRINT 9\nRIGHT\nPRINT 2\nRIGHT\nPRINT 7\nRIGHT\nPRINT 3\nRIGHT\nPRINT 2\nRIGHT\nP..."
},
{
"input": "100 50\n5B2N,CXCWOIWH71XV!HCFEUCN3U88JDRIFRO2VHY?!N.RGH.?W14X5S.Y00RIY6YA19BPD0T,WECXYI,O2RF1U4NX9,F5AVLPOYK",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT 5\nRIGHT\nPRINT B\nRIGHT\nPRINT 2\nRIGHT\nPRINT N\nRIGHT\nPRINT ,\nRIGHT\nPRINT C\nRIGHT\nPRINT X\nRIGHT\nPRINT C\nRIGHT\nPRINT W\nRIGHT\nPRINT O\nRIGHT\nPRINT I\nRIGHT\nPRINT W\nRIGHT\nPRINT H\nRIGHT\nPRINT 7\n..."
},
{
"input": "100 51\n!X85PT!WJDNS9KA6D2SJBR,U,G7M914W07EK3EAJ4XG..UHA3KOOFYJ?M0MEFDC6KNCNGKS0A!S,C02H4TSZA1U7NDBTIY?,7XZ4",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT 4\nLEFT\nPRINT Z\nLEFT\nPRINT X\nLEFT\nPRINT 7\nLEFT\nPRINT ,\nLEFT\nPRINT ?\nLEFT\nPRINT Y\nLEFT\nPRINT I\nLEFT\nPRINT T\nLEFT\nPRINT B\nLEFT\nPRINT D\nLEFT\nPRI..."
},
{
"input": "100 52\n!MLPE.0K72RW9XKHR60QE?69ILFSIKYSK5AG!TA5.02VG5OMY0967G2RI.62CNK9L8G!7IG9F0XNNCGSDOTFD?I,EBP31HRERZSX",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT X\nLEFT\nPRINT S\nLEFT\nPRINT Z\nLEFT\nPRINT R\nLEFT\nPRINT E\nLEFT\nPRINT R\nLEFT\nPRINT H\nLEFT\nPRINT 1\nLEFT\nPRINT 3\nLEFT\nPRINT P\nLEFT\nPRINT B\nLEFT\nPRINT E\nL..."
},
{
"input": "100 49\n86C0NR7V,BE09,7,ER715OQ3GZ,P014H4BSQ5YS?OFNDD7YWI?S?UMKIWHSBDZ4398?SSDZLTDU1L?G4QVAB53HNDS!4PYW5C!VI",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT 8\nRIGHT\nPRINT 6\nRIGHT\nPRINT C\nRIGHT\nPRINT 0\nRIGHT\nPRINT N\nRIGHT\nPRINT R\nRIGHT\nPRINT 7\nRIGHT\nPRINT V\nRIGHT\nPRINT ,\nRIGHT\nPRINT B\nRIGHT\nPRINT E\nRIGHT\nPRINT 0\nRIGHT\nPRINT 9\nRIGHT\nPRINT ,\nRIGHT\n..."
},
{
"input": "100 48\nFO,IYI4AAV?4?N5PWMZX1AINZLKAUJCKMDWU4CROT?.LYWYLYU5S80,15A6VGP!V0N,O.70CP?GEA52WG59UYWU1MMMU4BERVY.!",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT F\nRIGHT\nPRINT O\nRIGHT\nPRINT ,\nRIGHT\nPRINT I\nRIGHT\nPRINT Y\nRIGHT\nPRINT I\nRIGHT\nPRINT 4\nRIGHT\nPRINT A\nRIGHT\nPRINT A\nRIGHT\nPRINT V\nRIGHT\nPRINT ?\nRIGHT\nPRINT 4\nRIGHT\nPRINT ?\nRIGHT\nPRINT N\nRIGHT\nPRINT..."
},
{
"input": "100 100\nE?F,W.,,O51!!G13ZWP?YHWRT69?RQPW7,V,EM3336F1YAIKJIME1M45?LJM42?45V7221?P.DIO9FK245LXKMR4ALKPDLA5YI2Y",
"output": "PRINT Y\nLEFT\nPRINT 2\nLEFT\nPRINT I\nLEFT\nPRINT Y\nLEFT\nPRINT 5\nLEFT\nPRINT A\nLEFT\nPRINT L\nLEFT\nPRINT D\nLEFT\nPRINT P\nLEFT\nPRINT K\nLEFT\nPRINT L\nLEFT\nPRINT A\nLEFT\nPRINT 4\nLEFT\nPRINT R\nLEFT\nPRINT M\nLEFT\nPRINT K\nLEFT\nPRINT X\nLEFT\nPRINT L\nLEFT\nPRINT 5\nLEFT\nPRINT 4\nLEFT\nPRINT 2\nLEFT\nPRINT K\nLEFT\nPRINT F\nLEFT\nPRINT 9\nLEFT\nPRINT O\nLEFT\nPRINT I\nLEFT\nPRINT D\nLEFT\nPRINT .\nLEFT\nPRINT P\nLEFT\nPRINT ?\nLEFT\nPRINT 1\nLEFT\nPRINT 2\nLEFT\nPRINT 2\nLEFT\nPRINT 7\nLEFT\nP..."
},
{
"input": "100 1\nJJ0ZOX4CY,SQ9L0K!2C9TM3C6K.6R21717I37VDSXGHBMR2!J820AI75D.O7NYMT6F.AGJ8R0RDETWOACK3P6UZAUYRKMKJ!G3WF",
"output": "PRINT J\nRIGHT\nPRINT J\nRIGHT\nPRINT 0\nRIGHT\nPRINT Z\nRIGHT\nPRINT O\nRIGHT\nPRINT X\nRIGHT\nPRINT 4\nRIGHT\nPRINT C\nRIGHT\nPRINT Y\nRIGHT\nPRINT ,\nRIGHT\nPRINT S\nRIGHT\nPRINT Q\nRIGHT\nPRINT 9\nRIGHT\nPRINT L\nRIGHT\nPRINT 0\nRIGHT\nPRINT K\nRIGHT\nPRINT !\nRIGHT\nPRINT 2\nRIGHT\nPRINT C\nRIGHT\nPRINT 9\nRIGHT\nPRINT T\nRIGHT\nPRINT M\nRIGHT\nPRINT 3\nRIGHT\nPRINT C\nRIGHT\nPRINT 6\nRIGHT\nPRINT K\nRIGHT\nPRINT .\nRIGHT\nPRINT 6\nRIGHT\nPRINT R\nRIGHT\nPRINT 2\nRIGHT\nPRINT 1\nRIGHT\nPRINT 7\nRIGHT\n..."
},
{
"input": "99 50\nLQJ!7GDFJ,SKQ8J2R?I4VA0K2.NDY.AZ?7K275NA81.YK!DO,PCQCJYL6BUU30XQ300FP0,LB!5TYTRSGOB4ELZ8IBKGVDNW8?B",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT B\nLEFT\nPRINT ?\nLEFT\nPRINT 8\nLEFT\nPRINT W\nLEFT\nPRINT N\nLEFT\nPRINT D\nLEFT\nPRINT V\nLEFT\nPRINT G\nLEFT\nPRINT K\nLEFT\nPRINT B\nLEFT\nPRINT I\nLEFT\nPRI..."
},
{
"input": "99 51\nD9QHZXG46IWHHLTD2E,AZO0.M40R4B1WU6F,0QNZ37NQ0ACSU6!7Z?H02AD?0?9,5N5RG6PVOWIE6YA9QBCOHVNU??YT6,29SAC",
"output": "RIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nRIGHT\nPRINT C\nLEFT\nPRINT A\nLEFT\nPRINT S\nLEFT\nPRINT 9\nLEFT\nPRINT 2\nLEFT\nPRINT ,\nLEFT\nPRINT 6\nLEFT\nPRINT T\nLEFT\nPRINT Y\nLEFT\nPRINT ?\nLEFT\nPRINT ?\nLEFT\nPRINT U\nL..."
},
{
"input": "99 49\nOLUBX0Q3VPNSH,QCAWFVSKZA3NUURJ9PXBS3?72PMJ,27QTA7Z1N?6Q2CSJE,W0YX8XWS.W6B?K?M!PYAD30BX?8.VJCC,P8QL9",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT O\nRIGHT\nPRINT L\nRIGHT\nPRINT U\nRIGHT\nPRINT B\nRIGHT\nPRINT X\nRIGHT\nPRINT 0\nRIGHT\nPRINT Q\nRIGHT\nPRINT 3\nRIGHT\nPRINT V\nRIGHT\nPRINT P\nRIGHT\nPRINT N\nRIGHT\nPRINT S\nRIGHT\nPRINT H\nRIGHT\nPRINT ,\nRIGHT\n..."
},
{
"input": "99 48\nW0GU5MNE5!JVIOO2SR5OO7RWLHDFH.HLCCX89O21SLD9!CU0MFG3RFZUFT!R0LWNVNSS.W54.67N4VAN1Q2J9NMO9Q6.UE8U6B8",
"output": "LEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nLEFT\nPRINT W\nRIGHT\nPRINT 0\nRIGHT\nPRINT G\nRIGHT\nPRINT U\nRIGHT\nPRINT 5\nRIGHT\nPRINT M\nRIGHT\nPRINT N\nRIGHT\nPRINT E\nRIGHT\nPRINT 5\nRIGHT\nPRINT !\nRIGHT\nPRINT J\nRIGHT\nPRINT V\nRIGHT\nPRINT I\nRIGHT\nPRINT O\nRIGHT\nPRINT..."
},
{
"input": "2 1\nOA",
"output": "PRINT O\nRIGHT\nPRINT A"
},
{
"input": "2 2\nGW",
"output": "PRINT W\nLEFT\nPRINT G"
},
{
"input": "3 1\n.VP",
"output": "PRINT .\nRIGHT\nPRINT V\nRIGHT\nPRINT P"
},
{
"input": "3 2\nUD0",
"output": "RIGHT\nPRINT 0\nLEFT\nPRINT D\nLEFT\nPRINT U"
},
{
"input": "3 3\nMYE",
"output": "PRINT E\nLEFT\nPRINT Y\nLEFT\nPRINT M"
},
{
"input": "4 1\nC5EJ",
"output": "PRINT C\nRIGHT\nPRINT 5\nRIGHT\nPRINT E\nRIGHT\nPRINT J"
},
{
"input": "4 2\n5QSW",
"output": "LEFT\nPRINT 5\nRIGHT\nPRINT Q\nRIGHT\nPRINT S\nRIGHT\nPRINT W"
},
{
"input": "4 3\n!F3D",
"output": "RIGHT\nPRINT D\nLEFT\nPRINT 3\nLEFT\nPRINT F\nLEFT\nPRINT !"
},
{
"input": "4 4\nS!?Y",
"output": "PRINT Y\nLEFT\nPRINT ?\nLEFT\nPRINT !\nLEFT\nPRINT S"
},
{
"input": "5 1\nIP4!N",
"output": "PRINT I\nRIGHT\nPRINT P\nRIGHT\nPRINT 4\nRIGHT\nPRINT !\nRIGHT\nPRINT N"
},
{
"input": "5 2\nI7??5",
"output": "LEFT\nPRINT I\nRIGHT\nPRINT 7\nRIGHT\nPRINT ?\nRIGHT\nPRINT ?\nRIGHT\nPRINT 5"
},
{
"input": "5 3\nASNUW",
"output": "RIGHT\nRIGHT\nPRINT W\nLEFT\nPRINT U\nLEFT\nPRINT N\nLEFT\nPRINT S\nLEFT\nPRINT A"
},
{
"input": "5 4\n3?,4L",
"output": "RIGHT\nPRINT L\nLEFT\nPRINT 4\nLEFT\nPRINT ,\nLEFT\nPRINT ?\nLEFT\nPRINT 3"
},
{
"input": "5 5\n30COA",
"output": "PRINT A\nLEFT\nPRINT O\nLEFT\nPRINT C\nLEFT\nPRINT 0\nLEFT\nPRINT 3"
},
{
"input": "4 2\nABCD",
"output": "LEFT\nPRINT A\nRIGHT\nPRINT B\nRIGHT\nPRINT C\nRIGHT\nPRINT D"
}
] | 1,397,842,588 | 5,188 | Python 3 | OK | TESTS | 43 | 124 | 0 | n, k = map(int, input().split());
st=input();
if (2*k)<= n:
for i in range(k-1): print('LEFT');
naprav='RIGHT'
else:
for i in range(n-k): print('RIGHT') ;
naprav='LEFT'
st=st[::-1];
print('PRINT', st[0])
for i in range(1, len(st)):
print(naprav);
print('PRINT',st[i])
| Title: Poster
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The R1 company has recently bought a high rise building in the centre of Moscow for its main office. It's time to decorate the new office, and the first thing to do is to write the company's slogan above the main entrance to the building.
The slogan of the company consists of *n* characters, so the decorators hung a large banner, *n* meters wide and 1 meter high, divided into *n* equal squares. The first character of the slogan must be in the first square (the leftmost) of the poster, the second character must be in the second square, and so on.
Of course, the R1 programmers want to write the slogan on the poster themselves. To do this, they have a large (and a very heavy) ladder which was put exactly opposite the *k*-th square of the poster. To draw the *i*-th character of the slogan on the poster, you need to climb the ladder, standing in front of the *i*-th square of the poster. This action (along with climbing up and down the ladder) takes one hour for a painter. The painter is not allowed to draw characters in the adjacent squares when the ladder is in front of the *i*-th square because the uncomfortable position of the ladder may make the characters untidy. Besides, the programmers can move the ladder. In one hour, they can move the ladder either a meter to the right or a meter to the left.
Drawing characters and moving the ladder is very tiring, so the programmers want to finish the job in as little time as possible. Develop for them an optimal poster painting plan!
Input Specification:
The first line contains two integers, *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=100) — the number of characters in the slogan and the initial position of the ladder, correspondingly. The next line contains the slogan as *n* characters written without spaces. Each character of the slogan is either a large English letter, or digit, or one of the characters: '.', '!', ',', '?'.
Output Specification:
In *t* lines, print the actions the programmers need to make. In the *i*-th line print:
- "LEFT" (without the quotes), if the *i*-th action was "move the ladder to the left"; - "RIGHT" (without the quotes), if the *i*-th action was "move the ladder to the right"; - "PRINT *x*" (without the quotes), if the *i*-th action was to "go up the ladder, paint character *x*, go down the ladder".
The painting time (variable *t*) must be minimum possible. If there are multiple optimal painting plans, you can print any of them.
Demo Input:
['2 2\nR1\n', '2 1\nR1\n', '6 4\nGO?GO!\n']
Demo Output:
['PRINT 1\nLEFT\nPRINT R\n', 'PRINT R\nRIGHT\nPRINT 1\n', 'RIGHT\nRIGHT\nPRINT !\nLEFT\nPRINT O\nLEFT\nPRINT G\nLEFT\nPRINT ?\nLEFT\nPRINT O\nLEFT\nPRINT G\n']
Note:
Note that the ladder cannot be shifted by less than one meter. The ladder can only stand in front of some square of the poster. For example, you cannot shift a ladder by half a meter and position it between two squares. Then go up and paint the first character and the second character. | ```python
n, k = map(int, input().split());
st=input();
if (2*k)<= n:
for i in range(k-1): print('LEFT');
naprav='RIGHT'
else:
for i in range(n-k): print('RIGHT') ;
naprav='LEFT'
st=st[::-1];
print('PRINT', st[0])
for i in range(1, len(st)):
print(naprav);
print('PRINT',st[i])
``` | 3 |
|
25 | B | Phone numbers | PROGRAMMING | 1,100 | [
"implementation"
] | B. Phone numbers | 2 | 256 | Phone number in Berland is a sequence of *n* digits. Often, to make it easier to memorize the number, it is divided into groups of two or three digits. For example, the phone number 1198733 is easier to remember as 11-987-33. Your task is to find for a given phone number any of its divisions into groups of two or three digits. | The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of digits in the phone number. The second line contains *n* digits — the phone number to divide into groups. | Output any of divisions of the given phone number into groups of two or three digits. Separate groups by single character -. If the answer is not unique, output any. | [
"6\n549871\n",
"7\n1198733\n"
] | [
"54-98-71",
"11-987-33\n"
] | none | 0 | [
{
"input": "6\n549871",
"output": "54-98-71"
},
{
"input": "7\n1198733",
"output": "119-87-33"
},
{
"input": "2\n74",
"output": "74"
},
{
"input": "2\n33",
"output": "33"
},
{
"input": "3\n074",
"output": "074"
},
{
"input": "3\n081",
"output": "081"
},
{
"input": "4\n3811",
"output": "38-11"
},
{
"input": "5\n21583",
"output": "215-83"
},
{
"input": "8\n33408349",
"output": "33-40-83-49"
},
{
"input": "9\n988808426",
"output": "988-80-84-26"
},
{
"input": "10\n0180990956",
"output": "01-80-99-09-56"
},
{
"input": "15\n433488906230138",
"output": "433-48-89-06-23-01-38"
},
{
"input": "22\n7135498415686025907059",
"output": "71-35-49-84-15-68-60-25-90-70-59"
},
{
"input": "49\n2429965524999668169991253653390090510755018570235",
"output": "242-99-65-52-49-99-66-81-69-99-12-53-65-33-90-09-05-10-75-50-18-57-02-35"
},
{
"input": "72\n491925337784111770500147619881727525570039735507439360627744863794794290",
"output": "49-19-25-33-77-84-11-17-70-50-01-47-61-98-81-72-75-25-57-00-39-73-55-07-43-93-60-62-77-44-86-37-94-79-42-90"
},
{
"input": "95\n32543414456047900690980198395035321172843693417425457554204776648220562494524275489599199209210",
"output": "325-43-41-44-56-04-79-00-69-09-80-19-83-95-03-53-21-17-28-43-69-34-17-42-54-57-55-42-04-77-66-48-22-05-62-49-45-24-27-54-89-59-91-99-20-92-10"
},
{
"input": "97\n9362344595153688016434451101547661156123505108492010669557671355055642365998461003851354321478898",
"output": "936-23-44-59-51-53-68-80-16-43-44-51-10-15-47-66-11-56-12-35-05-10-84-92-01-06-69-55-76-71-35-50-55-64-23-65-99-84-61-00-38-51-35-43-21-47-88-98"
},
{
"input": "98\n65521815795893886057122984634320900545031770769333931308009346017867969790810907868670369236928568",
"output": "65-52-18-15-79-58-93-88-60-57-12-29-84-63-43-20-90-05-45-03-17-70-76-93-33-93-13-08-00-93-46-01-78-67-96-97-90-81-09-07-86-86-70-36-92-36-92-85-68"
},
{
"input": "99\n455213856470326729480192345541970106407563996625458559297407682539801838244443866898560852503660390",
"output": "455-21-38-56-47-03-26-72-94-80-19-23-45-54-19-70-10-64-07-56-39-96-62-54-58-55-92-97-40-76-82-53-98-01-83-82-44-44-38-66-89-85-60-85-25-03-66-03-90"
},
{
"input": "100\n4004223124942730640235383244438257614581534320356060987241659784249551110165034719443327659510644224",
"output": "40-04-22-31-24-94-27-30-64-02-35-38-32-44-43-82-57-61-45-81-53-43-20-35-60-60-98-72-41-65-97-84-24-95-51-11-01-65-03-47-19-44-33-27-65-95-10-64-42-24"
}
] | 1,687,618,320 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 92 | 0 | def solve():
n=int(input())
s=input()
if n==2:
print(s[0]+"-"+s[1])
return
else:
print(s[0]+"-"+s[1]+"-"+s[2:])
return
# for _ in range(int(input())):
solve(); | Title: Phone numbers
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Phone number in Berland is a sequence of *n* digits. Often, to make it easier to memorize the number, it is divided into groups of two or three digits. For example, the phone number 1198733 is easier to remember as 11-987-33. Your task is to find for a given phone number any of its divisions into groups of two or three digits.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of digits in the phone number. The second line contains *n* digits — the phone number to divide into groups.
Output Specification:
Output any of divisions of the given phone number into groups of two or three digits. Separate groups by single character -. If the answer is not unique, output any.
Demo Input:
['6\n549871\n', '7\n1198733\n']
Demo Output:
['54-98-71', '11-987-33\n']
Note:
none | ```python
def solve():
n=int(input())
s=input()
if n==2:
print(s[0]+"-"+s[1])
return
else:
print(s[0]+"-"+s[1]+"-"+s[2:])
return
# for _ in range(int(input())):
solve();
``` | 0 |
0 | none | none | none | 0 | [
"none"
] | null | null | На координатной прямой сидит *n* собачек, *i*-я собачка находится в точке *x**i*. Кроме того, на прямой есть *m* мисок с едой, для каждой известна её координата на прямой *u**j* и время *t**j*, через которое еда в миске остынет и станет невкусной. Это значит, что если собачка прибежит к миске в момент времени, строго больший *t**j*, то еда уже остынет, и собачка кушать её не станет.
Считая, что каждая собачка бежит со скоростью 1, найдите максимальное количество собачек, которые смогут покушать. Считайте, что собачки побегут к тем мискам, на которые вы им укажете. Из одной миски не могут кушать две или более собачки.
Собачки могут обгонять друг друга, то есть, если одна из них остановится покушать, другая может пройти мимо неё, чтобы попасть к другой миске. | В первой строке находится пара целых чисел *n* и *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — количество собачек и мисок соответственно.
Во второй строке находятся *n* целых чисел *x**i* (<=-<=109<=≤<=*x**i*<=≤<=109) — координата *i*-й собачки.
В следующих *m* строках находятся пары целых чисел *u**j* и *t**j* (<=-<=109<=≤<=*u**j*<=≤<=109, 1<=≤<=*t**j*<=≤<=109) — координата *j*-й миски и время, когда остынет еда в ней, соответственно.
Гарантируется, что никакие две собачки не находятся в одной точке. Никакие две миски также не могут находиться в одной точке. | Выведите одно целое число *a* — максимальное количество собачек, которые смогут покушать. | [
"5 4\n-2 0 4 8 13\n-1 1\n4 3\n6 3\n11 2\n",
"3 3\n-1 3 7\n1 1\n4 1\n7 1\n",
"4 4\n20 1 10 30\n1 1\n2 5\n22 2\n40 10\n"
] | [
"4\n",
"2\n",
"3\n"
] | В первом примере первая собачка побежит направо к первой миске, третья собачка сразу начнёт есть из второй миски, четвёртая собачка побежит влево к третьей миске, а пятая собачка побежит влево к четвёртой миске. | 0 | [] | 1,458,750,341 | 5,141 | Python 3 | TIME_LIMIT_EXCEEDED | PRETESTS | 4 | 2,000 | 25,907,200 | n, m = map(int, input().split())
N = list(map(int, input().split()))
N.sort()
M = []
for i in range(m):
m, t = map(int, input().split())
M.append([m])
for j in range(n):
if abs(m-N[j])>t:
M[i].append('NO')
else:
M[i].append('YES')
M.sort(key=lambda x:x[0])
c = 0
for i in range(1, n):
k = 0
while k<len(M) and M[k][i]!='YES':
k+=1
if k<len(M) and M[k][i]=='YES':
c+=1
del M[k]
print(c+1) | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
На координатной прямой сидит *n* собачек, *i*-я собачка находится в точке *x**i*. Кроме того, на прямой есть *m* мисок с едой, для каждой известна её координата на прямой *u**j* и время *t**j*, через которое еда в миске остынет и станет невкусной. Это значит, что если собачка прибежит к миске в момент времени, строго больший *t**j*, то еда уже остынет, и собачка кушать её не станет.
Считая, что каждая собачка бежит со скоростью 1, найдите максимальное количество собачек, которые смогут покушать. Считайте, что собачки побегут к тем мискам, на которые вы им укажете. Из одной миски не могут кушать две или более собачки.
Собачки могут обгонять друг друга, то есть, если одна из них остановится покушать, другая может пройти мимо неё, чтобы попасть к другой миске.
Input Specification:
В первой строке находится пара целых чисел *n* и *m* (1<=≤<=*n*,<=*m*<=≤<=200<=000) — количество собачек и мисок соответственно.
Во второй строке находятся *n* целых чисел *x**i* (<=-<=109<=≤<=*x**i*<=≤<=109) — координата *i*-й собачки.
В следующих *m* строках находятся пары целых чисел *u**j* и *t**j* (<=-<=109<=≤<=*u**j*<=≤<=109, 1<=≤<=*t**j*<=≤<=109) — координата *j*-й миски и время, когда остынет еда в ней, соответственно.
Гарантируется, что никакие две собачки не находятся в одной точке. Никакие две миски также не могут находиться в одной точке.
Output Specification:
Выведите одно целое число *a* — максимальное количество собачек, которые смогут покушать.
Demo Input:
['5 4\n-2 0 4 8 13\n-1 1\n4 3\n6 3\n11 2\n', '3 3\n-1 3 7\n1 1\n4 1\n7 1\n', '4 4\n20 1 10 30\n1 1\n2 5\n22 2\n40 10\n']
Demo Output:
['4\n', '2\n', '3\n']
Note:
В первом примере первая собачка побежит направо к первой миске, третья собачка сразу начнёт есть из второй миски, четвёртая собачка побежит влево к третьей миске, а пятая собачка побежит влево к четвёртой миске. | ```python
n, m = map(int, input().split())
N = list(map(int, input().split()))
N.sort()
M = []
for i in range(m):
m, t = map(int, input().split())
M.append([m])
for j in range(n):
if abs(m-N[j])>t:
M[i].append('NO')
else:
M[i].append('YES')
M.sort(key=lambda x:x[0])
c = 0
for i in range(1, n):
k = 0
while k<len(M) and M[k][i]!='YES':
k+=1
if k<len(M) and M[k][i]=='YES':
c+=1
del M[k]
print(c+1)
``` | 0 |
|
847 | G | University Classes | PROGRAMMING | 900 | [
"implementation"
] | null | null | There are *n* student groups at the university. During the study day, each group can take no more than 7 classes. Seven time slots numbered from 1 to 7 are allocated for the classes.
The schedule on Monday is known for each group, i. e. time slots when group will have classes are known.
Your task is to determine the minimum number of rooms needed to hold classes for all groups on Monday. Note that one room can hold at most one group class in a single time slot. | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of groups.
Each of the following *n* lines contains a sequence consisting of 7 zeroes and ones — the schedule of classes on Monday for a group. If the symbol in a position equals to 1 then the group has class in the corresponding time slot. In the other case, the group has no class in the corresponding time slot. | Print minimum number of rooms needed to hold all groups classes on Monday. | [
"2\n0101010\n1010101\n",
"3\n0101011\n0011001\n0110111\n"
] | [
"1\n",
"3\n"
] | In the first example one room is enough. It will be occupied in each of the seven time slot by the first group or by the second group.
In the second example three rooms is enough, because in the seventh time slot all three groups have classes. | 0 | [
{
"input": "2\n0101010\n1010101",
"output": "1"
},
{
"input": "3\n0101011\n0011001\n0110111",
"output": "3"
},
{
"input": "1\n0111000",
"output": "1"
},
{
"input": "1\n0000000",
"output": "0"
},
{
"input": "1\n1111111",
"output": "1"
},
{
"input": "2\n1000000\n0101000",
"output": "1"
},
{
"input": "3\n0101111\n1101011\n1010011",
"output": "3"
},
{
"input": "5\n0100101\n0000001\n0110000\n0010000\n0011110",
"output": "3"
},
{
"input": "6\n1101110\n1111011\n1101110\n0100011\n1110110\n1110100",
"output": "6"
},
{
"input": "10\n0000000\n0010000\n0000000\n0000010\n0000000\n0100001\n1000000\n0000000\n0000000\n0000000",
"output": "1"
},
{
"input": "20\n1111111\n1101011\n1111011\n0111111\n1111111\n1110111\n1111111\n1111111\n1111111\n1111111\n1110111\n1111111\n0111111\n1011111\n1111111\n1111111\n1101110\n1111111\n1111111\n1111111",
"output": "20"
}
] | 1,679,417,915 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 21 | 109 | 3,481,600 | import sys, io, os
import math
import bisect
import heapq
import string
from collections import defaultdict,Counter,deque
input = sys.stdin.readline
def I():
return input()
def II():
return int(input())
def MII():
return map(int, input().split())
def LI():
return list(input().split())
def LII():
return list(map(int, input().split()))
def GMI():
return map(lambda x: int(x) - 1, input().split())
def LGMI():
return list(map(lambda x: int(x) - 1, input().split()))
def WRITE(out):
return print('\n'.join(map(str, out)))
def WS(out):
return print(' '.join(map(str, out)))
def WNS(out):
return print(''.join(map(str, out)))
'''
n%4 == 0 and all_cnts <= n//4
'''
def solve():
n = II()
ans = [0] * 7
for _ in range(n):
for i, c in enumerate(I().strip()):
ans[i] += int(c)
print(max(ans))
solve() | Title: University Classes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* student groups at the university. During the study day, each group can take no more than 7 classes. Seven time slots numbered from 1 to 7 are allocated for the classes.
The schedule on Monday is known for each group, i. e. time slots when group will have classes are known.
Your task is to determine the minimum number of rooms needed to hold classes for all groups on Monday. Note that one room can hold at most one group class in a single time slot.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of groups.
Each of the following *n* lines contains a sequence consisting of 7 zeroes and ones — the schedule of classes on Monday for a group. If the symbol in a position equals to 1 then the group has class in the corresponding time slot. In the other case, the group has no class in the corresponding time slot.
Output Specification:
Print minimum number of rooms needed to hold all groups classes on Monday.
Demo Input:
['2\n0101010\n1010101\n', '3\n0101011\n0011001\n0110111\n']
Demo Output:
['1\n', '3\n']
Note:
In the first example one room is enough. It will be occupied in each of the seven time slot by the first group or by the second group.
In the second example three rooms is enough, because in the seventh time slot all three groups have classes. | ```python
import sys, io, os
import math
import bisect
import heapq
import string
from collections import defaultdict,Counter,deque
input = sys.stdin.readline
def I():
return input()
def II():
return int(input())
def MII():
return map(int, input().split())
def LI():
return list(input().split())
def LII():
return list(map(int, input().split()))
def GMI():
return map(lambda x: int(x) - 1, input().split())
def LGMI():
return list(map(lambda x: int(x) - 1, input().split()))
def WRITE(out):
return print('\n'.join(map(str, out)))
def WS(out):
return print(' '.join(map(str, out)))
def WNS(out):
return print(''.join(map(str, out)))
'''
n%4 == 0 and all_cnts <= n//4
'''
def solve():
n = II()
ans = [0] * 7
for _ in range(n):
for i, c in enumerate(I().strip()):
ans[i] += int(c)
print(max(ans))
solve()
``` | 3 |
|
224 | A | Parallelepiped | PROGRAMMING | 1,100 | [
"brute force",
"geometry",
"math"
] | null | null | You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped. | The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement. | Print a single number — the sum of all edges of the parallelepiped. | [
"1 1 1\n",
"4 6 6\n"
] | [
"12\n",
"28\n"
] | In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3. | 500 | [
{
"input": "1 1 1",
"output": "12"
},
{
"input": "4 6 6",
"output": "28"
},
{
"input": "20 10 50",
"output": "68"
},
{
"input": "9 4 36",
"output": "56"
},
{
"input": "324 9 36",
"output": "184"
},
{
"input": "1333 93 129",
"output": "308"
},
{
"input": "1022 584 112",
"output": "380"
},
{
"input": "66 174 319",
"output": "184"
},
{
"input": "912 276 1748",
"output": "444"
},
{
"input": "65 156 60",
"output": "120"
},
{
"input": "1 10000 10000",
"output": "40008"
},
{
"input": "1485 55 27",
"output": "332"
},
{
"input": "152 108 4104",
"output": "528"
},
{
"input": "1656 6900 1350",
"output": "740"
},
{
"input": "12 14 42",
"output": "60"
},
{
"input": "615 18 1230",
"output": "856"
},
{
"input": "680 60 408",
"output": "336"
},
{
"input": "644 966 6",
"output": "1308"
},
{
"input": "1 432 432",
"output": "1736"
},
{
"input": "2239 2239 1",
"output": "8964"
},
{
"input": "4106 8212 2",
"output": "16436"
},
{
"input": "10000 10000 10000",
"output": "1200"
},
{
"input": "3623 3623 1",
"output": "14500"
},
{
"input": "9801 9801 9801",
"output": "1188"
},
{
"input": "10000 1 10000",
"output": "40008"
},
{
"input": "9 9 9",
"output": "36"
},
{
"input": "9801 9702 9702",
"output": "1184"
}
] | 1,640,668,712 | 2,147,483,647 | Python 3 | OK | TESTS | 27 | 124 | 0 | s = input().split()
a,b,c = (int(i) for i in s)
print(int(4*(((a*c/b)**0.5)+((a*b/c)**0.5)+((b*c/a)**0.5))))
| Title: Parallelepiped
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
Input Specification:
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Output Specification:
Print a single number — the sum of all edges of the parallelepiped.
Demo Input:
['1 1 1\n', '4 6 6\n']
Demo Output:
['12\n', '28\n']
Note:
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3. | ```python
s = input().split()
a,b,c = (int(i) for i in s)
print(int(4*(((a*c/b)**0.5)+((a*b/c)**0.5)+((b*c/a)**0.5))))
``` | 3 |
|
913 | B | Christmas Spruce | PROGRAMMING | 1,200 | [
"implementation",
"trees"
] | null | null | Consider a rooted tree. A rooted tree has one special vertex called the root. All edges are directed from the root. Vertex *u* is called a child of vertex *v* and vertex *v* is called a parent of vertex *u* if there exists a directed edge from *v* to *u*. A vertex is called a leaf if it doesn't have children and has a parent.
Let's call a rooted tree a spruce if its every non-leaf vertex has at least 3 leaf children. You are given a rooted tree, check whether it's a spruce.
The definition of a rooted tree can be found [here](https://goo.gl/1dqvzz). | The first line contains one integer *n* — the number of vertices in the tree (3<=≤<=*n*<=≤<=1<=000). Each of the next *n*<=-<=1 lines contains one integer *p**i* (1<=≤<=*i*<=≤<=*n*<=-<=1) — the index of the parent of the *i*<=+<=1-th vertex (1<=≤<=*p**i*<=≤<=*i*).
Vertex 1 is the root. It's guaranteed that the root has at least 2 children. | Print "Yes" if the tree is a spruce and "No" otherwise. | [
"4\n1\n1\n1\n",
"7\n1\n1\n1\n2\n2\n2\n",
"8\n1\n1\n1\n1\n3\n3\n3\n"
] | [
"Yes\n",
"No\n",
"Yes\n"
] | The first example:
<img class="tex-graphics" src="https://espresso.codeforces.com/8dd976913226df83d535dfa66193f5525f8471bc.png" style="max-width: 100.0%;max-height: 100.0%;"/>
The second example:
<img class="tex-graphics" src="https://espresso.codeforces.com/44dad5804f5290a2e026c9c41a15151562df8682.png" style="max-width: 100.0%;max-height: 100.0%;"/>
It is not a spruce, because the non-leaf vertex 1 has only 2 leaf children.
The third example:
<img class="tex-graphics" src="https://espresso.codeforces.com/cf84a9e1585707f4ab06eff8eb1120a49b5e1ef7.png" style="max-width: 100.0%;max-height: 100.0%;"/> | 750 | [
{
"input": "4\n1\n1\n1",
"output": "Yes"
},
{
"input": "7\n1\n1\n1\n2\n2\n2",
"output": "No"
},
{
"input": "8\n1\n1\n1\n1\n3\n3\n3",
"output": "Yes"
},
{
"input": "3\n1\n1",
"output": "No"
},
{
"input": "13\n1\n2\n2\n2\n1\n6\n6\n6\n1\n10\n10\n10",
"output": "No"
},
{
"input": "7\n1\n2\n2\n1\n1\n1",
"output": "No"
},
{
"input": "7\n1\n1\n1\n1\n2\n2",
"output": "No"
},
{
"input": "8\n1\n1\n1\n1\n5\n5\n5",
"output": "Yes"
},
{
"input": "9\n1\n1\n1\n1\n2\n6\n6\n6",
"output": "No"
},
{
"input": "12\n1\n1\n1\n2\n5\n5\n5\n5\n1\n2\n2",
"output": "No"
},
{
"input": "20\n1\n1\n1\n1\n2\n2\n2\n3\n3\n3\n4\n4\n4\n5\n5\n5\n1\n1\n1",
"output": "Yes"
},
{
"input": "7\n1\n1\n1\n3\n3\n3",
"output": "No"
}
] | 1,637,207,643 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 31 | 77 | 2,355,200 | n = int(input())
nodes = {1: []}
yes_or_no = "Yes"
for i in range(2,n+1):
p = int(input())
nodes[p].append(i)
nodes[i] = []
for i in nodes:
no_of_leaves = 0
for child in nodes[i]:
if len(nodes[child]) == 0:
no_of_leaves += 1
if 0 < no_of_leaves < 3 or (len(nodes[i]) > 0 and no_of_leaves == 0):
yes_or_no = "No"
break
def dfs(tree: dict) -> dict:
pass
print(f"{yes_or_no}")
'''
Faulty test case result
13
---
1
2
2
2
1
6
6
6
1
10
10
10
''' | Title: Christmas Spruce
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Consider a rooted tree. A rooted tree has one special vertex called the root. All edges are directed from the root. Vertex *u* is called a child of vertex *v* and vertex *v* is called a parent of vertex *u* if there exists a directed edge from *v* to *u*. A vertex is called a leaf if it doesn't have children and has a parent.
Let's call a rooted tree a spruce if its every non-leaf vertex has at least 3 leaf children. You are given a rooted tree, check whether it's a spruce.
The definition of a rooted tree can be found [here](https://goo.gl/1dqvzz).
Input Specification:
The first line contains one integer *n* — the number of vertices in the tree (3<=≤<=*n*<=≤<=1<=000). Each of the next *n*<=-<=1 lines contains one integer *p**i* (1<=≤<=*i*<=≤<=*n*<=-<=1) — the index of the parent of the *i*<=+<=1-th vertex (1<=≤<=*p**i*<=≤<=*i*).
Vertex 1 is the root. It's guaranteed that the root has at least 2 children.
Output Specification:
Print "Yes" if the tree is a spruce and "No" otherwise.
Demo Input:
['4\n1\n1\n1\n', '7\n1\n1\n1\n2\n2\n2\n', '8\n1\n1\n1\n1\n3\n3\n3\n']
Demo Output:
['Yes\n', 'No\n', 'Yes\n']
Note:
The first example:
<img class="tex-graphics" src="https://espresso.codeforces.com/8dd976913226df83d535dfa66193f5525f8471bc.png" style="max-width: 100.0%;max-height: 100.0%;"/>
The second example:
<img class="tex-graphics" src="https://espresso.codeforces.com/44dad5804f5290a2e026c9c41a15151562df8682.png" style="max-width: 100.0%;max-height: 100.0%;"/>
It is not a spruce, because the non-leaf vertex 1 has only 2 leaf children.
The third example:
<img class="tex-graphics" src="https://espresso.codeforces.com/cf84a9e1585707f4ab06eff8eb1120a49b5e1ef7.png" style="max-width: 100.0%;max-height: 100.0%;"/> | ```python
n = int(input())
nodes = {1: []}
yes_or_no = "Yes"
for i in range(2,n+1):
p = int(input())
nodes[p].append(i)
nodes[i] = []
for i in nodes:
no_of_leaves = 0
for child in nodes[i]:
if len(nodes[child]) == 0:
no_of_leaves += 1
if 0 < no_of_leaves < 3 or (len(nodes[i]) > 0 and no_of_leaves == 0):
yes_or_no = "No"
break
def dfs(tree: dict) -> dict:
pass
print(f"{yes_or_no}")
'''
Faulty test case result
13
---
1
2
2
2
1
6
6
6
1
10
10
10
'''
``` | 3 |
|
579 | A | Raising Bacteria | PROGRAMMING | 1,000 | [
"bitmasks"
] | null | null | You are a lover of bacteria. You want to raise some bacteria in a box.
Initially, the box is empty. Each morning, you can put any number of bacteria into the box. And each night, every bacterium in the box will split into two bacteria. You hope to see exactly *x* bacteria in the box at some moment.
What is the minimum number of bacteria you need to put into the box across those days? | The only line containing one integer *x* (1<=≤<=*x*<=≤<=109). | The only line containing one integer: the answer. | [
"5\n",
"8\n"
] | [
"2\n",
"1\n"
] | For the first sample, we can add one bacterium in the box in the first day morning and at the third morning there will be 4 bacteria in the box. Now we put one more resulting 5 in the box. We added 2 bacteria in the process so the answer is 2.
For the second sample, we can put one in the first morning and in the 4-th morning there will be 8 in the box. So the answer is 1. | 250 | [
{
"input": "5",
"output": "2"
},
{
"input": "8",
"output": "1"
},
{
"input": "536870911",
"output": "29"
},
{
"input": "1",
"output": "1"
},
{
"input": "343000816",
"output": "14"
},
{
"input": "559980448",
"output": "12"
},
{
"input": "697681824",
"output": "14"
},
{
"input": "41313494",
"output": "14"
},
{
"input": "673935585",
"output": "13"
},
{
"input": "117422204",
"output": "19"
},
{
"input": "954746654",
"output": "15"
},
{
"input": "536838144",
"output": "14"
},
{
"input": "1000000000",
"output": "13"
},
{
"input": "2",
"output": "1"
},
{
"input": "3",
"output": "2"
},
{
"input": "4",
"output": "1"
},
{
"input": "6",
"output": "2"
},
{
"input": "7",
"output": "3"
},
{
"input": "9",
"output": "2"
},
{
"input": "10",
"output": "2"
},
{
"input": "999999999",
"output": "21"
},
{
"input": "999999998",
"output": "20"
},
{
"input": "999999997",
"output": "20"
},
{
"input": "999999996",
"output": "19"
},
{
"input": "999999995",
"output": "20"
},
{
"input": "999999994",
"output": "19"
},
{
"input": "999999993",
"output": "19"
},
{
"input": "999999992",
"output": "18"
},
{
"input": "999999991",
"output": "20"
},
{
"input": "999999990",
"output": "19"
},
{
"input": "536870910",
"output": "28"
},
{
"input": "536870912",
"output": "1"
},
{
"input": "536870913",
"output": "2"
},
{
"input": "536870914",
"output": "2"
},
{
"input": "22",
"output": "3"
},
{
"input": "14",
"output": "3"
}
] | 1,697,128,260 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | x = int(input()) # Read the input value x
bacteria = 1 # Start with 1 bacterium
days = 0 # Initialize the number of days to 0
while bacteria < x:
bacteria *= 2 # Each night, every bacterium splits into two
days += 1
if bacteria > x:
days += 1 # If we exceed the target, add one more day to reduce the count to x
print(days) # Output the minimum number of days
| Title: Raising Bacteria
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are a lover of bacteria. You want to raise some bacteria in a box.
Initially, the box is empty. Each morning, you can put any number of bacteria into the box. And each night, every bacterium in the box will split into two bacteria. You hope to see exactly *x* bacteria in the box at some moment.
What is the minimum number of bacteria you need to put into the box across those days?
Input Specification:
The only line containing one integer *x* (1<=≤<=*x*<=≤<=109).
Output Specification:
The only line containing one integer: the answer.
Demo Input:
['5\n', '8\n']
Demo Output:
['2\n', '1\n']
Note:
For the first sample, we can add one bacterium in the box in the first day morning and at the third morning there will be 4 bacteria in the box. Now we put one more resulting 5 in the box. We added 2 bacteria in the process so the answer is 2.
For the second sample, we can put one in the first morning and in the 4-th morning there will be 8 in the box. So the answer is 1. | ```python
x = int(input()) # Read the input value x
bacteria = 1 # Start with 1 bacterium
days = 0 # Initialize the number of days to 0
while bacteria < x:
bacteria *= 2 # Each night, every bacterium splits into two
days += 1
if bacteria > x:
days += 1 # If we exceed the target, add one more day to reduce the count to x
print(days) # Output the minimum number of days
``` | 0 |
|
946 | A | Partition | PROGRAMMING | 800 | [
"greedy"
] | null | null | You are given a sequence *a* consisting of *n* integers. You may partition this sequence into two sequences *b* and *c* in such a way that every element belongs exactly to one of these sequences.
Let *B* be the sum of elements belonging to *b*, and *C* be the sum of elements belonging to *c* (if some of these sequences is empty, then its sum is 0). What is the maximum possible value of *B*<=-<=*C*? | The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in *a*.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (<=-<=100<=≤<=*a**i*<=≤<=100) — the elements of sequence *a*. | Print the maximum possible value of *B*<=-<=*C*, where *B* is the sum of elements of sequence *b*, and *C* is the sum of elements of sequence *c*. | [
"3\n1 -2 0\n",
"6\n16 23 16 15 42 8\n"
] | [
"3\n",
"120\n"
] | In the first example we may choose *b* = {1, 0}, *c* = { - 2}. Then *B* = 1, *C* = - 2, *B* - *C* = 3.
In the second example we choose *b* = {16, 23, 16, 15, 42, 8}, *c* = {} (an empty sequence). Then *B* = 120, *C* = 0, *B* - *C* = 120. | 0 | [
{
"input": "3\n1 -2 0",
"output": "3"
},
{
"input": "6\n16 23 16 15 42 8",
"output": "120"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "100\n-100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100 -100",
"output": "10000"
},
{
"input": "2\n-1 5",
"output": "6"
},
{
"input": "3\n-2 0 1",
"output": "3"
},
{
"input": "12\n-1 -2 -3 4 4 -6 -6 56 3 3 -3 3",
"output": "94"
},
{
"input": "4\n1 -1 1 -1",
"output": "4"
},
{
"input": "4\n100 -100 100 -100",
"output": "400"
},
{
"input": "3\n-2 -5 10",
"output": "17"
},
{
"input": "5\n1 -2 3 -4 5",
"output": "15"
},
{
"input": "3\n-100 100 -100",
"output": "300"
},
{
"input": "6\n1 -1 1 -1 1 -1",
"output": "6"
},
{
"input": "6\n2 -2 2 -2 2 -2",
"output": "12"
},
{
"input": "9\n12 93 -2 0 0 0 3 -3 -9",
"output": "122"
},
{
"input": "6\n-1 2 4 -5 -3 55",
"output": "70"
},
{
"input": "6\n-12 8 68 -53 1 -15",
"output": "157"
},
{
"input": "2\n-2 1",
"output": "3"
},
{
"input": "3\n100 -100 100",
"output": "300"
},
{
"input": "5\n100 100 -1 -100 2",
"output": "303"
},
{
"input": "6\n-5 -4 -3 -2 -1 0",
"output": "15"
},
{
"input": "6\n4 4 4 -3 -3 2",
"output": "20"
},
{
"input": "2\n-1 2",
"output": "3"
},
{
"input": "1\n100",
"output": "100"
},
{
"input": "5\n-1 -2 3 1 2",
"output": "9"
},
{
"input": "5\n100 -100 100 -100 100",
"output": "500"
},
{
"input": "5\n1 -1 1 -1 1",
"output": "5"
},
{
"input": "4\n0 0 0 -1",
"output": "1"
},
{
"input": "5\n100 -100 -1 2 100",
"output": "303"
},
{
"input": "2\n75 0",
"output": "75"
},
{
"input": "4\n55 56 -59 -58",
"output": "228"
},
{
"input": "2\n9 71",
"output": "80"
},
{
"input": "2\n9 70",
"output": "79"
},
{
"input": "2\n9 69",
"output": "78"
},
{
"input": "2\n100 -100",
"output": "200"
},
{
"input": "4\n-9 4 -9 5",
"output": "27"
},
{
"input": "42\n91 -27 -79 -56 80 -93 -23 10 80 94 61 -89 -64 81 34 99 31 -32 -69 92 79 -9 73 66 -8 64 99 99 58 -19 -40 21 1 -33 93 -23 -62 27 55 41 57 36",
"output": "2348"
},
{
"input": "7\n-1 2 2 2 -1 2 -1",
"output": "11"
},
{
"input": "6\n-12 8 17 -69 7 -88",
"output": "201"
},
{
"input": "3\n1 -2 5",
"output": "8"
},
{
"input": "6\n-2 3 -4 5 6 -1",
"output": "21"
},
{
"input": "2\n-5 1",
"output": "6"
},
{
"input": "4\n2 2 -2 4",
"output": "10"
},
{
"input": "68\n21 47 -75 -25 64 83 83 -21 89 24 43 44 -35 34 -42 92 -96 -52 -66 64 14 -87 25 -61 -78 83 -96 -18 95 83 -93 -28 75 49 87 65 -93 -69 -2 95 -24 -36 -61 -71 88 -53 -93 -51 -81 -65 -53 -46 -56 6 65 58 19 100 57 61 -53 44 -58 48 -8 80 -88 72",
"output": "3991"
},
{
"input": "5\n5 5 -10 -1 1",
"output": "22"
},
{
"input": "3\n-1 2 3",
"output": "6"
},
{
"input": "76\n57 -38 -48 -81 93 -32 96 55 -44 2 38 -46 42 64 71 -73 95 31 -39 -62 -1 75 -17 57 28 52 12 -11 82 -84 59 -86 73 -97 34 97 -57 -85 -6 39 -5 -54 95 24 -44 35 -18 9 91 7 -22 -61 -80 54 -40 74 -90 15 -97 66 -52 -49 -24 65 21 -93 -29 -24 -4 -1 76 -93 7 -55 -53 1",
"output": "3787"
},
{
"input": "5\n-1 -2 1 2 3",
"output": "9"
},
{
"input": "4\n2 2 -2 -2",
"output": "8"
},
{
"input": "6\n100 -100 100 -100 100 -100",
"output": "600"
},
{
"input": "100\n-59 -33 34 0 69 24 -22 58 62 -36 5 45 -19 -73 61 -9 95 42 -73 -64 91 -96 2 53 -8 82 -79 16 18 -5 -53 26 71 38 -31 12 -33 -1 -65 -6 3 -89 22 33 -27 -36 41 11 -47 -32 47 -56 -38 57 -63 -41 23 41 29 78 16 -65 90 -58 -12 6 -60 42 -36 -52 -54 -95 -10 29 70 50 -94 1 93 48 -71 -77 -16 54 56 -60 66 76 31 8 44 -61 -74 23 37 38 18 -18 29 41",
"output": "4362"
},
{
"input": "2\n-1 1",
"output": "2"
},
{
"input": "3\n1 -2 100",
"output": "103"
},
{
"input": "5\n1 -2 3 1 2",
"output": "9"
},
{
"input": "10\n100 -10 -100 10 10 10 10 10 10 10",
"output": "280"
},
{
"input": "4\n2 0 -2 4",
"output": "8"
},
{
"input": "4\n3 -3 1 -1",
"output": "8"
},
{
"input": "3\n1 -1 1",
"output": "3"
},
{
"input": "4\n2 5 -2 4",
"output": "13"
},
{
"input": "2\n-2 2",
"output": "4"
},
{
"input": "3\n1 -2 1",
"output": "4"
},
{
"input": "5\n-1 -2 1 1 -1",
"output": "6"
},
{
"input": "4\n-2 0 2 4",
"output": "8"
},
{
"input": "8\n-42 7 87 -16 -5 65 -88 1",
"output": "311"
},
{
"input": "3\n1 -3 4",
"output": "8"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "3\n-1 2 -1",
"output": "4"
},
{
"input": "18\n-21 12 65 66 -24 62 82 35 -45 -47 28 37 5 -32 22 -14 -69 -95",
"output": "761"
},
{
"input": "4\n-1 1 -1 1",
"output": "4"
},
{
"input": "5\n-1 2 1 1 1",
"output": "6"
},
{
"input": "3\n1 1 1",
"output": "3"
}
] | 1,580,706,125 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 108 | 0 | n=int(input())
l=list(map(int, input().split()))
l2=[]
for p in range(0,n+1):
l2.append(sum(l[0:p])-sum(l[p:n]))
print(max(l2)) | Title: Partition
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a sequence *a* consisting of *n* integers. You may partition this sequence into two sequences *b* and *c* in such a way that every element belongs exactly to one of these sequences.
Let *B* be the sum of elements belonging to *b*, and *C* be the sum of elements belonging to *c* (if some of these sequences is empty, then its sum is 0). What is the maximum possible value of *B*<=-<=*C*?
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in *a*.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (<=-<=100<=≤<=*a**i*<=≤<=100) — the elements of sequence *a*.
Output Specification:
Print the maximum possible value of *B*<=-<=*C*, where *B* is the sum of elements of sequence *b*, and *C* is the sum of elements of sequence *c*.
Demo Input:
['3\n1 -2 0\n', '6\n16 23 16 15 42 8\n']
Demo Output:
['3\n', '120\n']
Note:
In the first example we may choose *b* = {1, 0}, *c* = { - 2}. Then *B* = 1, *C* = - 2, *B* - *C* = 3.
In the second example we choose *b* = {16, 23, 16, 15, 42, 8}, *c* = {} (an empty sequence). Then *B* = 120, *C* = 0, *B* - *C* = 120. | ```python
n=int(input())
l=list(map(int, input().split()))
l2=[]
for p in range(0,n+1):
l2.append(sum(l[0:p])-sum(l[p:n]))
print(max(l2))
``` | 0 |
|
518 | A | Vitaly and Strings | PROGRAMMING | 1,600 | [
"constructive algorithms",
"strings"
] | null | null | Vitaly is a diligent student who never missed a lesson in his five years of studying in the university. He always does his homework on time and passes his exams in time.
During the last lesson the teacher has provided two strings *s* and *t* to Vitaly. The strings have the same length, they consist of lowercase English letters, string *s* is lexicographically smaller than string *t*. Vitaly wondered if there is such string that is lexicographically larger than string *s* and at the same is lexicographically smaller than string *t*. This string should also consist of lowercase English letters and have the length equal to the lengths of strings *s* and *t*.
Let's help Vitaly solve this easy problem! | The first line contains string *s* (1<=≤<=|*s*|<=≤<=100), consisting of lowercase English letters. Here, |*s*| denotes the length of the string.
The second line contains string *t* (|*t*|<==<=|*s*|), consisting of lowercase English letters.
It is guaranteed that the lengths of strings *s* and *t* are the same and string *s* is lexicographically less than string *t*. | If the string that meets the given requirements doesn't exist, print a single string "No such string" (without the quotes).
If such string exists, print it. If there are multiple valid strings, you may print any of them. | [
"a\nc\n",
"aaa\nzzz\n",
"abcdefg\nabcdefh\n"
] | [
"b\n",
"kkk\n",
"No such string\n"
] | String *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">*n*</sub> is said to be lexicographically smaller than *t* = *t*<sub class="lower-index">1</sub>*t*<sub class="lower-index">2</sub>... *t*<sub class="lower-index">*n*</sub>, if there exists such *i*, that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, *s*<sub class="lower-index">2</sub> = *t*<sub class="lower-index">2</sub>, ... *s*<sub class="lower-index">*i* - 1</sub> = *t*<sub class="lower-index">*i* - 1</sub>, *s*<sub class="lower-index">*i*</sub> < *t*<sub class="lower-index">*i*</sub>. | 500 | [
{
"input": "a\nc",
"output": "b"
},
{
"input": "aaa\nzzz",
"output": "kkk"
},
{
"input": "abcdefg\nabcdefh",
"output": "No such string"
},
{
"input": "abcdefg\nabcfefg",
"output": "abcdefh"
},
{
"input": "frt\nfru",
"output": "No such string"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzx\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzy"
},
{
"input": "q\nz",
"output": "r"
},
{
"input": "pnzcl\npnzdf",
"output": "pnzcm"
},
{
"input": "vklldrxnfgyorgfpfezvhbouyzzzzz\nvklldrxnfgyorgfpfezvhbouzaaadv",
"output": "vklldrxnfgyorgfpfezvhbouzaaaaa"
},
{
"input": "pkjlxzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\npkjlyaaaaaaaaaaaaaaaaaaaaaaaaaaaahr",
"output": "pkjlyaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "exoudpymnspkocwszzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nexoudpymnspkocwtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabml",
"output": "exoudpymnspkocwtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "anarzvsklmwvovozwnmhklkpcseeogdgauoppmzrukynbjjoxytuvsiecuzfquxnowewebhtuoxepocyeamqfrblpwqiokbcubil\nanarzvsklmwvovozwnmhklkpcseeogdgauoppmzrukynbjjoxytuvsiecuzfquxnowewebhtuoxepocyeamqfrblpwqiokbcubim",
"output": "No such string"
},
{
"input": "uqyugulumzwlxsjnxxkutzqayskrbjoaaekbhckjryhjjllzzz\nuqyugulumzwlxsjnxxkutzqayskrbjoaaekbhckjryhjjlmaaa",
"output": "No such string"
},
{
"input": "esfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdacbzzzzzzzzzzzzzz\nesfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdaccaaaaaaaaaaaatf",
"output": "esfaeyxpblcrriizhnhfrxnbopqvhwtetgjqavlqdlxexaifgvkqfwzneibhxxdaccaaaaaaaaaaaaaa"
},
{
"input": "oisjtilteipnzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\noisjtilteipoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaao",
"output": "oisjtilteipoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "svpoxbsudndfnnpugbouawegyxgtmvqzbewxpcwhopdbwscimgzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nsvpoxbsudndfnnpugbouawegyxgtmvqzbewxpcwhopdbwscimhaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "No such string"
},
{
"input": "ddzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\ndeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaao",
"output": "deaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "xqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdavdzz\nxqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdavilj",
"output": "xqzbhslocdbifnyzyjenlpctocieaccsycmwlcebkqqkeibatfvylbqlutvjijgjhdetqsjqnoipqbmjhhzxggdobyvpczdaveaa"
},
{
"input": "poflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawfoq\npoflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawujg",
"output": "poflpxucohdobeisxfsnkbdzwizjjhgngufssqhmfgmydmmrnuminrvxxamoebhczlwsfefdtnchaisfxkfcovxmvppxnrfawfor"
},
{
"input": "vonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjnzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nvonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac",
"output": "vonggnmokmvmguwtobkxoqgxkuxtyjmxrygyliohlhwxuxjmlkqcfuxboxjoaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "bqycw\nquhod",
"output": "bqycx"
},
{
"input": "hceslswecf\nnmxshuymaa",
"output": "hceslswecg"
},
{
"input": "awqtzslxowuaefe\nvujscakjpvxviki",
"output": "awqtzslxowuaeff"
},
{
"input": "lerlcnaogdravnogfogcyoxgi\nojrbithvjdqtempegvqxmgmmw",
"output": "lerlcnaogdravnogfogcyoxgj"
},
{
"input": "jbrhvicytqaivheqeourrlosvnsujsxdinryyawgalidsaufxv\noevvkhujmhagaholrmsatdjjyfmyblvgetpnxgjcilugjsncjs",
"output": "jbrhvicytqaivheqeourrlosvnsujsxdinryyawgalidsaufxw"
},
{
"input": "jrpogrcuhqdpmyzpuabuhaptlxaeiqjxhqkmuzsjbhqxvdtoocrkusaeasqdwlunomwzww\nspvgaswympzlscnumemgiznngnxqgccbubmxgqmaakbnyngkxlxjjsafricchhpecdjgxw",
"output": "jrpogrcuhqdpmyzpuabuhaptlxaeiqjxhqkmuzsjbhqxvdtoocrkusaeasqdwlunomwzwx"
},
{
"input": "mzmhjmfxaxaplzjmjkbyadeweltagyyuzpvrmnyvirjpdmebxyzjvdoezhnayfrvtnccryhkvhcvakcf\nohhhhkujfpjbgouebtmmbzizuhuumvrsqfniwpmxdtzhyiaivdyxhywnqzagicydixjtvbqbevhbqttu",
"output": "mzmhjmfxaxaplzjmjkbyadeweltagyyuzpvrmnyvirjpdmebxyzjvdoezhnayfrvtnccryhkvhcvakcg"
},
{
"input": "cdmwmzutsicpzhcokbbhwktqbomozxvvjlhwdgtiledgurxsfreisgczdwgupzxmjnfyjxcpdwzkggludkcmgppndl\nuvuqvyrnhtyubpevizhjxdvmpueittksrnosmfuuzbimnqussasdjufrthrgjbyzomauaxbvwferfvtmydmwmjaoxg",
"output": "cdmwmzutsicpzhcokbbhwktqbomozxvvjlhwdgtiledgurxsfreisgczdwgupzxmjnfyjxcpdwzkggludkcmgppndm"
},
{
"input": "dpnmrwpbgzvcmrcodwgvvfwpyagdwlngmhrazyvalszhruprxzmwltftxmujfyrrnwzvphgqlcphreumqkytswxziugburwrlyay\nqibcfxdfovoejutaeetbbwrgexdrvqywwmhipxgfrvhzovxkfawpfnpjvlhkyahessodqcclangxefcaixysqijnitevwmpalkzd",
"output": "dpnmrwpbgzvcmrcodwgvvfwpyagdwlngmhrazyvalszhruprxzmwltftxmujfyrrnwzvphgqlcphreumqkytswxziugburwrlyaz"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab",
"output": "No such string"
},
{
"input": "phdvmuwqmvzyurtnshitcypuzbhpceovkibzbhhjwxkdtvqmbpoumeoiztxtvkvsjrlnhowsdmgftuiulzebdigmun\nphdvmuwqmvzyurtnshitcypuzbhpceovkibzbhhjwxkdtvqmbpoumeoiztxtvkvsjrlnhowsdmgftuiulzebdigmuo",
"output": "No such string"
},
{
"input": "hrsantdquixzjyjtqytcmnflnyehzbibkbgkqffgqpkgeuqmbmxzhbjwsnfkizvbcyoghyvnxxjavoahlqjxomtsouzoog\nhrsantdquixzjyjtqytcmnflnyehzbibkbgkqffgqpkgeuqmbmxzhbjwsnfkizvbcyoghyvnxxjavoahlqjxomtsouzooh",
"output": "No such string"
},
{
"input": "kexdbtpkjbwwyibjndbtmwqzolopqitgkomqggojevoankiepxirrcidxldlzsppehmoazdywltmjbxgsxgihwnwpmczjrcwpywl\nkexdbtpkjbwwyibjndbtmwqzolopqitgkomqggojevoankiepxirrcidxldlzsppehmoazdywltmjbxgsxgihwnwpmczjrcwpywm",
"output": "No such string"
},
{
"input": "yijdysvzfcnaedvnecswgoylhzgguxecmucepgstjbdkbjyfdlxxxejkrrxfiuwjpdmdhhqhlqeqzjwudtdryrfkpwfxdjlkowmk\nyijdysvzfcnaedvnecswgoylhzgguxecmucepgstjbdkbjyfdlxxxejkrrxfiuwjpdmdhhqhlqeqzjwudtdryrfkpwfxdjlkowml",
"output": "No such string"
},
{
"input": "a\nb",
"output": "No such string"
},
{
"input": "x\nz",
"output": "y"
},
{
"input": "a\nz",
"output": "b"
},
{
"input": "y\nz",
"output": "No such string"
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzy\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "No such string"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\nzaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab"
},
{
"input": "yzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyz"
},
{
"input": "aaa\naac",
"output": "aab"
},
{
"input": "aaa\naab",
"output": "No such string"
},
{
"input": "zzx\nzzz",
"output": "zzy"
},
{
"input": "zzy\nzzz",
"output": "No such string"
},
{
"input": "aba\naca",
"output": "abb"
},
{
"input": "aaa\nbbb",
"output": "aab"
},
{
"input": "azzz\ncaaa",
"output": "baaa"
}
] | 1,699,692,464 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 8 | 46 | 0 | s = input()
t = input()
string = ""
for i in range(len(s)):
if abs(ord(s[i]) - ord(t[i])) != 1:
string += chr(int((ord(s[i])+ord(t[i]))/2))
else:
print("No such string")
break
else:
print(string)
| Title: Vitaly and Strings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vitaly is a diligent student who never missed a lesson in his five years of studying in the university. He always does his homework on time and passes his exams in time.
During the last lesson the teacher has provided two strings *s* and *t* to Vitaly. The strings have the same length, they consist of lowercase English letters, string *s* is lexicographically smaller than string *t*. Vitaly wondered if there is such string that is lexicographically larger than string *s* and at the same is lexicographically smaller than string *t*. This string should also consist of lowercase English letters and have the length equal to the lengths of strings *s* and *t*.
Let's help Vitaly solve this easy problem!
Input Specification:
The first line contains string *s* (1<=≤<=|*s*|<=≤<=100), consisting of lowercase English letters. Here, |*s*| denotes the length of the string.
The second line contains string *t* (|*t*|<==<=|*s*|), consisting of lowercase English letters.
It is guaranteed that the lengths of strings *s* and *t* are the same and string *s* is lexicographically less than string *t*.
Output Specification:
If the string that meets the given requirements doesn't exist, print a single string "No such string" (without the quotes).
If such string exists, print it. If there are multiple valid strings, you may print any of them.
Demo Input:
['a\nc\n', 'aaa\nzzz\n', 'abcdefg\nabcdefh\n']
Demo Output:
['b\n', 'kkk\n', 'No such string\n']
Note:
String *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">*n*</sub> is said to be lexicographically smaller than *t* = *t*<sub class="lower-index">1</sub>*t*<sub class="lower-index">2</sub>... *t*<sub class="lower-index">*n*</sub>, if there exists such *i*, that *s*<sub class="lower-index">1</sub> = *t*<sub class="lower-index">1</sub>, *s*<sub class="lower-index">2</sub> = *t*<sub class="lower-index">2</sub>, ... *s*<sub class="lower-index">*i* - 1</sub> = *t*<sub class="lower-index">*i* - 1</sub>, *s*<sub class="lower-index">*i*</sub> < *t*<sub class="lower-index">*i*</sub>. | ```python
s = input()
t = input()
string = ""
for i in range(len(s)):
if abs(ord(s[i]) - ord(t[i])) != 1:
string += chr(int((ord(s[i])+ord(t[i]))/2))
else:
print("No such string")
break
else:
print(string)
``` | 0 |
|
701 | A | Cards | PROGRAMMING | 800 | [
"greedy",
"implementation"
] | null | null | There are *n* cards (*n* is even) in the deck. Each card has a positive integer written on it. *n*<=/<=2 people will play new card game. At the beginning of the game each player gets two cards, each card is given to exactly one player.
Find the way to distribute cards such that the sum of values written of the cards will be equal for each player. It is guaranteed that it is always possible. | The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=100) — the number of cards in the deck. It is guaranteed that *n* is even.
The second line contains the sequence of *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100), where *a**i* is equal to the number written on the *i*-th card. | Print *n*<=/<=2 pairs of integers, the *i*-th pair denote the cards that should be given to the *i*-th player. Each card should be given to exactly one player. Cards are numbered in the order they appear in the input.
It is guaranteed that solution exists. If there are several correct answers, you are allowed to print any of them. | [
"6\n1 5 7 4 4 3\n",
"4\n10 10 10 10\n"
] | [
"1 3\n6 2\n4 5\n",
"1 2\n3 4\n"
] | In the first sample, cards are distributed in such a way that each player has the sum of numbers written on his cards equal to 8.
In the second sample, all values *a*<sub class="lower-index">*i*</sub> are equal. Thus, any distribution is acceptable. | 500 | [
{
"input": "6\n1 5 7 4 4 3",
"output": "1 3\n6 2\n4 5"
},
{
"input": "4\n10 10 10 10",
"output": "1 4\n2 3"
},
{
"input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "1 100\n2 99\n3 98\n4 97\n5 96\n6 95\n7 94\n8 93\n9 92\n10 91\n11 90\n12 89\n13 88\n14 87\n15 86\n16 85\n17 84\n18 83\n19 82\n20 81\n21 80\n22 79\n23 78\n24 77\n25 76\n26 75\n27 74\n28 73\n29 72\n30 71\n31 70\n32 69\n33 68\n34 67\n35 66\n36 65\n37 64\n38 63\n39 62\n40 61\n41 60\n42 59\n43 58\n44 57\n45 56\n46 55\n47 54\n48 53\n49 52\n50 51"
},
{
"input": "4\n82 46 8 44",
"output": "3 1\n4 2"
},
{
"input": "2\n35 50",
"output": "1 2"
},
{
"input": "8\n24 39 49 38 44 64 44 50",
"output": "1 6\n4 8\n2 3\n5 7"
},
{
"input": "100\n23 44 35 88 10 78 8 84 46 19 69 36 81 60 46 12 53 22 83 73 6 18 80 14 54 39 74 42 34 20 91 70 32 11 80 53 70 21 24 12 87 68 35 39 8 84 81 70 8 54 73 2 60 71 4 33 65 48 69 58 55 57 78 61 45 50 55 72 86 37 5 11 12 81 32 19 22 11 22 82 23 56 61 84 47 59 31 38 31 90 57 1 24 38 68 27 80 9 37 14",
"output": "92 31\n52 90\n55 4\n71 41\n21 69\n7 84\n45 46\n49 8\n98 19\n5 80\n34 74\n72 47\n78 13\n16 97\n40 35\n73 23\n24 63\n100 6\n22 27\n10 51\n76 20\n30 68\n38 54\n18 48\n77 37\n79 32\n1 59\n81 11\n39 95\n93 42\n96 57\n87 83\n89 64\n33 53\n75 14\n56 86\n29 60\n3 91\n43 62\n12 82\n70 67\n99 61\n88 50\n94 25\n26 36\n44 17\n28 66\n2 58\n65 85\n9 15"
},
{
"input": "12\n22 83 2 67 55 12 40 93 83 73 12 28",
"output": "3 8\n6 9\n11 2\n1 10\n12 4\n7 5"
},
{
"input": "16\n10 33 36 32 48 25 31 27 45 13 37 26 22 21 15 43",
"output": "1 5\n10 9\n15 16\n14 11\n13 3\n6 2\n12 4\n8 7"
},
{
"input": "20\n18 13 71 60 28 10 20 65 65 12 13 14 64 68 6 50 72 7 66 58",
"output": "15 17\n18 3\n6 14\n10 19\n2 9\n11 8\n12 13\n1 4\n7 20\n5 16"
},
{
"input": "24\n59 39 25 22 46 21 24 70 60 11 46 42 44 37 13 37 41 58 72 23 25 61 58 62",
"output": "10 19\n15 8\n6 24\n4 22\n20 9\n7 1\n3 23\n21 18\n14 11\n16 5\n2 13\n17 12"
},
{
"input": "28\n22 1 51 31 83 35 3 64 59 10 61 25 19 53 55 80 78 8 82 22 67 4 27 64 33 6 85 76",
"output": "2 27\n7 5\n22 19\n26 16\n18 17\n10 28\n13 21\n1 24\n20 8\n12 11\n23 9\n4 15\n25 14\n6 3"
},
{
"input": "32\n41 42 22 68 40 52 66 16 73 25 41 21 36 60 46 30 24 55 35 10 54 52 70 24 20 56 3 34 35 6 51 8",
"output": "27 9\n30 23\n32 4\n20 7\n8 14\n25 26\n12 18\n3 21\n17 22\n24 6\n10 31\n16 15\n28 2\n19 11\n29 1\n13 5"
},
{
"input": "36\n1 10 61 43 27 49 55 33 7 30 45 78 69 34 38 19 36 49 55 11 30 63 46 24 16 68 71 18 11 52 72 24 60 68 8 41",
"output": "1 12\n9 31\n35 27\n2 13\n20 34\n29 26\n25 22\n28 3\n16 33\n24 19\n32 7\n5 30\n10 18\n21 6\n8 23\n14 11\n17 4\n15 36"
},
{
"input": "40\n7 30 13 37 37 56 45 28 61 28 23 33 44 63 58 52 21 2 42 19 10 32 9 7 61 15 58 20 45 4 46 24 35 17 50 4 20 48 41 55",
"output": "18 14\n30 25\n36 9\n1 27\n24 15\n23 6\n21 40\n3 16\n26 35\n34 38\n20 31\n28 29\n37 7\n17 13\n11 19\n32 39\n8 5\n10 4\n2 33\n22 12"
},
{
"input": "44\n7 12 46 78 24 68 86 22 71 79 85 14 58 72 26 46 54 39 35 13 31 45 81 21 15 8 47 64 69 87 57 6 18 80 47 29 36 62 34 67 59 48 75 25",
"output": "32 30\n1 7\n26 11\n2 23\n20 34\n12 10\n25 4\n33 43\n24 14\n8 9\n5 29\n44 6\n15 40\n36 28\n21 38\n39 41\n19 13\n37 31\n18 17\n22 42\n3 35\n16 27"
},
{
"input": "48\n57 38 16 25 34 57 29 38 60 51 72 78 22 39 10 33 20 16 12 3 51 74 9 88 4 70 56 65 86 18 33 12 77 78 52 87 68 85 81 5 61 2 52 39 80 13 74 30",
"output": "42 24\n20 36\n25 29\n40 38\n23 39\n15 45\n19 34\n32 12\n46 33\n3 47\n18 22\n30 11\n17 26\n13 37\n4 28\n7 41\n48 9\n16 6\n31 1\n5 27\n2 43\n8 35\n14 21\n44 10"
},
{
"input": "52\n57 12 13 40 68 31 18 4 31 18 65 3 62 32 6 3 49 48 51 33 53 40 9 32 47 53 58 19 14 23 32 38 39 69 19 20 62 52 68 17 39 22 54 59 3 2 52 9 67 68 24 39",
"output": "46 34\n12 50\n16 39\n45 5\n8 49\n15 11\n23 37\n48 13\n2 44\n3 27\n29 1\n40 43\n7 26\n10 21\n28 47\n35 38\n36 19\n42 17\n30 18\n51 25\n6 22\n9 4\n14 52\n24 41\n31 33\n20 32"
},
{
"input": "56\n53 59 66 68 71 25 48 32 12 61 72 69 30 6 56 55 25 49 60 47 46 46 66 19 31 9 23 15 10 12 71 53 51 32 39 31 66 66 17 52 12 7 7 22 49 12 71 29 63 7 47 29 18 39 27 26",
"output": "14 11\n42 47\n43 31\n50 5\n26 12\n29 4\n9 38\n30 37\n41 23\n46 3\n28 49\n39 10\n53 19\n24 2\n44 15\n27 16\n6 32\n17 1\n56 40\n55 33\n48 45\n52 18\n13 7\n25 51\n36 20\n8 22\n34 21\n35 54"
},
{
"input": "60\n47 63 20 68 46 12 45 44 14 38 28 73 60 5 20 18 70 64 37 47 26 47 37 61 29 61 23 28 30 68 55 22 25 60 38 7 63 12 38 15 14 30 11 5 70 15 53 52 7 57 49 45 55 37 45 28 50 2 31 30",
"output": "58 12\n14 45\n44 17\n36 30\n49 4\n43 18\n6 37\n38 2\n9 26\n41 24\n40 34\n46 13\n16 50\n3 53\n15 31\n32 47\n27 48\n33 57\n21 51\n11 22\n28 20\n56 1\n25 5\n29 55\n42 52\n60 7\n59 8\n19 39\n23 35\n54 10"
},
{
"input": "64\n63 39 19 5 48 56 49 45 29 68 25 59 37 69 62 26 60 44 60 6 67 68 2 40 56 6 19 12 17 70 23 11 59 37 41 55 30 68 72 14 38 34 3 71 2 4 55 15 31 66 15 51 36 72 18 7 6 14 43 33 8 35 57 18",
"output": "23 54\n45 39\n43 44\n46 30\n4 14\n20 38\n26 22\n57 10\n56 21\n61 50\n32 1\n28 15\n40 19\n58 17\n48 33\n51 12\n29 63\n55 25\n64 6\n3 47\n27 36\n31 52\n11 7\n16 5\n9 8\n37 18\n49 59\n60 35\n42 24\n62 2\n53 41\n13 34"
},
{
"input": "68\n58 68 40 55 62 15 10 54 19 18 69 27 15 53 8 18 8 33 15 49 20 9 70 8 18 64 14 59 9 64 3 35 46 11 5 65 58 55 28 58 4 55 64 5 68 24 4 58 23 45 58 50 38 68 5 15 20 9 5 53 20 63 69 68 15 53 65 65",
"output": "31 23\n41 63\n47 11\n35 64\n44 54\n55 45\n59 2\n15 68\n17 67\n24 36\n22 43\n29 30\n58 26\n7 62\n34 5\n27 28\n6 51\n13 48\n19 40\n56 37\n65 1\n10 42\n16 38\n25 4\n9 8\n21 66\n57 60\n61 14\n49 52\n46 20\n12 33\n39 50\n18 3\n32 53"
},
{
"input": "72\n61 13 55 23 24 55 44 33 59 19 14 17 66 40 27 33 29 37 28 74 50 56 59 65 64 17 42 56 73 51 64 23 22 26 38 22 36 47 60 14 52 28 14 12 6 41 73 5 64 67 61 74 54 34 45 34 44 4 34 49 18 72 44 47 31 19 11 31 5 4 45 50",
"output": "58 52\n70 20\n48 47\n69 29\n45 62\n67 50\n44 13\n2 24\n11 49\n40 31\n43 25\n12 51\n26 1\n61 39\n10 23\n66 9\n33 28\n36 22\n4 6\n32 3\n5 53\n34 41\n15 30\n19 72\n42 21\n17 60\n65 64\n68 38\n8 71\n16 55\n54 63\n56 57\n59 7\n37 27\n18 46\n35 14"
},
{
"input": "76\n73 37 73 67 26 45 43 74 47 31 43 81 4 3 39 79 48 81 67 39 67 66 43 67 80 51 34 79 5 58 45 10 39 50 9 78 6 18 75 17 45 17 51 71 34 53 33 11 17 15 11 69 50 41 13 74 10 33 77 41 11 64 36 74 17 32 3 10 27 20 5 73 52 41 7 57",
"output": "14 18\n67 12\n13 25\n29 28\n71 16\n37 36\n75 59\n35 39\n32 64\n57 56\n68 8\n48 72\n51 3\n61 1\n55 44\n50 52\n40 24\n42 21\n49 19\n65 4\n38 22\n70 62\n5 30\n69 76\n10 46\n66 73\n47 43\n58 26\n27 53\n45 34\n63 17\n2 9\n15 41\n20 31\n33 6\n54 23\n60 11\n74 7"
},
{
"input": "80\n18 38 65 1 20 9 57 2 36 26 15 17 33 61 65 27 10 35 49 42 40 32 19 33 12 36 56 31 10 41 8 54 56 60 5 47 61 43 23 19 20 30 7 6 38 60 29 58 35 64 30 51 6 17 30 24 47 1 37 47 34 36 48 28 5 25 47 19 30 39 36 23 31 28 46 46 59 43 19 49",
"output": "4 15\n58 3\n8 50\n35 37\n65 14\n44 46\n53 34\n43 77\n31 48\n6 7\n17 33\n29 27\n25 32\n11 52\n12 80\n54 19\n1 63\n23 67\n40 60\n68 57\n79 36\n5 76\n41 75\n39 78\n72 38\n56 20\n66 30\n10 21\n16 70\n64 45\n74 2\n47 59\n42 71\n51 62\n55 26\n69 9\n28 49\n73 18\n22 61\n13 24"
},
{
"input": "84\n59 41 54 14 42 55 29 28 41 73 40 15 1 1 66 49 76 59 68 60 42 81 19 23 33 12 80 81 42 22 54 54 2 22 22 28 27 60 36 57 17 76 38 20 40 65 23 9 81 50 25 13 46 36 59 53 6 35 47 40 59 19 67 46 63 49 12 33 23 49 33 23 32 62 60 70 44 1 6 63 28 16 70 69",
"output": "13 49\n14 28\n78 22\n33 27\n57 42\n79 17\n48 10\n26 83\n67 76\n52 84\n4 19\n12 63\n82 15\n41 46\n23 80\n62 65\n44 74\n30 75\n34 38\n35 20\n24 61\n47 55\n69 18\n72 1\n51 40\n37 6\n8 32\n36 31\n81 3\n7 56\n73 50\n25 70\n68 66\n71 16\n58 59\n39 64\n54 53\n43 77\n11 29\n45 21\n60 5\n2 9"
},
{
"input": "88\n10 28 71 6 58 66 45 52 13 71 39 1 10 29 30 70 14 17 15 38 4 60 5 46 66 41 40 58 2 57 32 44 21 26 13 40 64 63 56 33 46 8 30 43 67 55 44 28 32 62 14 58 42 67 45 59 32 68 10 31 51 6 42 34 9 12 51 27 20 14 62 42 16 5 1 14 30 62 40 59 58 26 25 15 27 47 21 57",
"output": "12 10\n75 3\n29 16\n21 58\n23 54\n74 45\n4 25\n62 6\n42 37\n65 38\n1 78\n13 71\n59 50\n66 22\n9 80\n35 56\n17 81\n51 52\n70 28\n76 5\n19 88\n84 30\n73 39\n18 46\n69 8\n33 67\n87 61\n83 86\n34 41\n82 24\n68 55\n85 7\n2 47\n48 32\n14 44\n15 72\n43 63\n77 53\n60 26\n31 79\n49 36\n57 27\n40 11\n64 20"
},
{
"input": "92\n17 37 81 15 29 70 73 42 49 23 44 77 27 44 74 11 43 66 15 41 60 36 33 11 2 76 16 51 45 21 46 16 85 29 76 79 16 6 60 13 25 44 62 28 43 35 63 24 76 71 62 15 57 72 45 10 71 59 74 14 53 13 58 72 14 72 73 11 25 1 57 42 86 63 50 30 64 38 10 77 75 24 58 8 54 12 43 30 27 71 52 34",
"output": "70 73\n25 33\n38 3\n84 36\n56 80\n79 12\n16 49\n24 35\n68 26\n86 81\n40 59\n62 15\n60 67\n65 7\n4 66\n19 64\n52 54\n27 90\n32 57\n37 50\n1 6\n30 18\n10 77\n48 74\n82 47\n41 51\n69 43\n13 39\n89 21\n44 58\n5 83\n34 63\n76 71\n88 53\n23 85\n92 61\n46 91\n22 28\n2 75\n78 9\n20 31\n8 55\n72 29\n17 42\n45 14\n87 11"
},
{
"input": "96\n77 7 47 19 73 31 46 13 89 69 52 9 26 77 6 87 55 45 71 2 79 1 80 20 4 82 64 20 75 86 84 24 77 56 16 54 53 35 74 73 40 29 63 20 83 39 58 16 31 41 40 16 11 90 30 48 62 39 55 8 50 3 77 73 75 66 14 90 18 54 38 10 53 22 67 38 27 91 62 37 85 13 92 7 18 83 10 3 86 54 80 59 34 16 39 43",
"output": "22 83\n20 78\n62 68\n88 54\n25 9\n15 16\n2 89\n84 30\n60 81\n12 31\n72 86\n87 45\n53 26\n8 91\n82 23\n67 21\n35 63\n48 33\n52 14\n94 1\n69 65\n85 29\n4 39\n24 64\n28 40\n44 5\n74 19\n32 10\n13 75\n77 66\n42 27\n55 43\n6 79\n49 57\n93 92\n38 47\n80 34\n71 59\n76 17\n46 90\n58 70\n95 36\n41 73\n51 37\n50 11\n96 61\n18 56\n7 3"
},
{
"input": "4\n100 100 1 1",
"output": "3 2\n4 1"
},
{
"input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1 100\n2 99\n3 98\n4 97\n5 96\n6 95\n7 94\n8 93\n9 92\n10 91\n11 90\n12 89\n13 88\n14 87\n15 86\n16 85\n17 84\n18 83\n19 82\n20 81\n21 80\n22 79\n23 78\n24 77\n25 76\n26 75\n27 74\n28 73\n29 72\n30 71\n31 70\n32 69\n33 68\n34 67\n35 66\n36 65\n37 64\n38 63\n39 62\n40 61\n41 60\n42 59\n43 58\n44 57\n45 56\n46 55\n47 54\n48 53\n49 52\n50 51"
},
{
"input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "1 100\n2 99\n3 98\n4 97\n5 96\n6 95\n7 94\n8 93\n9 92\n10 91\n11 90\n12 89\n13 88\n14 87\n15 86\n16 85\n17 84\n18 83\n19 82\n20 81\n21 80\n22 79\n23 78\n24 77\n25 76\n26 75\n27 74\n28 73\n29 72\n30 71\n31 70\n32 69\n33 68\n34 67\n35 66\n36 65\n37 64\n38 63\n39 62\n40 61\n41 60\n42 59\n43 58\n44 57\n45 56\n46 55\n47 54\n48 53\n49 52\n50 51"
},
{
"input": "4\n3 4 4 5",
"output": "1 4\n2 3"
},
{
"input": "4\n1 1 2 2",
"output": "1 4\n2 3"
},
{
"input": "4\n1 2 3 4",
"output": "1 4\n2 3"
}
] | 1,590,157,818 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 124 | 0 | n=int(input())
a=list(map(int,input().split()))
l=[]
l.extend(a)
l.sort()
for i in range(n//2):
m=a.index(l[i])
a[m]=0
p=a.index(l[n-i-1])
a[p]=0
print(m+1,p+1)
| Title: Cards
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* cards (*n* is even) in the deck. Each card has a positive integer written on it. *n*<=/<=2 people will play new card game. At the beginning of the game each player gets two cards, each card is given to exactly one player.
Find the way to distribute cards such that the sum of values written of the cards will be equal for each player. It is guaranteed that it is always possible.
Input Specification:
The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=100) — the number of cards in the deck. It is guaranteed that *n* is even.
The second line contains the sequence of *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100), where *a**i* is equal to the number written on the *i*-th card.
Output Specification:
Print *n*<=/<=2 pairs of integers, the *i*-th pair denote the cards that should be given to the *i*-th player. Each card should be given to exactly one player. Cards are numbered in the order they appear in the input.
It is guaranteed that solution exists. If there are several correct answers, you are allowed to print any of them.
Demo Input:
['6\n1 5 7 4 4 3\n', '4\n10 10 10 10\n']
Demo Output:
['1 3\n6 2\n4 5\n', '1 2\n3 4\n']
Note:
In the first sample, cards are distributed in such a way that each player has the sum of numbers written on his cards equal to 8.
In the second sample, all values *a*<sub class="lower-index">*i*</sub> are equal. Thus, any distribution is acceptable. | ```python
n=int(input())
a=list(map(int,input().split()))
l=[]
l.extend(a)
l.sort()
for i in range(n//2):
m=a.index(l[i])
a[m]=0
p=a.index(l[n-i-1])
a[p]=0
print(m+1,p+1)
``` | 3 |
|
580 | A | Kefa and First Steps | PROGRAMMING | 900 | [
"brute force",
"dp",
"implementation"
] | null | null | Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task! | The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*. | [
"6\n2 2 1 3 4 1\n",
"3\n2 2 9\n"
] | [
"3",
"3"
] | In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one. | 750 | [
{
"input": "6\n2 2 1 3 4 1",
"output": "3"
},
{
"input": "3\n2 2 9",
"output": "3"
},
{
"input": "5\n10 100 111 1 2",
"output": "3"
},
{
"input": "10\n1 2 3 4 1 2 3 4 5 6",
"output": "6"
},
{
"input": "50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
},
{
"input": "100\n1 838 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 605 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 27 533 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 835 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 992",
"output": "42"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "6\n5 4 3 2 1 2",
"output": "2"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "7\n99 100 1 2 3 4 5",
"output": "5"
},
{
"input": "5\n3 3 1 2 3",
"output": "3"
},
{
"input": "1\n100",
"output": "1"
},
{
"input": "1\n5",
"output": "1"
}
] | 1,695,541,609 | 2,147,483,647 | Python 3 | OK | TESTS | 28 | 109 | 14,643,200 | n=int(input())
r=input()
s=r.split(" ")
a=[]
for i in s:
a.append(int(i))
i=0;maxi=1;num=1
while i<n-1:
if a[i]<=a[i+1]:
num+=1
if num>maxi:
maxi=num
else:
num=1
i+=1
print(maxi) | Title: Kefa and First Steps
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task!
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*.
Demo Input:
['6\n2 2 1 3 4 1\n', '3\n2 2 9\n']
Demo Output:
['3', '3']
Note:
In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one. | ```python
n=int(input())
r=input()
s=r.split(" ")
a=[]
for i in s:
a.append(int(i))
i=0;maxi=1;num=1
while i<n-1:
if a[i]<=a[i+1]:
num+=1
if num>maxi:
maxi=num
else:
num=1
i+=1
print(maxi)
``` | 3 |
|
459 | A | Pashmak and Garden | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones. | The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct. | If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000). | [
"0 0 0 1\n",
"0 0 1 1\n",
"0 0 1 2\n"
] | [
"1 0 1 1\n",
"0 1 1 0\n",
"-1\n"
] | none | 500 | [
{
"input": "0 0 0 1",
"output": "1 0 1 1"
},
{
"input": "0 0 1 1",
"output": "0 1 1 0"
},
{
"input": "0 0 1 2",
"output": "-1"
},
{
"input": "-100 -100 100 100",
"output": "-100 100 100 -100"
},
{
"input": "-100 -100 99 100",
"output": "-1"
},
{
"input": "0 -100 0 100",
"output": "200 -100 200 100"
},
{
"input": "27 -74 27 74",
"output": "175 -74 175 74"
},
{
"input": "0 1 2 3",
"output": "0 3 2 1"
},
{
"input": "-100 100 100 -100",
"output": "-100 -100 100 100"
},
{
"input": "-100 -100 -100 100",
"output": "100 -100 100 100"
},
{
"input": "100 100 100 -100",
"output": "300 100 300 -100"
},
{
"input": "100 -100 -100 -100",
"output": "100 100 -100 100"
},
{
"input": "-100 100 100 100",
"output": "-100 300 100 300"
},
{
"input": "0 1 0 0",
"output": "1 1 1 0"
},
{
"input": "1 1 0 0",
"output": "1 0 0 1"
},
{
"input": "0 0 1 0",
"output": "0 1 1 1"
},
{
"input": "1 0 0 1",
"output": "1 1 0 0"
},
{
"input": "1 0 1 1",
"output": "2 0 2 1"
},
{
"input": "1 1 0 1",
"output": "1 2 0 2"
},
{
"input": "15 -9 80 -9",
"output": "15 56 80 56"
},
{
"input": "51 -36 18 83",
"output": "-1"
},
{
"input": "69 -22 60 16",
"output": "-1"
},
{
"input": "-68 -78 -45 -55",
"output": "-68 -55 -45 -78"
},
{
"input": "68 -92 8 -32",
"output": "68 -32 8 -92"
},
{
"input": "95 -83 -39 -6",
"output": "-1"
},
{
"input": "54 94 53 -65",
"output": "-1"
},
{
"input": "-92 15 84 15",
"output": "-92 191 84 191"
},
{
"input": "67 77 -11 -1",
"output": "67 -1 -11 77"
},
{
"input": "91 -40 30 21",
"output": "91 21 30 -40"
},
{
"input": "66 -64 -25 -64",
"output": "66 27 -25 27"
},
{
"input": "-42 84 -67 59",
"output": "-42 59 -67 84"
},
{
"input": "73 47 -5 -77",
"output": "-1"
},
{
"input": "6 85 -54 -84",
"output": "-1"
},
{
"input": "-58 -55 40 43",
"output": "-58 43 40 -55"
},
{
"input": "56 22 48 70",
"output": "-1"
},
{
"input": "-17 -32 76 -32",
"output": "-17 61 76 61"
},
{
"input": "0 2 2 0",
"output": "0 0 2 2"
},
{
"input": "0 0 -1 1",
"output": "0 1 -1 0"
},
{
"input": "0 2 1 1",
"output": "0 1 1 2"
},
{
"input": "0 0 1 -1",
"output": "0 -1 1 0"
},
{
"input": "-1 2 -2 3",
"output": "-1 3 -2 2"
},
{
"input": "0 1 1 0",
"output": "0 0 1 1"
},
{
"input": "1 2 2 1",
"output": "1 1 2 2"
},
{
"input": "4 1 2 1",
"output": "4 3 2 3"
},
{
"input": "70 0 0 10",
"output": "-1"
},
{
"input": "2 3 4 1",
"output": "2 1 4 3"
},
{
"input": "1 3 3 1",
"output": "1 1 3 3"
},
{
"input": "-3 3 0 0",
"output": "-3 0 0 3"
},
{
"input": "2 8 7 3",
"output": "2 3 7 8"
},
{
"input": "1 2 2 3",
"output": "1 3 2 2"
},
{
"input": "0 3 3 0",
"output": "0 0 3 3"
},
{
"input": "0 0 -3 3",
"output": "0 3 -3 0"
},
{
"input": "0 2 1 2",
"output": "0 3 1 3"
},
{
"input": "1 1 2 0",
"output": "1 0 2 1"
},
{
"input": "0 0 5 0",
"output": "0 5 5 5"
},
{
"input": "3 4 7 8",
"output": "3 8 7 4"
},
{
"input": "0 5 5 0",
"output": "0 0 5 5"
},
{
"input": "5 6 8 3",
"output": "5 3 8 6"
},
{
"input": "2 2 1 1",
"output": "2 1 1 2"
},
{
"input": "0 1 3 1",
"output": "0 4 3 4"
},
{
"input": "2 4 5 4",
"output": "2 7 5 7"
},
{
"input": "0 5 1 5",
"output": "0 6 1 6"
},
{
"input": "4 0 0 4",
"output": "4 4 0 0"
},
{
"input": "0 1 1 8",
"output": "-1"
},
{
"input": "2 3 3 4",
"output": "2 4 3 3"
},
{
"input": "1 0 2 1",
"output": "1 1 2 0"
},
{
"input": "0 0 2 14",
"output": "-1"
},
{
"input": "0 0 4 3",
"output": "-1"
},
{
"input": "3 5 5 3",
"output": "3 3 5 5"
},
{
"input": "-1 1 1 -1",
"output": "-1 -1 1 1"
},
{
"input": "0 0 2 0",
"output": "0 2 2 2"
},
{
"input": "0 0 1 7",
"output": "-1"
},
{
"input": "1 2 3 2",
"output": "1 4 3 4"
},
{
"input": "1 12 3 10",
"output": "1 10 3 12"
}
] | 1,693,188,927 | 2,147,483,647 | PyPy 3-64 | RUNTIME_ERROR | TESTS | 2 | 77 | 3,379,200 | x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
res = [x1+(y1-y2),y1,x2+(y1-y2),y2]
elif y1 == y2:
res = [x1,y1+(x2-x1),x2,y2+(x2-x1)]
elif abs(x1-x2)==abs(y1-y2):
res = [x1,y2,x2,y1]
print(*res) | Title: Pashmak and Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
Input Specification:
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
Output Specification:
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000).
Demo Input:
['0 0 0 1\n', '0 0 1 1\n', '0 0 1 2\n']
Demo Output:
['1 0 1 1\n', '0 1 1 0\n', '-1\n']
Note:
none | ```python
x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
res = [x1+(y1-y2),y1,x2+(y1-y2),y2]
elif y1 == y2:
res = [x1,y1+(x2-x1),x2,y2+(x2-x1)]
elif abs(x1-x2)==abs(y1-y2):
res = [x1,y2,x2,y1]
print(*res)
``` | -1 |
|
227 | B | Effective Approach | PROGRAMMING | 1,100 | [
"implementation"
] | null | null | Once at a team training Vasya, Petya and Sasha got a problem on implementing linear search in an array.
According to the boys, linear search works as follows. The array elements in a pre-selected order are in turn compared with the number that you need to find. Once you find the array element that is equal to the required one, the search ends. The efficiency of the algorithm is the number of performed comparisons. The fewer comparisons the linear search has made, the more effective it is.
Vasya believes that a linear search would work better if it sequentially iterates through the elements, starting with the 1-st one (in this problem we consider the elements of the array indexed from 1 to *n*) and ending with the *n*-th one. And Petya says that Vasya is wrong: the search will need less comparisons if it sequentially iterates the elements starting from the *n*-th and ending with the 1-st one. Sasha argues that the two approaches are equivalent.
To finally begin the task, the teammates decided to settle the debate and compare the two approaches on an example. For this, they took an array that is a permutation of integers from 1 to *n*, and generated *m* queries of the form: find element with value *b**i* in the array. They want to calculate for both approaches how many comparisons in total the linear search will need to respond to all queries. If the first search needs fewer comparisons, then the winner of the dispute is Vasya. If the second one does, then the winner is Petya. If both approaches make the same number of comparisons, then Sasha's got the upper hand.
But the problem is, linear search is too slow. That's why the boys aren't going to find out who is right before the end of the training, unless you come in here. Help them to determine who will win the dispute. | The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of elements in the array. The second line contains *n* distinct space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*) — the elements of array.
The third line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. The last line contains *m* space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=*n*) — the search queries. Note that the queries can repeat. | Print two integers, showing how many comparisons Vasya's approach needs and how many comparisons Petya's approach needs. Separate the numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specifier. | [
"2\n1 2\n1\n1\n",
"2\n2 1\n1\n1\n",
"3\n3 1 2\n3\n1 2 3\n"
] | [
"1 2\n",
"2 1\n",
"6 6\n"
] | In the first sample Vasya's approach will make one comparison (it starts with the 1-st element and immediately finds the required number), and Petya's approach makes two comparisons (first he compares with the 2-nd array element, doesn't find the search item and compares with the 1-st element).
In the second sample, on the contrary, Vasya's approach will need two comparisons (first with 1-st element, and then with the 2-nd), and Petya's approach will find the required value in one comparison (the first comparison with the 2-nd element). | 1,000 | [
{
"input": "2\n1 2\n1\n1",
"output": "1 2"
},
{
"input": "2\n2 1\n1\n1",
"output": "2 1"
},
{
"input": "3\n3 1 2\n3\n1 2 3",
"output": "6 6"
},
{
"input": "9\n2 9 3 1 6 4 7 8 5\n9\n5 1 5 2 8 4 4 4 5",
"output": "58 32"
},
{
"input": "10\n3 10 9 2 7 6 5 8 4 1\n1\n4",
"output": "9 2"
},
{
"input": "10\n5 2 10 8 3 1 9 7 6 4\n9\n2 5 9 2 3 2 5 9 8",
"output": "31 68"
},
{
"input": "9\n3 8 4 7 1 2 5 6 9\n3\n2 7 1",
"output": "15 15"
},
{
"input": "9\n5 3 8 4 2 6 1 7 9\n4\n6 1 9 2",
"output": "27 13"
},
{
"input": "4\n1 3 2 4\n4\n3 1 2 3",
"output": "8 12"
},
{
"input": "3\n1 2 3\n8\n3 2 1 1 2 3 1 2",
"output": "15 17"
}
] | 1,692,376,690 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 5 | 2,000 | 12,083,200 | n=int(input())
l=list(map(int,input().split()))
s=int(input())
q=list(map(int,input().split()))
dv={i:0 for i in q}
dp={i:0 for i in q}
v=p=0
for i in range(n):
for j in q:
if l[i]==j:
dv[j]=1
v+=i+1
for i in range(n-1,-1,-1):
for j in q:
if l[i]==j:
dp[j]=1
p+=n-i
print(v,p)
| Title: Effective Approach
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Once at a team training Vasya, Petya and Sasha got a problem on implementing linear search in an array.
According to the boys, linear search works as follows. The array elements in a pre-selected order are in turn compared with the number that you need to find. Once you find the array element that is equal to the required one, the search ends. The efficiency of the algorithm is the number of performed comparisons. The fewer comparisons the linear search has made, the more effective it is.
Vasya believes that a linear search would work better if it sequentially iterates through the elements, starting with the 1-st one (in this problem we consider the elements of the array indexed from 1 to *n*) and ending with the *n*-th one. And Petya says that Vasya is wrong: the search will need less comparisons if it sequentially iterates the elements starting from the *n*-th and ending with the 1-st one. Sasha argues that the two approaches are equivalent.
To finally begin the task, the teammates decided to settle the debate and compare the two approaches on an example. For this, they took an array that is a permutation of integers from 1 to *n*, and generated *m* queries of the form: find element with value *b**i* in the array. They want to calculate for both approaches how many comparisons in total the linear search will need to respond to all queries. If the first search needs fewer comparisons, then the winner of the dispute is Vasya. If the second one does, then the winner is Petya. If both approaches make the same number of comparisons, then Sasha's got the upper hand.
But the problem is, linear search is too slow. That's why the boys aren't going to find out who is right before the end of the training, unless you come in here. Help them to determine who will win the dispute.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of elements in the array. The second line contains *n* distinct space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*) — the elements of array.
The third line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. The last line contains *m* space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b**i*<=≤<=*n*) — the search queries. Note that the queries can repeat.
Output Specification:
Print two integers, showing how many comparisons Vasya's approach needs and how many comparisons Petya's approach needs. Separate the numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use cin, cout streams or the %I64d specifier.
Demo Input:
['2\n1 2\n1\n1\n', '2\n2 1\n1\n1\n', '3\n3 1 2\n3\n1 2 3\n']
Demo Output:
['1 2\n', '2 1\n', '6 6\n']
Note:
In the first sample Vasya's approach will make one comparison (it starts with the 1-st element and immediately finds the required number), and Petya's approach makes two comparisons (first he compares with the 2-nd array element, doesn't find the search item and compares with the 1-st element).
In the second sample, on the contrary, Vasya's approach will need two comparisons (first with 1-st element, and then with the 2-nd), and Petya's approach will find the required value in one comparison (the first comparison with the 2-nd element). | ```python
n=int(input())
l=list(map(int,input().split()))
s=int(input())
q=list(map(int,input().split()))
dv={i:0 for i in q}
dp={i:0 for i in q}
v=p=0
for i in range(n):
for j in q:
if l[i]==j:
dv[j]=1
v+=i+1
for i in range(n-1,-1,-1):
for j in q:
if l[i]==j:
dp[j]=1
p+=n-i
print(v,p)
``` | 0 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.